CN101492722A - Uses of DUSP21 gene - Google Patents

Abstract

The invention discloses an application of DUSP21 gene which is used for preparing products for diagnosing liver cancer and medicines for treating the cancer. The DUSP21 gene of the invention can be used as the peculiar marker gene for diagnosing liver cancer, facilitates the diagnosis on the liver cancer to be more accurate and rapid and provides new therapeutic targets and effective medicines for preventing and treating liver cancer.

Description

The application of DUSP21 gene

Technical field

The present invention relates to a kind of gene, relate in particular to a kind of application of DUSP21 gene.

Background technology

Liver cancer is one of China's common malignancy, is that China occupies second cancer " killer ", is common in middle-aged male.Fast because of its grade of malignancy height, disease progression, patient does not generally have any discomfort in early days, goes to a doctor in case symptom occurs, has often belonged to middle and advanced stage.So big, the weak curative effect of treatment difficulty, general morbidity back survival time only is 6 months, person " king in the cancer ".Therefore, improve the hepatocarcinoma early diagnosis level, to select scientific and reasonable methods of treatment and take effective prevention of recurrence to shift measure will be three key links that change this situation.

The most important tumor markers of current diagnosis primary hepatocarcinoma is alpha-fetoglobulin (AFP), but in China's Patients with Primary, serum afp is higher than the normal value, and the person only accounts for 60%～70%; 32% the patients serum AFP level of wherein only having an appointment can reach Case definition (＞400 μ g/L), and all the other are the lower concentration positive.In addition, non-liver cancer patients' such as part hepatitis, liver cirrhosis serum afp also can raise unusually.These have all influenced the specificity of this index of AFP.Therefore, remain to be developed new specific tumour marker, to improve the diagnostic level of primary hepatocarcinoma.

In addition, merge serious liver cirrhosis because China's liver cancer patient more, and easily send out and distant metastasis in the liver, excision is very limited, and chemicotherapy also there are destruction and restraining effect to normal cell and immunity system in killing tumor cell.Therefore, treatment liver cancer also needs the assisting therapy of oncotherapy vaccine except traditional operation, radiotherapy, chemotherapy mode.

CT (Cancer-testis, tumor-testis) antigen, claim tumour to share antigen again, generally in healthy tissues, do not express, but be normal expression at people's sexual cell, expression is also all arranged in the tumour of number of different types, comprise melanoma, bladder cancer, lung cancer, liver cancer etc., these have immunogenic albumen is being the target spot of oncotherapy vaccine by develop actively.Existing so far nearly more than 80 CT antigen family identified.The effect of CT antigen in tumour forms also is being subjected to further assessment, portion gene in the spermatogeny process is expressed program and is reopened when tumour takes place, and has the phenotypic characteristic-immortalization of the malignant tumour of helping, aggressive, immunologic escape, genome hypomethylation and transfer ability.

CT antigen can be divided into X-linkage CT antigen (X-CT) and euchromosome (non-X CT) is non-X-linkage antigen according to the chromosomal localization of their genes of coding.The CT antigen of X-linkage is expressed in spermatogonium usually in normal testis, and spermatogonium is to keep a constantly class germline stem cell of propagation in testis.Owing to germline stem cell, betide the trophoblastic cell of embryo and tumour cell has many total features, do not have under the situation of sudden change known oncogene and cancer suppressor gene, can regulate the malignant phenotype of tumour after reticent originally germ cell line different expression gene is activated in tumor stem cell.What be worth emphasizing is, has 10% gene to belong to X-linkage CT gene according to estimates on the X chromosome approximately.Therefore, the CT gene of choosing X-linkage is that object is studied its mechanism of action in liver cancer genesis and development.

People DUSP21 gene (Genbank No.NM_022076.2) is one of member of CT antigen family.Relation about DUSP21 gene and liver cancer generation it be unclear that, and remains further to be studied.

Summary of the invention

One of the technical problem to be solved in the present invention provides a kind of application of DUSP21 gene, and this DUSP21 gene can be used as the tagged molecule of diagnosing cancer of liver, has improved the accuracy of diagnosing cancer of liver.

Two of the technical problem to be solved in the present invention provides the application of a kind of DUSP21 gene in the medicine of preparation treatment liver cancer, and the recurrence of tumour and transfer are effectively controlled.

In order to solve the problems of the technologies described above, the present invention is achieved through the following technical solutions:

In one aspect of the invention, provide the application of a kind of DUSP21 gene in the product of preparation diagnosing liver cancer.

The product of described diagnosing liver cancer comprises: with the product of RT-PCR, real-time quantitative PCR, immunodetection, in situ hybridization or gene chip diagnosis liver cancer.

In the present invention, described product with the RT-PCR diagnosing liver cancer comprises the primer of a pair of specific amplified DUSP21 gene at least.

Described product with the real-time quantitative PCR diagnosing liver cancer comprises the primer of a pair of specific amplified DUSP21 gene at least.

Described product with the immunodetection diagnosing liver cancer comprises: with DUSP21 protein-specific bonded antibody, comprise polyclonal antibody and monoclonal antibody.

Described product with the in situ hybridization diagnosing liver cancer comprises: with the probe of the nucleic acid array hybridizing of DUSP21 gene.

Described product with gene chip diagnosis liver cancer comprises: with the probe of the nucleic acid array hybridizing of DUSP21 gene.

In the present invention, can use a series of methods known in the art to prepare at the special antibody of DUSP21 albumen.For example, the people DUSP21 gene product or its antigen fragment of purifying is injected in the animal body to produce polyclonal antibody.Equally, the cell of expressing human DUSP21 albumen or its antigen fragment also can be used for animal is caused immunity and produces antibody.Antibody prepared in accordance with the present invention also can be monoclonal antibody, and these monoclonal antibodies can prepare (for example, Kohler et al., Nature 256:495,1975 with hybridoma technology; Kohler et al., Eur.J.Immunol.6:511,1976; Kohler et al., Eur.J.Immunol.6:292,1976).Antibody of the present invention comprises the antibody that can prevent the DUSP21 function, also can be the antibody that does not influence people DUSP21 function.Each antibody-like can produce by the fragment of people DUSP21 gene product or functional domain are caused immunity, and people DUSP21 gene product and fragment thereof can produce or synthesize with Peptide synthesizer with recombination method.With the DUSP21 gene product bonded antibody of non-modified forms, can utilize the gene product that for example produces among the E.coli at prokaryotic cell prokaryocyte to come immune animal and obtain.With posttranslational modification form such as glycosylation or phosphorylation DUSP21 albumen or polypeptide bonded antibody, can utilize the gene product that in eukaryotic cell such as yeast or insect cell, produces to come immune animal and obtain.

In the present invention, described probe can be DNA, RNA, DNA-RNA mosaic, PNA or other derivative.The length of described probe without limits, as long as finish specific hybrid, combine with purpose nucleotide sequence specificity, any length can.The length of described probe can be as short as 25,20,15,13 or 10 base length.Equally, the length of described probe can be grown to 60,80,100,150,300 base pairs or longer, even whole gene.Because different probe length has different influences to hybridization efficiency, signal specificity, the length of described probe is 14 base pairs usually at least, the longlyest generally be no more than 30 base pairs, with purpose nucleotide sequence complementary length with 15-25 base pair the best.Described probe self complementary sequence is most preferably less than 4 base pairs, in order to avoid influence hybridization efficiency.

In another aspect of this invention, provide the application of a kind of DUSP21 gene in the medicine of preparation treatment liver cancer.

The medicine of described treatment liver cancer comprises: disturb to suppress the double stranded RNA of DUSP21 genetic expression by RNA, or based on the tumor vaccine of DUSP21 antigen protein, or be used to suppress the protein of DUSP21 protein-active.

In the present invention, described RNA disturb (RNA interference, RNAi) be meant high conservative during evolution, by double-stranded RNA (double-stranded RNA, phenomenon that dsRNA) bring out, the efficient specificity degraded of homologous mRNA.Use the RNAi technology can specificity to reject or close the expression of specific gene, this technology has been widely used in exploring the field of gene of gene function and communicable disease and malignant tumour.Learn at functional gene based on the RNAi of cell screening and to have many advantages aspect the research, show that mainly most cell types can both use the RNAi method, and be easier to relatively to reduce or the expression of reticent any goal gene.

In the present invention, described tumor vaccine is meant with the particular matter in the tumor tissues and excites the intravital immunologic function of patient, makes patient's the immunologic function can killing tumor cell.Tumor vaccine mainly refers to therapeutic vaccine, is to get after being ill patient to treat with the method for vaccine, with the recurrence and the transfer of control tumour again.Tumor vaccine has individuality, because the tumor type of each patient's gained, all different by stages, the expressed material of tumour cell is also different, and tumor vaccine is to be made by patient's tumour itself, therefore the tumor vaccine at the concrete tumour preparation of patient has the individuation feature, its side effect is little, and is with strong points.

When described tumor vaccine prepares, cut the tumor tissues of tumour patient and aseptic freezing preservation, to extract tumour antigen with operation method.DUSP21 antigen protein of the present invention can be used as tumour antigen and is extracted.Obtaining tumour antigen is the first step, then will obtain dendritic cell, promptly obtains from the mononuclearcell of patient blood.Screen again and vitro culture behind the extraction mononuclearcell, use tumour antigen DUSP21 at dendritic cell by in vitro stimulation then, make this dendritic cell can premunition information, at last the dendritic cell that trains is fed back in the body, make the immunne response that produces in the body at tumour antigen DUSP21.

The medicament administration mode that the present invention treats liver cancer can be oral, systemic administration (for example, see through skin, snuffing is gone into or use suppository) or parenteral administration (for example, intramuscular, intravenously or subcutaneous).

Medicine of the present invention also can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Medicine such as tablet and capsule can be prepared by ordinary method.Injection, solution, tablet and capsule should be made under aseptic condition.

The present invention experimental results show that the expression of DUSP21 gene in liver cancer tissue apparently higher than cancer beside organism, so the DUSP21 gene can be used as the special marker gene of diagnosing liver cancer, makes diagnosing cancer of liver more accurately, fast.DUSP21 gene of the present invention provides new treatment target spot and effective new drug for preventing and treating liver cancer.

Description of drawings

Fig. 1 is that the embodiment of the invention 1 is by the differential expression figure of RT-PCR checking DUSP21 gene in people's liver cancer tissue and cancer beside organism;

Fig. 2 is that the embodiment of the invention 6 is by the expression figure of RT-PCR Analysis of X chromosome linkage CT gene in liver cancer cell;

Fig. 3 is the schema that 7 pairs of DUSP21 genes of the embodiment of the invention carry out the siRNA experiment.

Embodiment

The present invention is further detailed explanation below in conjunction with drawings and Examples.

Following examples only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions among the embodiment, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The RT-PCR experiment detects the expression of DUSP21 gene in liver cancer tissue.

1. separate tissue (Tissue isolation)

Experiment is with the tissue-derived and operation patients (RT-PCR confirm AFP in liver cancer all positive and cancer by negative) of expressing the primary hepatocarcinoma of alpha-fetoprotein positive in 72 routine HBV.The liver of excision cuts focus rapidly and reaches 5 centimeters outer cancer beside organisms on every side once exsomatizing, and puts into liquid nitrogen (80 ℃) and preserves.The other diagnosis of cancer and cancer is final foundation with pathological diagnosis all.

2. the extraction agent box of total RNA

Extracting RNA reagent employing TRIzolreagent (GIBCO/BRL), this reagent are based on the extraction process production of one step of acidic phenol.Being used for used vessel of extracting RNA and water all will not have the processing of RNA enzyme, to guarantee the environment of no RNA enzyme in the experiment.

3.RNA extraction steps

To grind vessel such as pestle and homogenizer and do roasting 4h, remove the RNA enzyme, cooling at 200 ℃; Add precooling in the liquid nitrogen, will organize from liquid nitrogen and take out rapidly, be crushed into powder; With curet tissue is put into the homogenizer that adds TRIzol reagent in advance, homogenate number minute; Liquid after the homogenate is changed in the centrifuge tube of no RNA enzyme, behind the adding chloroform, 4 ℃ of centrifugal layerings; The upper strata water is changed in the centrifuge tube of a no RNA enzyme, behind the adding chloroform, 4 ℃ of centrifugal layerings; The upper strata water is changed in the centrifuge tube of a no RNA enzyme, add Virahol, 4 ℃ of centrifugation RNA; Precipitate 2 times with 75% washing with alcohol; Deionized water dissolving precipitation with no RNA enzyme.Extractive RNA quality evalution: ultraviolet spectrophotometer is measured 260/280 ratio (ratio is all 1.7～2.0); And observation has or not degraded in MOPS denaturing formaldehyde glue.

4.cDNA synthetic

Get total RNA2 μ g, OligodT161 μ L, 70 ℃ of insulation 3min, sex change 5min on ice immediately.Add 5 * buffer, the reversed transcriptive enzyme of each 2 μ L of the dNTP of DTT and 50mg/L and 1 μ L, behind the abundant mixing, 42 ℃ of 2h.Template uses final concentration to be generally 1 μ g/100 μ L.

5.RT-PCR amplification

DUSP21 (F): upstream primer is 5 '-AAAGGTGCCTGTTACCGATG-3 ' (SEQ ID NO:1);

DUSP21 (R): downstream primer is 5 '-GTTACCTACCGGCGAGTTGA-3 ' (SEQ ID NO:2);

β-actin(F)：5’-CATCCTGCGTCTGGACCT-3’(SEQ?ID?NO：3)；

β-actin(R)：5’-GTACTTGCGCTCAGGAGGAG-3’(SEQ?ID?NO：4)。

Make internal reference with β-actin, each composition is in the reaction mixture: β-actin (F), β-actin (R), DUSP21 (F), DUSP21 (R), 10 * Buffer, MgCl2, dNTP, Taq archaeal dna polymerase, cDNA template are respectively 0.2,0.2,0.4,0.4,1.0,1.0,0.2,0.1 and 5 μ L, and it is 10 μ L that additional at last ddH2O makes reaction system.The reaction conditions of PCR is as follows: 94 ℃, and pre-sex change in 5 minutes; 94 ℃, sex change in 30 seconds; 55 ℃, annealing in 30 seconds; 72 ℃, extended in 30 seconds; 35 circulations, the electrophoresis detection pcr amplification product.

6. experimental result shows, the expression level of DUSP21 gene in liver cancer tissue horizontal (see figure 1) of DUSP21 expression of gene in the cancer beside organism, variance rate reaches 81.8%, DUSP21 specific amplified segment size is 319bp, the product segment size of confidential reference items β-actin is 490bp, in Fig. 1, " N " refers to cancer beside organism, and " C " refers to liver cancer tissue.

7. according to above-mentioned experimental result, can pass through the RT-PCR diagnosing liver cancer: the PCR primer of design DUSP21 gene, the content of DUSP21 gene RNA in the detection tumor tissues, the rna content height then illustrates the possibility height of suffering from liver cancer, otherwise then low.

The experiment of embodiment 2 real-time quantitative PCRs

Adopt the relative quantification method to detect differential expression (ThermalCyclerDiceTM Real Time System TP800, the Takara of DUSP21 gene in the liver cancer sample;

Premix Ex TaqTM, Takara).Real-time quantitative PCR detects and to show, the expression level of the expression level of DUSP21 gene in liver cancer tissue in the cancer beside organism is through t check, P＜0.01.This experimental result shows, can pass through the real-time quantitative PCR diagnosing liver cancer: the PCR primer of design DUSP21 gene, and the content of DUSP21 gene RNA in the detection tumor tissues, the rna content height then illustrates the possibility height of suffering from liver cancer, otherwise then low.

Embodiment 3 in situ hybridizations

Use the DUSP21 gene probe, carry out in situ hybridization with tumor biopsy, positive hybridization signal is strong more, and the possibility of suffering from liver cancer is high more.Experimental procedure is: OCT embedding after the liver neoplasm tissue is drawn materials, liquid nitrogen flash freezer, and the cryostat frozen section, this frozen section is further used in situ hybridization.

Embodiment 4 immunodetection

1. antigen protein obtains

(1) utilizes gene engineering expression: the cDNA sequence that can from the Genbank database, obtain people DUSP21 gene, obtain encoder block by pcr amplification, insert in prokaryotic organism or the eukaryote expression vector, express DUSP21 albumen, and press the purification system protein purification of gene engineering expression product.

(2) by cultivating the human body derived cell or the tissue of high expression level DUSP21 gene, separation and purification DUSP21 albumen again.

2. Antibody Preparation

Can adopt following several method to prepare antibody:

(1) cytogamy method: with the DUSP21 protein immune animal (comprising rabbit, goat etc.) of above-mentioned preparation, obtain spleen cell, merge with the myeloma cell again, and the Monoclonal Antibody technology prepares monoclonal antibody routinely.

(2) utilize the phage display storehouse, the spleen IgG variable region of clone immune animal also is expressed as gene engineering monoclonal antibody.

(3) utilize the protein immune animal of purifying, the preparation polyvalent antibody.

3. detect

(1) with the antibody (how anti-or monoclonal antibody) of preparation, carry out the pathology detection of liver cancer with histochemical method, positive signal is a liver cancer.

(2) get the patients serum, detect with the ELISA method, positive reaction is the suspicious patient of liver cancer.

(3) with DUSP21 antibody as one of probe of protein chip, be used for the kinds of tumors diagnosis.

Embodiment 5

With demethylation medicine DAC (final concentration is 2000nM), handle 15 strain hepatoma cell strains after, the difference of gene expression dose finds that the DUSP21 gene expression difference is obvious in 8 strain cell strains before and after using gene chip to detect to handle.Wherein, gene chip experiment mainly comprises following four steps: chip preparation, specimen preparation, hybridization and signal detection and interpretation of result.

1. the present preparation of chip preparation chip is a carrier with sheet glass or silicon chip mainly.By the point sample method target gene is arranged on the carrier in order as probe, target gene can be divided into genomic dna, cDNA (or artificial-synthetic DNA).

2. the extraction steps of total RNA is as follows in the specimen preparation testing sample: take 15 strain hepatoma cell strains of demethylation medicine DAC processing and the hepatoma cell strain that 15 strains are handled without demethylation respectively, use TRIZol method extracted total RNA again.

The total RNA that extracts can be further used for the preparation of sample cDNA probe, and its process comprises preparation (the cDNA first chain mark), the purifying and quantitative of fluorescent probe.Probe quantitatively sucks back to the 1.5ml centrifuge tube, and heating is drained, and is stored in-20 ℃, waits to hybridize.

3. chip hybridization

Taking-up is through the probe of quantitative Cy3 and Cy5 mark, each fully dissolves with 9～15 μ l ddH2O and is mixed in the 1.5ml centrifuge tube, preparing hybrid liquid then, the hybridization solution of Cy3/Cy5 fluorescence labeling probe is made up of 20 * SSPE damping fluid, 50 * Denhandts damping fluid and the ddH2O that is dissolved with probe, then, get hybridization solution and drip on chip, and covered.At last, this hybridization hybrid chip is put into the hybridizing box that is added with PBS, place 42 ℃ of hybridization casees to hybridize 12～20 hours.

4. after washing, scanning and the reaction of data analysis chip hybridization finish, need carry out the chip washing.Scan such as the laser confocal scanning instrument by specific scanner again, after the scanning image is converted into numerary signal, carry out data analysis and processing subsequently based on fluorescence intensity.Because the imbalance of differences between samples, fluorescent label efficiency and recall rate needs that the original extraction signal is carried out equilibrium and could further analyze experimental data with revising.By analysis, detect DUSP21 expression of gene difference in liver cancer and the cancer beside organism by gene chip, the result shows that the DUSP21 gene expresses significantly rise in liver cancer tissue.

The selection of embodiment 6 hepatoma cell strain models

Utilize RT-PCR to analyze the expression (see figure 2) of about 40 X-linkage CT genes in 17 strain liver cancer cells, find they therein two cell strains (PLC all has expression in Focus), therefore selects this two strains clone as screening model.

Hepatoma cell strain Focus, PLC are protected by this laboratory and plant, and train in the liquid at the DMEM (GIBCO) that contains 10% foetal calf serum, 200 units per ml penicillin, 200 pg/ml Streptomycin sulphates the recovery back, 5%CO ₂, cultivate under 37 ℃ of conditions, to be used for the siRNA transfection.

Embodiment 7 carries out the siRNA screening based on hepatoma cell strain PLC, Focus to X-linkage CT gene

1. specificity is at the generation of candidate gene siRNA

For guarantee that candidate gene can efficiently be rejected or silence in the screening system, at mRNA sequence (Refseq, NCBI GenBank) design 2～3siRNA specificity segment of each candidate gene.CT gene at X-linkage has designed 177 siRNAs altogether.(Elbashiret.al 2001 for the universal design principle that the design consideration of siRNA has been delivered, Schwarz et.al 2003, Khvorova et.al 2003, Reynolds et.al 2004, Hsiehet.al 2004, Ui-Tei et.al 2004), finish design by online tool, this online tool is: siRNASelection Program of Whitehead Institute (BingbingYuan et.al2004, http://jura.wi.mit.edu/bioc/siRNAext/) and BLOCK-iT ^TMRNAi Designer ofINVITROGEN (winner of the 2004Frost﹠amp; Sullivan Excellence in Research Award, https: //rnaidesigner.invitrogen.com/sirna/).In order further to improve the pulsating validity of siRNA, the advantage of comprehensive two online design tools is designed for the siRNA segment of screening.At last, filter the siRNA sequence, to improve the pulsating specificity of siRNA and to reduce the RNAi interferential effect of missing the target by homology comparison (NCBI BLAST).The SiRNA oligonucleotide is by Shanghai JiMa pharmacy Technology Co., Ltd's chemosynthesis, the distilled water dissolving of the RNase-free that handled by DEPC, and solubility is 20 μ M.Article two, the siRNA segment is as negative control, and sequence is as follows:

S：5’CGUACGCGGAAUACUUCGAdTdT3’(SEQ?ID?NO：5)，

AS：5’UCGAAGUAUUCCGCGUACGdTdT3’(SEQ?ID?NO：6)；

S：5’UUCUCCGAACGUGUCACGUdTdT?3’(SEQ?ID?NO：7)，

AS：5’ACGUGACACGUUCGGAGAAdTdT?3’(SEQ?ID?NO：8)。

2.siRNA transfection and analysis of cell proliferation

As shown in Figure 3, the liver cancer cell of inoculation proper density in 96 orifice plates.Change the DMEM training liquid of serum-free before the transfection into, and cell density is not higher than 40%.Transfection reagent is selected Lipofectamine for use ^TM2000 (Invotrogen) use Opti-

I hangs down blood serum medium (Invotrogen) configuration siRNA oligomer-Lipofectamine ^TM2000 mixtures (transfection conditions is optimized), room temperature are placed and are added after 30 minutes in the cell, and mixing is cultivated for 37 ℃ and changed the DMEM training liquid that contains 10% foetal calf serum after 4～6 hours into.Every siRNA segment transfection three multiple porocytes, transfection experiment independently repeats twice.

Cell was cultivated through 3 days after the transfection, adopted CCK-8 (cell counting kit-8, cell counting test kit, Dojindo) method analysis of cells vegetative state.Add 10 μ l CCK-8 solution/holes behind 96 orifice plates, 37 ℃, 5%CO ₂Cultivated 2 hours, and reflected every hole active cells number than colourity analysis by solution; (Bio-Tek MQX200) in the ratio colourity of wavelength period 450nm mensuration solution, repeats reading twice to microplate reader.

3. data analysis

Operate miss during in view of the variation of cell RNA i interference experiment and large scale experiment, adopt necessary statistical method analytical data can improve the confidence level of screening system, reduce the false positive rate that the screening system draws, therefore when data analysis, introduce Z value (sieveing coeffecient) and P value (T checks confidence level).The Z value is the statistics parameter of a simple and clear no degree of freedom restriction, is used for assessment and adjusts any screening system.Z=1-(3 δ s+3 δ c)/| μ s-μ c| (Journal of Biomolecular Screening, 1999), δ s: experimental group siRNA standard deviation; δ c: control group siRNA standard deviation; μ s: experimental group siRNA mean; μ c: control group siRNA mean; Experimental group siRNA and contrast siRNA standardized data are carried out the one-side t check, obtain the P value.

After data processing, calculate statistics parameter Z value and P value in a manner described, think P＜0.05, the phenotype that the siRNA of Z＞1 causes is meaningful, and delimits positive siRNA segment thus.

At two siRNA of DUSP21 gene (Genbank No.NM_022076.2) design, one of them is the siRNA at target sequence CCTCCATCTACAGCTTCTCCCAAAT (179-203) design, name is called SI_83, its sequence is as follows: S:5 ' UCCAUCUACAGCUUCUCCCAAdTdT3 ' (SEQ ID NO:9), AS:5 ' UUGGGAGAAGCUGUAGAUGGAdGdG 3 ' (SEQ ID NO:10); Another siRNA segment of DUSP21 gene is the siRNA at target sequence AAGGACCTACGTACGATGATATC (673-695) design, name is called SI_84, its sequence is as follows: S:5 ' GGACCUACGUACGAUGAUAdTdT3 ' (SEQ ID NO:11), AS:5 ' UAUCAUCGUACGUAGGUCCdTdT3 ' (SEQ ID NO:12).

4. the positive siRNA segment of checking DUSP21 gene is to the influence of liver cancer cell growth effect

After the positive siRNA segment of DUSP21 gene carried out transfection experiment separately, with CCK-8 method metering viable cell growth number, be at interval with the sky, the growth curve of cell is made in continuously measured five days.

The result shows, at the siRNA of DUSP21 gene, can make the survival rate of Focus, PLC liver cancer cell be starkly lower than the cell of control group, illustrates that the downward modulation of people DUSP21 expression of gene can suppress liver cancer cell growth to a certain extent.

Embodiment 8DUSP21 antigen protein is as the application of tumor vaccine

1. the primary hepatocarcinoma tissue sample is drawn materials in art, and postoperative is all proved conclusively through pathological diagnosis.Adopt U.S. PEL-FREEZA-SSP UNITRAY test kit that liver cancer tissue DNA is carried out pcr amplification, the PCR product is electrophoresis in 2% sepharose, according to electrophoresis result pair cell strain HLA-A site somatotype.

2. the extraction of total RNA and cDNA's is synthetic: utilize Trizol reagent (Gibco BRL company) to extract the total RNA of liver cancer tissue, be dissolved in the ultrapure water that an amount of diethylpyrocarbonate (DEPC) handles and quantitatively.Get 5 μ g RNA samples, with the synthetic cDNA of reversed transcriptive enzyme Superscript II.

3. the pcr amplification of antigen gene cDNA: total reaction volume is 50 μ l.The primer that wherein contains 2 μ l cDNA, 25pmolCT antigen gene DUSP21.The PCR product is identified through 1% agarose gel electrophoresis.

4.PCR the purifying of product, clone and order-checking: with reference to the method for " molecular cloning " (the 3rd edition).

The in-vitro separation of (5.DC dendritic cell) and cultivation: patient's peripheric venous blood is the separating interface mononuclearcell after lymphocyte layering liquid Ficoll gradient centrifugation.Cell suspends with serum free medium AIM-V nutrient solution (Gibco BRL company) after washing 2 times, adjusts cell concn to 3 * 106/ml, and 6 well culture plates are gone in inoculation.In 37 ℃, 5%CO2 incubator after the overnight incubation, blow and beat suspension cell gently and reclaim frozen, in order to the preparation effector cell.In the attached cell nutrient solution, add the AIM-V that contains 1000U/ml grain single colony stimulating factor and 500U/ml interleukin-.When being cultured to the 7th day, the DC that results suspend.

6. polypeptide is synthetic: the DUSP21 antigenic peptide is synthetic by Peptide synthesizer.The DUSP21 antigenic peptide that the human B lymphocyte of the EBV of T2 cell or HLA-A2 (Epstein Barr Virus, epstein-barr virus (EB)) transfection and final concentration are 20ug/ml was hatched 4 hours altogether, and the washing back is as target cell.

7. identify in the following manner that the present invention treats the tumor CT antigen vaccine of liver cancer,, produce the immunne response of specificity at the DUSP21 epitope by DC submission DUSP21 antigen peptide activating effect T cell:

(1) evaluation of DC film sign: use fluorescent-labeled antibody, HLA-DR (available from Pharmingen company) detects, and detects cell phenotype by flow cytometer.

(2) processing of DC cell: DC is resuspended among the 2mlAIM-V after centrifugal, and adding DUSP21 antigen peptide to this polypeptide final concentration is 40ug/ml.37 ℃, 5%CO ₂Cultivated 18 hours, and behind the 3000rad radiation exposure, washed stand-by.

(3) effector cell's preparation: after the non-adherent cell recovery, mixes with 20: 1 with postradiation DC cell and to hatch 6-7 days altogether, again according to same ratio adding DC, after 6-7 days, once more repetitive stimulation once, action effect T cell.In 0,7,10,14,19 day, leave and take culture supernatant respectively, be used for cytokines measurement.

(4) cytokines measurement: adopt cytokines measurement test kit (available from U.S. Endogen company) to detect excretory cytokine in the culture supernatant.

8. experimental result shows, DC institute activatory effector T cell through DUSP21 antigen peptide stimulation of the present invention, can produce the immunne response of specificity at the DUSP21 epitope, thereby specific killing is combined with the target cell of this identical DUSP21 antigen peptide, illustrates that DUSP21 antigen protein of the present invention can be used as potential liver cancer treatment vaccine.

The gene therapy that embodiment 9 designs for target molecule with the DUSP21 gene expression product

With the DUSP21 gene expression product is target molecule, designs a kind of certain expression carrier of carrying, and imports this carrier, and its product has restraining effect to the DUSP21 expression of gene, or the DUSP21 protein-active is had restraining effect.

＜110〉Research Center of Shanghai Human Genome

＜120〉application of DUSP21 gene

<130>NP-08-12197

<160>12

<170>PatentIn?version?3.3

<210>1

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(20)

＜223〉primer

<400>1

aaaggtgcct?gttaccgatg 20

<210>2

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(20)

＜223〉primer

<400>2

gttacctacc?ggcgagttga 20

<210>3

<211>18

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(18)

＜223〉primer

<400>3

catcctgcgt?ctggacct 18

<210>4

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(20)

＜223〉primer

<400>4

gtacttgcgc?tcaggaggag 20

<210>5

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_RNA

<222>(1)..(21)

<223>siRNA

<400>5

cguacgcgga?auacuucgat?t 21

<210>6

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_RNA

<222>(1)..(21)

<223>siRNA

<400>6

ucgaaguauu?ccgcguacgt?t 21

<210>7

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_RNA

<222>(1)..(21)

<223>siRNA

<400>7

uucuccgaac?gugucacgut?t 21

<210>8

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_RNA

<222>(1)..(21)

<223>siRNA

<400>8

acgugacacg?uucggagaat?t 21

<210>9

<211>23

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_RNA

<222>(1)..(23)

<223>siRNA

<400>9

uccaucuaca?gcuucuccca?att 23

<210>10

<211>23

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_RNA

<222>(1)..(23)

<223>siRNA

<400>10

uugggagaag?cuguagaugg?agg 23

<210>11

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_RNA

<222>(1)..(21)

<223>siRNA

<400>11

ggaccuacgu?acgaugauat?t 21

<210>12

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_RNA

<222>(1)..(21)

<223>siRNA

<400>12

uaucaucgua?cguaggucct?t 21

Claims (9)

1. the application of a DUSP21 gene is characterized in that, the application of described DUSP21 gene in the product of preparation diagnosing liver cancer.

2. application as claimed in claim 1 is characterized in that, the product of described diagnosing liver cancer comprises: with the product of RT-PCR, real-time quantitative PCR, immunodetection, in situ hybridization or gene chip diagnosis liver cancer.

3. application as claimed in claim 2 is characterized in that, described product with the RT-PCR diagnosing liver cancer comprises the primer of a pair of specific amplified DUSP21 gene at least.

4. application as claimed in claim 2 is characterized in that, described product with the real-time quantitative PCR diagnosing liver cancer comprises the primer of a pair of specific amplified DUSP21 gene at least.

5. application as claimed in claim 2 is characterized in that, described product with the immunodetection diagnosing liver cancer comprises: with DUSP21 protein-specific bonded antibody.

6. application as claimed in claim 2 is characterized in that, described product with the in situ hybridization diagnosing liver cancer comprises: with the probe of the nucleic acid array hybridizing of DUSP21 gene.

7. application as claimed in claim 2 is characterized in that, described product with gene chip diagnosis liver cancer comprises: with the probe of the nucleic acid array hybridizing of DUSP21 gene.

8. the application of a DUSP21 gene is characterized in that, the application of described DUSP21 gene in the medicine of preparation treatment liver cancer.

9. application as claimed in claim 1, it is characterized in that, the medicine of described treatment liver cancer comprises: disturb to suppress the double stranded RNA of DUSP21 genetic expression by RNA, or based on the tumor vaccine of DUSP21 antigen protein, or be used to suppress the protein of DUSP21 protein-active.

Images