CN101457252B - Application of E2F8 gene - Google Patents

Abstract

The invention discloses an application of an E2F8 gene for preparing liver cancer diagnosis products and liver cancer treatment drugs. The E2F8 gene as a specific marking gene for the liver cancer diagnosis enables the liver cancer diagnosis more accurate and rapid and provides a novel treatment target point and an efficient new drug for controlling the liver cancer.

Description

The application of E2F8 gene

Technical field

The present invention relates to a kind of gene, relate in particular to a kind of application of E2F8 gene.

Background technology

People E2F8 gene (Genbank No.NM_024680) is one of member of E2F transcription factor family, and its function is not quite clear.E2F is found as the activator of adenovirus E2 promotor at first, and other member of E2F family is found in research subsequently successively.The E2F transcription factor family has been proved to be in cell cycle regulating and has played a significant role, and they come the propagation of regulating cell by regulate transcribing of target gene in the cell cycle.Along with to the going deep into of E2F family research work, the function of E2F transcription factor has formed with apoptosis and tumour and has connected.

At present, it be unclear that, remain further to be studied about E2F8 gene and tumorigenic relation.

Summary of the invention

One of the technical problem to be solved in the present invention provides a kind of application of E2F8 gene, and this E2F8 gene can be used as the tagged molecule of diagnosing cancer of liver, has improved the accuracy of diagnosing cancer of liver.

Two of the technical problem to be solved in the present invention provides the application of a kind of E2F8 gene in the medicine of preparation treatment liver cancer.

In order to solve the problems of the technologies described above, the present invention is achieved through the following technical solutions:

In one aspect of the invention, provide the application of a kind of E2F8 gene in the product of preparation diagnosing liver cancer.

The product of described diagnosing liver cancer comprises: with the product of RT-PCR, real-time quantitative PCR, immunodetection, in situ hybridization or gene chip diagnosis liver cancer.

In the present invention, described product with the RT-PCR diagnosing liver cancer comprises the primer of a pair of specific amplified E2F8 gene at least.

Described product with the real-time quantitative PCR diagnosing liver cancer comprises the primer of a pair of specific amplified E2F8 gene at least.

Described product with the immunodetection diagnosing liver cancer comprises: with E2F8 protein-specific bonded antibody, comprise polyclonal antibody and monoclonal antibody.

Described product with the in situ hybridization diagnosing liver cancer comprises: with the probe of the nucleic acid array hybridizing of E2F8 gene.

Described product with gene chip diagnosis liver cancer comprises: with the probe of the nucleic acid array hybridizing of E2F8 gene.

In the present invention, can use a series of methods known in the art to prepare at the special antibody of E2F8 albumen.For example, the people E2F8 gene product or its antigen fragment of purifying is injected in the animal body to produce polyclonal antibody.Equally, the cell of expressing human E2F8 albumen or its antigen fragment also can be used for animal is caused immunity and produces antibody.Antibody prepared in accordance with the present invention also can be monoclonal antibody, and these monoclonal antibodies can prepare (for example, Kohler et al., Nature 256:495,1975 with hybridoma technology; Kohler et al., Eur.J.Immunol.6:511,1976; Kohler et al., Eur.J.Immunol.6:292,1976).Antibody of the present invention comprises the antibody that can prevent the E2F8 function, also can be the antibody that does not influence people E2F8 function.Each antibody-like can produce by the fragment of people E2F8 gene product or functional domain are caused immunity, and people E2F8 gene product and fragment thereof can produce or synthesize with Peptide synthesizer with recombination method.With the E2F8 gene product bonded antibody of non-modified forms, can utilize the gene product that for example produces among the E.coli at prokaryotic cell prokaryocyte to come immune animal and obtain.With posttranslational modification form such as glycosylation or phosphorylation E2F8 albumen or polypeptide bonded antibody, can utilize the gene product that in eukaryotic cell such as yeast or insect cell, produces to come immune animal and obtain.

In the present invention, described probe can be DNA, RNA, DNA-RNA mosaic, PNA or other derivative.The length of described probe without limits, as long as finish specific hybrid, combine with purpose nucleotide sequence specificity, any length can.The length of described probe can be as short as 25,20,15,13 or 10 base length.Equally, the length of described probe can be grown to 60,80,100,150,300 base pairs or longer, even whole gene.Because different probe length has different influences to hybridization efficiency, signal specificity, the length of described probe is 14 base pairs usually at least, the longlyest generally be no more than 30 base pairs, with purpose nucleotide sequence complementary length with 15-25 base pair the best.Described probe self complementary sequence is most preferably less than 4 base pairs, in order to avoid influence hybridization efficiency.

In another aspect of this invention, provide the application of a kind of E2F8 gene in the medicine of preparation treatment liver cancer.

The medicine of described treatment liver cancer comprises: disturb the double stranded RNA that suppresses E2F8 genetic expression by RNA, or be used to suppress the protein of E2F8 protein-active.

The present invention experimental results show that the expression of E2F8 gene in liver cancer tissue apparently higher than cancer beside organism, so the E2F8 gene can be used as the special marker gene of diagnosing liver cancer, makes diagnosing cancer of liver more accurately, fast.E2F8 gene of the present invention provides new treatment target spot and effective new drug for preventing and treating liver cancer.

Description of drawings

Fig. 1 is that the present invention is by the differential expression figure of RT-PCR checking E2F8 gene in people's liver cancer tissue and cancer beside organism;

Fig. 2 is that the present invention is by the differential expression figure of real-time quantitative PCR checking E2F8 gene in people's liver cancer tissue and cancer beside organism;

Fig. 3 is the fluidic cell detection figure of the embodiment of the invention 7.

Embodiment

The present invention is further detailed explanation below in conjunction with drawings and Examples.

Following examples only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions among the embodiment, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

With demethylation medicine DAC (final concentration is 2000nM), handle 15 strain hepatoma cell strains after, the difference of gene expression dose finds that the E2F8 gene expression difference is obvious in 8 strain cell strains before and after using gene chip to detect to handle.Wherein, gene chip experiment mainly comprises following four steps: chip preparation, specimen preparation, hybridization and signal detection and interpretation of result.

1. the present preparation of chip preparation chip is a carrier with sheet glass or silicon chip mainly.By the point sample method target gene is arranged on the carrier in order as probe, target gene can be divided into genomic dna, cDNA (or artificial-synthetic DNA).

2. the extraction steps of total RNA is as follows in the specimen preparation testing sample: take 15 strain hepatoma cell strains of demethylation medicine DAC processing and the hepatoma cell strain that 15 strains are handled without demethylation respectively, use TRIZol method extracted total RNA again.

The total RNA that extracts can be further used for the preparation of sample cDNA probe, and its process comprises preparation (the cDNA first chain mark), the purifying and quantitative of fluorescent probe.Probe quantitatively sucks back to the 1.5ml centrifuge tube, and heating is drained, and is stored in-20 ℃, waits to hybridize.

3. chip hybridization

1) preparation work: (1) washboard slide, cover glass is put into ddH2O, 95% ethanol, ddH2O successively, each 3min puts into exsiccant 50ml centrifuge tube 1000rpm at last, and centrifugal 3min removes residual water stainly, places stand-by; (2) preparation 10%PBS solution; (3) the balance hybrid heater is calibrated hybrid heater with water level gauge, the maintenance level; (4) be formulated as follows the liquid of developing a film: 20 * SSC solution, 10%SDS solution, washing lotion I (2 * SSC/0.5%SDS), washing lotion II (1 * SSC/0.1%SDS), the solution III (0.1 * SSC) of developing a film.

2) preparation of prehybridization prehybridization solution is in the cumulative volume of 30 μ l 20 * SSPE damping fluid of 9 μ l, 50 * Denhandts damping fluid and the 18 μ l ddH2O of 3 μ l to be arranged, from loft drier, take out chip again, an amount of prehybridization solution is dripped on chip, covered, then chip is put into the hybridizing box that is added with PBS, placed 42 ℃ of hybridization case prehybridizations about 1 hour.Prehybridization takes out chip after finishing and embathes a moment with ddH2O, and it is centrifugal to treat after cover glass comes off chip to be put into the exsiccant centrifuge tube, removes residual water stainly, places stand-by.

3) probe through quantitative Cy3 and Cy5 mark is taken out in hybridization, each fully dissolves with 9～15 μ l ddH2O and is mixed in the 1.5ml centrifuge tube, preparing hybrid liquid then, the hybridization solution of Cy3/Cy5 fluorescence labeling probe is made up of 20 * SSPE damping fluid, 50 * Denhandts damping fluid and the ddH2O that is dissolved with probe, then, get hybridization solution and drip on chip, and covered.At last, this hybridization hybrid chip is put into the hybridizing box that is added with PBS, place 42 ℃ of hybridization casees to hybridize 12～20 hours.

4. after washing, scanning and the reaction of data analysis chip hybridization finish, need carry out the chip washing.Scan such as the laser confocal scanning instrument by specific scanner again, after the scanning image is converted into numerary signal, carry out data analysis and processing subsequently based on fluorescence intensity.Because the imbalance of differences between samples, fluorescent label efficiency and recall rate needs that the original extraction signal is carried out equilibrium and could further analyze experimental data with revising.By analysis, detect E2F8 expression of gene difference in liver cancer and the cancer beside organism by gene chip, the result shows that the E2F8 gene expresses significantly rise in liver cancer tissue.

Embodiment 2

The RT-PCR experiment detects the expression of E2F8 gene in liver cancer tissue.

1. separate tissue (Tissue isolation)

Experiment is with the tissue-derived and operation patients (RT-PCR confirm AFP in liver cancer all positive and cancer by negative) of expressing the primary hepatocarcinoma of alpha-fetoprotein positive in 72 routine HBV.The liver of excision cuts focus rapidly and reaches 5 centimeters outer cancer beside organisms on every side once exsomatizing, and puts into liquid nitrogen (80 ℃) and preserves.The other diagnosis of cancer and cancer is final foundation with pathological diagnosis all.

2. the extraction agent box of total RNA

Extracting RNA reagent employing TRIzol reagent (GIBCO/BRL), this reagent are based on the extraction process production of one step of acidic phenol.Being used for used vessel of extracting RNA and water all will not have the processing of RNA enzyme, to guarantee the environment of no RNA enzyme in the experiment.

3.RNA extraction steps

To grind vessel such as pestle and homogenizer and do roasting 4h, remove the RNA enzyme, cooling at 200 ℃; Add precooling in the liquid nitrogen, will organize from liquid nitrogen and take out rapidly, be crushed into powder; With curet tissue is put into the homogenizer that adds TRIzol reagent in advance, homogenate number minute; Liquid after the homogenate is changed in the centrifuge tube of no RNA enzyme, behind the adding chloroform, 4 ℃ of centrifugal layerings; The upper strata water is changed in the centrifuge tube of a no RNA enzyme, behind the adding chloroform, 4 ℃ of centrifugal layerings; The upper strata water is changed in the centrifuge tube of a no RNA enzyme and add Virahol, 4 ℃ of centrifugation RNA; Precipitate 2 times with 75% washing with alcohol; Deionized water dissolving precipitation with no RNA enzyme.Extractive RNA quality evalution: ultraviolet spectrophotometer is measured 260/280 ratio (ratio is all 1.7～2.0); And observation has or not degraded in MOPS denaturing formaldehyde glue.

4.eDNA synthetic

Get total RNA2 μ g, OligodT16 1 μ L, 70 ℃ of insulation 3min, sex change 5min on ice immediately.Add 5 * buffer, the reversed transcriptive enzyme of each 2 μ L of the dNTP of DTT and 50mg/L and 1 μ L, behind the abundant mixing, 42 ℃ of 2h.Template uses final concentration to be generally 1 μ g/100 μ L.

5.RT-PCR amplification

E2F8 (F): upstream primer is 5 '-CCAACCCTGCTGTGAATA-3 ' (SEQ ID NO:1);

E2F8 (R): downstream primer is 5 '-TTTCTGGCTCATTACCCT-3 ' (SEQ ID NO:2);

β-actin(F)：5’-CATCCTGCGTCTGGACCT-3’(SEQ?ID?NO：4)；

β-actin(R)：5’-GTACTTGCGCTCAGGAGGAG-3’(SEQ?ID?NO：5)。

Make internal reference with β-actin, each composition is in the reaction mixture: β-actin (F), β-actin (R), E2F8 (F), E2F8 (R), 10 * Buffer, MgCl2, dNTP, Taq archaeal dna polymerase, cDNA template are respectively 0.2,0.2,0.4,0.4,1.0,1.0,0.2,0.1 and 5 μ L, and it is 10 μ L that additional at last ddH2O makes reaction system.The reaction conditions of PCR is as follows: 94 ℃, and pre-sex change in 5 minutes; 94 ℃ of (sex change in 2,30 seconds; 55 ℃, annealing in 30 seconds; 72 ℃, extended in 30 seconds; 35 circulations, the electrophoresis detection pcr amplification product.

6. experimental result shows, the expression level of E2F8 gene in liver cancer tissue horizontal (see figure 1) of E2F8 expression of gene in the cancer beside organism, variance rate reaches 89.2%, E2F8 specific amplified segment size is 419bp, the product segment size of confidential reference items β-actin is 490bp, in Fig. 1, " N " refers to cancer beside organism, and " C " refers to liver cancer tissue.

7. according to above-mentioned experimental result, can pass through the RT-PCR diagnosing liver cancer: the PCR primer of design E2F8 gene, the content of E2F8 gene RNA in the detection tumor tissues, the rna content height then illustrates the possibility height of suffering from liver cancer, otherwise then low.

The experiment of embodiment 3 real-time quantitative PCRs

Adopt the relative quantification method to detect differential expression (Thermal Cycler DiceTMReal Time System TP800, the Takara of E2F8 gene in the liver cancer sample; SYBR

Premix Ex TaqTM, Takara).The upstream primer of gene E2F8 is: ATCAAACACTGGCCCAAATG (SEQ ID NO:3), and downstream primer: TTTCTGGCTCATTACCCT (SEQ ID NO:2), product segment size is: 121bp.House-keeping gene β-actin is as confidential reference items, and its upstream primer is: TTGTTACAGGAAGTCCCTTGCC (SEQ ID NO:6), and downstream primer: ATGCTATCACCTCCCCTGTGTG (SEQ ID NO:7), product segment size is 101bp.Real-time quantitative PCR detects and to show, the expression level of the expression level of E2F8 gene in liver cancer tissue in the cancer beside organism is through t check, P＜0.00002 (see figure 2).This experimental result shows, can pass through the real-time quantitative PCR diagnosing liver cancer: the PCR primer of design E2F8 gene, and the content of E2F8 gene RNA in the detection tumor tissues, the rna content height then illustrates the possibility height of suffering from liver cancer, otherwise then low.

Embodiment 4 in situ hybridizations

Use the E2F8 gene probe, carry out in situ hybridization with tumor biopsy, positive hybridization signal is strong more, and the possibility of suffering from liver cancer is high more.Experimental procedure is: OCT embedding after the liver neoplasm tissue is drawn materials, liquid nitrogen flash freezer, and the cryostat frozen section, this frozen section is further used in situ hybridization.

Embodiment 5 immunodetection

1. antigen protein obtains

(1) utilizes gene engineering expression: the cDNA sequence that can from the Genbank database, obtain people E2F8 gene, obtain encoder block by pcr amplification, insert in prokaryotic organism or the eukaryote expression vector, express E2F8 albumen, and press the purification system protein purification of gene engineering expression product.

(2) by cultivating the human body derived cell or the tissue of high expression level E2F8 gene, separation and purification E2F8 albumen again.

2. Antibody Preparation

Can adopt following several method to prepare antibody:

(1) cytogamy method: with the E2F8 protein immune animal (comprising rabbit, goat etc.) of above-mentioned preparation, obtain spleen cell, merge with the myeloma cell again, and the Monoclonal Antibody technology prepares monoclonal antibody routinely.

(2) utilize the phage display storehouse, the spleen IgG variable region of clone immune animal also is expressed as gene engineering monoclonal antibody.

(3) utilize the protein immune animal of purifying, the preparation polyvalent antibody.

3. detect

(1) with the antibody (how anti-or monoclonal antibody) of preparation, carry out the pathology detection of liver cancer with histochemical method, positive signal is a liver cancer.

(2) get the patients serum, detect with the ELISA method, positive reaction is the suspicious patient of liver cancer.

(3) with E2F8 antibody as one of probe of protein chip, be used for the kinds of tumors diagnosis.

Embodiment 6SiRNA experiment

Make up the antisense expression system, import the treatment cell, suppress the E2F8 expression of gene.Designing and synthesizing two pairs of siRNA sequences at the E2F8 gene mRNA, is respectively E2F8-siRNA-1 and E2F8-siRNA-2.DMEM (the Gibco company product) nutrient solution that contains 10% foetal calf serum with 2ml is cultivated liver cancer QGY-7703 cell in 5% carbonic acid gas, 100% humidity incubator in the 35mm Tissue Culture Dish, when fraction of coverage reaches 80%-90%, according to LipofectAMINETM2000 liposome operation scheme transfection 100nM siRNA in cell, respectively 6,12,24,36, after 48 hours, 1xPBS (all ingredients and routine operation method are partly prepared according to related description in " molecular cloning experiment guide " second edition in the present embodiment) with precooling washes twice with cell, add the freshly prepared cell pyrolysis liquid of 120 μ l (50mM Tris-HCl, pH7.5; 1%NP-40; 150mM NaCl; 1mM PMSF, 1mM EGTA, 0.1mg/mlaprotinin; 1mS/ml leupeptin; 1mM Na ₃VO ₄1mM NaF), scrape cell with cell scraper immediately and make itself and lysate thorough mixing, ice bath 30 minutes to 1 hour.4 ℃, 13, centrifugal 15 minutes of 000g collects supernatant to new EP pipe, measures protein content with standard Bradford method.Get each sample equivalent total protein (20-50 μ g) and add isopyknic 2 times of sample-loading buffers respectively, boiling water boil sex change after 5 minutes the SDS-PAGE gel electrophoresis in 12% separate each albumen, and transfer printing albumen to hybridization P PVDA film on, this film was handled in the snubber with 20% methyl alcohol Tris-glycine.The film that has changeed is dipped in the PBS solution that contains 5% (w/v) BSA and seals, and afterwards, for immunoassay, is that 1: 500 anti-E2F8 antibody was at room temperature hatched 1 hour film with Dilution ratio.Then, use goat-anti rabbit two anti-incubated at room 1 hour.At last, utilize ECL PLUS system (Amersham Pharmacia Biotech, Inc., Piscataway, New Jersey) to detect E2F8 expression of gene situation.

The result shows that E2F8-siRNA-1 and E2F8-siRNA-2 can suppress corresponding E2F8 expression of gene in the QGY-7703 cell.

PSUPER or the luciferase of E2F8-siRNA-1, E2F8-siRNA-2 will be comprised respectively, by Lipofectamine2000 (Invitrogen), through 24 hours, transfection was to the HuH-7 that is arranged in 25 millimeters vessel, Hep3B is in HepG2 and the Bel-7721 cell.Then, in 100 millimeters tissue culture vessel, wash film and cultivate, then, adopt 0.6～1.0mg/mlGeneticin (eukaryotic expression screening microbiotic, Invitrogen company) to select through 21 days.

Read the 450nm absorbance, calculating mean value and standard error continuously measured 5-7 days, are drawn cell growth curve.

The result shows, after the SiRNA experiment suppresses people E2F8 of the present invention genetic expression, makes the survival rate of HuH-7 liver cancer cell be starkly lower than the cell of control group, illustrate that people E2F8 expression of gene is reduced can suppress liver cancer cell growth to a certain extent.

The growth that promotes liver cancer cell is expressed in crossing of embodiment 7E2F8

1. make up the Pcdna3.1B-E2F8 plasmid

The pcr amplification respective segments is connected to after enzyme is cut on the empty plasmid Pcdna3.1B, order-checking.

2. cell cultures and synchronization

With hepatoma cell strain PLC (ATCC

Number:CRL-8024 ^TM) be incubated at and contain in 10% calf serum and antibiotic DMEM (GIBCO) nutrient solution, at 37 ℃, cultivate in the saturation vapour CO2gas incubator of 5%CO2, went down to posterity once in 3～4 days.When cell length arrived certain density, transfection Pcdna3.1B-E2F8 plasmid was established Pcdna3.1B empty plasmid cells transfected simultaneously and is contrast.

Behind the cell transfecting 12 hours, change and contain 2nM Thymine deoxyriboside (thymi dine, Sigma) DMEM nutrient solution, cultivate after 17-18 hour, normal nutrient solution was cultivated 9 hours after the 1XPBS rinsing three times, add the Thymine deoxyriboside culturing cell once more, make cell cycle arrest at the critical place of G1/S.After cultivating after 18 hours, the different time points collecting cell.

3. flow cytometer detects

Cell mixes 0.033mM 5-bromine after synchronization, (5-bromo-2-deoxyuridine, BrdU Sigma) are hatched 30 minutes to the 2-deoxyuridine, behind the PBS rinsing cell, cell are collected 75% pre-cooled ethanol fixed cell with trysinization; 0.1Msodium borate (Na2B4O7, pH 8.5) neutralization is used in the sex change in 20 minutes of 2M HCl room temperature treatment again.The monoclonal antibody (BD Bioscience, mark fluorescein isothiocyanate [FITC]) of Brdu is added in the cell of having handled well, and room temperature was placed 2 hours.Subsequently, add RNase and PI (Propidium Iodide, propidium iodide), 37 ℃ 1 hour, flow cytometry analysis.The fluidic cell detected result shows that the cell of E2F8 gene overexpression synthesizes obviously increase at S phase DNA as shown in Figure 3, and liver cancer cell growth speed is significantly accelerated, and illustrates that the E2F8 gene overexpression promotes liver cancer cell growth.

The gene therapy that embodiment 8 designs for target molecule with the E2F8 gene expression product

With the E2F8 gene expression product is target molecule, designs a kind of certain expression carrier of carrying, and imports this carrier, and its product has restraining effect to the E2F8 expression of gene, or the E2F8 protein-active is had restraining effect.

Sequence table

Claims (2)

1. the primer of a pair of specific amplified E2F8 gene is used for preparing the application with the product of RT-PCR diagnosing liver cancer, and the upstream primer sequence of described primer is shown in SEQ ID NO:1, and the downstream primer sequence is shown in SEQ ID NO:2.

2. the primer of a pair of specific amplified E2F8 gene is used for preparing the application with the product of real-time quantitative PCR diagnosing liver cancer, and the upstream primer sequence of described primer is shown in SEQ ID NO:3, and the downstream primer sequence is shown in SEQ ID NO:2.

Images