CN101445829B - Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites - Google Patents
Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites Download PDFInfo
- Publication number
- CN101445829B CN101445829B CN 200810184121 CN200810184121A CN101445829B CN 101445829 B CN101445829 B CN 101445829B CN 200810184121 CN200810184121 CN 200810184121 CN 200810184121 A CN200810184121 A CN 200810184121A CN 101445829 B CN101445829 B CN 101445829B
- Authority
- CN
- China
- Prior art keywords
- microballoon
- seq
- probe
- detection
- exons
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a detection probe, a liquid phase chip and a detection method thereof for EGFR gene mutation sites. The EGFR gene mutation detection liquid phase chip mainly comprises a microsphere for wrapping the probe; and a primer used for being amplified with a target sequence with 19 exons and/or 21 exons. By adopting the EGFR gene mutation detection liquid phase chip and the detection method, the gene mutation sites with higher relative frequency can be detected simultaneously, the 19 exons and the 21 exons can be detected separately, and also can be detected simultaneously, the reaction conditions during the detection are uniform, the specificity of the detected result is good, the sensitivity is high, the detection accuracy reaches above 90 percent, and the detection time is short. The detection method not only can detect the EGFR gene mutation in the tumor tissue sample, but also can detect the EGFR gene mutation in the body fluid of the patient with tumor and also can perform dynamic detection.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, the concrete detection probes that relates to the EGFR gene mutation site, liquid-phase chip and detection method thereof.
Technical background
EGF-R ELISA (epidermal growth factor receptor, EGFR) be a kind of multi-functional glycoprotein that is distributed widely on each cell membranes in tissue of human body, have tyrosine kinase activity, for one of four members of ErbB family, therefore have another name called HER1 or ErbB1.Start the intracellular signal conduction after EGFR is activated by part, through the cascade reaction of adaptin, enzyme in tenuigenin, regulate and transcribe transcribing of factor activator gene, instruct cell migration, stick, propagation, differentiation and apoptosis.Studies show that, have high expression level or the unconventionality expression of EGFR in many noumenal tumours, provide theoretical basis and experimental basis for the oncotherapy take EGFR as target with for the signal transduction therapeutic intervention of EGFR signal transduction pathway.Therefore, the molecular targeted therapy take EGF-R ELISA (EGFR) as the treatment target becomes the focus that domestic and international tumour circle is paid close attention to.Wherein, EGFR receptor tyrosine kinase inhibitors Gefitinib (Genfitinib, Irressa) and Tarceva (Erlotinib, Erlotinib Tarceva) are used for the treatment of advanced Non-small cell lung (NSCLC) by the approval of U.S. food Drug Administration.China has also ratified Gefitinib in February, 2005 and has entered clinical.These medicines are used for the treatment of other tumours (as mammary cancer, colorectal carcinoma and cancer of the stomach etc.), have also entered at present clinical experimental stage.
Gefitinib, Tarceva is a kind of oral small molecules EGFR antagonist, thereby can suppress with ATP competition the activity of EGFR in conjunction with the ATP binding pocket in EGFR Tyrosylprotein kinase district, being applied to late period and the clinical treatment that is not suitable for the Patients with Non-small-cell Lung of traditional chemotherapy regimen, is at present for the most effective medicine of part NSCLC patient treatment.Yet the patient is relevant to individual genetic background to the reactivity of this molecular targeted agents.In June, 2004, the report that takes the lead in such as the researchist Lynch of U.S. Harvard Medical School etc. and Paez, in lung carcinoma cell, the transgenation of EGFR Tyrosine kinase domain is the prerequisite condition that target therapeutic agent proves effective.Result of study shows, to EGFR tyrosine kinase gene coding region mutant tumour, and Gefitinib efficient up to more than 80%, and to substantially invalid without the wild-type tumour said medicine of sudden change.Be subject to various countries scholars' great attention after this current research result is delivered, and in succession confirmed (Pao W etc., 2004 by the U.S., Japan, Korea S and China (comprising Taiwan) scholar's institute in not enough year; Han SW etc., 2005; Mitsudomi T etc., 2005; Huang SF etc., 2004; Mu XL etc., 2005).Therefore, carrying out Gefitinib, before the pharmacological agenies such as Erlotinib, detect the patient and whether have the functional sudden change of relevant EGFR, but the validity of Accurate Prediction molecular targeted agents treatment is convenient to clinical accurate medication, significantly improve curative effect of medication, patient is benefited to greatest extent, can avoids the Medical Expense for Patients that non-rational use of drug causes to increase and the waste of social medical resource simultaneously, reduce timeliness loss and the financial loss of unnecessary treatment.
At present, the examination criteria of EGFR (Tyrosylprotein kinase district) transgenation is the direct Sequencing of tissue DNA sample.The method is by reports that takes the lead in such as Lynch etc. and Pacz, and advantage is definitely to understand scope and the type of EGFR transgenation, and the relation of transgenation and Gefitinib clinical efficacy is affirmed.Yet also there are many obstacles in gene sequencing as routine clinical diagnostic method, remains to be got rid of.At first, the detection difficult of microcomponent's sample.Tissue DNA carries out gene sequencing after pcr amplification, the DNA requirement is at least more than 100ng.The sample that detects at present the EGFR transgenation is mainly taken from the tissue samples of postoperative, yet 70%-80% cancer patients has been difficult to carry out the radical surgery excision when making a definite diagnosis, and can't obtain tissue sample and carry out EGFR transgenation mensuration.The unique approach that can obtain to organize of patients with advanced cancer is aspiration biopsy.But the sample of tumor aspiration biopsy tissue is very little.Usually only contain tens thousand of cells.Thereby the EGFR gene test difficult of microcomponent's sample.The EGFR gene test of this class sample is domestic does not also have successful report.Secondly, the tumor aspiration biopsy operation is applicable part patient only, and the difficulty of collection of specimens is larger.The late tumor many places are in the hemorrhage high-risk status that breaks, and there is certain medical-risk in aspiration biopsy as a kind of damaging operation.And quite a few patient is because the residing special region of anatomy of focus (as brain transfer, the contiguous heart of focus and great vessels etc.) is not suitable for carrying out this operation.Cause to provide tumor tissues to carry out gene diagnosis.At last, require high, the as a result interpretation time and effort consuming of the method to technology.Although gene sequencing is the most intuitive and accurate detection method, scope and the type thereof of the sudden change of can clarifying a diagnosis.But its sense cycle is long, sends report from receiving sample to be checked to completing smoothly to detect, and needs continuous 15-21 hours.As to detect normal working hours, reality needs just can send test results report 3 working dayss at least, therefore, is difficult to satisfy and instructs the ageing requirement of clinical application.Simultaneously, because the sudden change more than 95% belongs to heterozygosity sudden change (namely having simultaneously wild-type and mutant amplified production), Accurate Diagnosis mutation type difficulty is larger, especially the gene mutation spectrum more complicated of exons 19, many samples need to be by determining its mutation type after gene clone.Thereby the method only is fit to minority technical equipment superior laboratory and carries out, and domestic existing research all relies on key university and scientific research institution (as the Chinese Academy of Sciences and the medical university that coordinates) to complete, and situation of all-level hospitals seldom can independently be carried out this diagnosis.
Therefore, the detection of EGFR transgenation will become a routine clinical diagnostic techniques, two key issues in the urgent need to address: 1. need to seek suitable tumor tissues equivalent material (surrogate source), can make patients with advanced cancer needn't obtain material from tumor tissues and also can advance the EGFR gene diagnosis.2. be necessary to develop the detection new technology that specificity is good, susceptibility is high, simple and easy to do, situation of all-level hospitals all had ready conditions carry out this gene diagnosis project.
Therefore, set up a kind ofly sample conveniently, patient's misery is little, specificity good, highly sensitive, accurately quick, simple and easy to do and EGFR transgenation diagnostic method that need not tissue sample is that NSCLC patient uses EGFR TKIs treatment and needs the major issue that solves.
Have a large amount of free nucleic acid (DNA or RNA) in the body fluid of tumour patient (blood plasma, serum or hydrothorax etc.), its content is about more than 10 times of Healthy People.The free nucleic acid of this class is mainly downright bad from cancer cell-apoptosis, and its hereditary property is identical with Oncogenome DNA.Thereby free serum nucleic acid can be used for the oncogene mutation detection.But free nucleic acid may only have mutator gene very in a small amount, and contain a large amount of wild type genes, the a large amount of wild type genes that mix can hinder detecting of mutator gene, therefore need a kind of hypersensitivity and specific mutant detection method to assess the EGFR transgenation.
According to present bibliographical information, the occurrence frequency of the transgenation that EGFR is relevant to curative effect of medication is about 30%-50% in the Asia, mainly concentrate on base deletion sudden change (the Δ E746-750A of 19 exons, comprise two kinds of common types, see the following form) and the point mutation (L858R) of 21 exons.In China, the point mutation that the base deletion of 19 exons sudden change accounts for 54.5%, 21 exon of sudden change sum accounts for 40.3%, and the sudden change of other exons only accounts for 5.2%.For this reason, the present invention selects 19 the highest exons of mutation rate and 21 exons to detect.
Summary of the invention
One of purpose of the present invention is to be provided for the probe sequence of EGFR detection in Gene Mutation.
The technical scheme that realizes above-mentioned purpose is as follows:
The probe that is used for the EGFR detection in Gene Mutation: include
Be selected from SEQ ID NO.1～SEQ ID NO.3 any, for the wild-type probe of Exon19 exon, and be selected from SEQ ID NO.4～SEQ ID NO.6 any, for del E746-A750 (1) the mutant probe of Exon19 exon, and/or be selected from SEQ ID NO.29～SEQ ID NO.31 any, for mutant del E746-A750 (2) probe of Exon19 exon; And/or
Be selected from any wild-type probe for the Exon21 exon of SEQ ID NO.7～SEQ ID NO.9, and be selected from any mutant probe for the Exon21 exon of SEQ ID NO.10～SEQ ID NO.12.
Another object of the present invention is to provide the liquid-phase chip of EGFR detection in Gene Mutation.This liquid-phase chip can be used for detecting the relevant sudden change on EGFR gene 19 and 21 exons, thereby can be used for predicting the pharmacological agent curative effects such as Gefitinib, Erlotinib.
The technical scheme that realizes above-mentioned purpose is as follows:
a kind of liquid-phase chip of EGFR detection in Gene Mutation, mainly include: be coated with base sequence be selected from SEQ IDNO.1～SEQ ID NO.3 any, microballoon for the amido modified probe of Exon19 exon wild-type, and be coated with base sequence be selected from SEQ ID NO.4～SEQ ID NO.6 any, microballoon for the amido modified probe of Exon19 exon delE746-A750 (1) mutant, and/or be coated with base sequence be selected from SEQ ID NO.29～SEQ ID NO.31 any, microballoon for the amido modified probe of Exon19 exon del E746-A750 (2) mutant, and/or
Be coated with base sequence and be selected from any microballoon for the amido modified probe of Exon21 exon wild-type of SEQ ID NO.7～SEQ ID NO.9, with be coated with base sequence and be selected from any microballoon for the amido modified probe of Exon21 exons mutation type of SEQ ID NO.10～SEQ ID NO.12, be connected with spacerarm between the base sequence of above-mentioned every kind of probe and amino, above-mentioned every kind of microballoon has the different colours coding;
And the primer that is used for amplifying the target sequence with 19 exons and/or 21 exons mutation sites, and the end of this target sequence has biotin labeling.
The above spacerarm is for being used for specific probe and microsphere surface is spaced apart or the sequence that specific probe is placed in hydrophilic environments.By the spacerarm sequence of suitable length is set between probe sequence and amino, can reduce sterically hinderedly, improve the efficient of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n 〉=3) are as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-30 T, more preferably 10 T.
Composition SEQ ID NO. with amido modified probe of spacerarm
5’NH2-TTTTTTTTTTcaaggaattaagagaagcaacat3’ 1
5’NH2-TTTTTTTTTTaa
ggaattaagagaagcaac3’ 2
5’NH2-TTTTTTTTTTgttgcttctcttaattcctt3’ 3
5’NH2-TTTTTTTTTTgtcgctatcaaaacatctccg3’ 4
5’NH2-TTTTTTTTTTtcgctatc
aaaacatctccg3’ 5
5’NH2-TTTTTTTTTTcggagatgttttgatagcga3’ 6
5’NH2-TTTTTTTTTTagattttgggcTggccaaact3’ 7
5’NH2-TTTTTTTTTTgattttgggcTggccaaact3’ 8
5’NH2-TTTTTTTTTTagtttggccAgcccaaaatc3’ 9
5’NH2-TTTTTTTTTTtttgggcGggccaaactctg3’ 10
5’NH2-TTTTTTTTTTgattttgggcGggccaaact3’ 11
5’NH2-TTTTTTTTTTagtttggccCgcccaaaatc3’ 12
5’NH2-TTTTTTTTTT ccgtcgctatcaagacatctc3’ 29
5’NH2-TTTTTTTTTT cgtcgctatcaagacatct3’ 30
5’NH2-TTTTTTTTTT gagatgtcttgatagcgacgg3’ 31。
Preferably, the primer that is used for amplifying the target sequence with 19 exons mutation sites includes SEQ ID NO.13～SEQ ID NO.15 primer sequence, has one in described primer at least with the biotin labeling of end; And/or be used for the SEQ ID NO.16 that the amplification mountain has the target sequence in 21 exons mutation sites～SEQ ID NO.18 primer, have one in described primer at least with the biotin labeling of end.
Another object of the present invention also is to provide a kind of detection method of EGFR transgenation, the method is quick, accurate, easy and simple to handle, a plurality of mutational sites of parallel detection simultaneously, and sample to be tested can be tissue samples, can also be serum, blood plasma or hydrothorax.
A kind of detection method of using the liquid-phase chip EGFR transgenation of above-mentioned EGFR detection in Gene Mutation comprises the following steps:
(1) extract DNA in sample to be detected after, carry out first round pcr amplification with the primer that is used for amplifying the target sequence with 19 exons and/or 21 exons mutation sites;
(2) enzyme is cut enrichment first round pcr amplification product;
(3) cutting product take enzyme carries out second as template and takes turns pcr amplification;
(4) second take turns pcr amplification product and the above-mentioned microballoon that is coated with probe sequence is hybridized;
(5) add SA-PE to react after hybridization, then by Luminex instrument detection signal.
Preferably, carrying out the primer pair that first round pcr amplification uses is: SEQ ID NO.13, SEQ ID NO.14 and/or SEQID NO.16, SEQ ID NO.17.
Carry out second and take turns the primer pair that pcr amplification is used: SEQ ID NO.13, SEQ ID NO.15 and/or SEQ ID NO.18, SEQ ID NO.17.
Preferably, the temperature of hybridization is 55-60 ℃.
Preferably, every kind of preparation method who is coated with the microballoon of probe comprises that step is as follows:
(1) get the microballoon mother liquor, vortex fully is mixed into the microballoon suspension;
(2) take out 8 μ l microballoon mother liquors, contain altogether 0.8 * 10
5-1.2 * 10
5Individual microballoon is to the 0.5ml centrifuge tube;
(3) the centrifugal 10min of 15,000rpm, careful abandoning supernatant;
(4) add 10 μ l coupling liquid (pH4.5), vortex makes it abundant mixing;
(5) add 2pmol/ μ l probe working fluid 2 μ l;
(6) add the EDC working fluid of 2.5 μ l10mg/ml, hatch 30min for 25 ℃; Repeat this step once;
(7) add the 0.2ml washings, vortex makes it abundant mixing, the centrifugal 5min of 12,000g, careful abandoning supernatant; Repeat this step once;
(8) add 500 μ lTE solution, vortex makes it abundant mixing;
(9) the centrifugal 5min of 12,000g, careful abandoning supernatant;
(10) add 17 μ lTE solution, vortex makes it abundant mixing, and microballoon concentration should be about 5 * 10
3Individual/μ l;
(11) get 2 μ l, 50 times of dilute with waters, counting is stored in 2-8 ℃.
Major advantage of the present invention is:
(1) adopt EGFR gene mutation detection liquid-phase chip provided by the invention, can be simultaneously to EGFR transgenation relative frequency higher site detecting, can each detects separately to 19 exons and 21 exons, also can both detect simultaneously, reaction conditions homogeneous during detection, the detected result specificity is good, and is highly sensitive, and accuracy in detection reaches more than 90%.
(2) detection method step of the present invention is simple, thereby has avoided many uncertain factors of existing in the complex operations process, thereby can greatly improve Detection accuracy.
(3) the needed time of detection method provided by the present invention well below sequencing technologies commonly used, meets clinical needs especially.
(4) the present invention's method of adopting enzyme to cut enrichment carry out target sequence pcr amplification so that for detection of, avoided the interference that in the product, a large amount of wild-type sequences cause detected result.
(5) detection method provided by the present invention can not only detect the EGFR transgenation in the tumor tissues sample, also can detect simultaneously the EGFR transgenation in tumour patient body fluid, thereby has that sampling is convenient, painful little, a advantage that can dynamic monitoring of patient.
Embodiment
With the carrier of polystyrene microsphere as reaction, as detection platform, nucleic acid molecule is carried out high-throughout many indexs parallel detection with fluorescence detector.In the manufacturing processed of microballoon, mix ruddiness and the infrared light staining agent of different ratios, thereby form the microballoon of 100 kinds of different colours codings of as many as.Different microballoon covalent attachment for the nucleic acid molecule of difference thing to be detected as probe molecule, reporter molecules is with biotin labeling, and uses high-sensitive fluorescent dyeing.These microballoons and determinand, reporter molecules, fluorescent marker just form complete microballoon detection system and are used for reading of Luminex system.Luminex reading system respectively excitated red laser and green laser is used for the detection of microsphere system, and wherein red laser detects the intensity of the red classification of microsphere surface fluorescence, and according to different color in microballoon and number class, thereby determines the type of reaction; Green laser detects the fluorescence intensity of fluorescent marker in sample, then microballoon kind, quantity detected by machine and computer automatic statistical analysis laser, thereby judges sample to be tested plurality of target tester concentration separately.
Solution formula:
Coupling liquid (pH4.5): 0.1mol/L MES (Sigma M-2933)
Washings: 0.2ml/LTween-20 (Sigma P-9416), 1g/L SDS (Sigma L-4390)
TE (pH8.0) (storage liquid): 10mmol/L Tris (Sigma 337501), 1mmol/L EDTA (Sigma E-5134) 2 * Tm hybridization buffer
| Reagent | The source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | SigmaT3038 | 0.2M | 50ml |
| 5M NaCl | Sigma S5150 | 0.4M | 20ml |
| Triton X-100 | Sigma T8787 | 0.16％ | 0.4ml |
Be stored in 4 ℃ after filtration
1 * Tm hybridization buffer
| Reagent | The source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | Sigma T3038 | 0.1M | 25ml |
| 5M NaCl | Sigma S5150 | 0.2M | 10ml |
| Triton X-100 | Sigma T8787 | 0.08％ | 0.2ml |
Be stored in 4 ℃ after filtration.
Embodiment 1
The preparation of the liquid-phase chip of EGFR detection in Gene Mutation
One, probe sequence design and microballoon are coated
Wild-type and mutant sequence for EGFR gene 19,21 exons design special oligonucleotide probe.5 ' end of probe is an amino group, is then the spacerarm of 10 T.Probe is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Probe is respectively together with the microballoon (available from Luminex company) of different colours coding is coupled at by covalent attachment (coated process).Probe sequence is as shown in the table:
The coated concrete steps of every kind of microballoon are as follows:
(1) with probe dry powder 10, the centrifugal 1min of 000rpm;
(2) use ddH
2O is dissolved to 0.1mM (0.1nmol/ μ l, approximately 70 μ l);
(3) centrifugal solution is gathered managed the end in short-term;
(4) be packed as 10 μ l and 2 μ l, be stored in-20 ℃;
(5) get the microballoon mother liquor, vortex fully is mixed into the microballoon suspension;
(6) take out respectively 1 * 10
5Microballoon (totally 8 μ l mother liquors) is to the 0.5ml centrifuge tube;
(7) the centrifugal 10min of 15,000rpm, careful abandoning supernatant;
(8) add 10 μ l coupling liquid (pH4.5), vortex makes it abundant mixing;
(9) get 2 μ l probe mother liquors, with coupling liquid (pH4.5) dilution 2pmol/ μ l;
(10) add corresponding 2pmol/ μ l probe working fluid 2 μ l in the centrifuge tube that microballoon is housed;
(11) use ddH
2O prepares EDC working fluid (10mg/ml);
(12) each reaction tubes respectively adds 2.5 μ l EDC working fluids, and remaining EDC working fluid is abandoned;
Hatch 30min for (13) 25 ℃;
(14) each reaction tubes respectively adds 2.5 μ l EDC working fluids again;
Hatch 30min for (15) 25 ℃;
(16) add the 0.2ml washings, vortex makes it abundant mixing;
(17) the centrifugal 5min of 12,000g, careful abandoning supernatant;
(18) repeating step (16), (17) are once;
(19) add 500 μ lTE solution (pH8.0), vortex makes it abundant mixing;
(20) the centrifugal 5min of 12,000g, careful abandoning supernatant;
(21) add 17 μ l TE solution (pH8.0), vortex makes it abundant mixing.(microballoon concentration should be about 5 * 10
3Individual/μ l);
(22) get 2 μ l, 50 times of dilute with waters, counting;
(23) be stored in 2-8 ℃.
Two, the detection of the coated effect of microballoon
19 exons and 21 exons arrange respectively 6 groups of experiments.Take 19 exons as example, containing the biotin labeled reverse complementary sequence that the coated microballoon of wild-type probe and corresponding coated effect detection use in coated effect detection the first group reaction system of microballoon is E19w-P+E19w-b; Contain the coated microballoon of wild-type probe in the second group reaction system, the microballoon that the mutant probe is coated and the reverse complementary sequence of biotin labeled wild-type probe are E19w-P+E19m-P+E19w-b; Containing the coated microballoon of mutant probe and the reverse complementary sequence of biotin labeled wild-type probe in the 3rd group reaction system is E19w-P+E19m-b; Containing the coated microballoon of mutant probe and the reverse complementary sequence of biotin labeled mutant probe in the 4th group reaction system is E19m-P+E19m-b; Contain the coated microballoon of mutant probe in the 5th group reaction system, the microballoon that wild-type probe is coated and the reverse complementary sequence of biotin labeled mutant probe are E19w-P+E19m-P+E19m-b; Containing the coated microballoon of mutant probe and the reverse complementary sequence of biotin labeled wild-type probe in the 6th group reaction system is E19m-P+E19w-b.The coated effect detection experimental design of the microballoon of 21 exons is with 19 exons.The concrete operations flow process is as follows:
(1) with microballoon pipe vortex, make the abundant mixing of microballoon;
(2) with 1.5 * Tm hybridization solution, microballoon is diluted to 75/μ l (every reaction needs microballoon working fluid 33 μ l);
(3) microballoon working fluid vortex is made it abundant mixing;
(4) every hole adds 33 μ l microballoon working fluids;
(5) will be coated with TE (pH8.0) the biotin labeled probe reverse complementary sequence (being E19w-b, E19m-b, E21w-b, E21m-b) that effect detection uses and be diluted to 25fmol/17 μ l;
(6) the background hole adds 17 μ l TE (pH8.0);
(7) other every holes add respectively biotin labeled probe reverse complementary sequence (being E19w-b, E19m-b, E21w-b, the E21m-b) working fluid (being dissolved in TE solution) that the coated effect detection of 17 μ l is used;
(8) mixing gently;
(9) covering Sptting plate (pipe lid) avoids evaporating;
(10) PCR instrument program is set: 95 ℃ of 3min; 15min is hatched in 60 ℃ of hybridization;
(11) with 1 * Tm hybridization solution preparation SA-PE to 10ug/ml;
(12) every hole adds 25 μ l SA-PE, mixings gently;
5min is hatched in (13) 60 ℃ of hybridization;
(14) the Luminex instrument is set to hybridization temperature, reading.
The coated effect detection result of microballoon is as follows
| 19 exons | MFI | 21 exons | MFI |
| E19w-P+E19w-b | 3777 | E21w-P+E21w-b | 3368 |
| E19w-P+E19m-P+E19w-b | 2860 | E21w-P+E21m-P+E21w-b | 4674.5 |
| E19w-P+E19m-b | 5 | E21w-P+E21m-b | 92 |
| E19m-P+E19m-b | 6866.5 | E21m-P+E21m-b | 5657 |
| E19w-P+E19m-P+E19m-b | 5011 | E21w-P+E21m-P+E21m-b | 5932 |
| E19m-P+E19w-b | 0 | E21m-P+E21w-b | 425 |
Experimental result shows, the 19 exon wild-type probe that the present invention is designed, and 19 exons mutation type probes, 21 exon wild-type probe, 21 exons mutation type probes all can be identified corresponding complementary sequence well, and the fluorescent value after hybridization is all more than 2500.Simultaneously, there is not cross reaction between 19 exon wild-type probe and 19 exons mutation type probes; Have the part cross reaction between 21 exon wild-type probe and 21 exons mutation type probes, but cross reacting rate does not affect detected result basically in 10%.
The design of primer and mark
Gene order for EGFR gene 19 and 21 exons, design respectively following primer:
Primer is synthetic by Shanghai living work biotechnology company limited.Wherein, Exon19-S1 and Exon19-As1 are used for the first round pcr amplification of 19 exons, and biotin labeling Exon19-S1 and Exon19-As2 are used for second of 19 exons and take turns pcr amplification; Exon21-S1 and Exon21-As1 are used for the first round pcr amplification of 21 exons, and Exon21-As1 and biotin labeled Exon21-S2 are used for second of 21 exons and take turns pcr amplification.
The liquid-phase chip of the EGFR detection in Gene Mutation for preparing includes:
be coated with SEQ ID NO.3's, microballoon for the amido modified probe of wild-type of Exon19 exon, be coated with SEQID NO.6's, microballoon for the amido modified probe of del E746-A750 (1) mutant of Exon19 exon, be coated with SEQID NO.31's, microballoon for the amido modified probe of del E746-A750 (2) mutant of Exon19 exon, be coated with the microballoon for the amido modified probe of wild-type of Exon21 exon in SEQ ID NO.9, with the microballoon for the amido modified probe of mutant of Exon21 exon that is coated with SEQ ID NO.12, above-mentioned every kind of microballoon has the different colours coding, and
The primer sequence of SEQ ID NO.13-15 and SEQ ID NO.16-18, wherein 5 ' of SEQ ID NO.13 and SEQ IDNO.18 base sequence end adds respectively biotin labeling.
Embodiment 2
Use the liquid-phase chip of the EGFR detection in Gene Mutation in embodiment 1 to the detection of serum of patients with non-small cell lung sample
One, the preparation of sample to be tested (extraction of the free nucleic acid of blood plasma, serum and hydrothorax supernatant):
Extract in a small amount the test kit explanation with reference to AxyPrep whole blood genome, detailed step is as follows:
(1) get approximately 2.5ml of patient's anti-freezing venous blood or hydrothorax, centrifugal 15 minutes of 3000rpm gets 300 μ l supernatants and is added in the clean aseptic centrifuge tube of a 1.5ml;
(2) add 500 μ l AP1 damping fluids in centrifuge tube, the abundant mixing of vortex vibration;
(3) add 100 μ l AP2 damping fluids, the abundant mixing of vortex vibration;
(4) under room temperature 12, centrifugal 10 minutes of 000rpm;
(5) carefully draw supernatant and add in the adsorption column AxyPrep that is placed on the 2ml collection tube, cover lid, with 6,000rpm centrifugal 1 minute;
(6) outwell waste liquid in the waste collection pipe, with 800 μ l damping fluid W1 washing 1 time, with 6,000rpm centrifugal 1 minute;
(7) outwell waste liquid in the waste collection pipe, add 800 μ l damping fluid W2, with 12,000rpm centrifugal 1 minute; Outwell the waste liquid in the waste collection pipe, add 500 μ l damping fluid W2, with 12,000rpm centrifugal 1 minute, discard waste liquid;
(8) adsorption column AxyPrep is put back in the sky collection tube centrifugal 1 minute of 12,000rpm;
(9) adsorption column AxyPrep is placed in a clean aseptic 1.5ml centrifuge tube, adds 40 μ l TE damping fluids, placed 1 minute centrifugal 1 minute eluted dna of 12,000rpm, electrophoresis detection ,-20 ℃ of preservations under room temperature.
Two, the pcr amplification of testing sample and enzyme are cut enrichment:
(1) pcr amplification of sample DNA and enzyme are cut enrichment
It is as follows that the enzyme of exons 19 mutants is cut the enrichment pcr amplification:
1. first round pcr amplification
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
95 ℃ of 5min 1 of denaturation
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend at last 72 ℃ of 10min 1
2.PCR product Mse I enzyme is cut:
Reaction system is as follows:
10×Mse I Buffer 1μμl
PCR product 3 μ μ l
100×BSA 0.1μμl
Mse I 0.5μμl(50U/μμl)
Add sterilization distilled water to 10 μ l
37 ℃ of incubations 2 hours, 65 ℃ of 20 minutes inactivators.
3. second take turns pcr amplification
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
95 ℃ of 5min 1 of denaturation
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend at last 72 ℃ of 10min 1
It is as follows that the enzyme of exon 21 mutant is cut the enrichment pcr amplification:
1. first round pcr amplification
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
95 ℃ of 5min 1 of denaturation
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend at last 72 ℃ of 10min 1
2.PCR product Msc I enzyme is cut:
Reaction system is as follows:
10×Msc I Buffer 1μl
PCR product 3 μ l
Msc I 0.5μl(10U/μl)
Add the l without enzyme water to 10 μ
37 ℃ of incubations 2 hours, 65 ℃ of 20 minutes inactivators.
3. second take turns pcr amplification
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
95 ℃ of 5min 1 of denaturation
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend at last 72 ℃ of 10min 1
Perhaps carry out the synchronous amplification (multiplex PCR amplification) of EGFR gene 19,21 exons mutation types and wild-type sequence
1. 19 exons, 21 exon first round pcr amplifications and enzyme are cut same as described above, and different is second takes turns the method that pcr amplification is taked synchronous amplification.
2. second take turns pcr amplification (19,21 exon wild-type sequences and mutant sequence increase simultaneously)
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
95 ℃ of 5min 1 of denaturation
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend at last 72 ℃ of 10min 1
Three, hybridization and upper machine testing
(1) will be coated with 19 exon wild-type probe (E19w-P), 19 exon del E746-A750 (1) mutant probes (E19m-P), 19 exon del E746-A750 (2) mutant probes (E19m-P11), 21 exon wild-type probe (E21w-P), 21 exons mutation type probes (E21m-P), the microballoon of negative control probe (N-P) is vortex 30s respectively, supersound process 30s;
(2) contain with 1.5 * Tm hybridization solution preparation the mixing microballoon working fluid that is coated with probe, make that in solution, every kind of microballoon concentration is 75/μ l;
(3) will mix microballoon working fluid vortex 30s, supersound process 30s;
(4) every hole adds 33 corresponding μ l mixing microballoon working fluids, makes and finally contains each approximately 2500 of every kind of microballoons in reaction system;
(5) the background hole adds 17 μ l TE (pH8.0); Other every holes add respectively second of 19 exons of each sample and 21 exons to take turns each 2-17 μ l of PCR product, add TE to 17 μ l; Mixing gently; Covering Sptting plate (pipe lid) avoids evaporating;
(6) PCR instrument program is set: 95 ℃ of 5min; 15min is hatched in 60 ℃ of hybridization;
(7) with 1 * Tm hybridization solution preparation SA-PE to 2ug/ml (75 μ l/ hole);
(8) with reaction tubes (plate) 12, the centrifugal 5min of 000g, careful abandoning supernatant.Perhaps be transferred in filter plate, suction filtration is removed liquid;
(9) every hole adds 75 μ l SA-PE (streptavidin phycoerythrin) working fluid (SA-PE that contains 150ng), mixings gently;
(10) be placed in hybridization temperature (60 ℃), hatch 5min at once;
(11) the Luminex instrument is set to hybridization temperature, reading.
Four, detected result and data analysis
The reaction after product detects by Luminex serial analysis instrument, and detected result is as shown in table 1.There are not cross reaction in 19 exon wild-types and mutant (disappearance) probe, therefore with mutant fluorescent value (two kinds of mutant fluorescent value the higher person) divided by negative control fluorescent value (being M/N) 25 as positive decision content (cut-off value).As 19 exon detected result M/N〉25 the time, judge that this sample is the disappearance that has 19 exons, otherwise judge that this sample is 19 exon wild-types.There are cross reaction (cross reacting rate is in 10%) in 21 exon wild-type probe and mutant probe, therefore, with (mutant fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value) i.e. ((M-N)/(W-N))〉2 as positive decision content (cut-off value).As 21 exon detected results ((M-N)/(W-N))〉2 the time, judge that there is the L858R point mutation of 21 exons in this sample, otherwise judge that this sample is 21 exon wild-types.
According to this criterion, 10 increments that the present embodiment detects are in this, and there is the disappearance (No. 3, No. 5, No. 7 samples) of 19 exons in 3 examples, and there are the point mutation (No. 2, No. 10 samples) of 21 exons in 2 examples.Detected result and traditional polyacrylamide gel electrophoresis carry out the result that silver dyes again makes comparisons, and calculates the rate of coincideing.The detection rate of coincideing that the detection of the 19 exons rate of coincideing reaches 100%, 21 exon also reaches 90%.The Integral-fit rate is 95%.Therefore, use EGFR gene mutation detection liquid-phase chip provided by the present invention and detection method thereof can accurately detect the deletion mutantion of EGFR gene 19 exons and the point mutation of 21 exons, accuracy rate is up to 95%, be the assessment Gefitinib, the validity of the targeted drugs such as Erlotinib treatment, be convenient to clinical accurate medication, avoid timeliness loss and the financial loss of unnecessary treatment that important detection means is provided.
The detected result of table 1 serum sample
| Sequence number | Negative control | E19w | E19ml | E19m2 | E21w | E21m |
| NO. | (MFI) | (MFI) | (MFI) | (MFI) | (MFI) | (MFI) |
| 1 | 13 | 1751 | 70 | 56 | 189 | 21 |
| 2 | 14 | 1366.5 | 39.5 | 49 | 40 | 1299 |
| 3 | 9 | 1373 | 1593.5 | 29.5 | 194 | 23 |
| 4 | 7 | 1132 | 40 | 36.5 | 69 | 75.5 |
| 5 | 4 | 236 | 53 | 1876.5 | 154.5 | 21.5 |
| 6 | 10.5 | 656 | 51.5 | 54 | 38 | 31 |
| 7 | 19 | 661.5 | 1818 | 78 | 61 | 99 |
| 8 | 4 | 83 | 91 | 38 | 71.5 | 58.5 |
| 9 | 15 | 46 | 9 | 7.5 | 35 | 38.5 |
| 10 | 11.5 | 1169 | 48.5 | 29 | 189 | 412 |
Table 2 serum sample EGFR mutation type analytical results
| Catalogue number(Cat.No.) | Mutant fluorescent value/negative control fluorescent value (M/N) | (mutagenicity fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value ((M-N)/(W-N)) | The mutation type analytical results | The detected through gel electrophoresis analytical results |
| 19 exons | 21 exons | |||
| 1 | 5.38 | 0.05 | Wild-type | Wild-type |
| 2 | 3.50 | 49.42 | 21 exon point mutation | 21 exon point mutation |
| 3 | 177.06 | 0.08 | 19 Exon deletion | 19 Exon deletion |
| 4 | 5.71 | 1.10 | Wild-type | Wild-type |
| 5 | 469.13 | 0.12 | 19 Exon deletion | 19 Exon deletion |
| 6 | 5.14 | 0.75 | Wild-type | Wild-type |
| 7 | 95.68 | 1.90 | 19 Exon deletion | 19 Exon deletion |
| 8 | 22.75 | 0.81 | Wild-type | Wild-type |
| 9 | 0.60 | 1.18 | Wild-type | Wild-type |
| 10 | 4.22 | 2.26 | 21 exon point mutation | Wild-type |
Embodiment 3
Use the liquid-phase chip of the EGFR detection in Gene Mutation in embodiment 1 to the detection of cancerous lung tissue sample
The cancerous lung tissue sample of getting above-described embodiment 2 patient 1-10 used detects, and detailed process is as follows:
One, the preparation of sample to be tested
The extraction of DNA in the cancerous lung tissue sample: get the tissue sample 5-50mg of lung cancer postoperative or biopsy, after grinding, the PBS solution washing of use pH7.4 2 times; Tissue sample after washing is resuspended in Digestive system (50mmol/L Tris, the 1mmo/LNa of 1ml
2EDTA, 0.5% Tween-20, the Proteinase K 200 of 200ug/ml, pH 8.5), 55 ℃ of water-baths digested 1 hour, 99 ℃ of water-bath 15min inactivated proteases K; 12000 rev/mins centrifugal 10 minutes; Get supernatant, by phenol-chloroform-primary isoamyl alcohol method extracting, ethanol precipitation obtains to be used for the DNA sample of PCR reaction.Also can extract DNA by microcentrifugation post method;
Two, the pcr amplification of testing sample and enzyme are cut enrichment:
Concrete grammar is with embodiment 2.
Three, hybridization and upper machine testing:
Concrete grammar detects with embodiment 2.
Four, detected result and data analysis
The reaction after product detects by Luminex serial analysis instrument, shown in detected result such as table 3, table 4.Criterion is described with embodiment 2.Experimental result shows, the analytical results of cancerous lung tissue pattern detection is consistent with the result that detects analysis with serum sample, i.e. the deletion mutantion (No. 3 of existence 3 example 19 exons in 10 routine samples, No. 5, No. 7 samples), there is the point mutation (No. 2, No. 10 samples) of 2 example 21 exons.Illustrate that method of carrying out the EGFR detection in Gene Mutation with free serum nucleic acid provided by the present invention is feasible, illustrate that also method provided by the present invention is reliable and stable.
The detected result of table 3 cancerous lung tissue sample
| Sequence number NO. | Negative control (MFI) | E19w (MFI) | E19ml (MFI) | E19m2(MFI) | E21w (MFI) | E21m (MFI) |
| 1 | 15 | 1987 | 77 | 54 | 201 | 41 |
| 2 | 10 | 1421 | 41 | 47 | 45 | 1412 |
| 3 | 9 | 1405 | 1657.5 | 36 | 231 | 35 |
| 4 | 8 | 1387 | 39 | 25.5 | 62.5 | 84.5 |
| 5 | 6 | 321 | 65.5 | 1905.5 | 275 | 51 |
| 6 | 12 | 761.5 | 84 | 62 | 42 | 54 |
| 7 | 5 | 657 | 1854 | 81 | 55 | 76 |
| 8 | 9 | 91 | 132 | 36.5 | 81 | 73.5 |
| 9 | 13 | 41 | 17 | 11 | 56 | 51 |
| 10 | 12.5 | 1241.5 | 53.5 | 34 | 215 | 451 |
Table 4 cancerous lung tissue sample EGFR mutation type analytical results
| Catalogue number(Cat.No.) | Mutant fluorescent value/negative control fluorescent value (M/N) | (mutant fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value ((M-N)/(W-N)) | The mutation type analytical results |
| 19 exons | 21 exons | ||
| 1 | 5.13 | 0.14 | Wild-type |
| 2 | 4.70 | 40.06 | 21 exon point mutation |
| 3 | 184.17 | 0.12 | 19 Exon deletion |
| 4 | 4.88 | 1.40 | Wild-type |
| 5 | 317.58 | 0.17 | 19 Exon deletion |
| 6 | 7.00 | 1.40 | Wild-type |
| 7 | 370.80 | 1.42 | 19 Exon deletion |
| 8 | 14.67 | 0.90 | Wild-type |
| 9 | 1.31 | 0.88 | Wild-type |
| 10 | 4.28 | 2.17 | 21 exon point mutation |
Embodiment 4
One, the liquid-phase chip of preparation EGFR detection in Gene Mutation
Method according to embodiment 1 is coated with microballoon with probe:
One, EGFR sudden change other alternative probe design of detection and microballoon are coated
For wild-type and the mutant sequence of EGFR gene 19,21 exons, design two groups of oligonucleotide probes (E19w-P1, E19m-P1, E19m-P13, E21w-P1, E21m-P1 and E19w-P2, E19m-P2, E19m-P12, E21w-P2, E21m-P2).5 ' end of probe is an amino group, is then the spacerarm of 10 T.Probe is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Probe is together with the microballoon (available from Luminex company) of different colours coding is coupled at by covalent attachment (coated process) respectively, and is described with embodiment 1.Probe sequence is as shown in the table:
The liquid-phase chip of the EGFR detection in Gene Mutation of the present embodiment includes:
be coated with SEQ ID NO.2's, microballoon for the amido modified probe of wild-type of Exon19 exon, be coated with SEQID NO.5's, microballoon for the amido modified probe of mutant of Exon19 exon del E746-A750 (1), be coated with SEQ ID NO.30's, microballoon for the amido modified probe of mutant of Exon19 exon del E746-A750 (2), be coated with the microballoon for the amido modified probe of wild-type of Exon21 exon in SEQ ID NO.8, with the microballoon for the amido modified probe of mutant of Exon21 exon that is coated with SEQ IDNO.11, above-mentioned every kind of microballoon has the different colours coding, and
The primer sequence of SEQ ID NO.13-15 and SEQ ID NO.16-18, wherein 5 ' of SEQ ID NO.15 and SEQ IDNO.17 base sequence end adds respectively biotin labeling.
Two, the liquid-phase chip of the EGFR detection in Gene Mutation of the present embodiment is used for the detection of Sera of Lung Cancer sample
Use E19w-P1, E19m-P1, E19m-P13, E21w-P1, the detection of the microballoon that the E21m-P1 probe is coated with to the serum of patients with non-small cell lung sample.
Select 1-5 used in embodiment 2 totally five parts of serum of patients with non-small cell lung samples detect.The preparation of sample to be tested, pcr amplification and the enzyme of sample to be tested are cut enrichment, and hybridization is described with embodiment 2 with the experimental procedure of upper machine testing.Experimental result is as follows:
The detected result of table 5 serum sample
| Sample | Negative control (MFI) | E19w-P1(MFI) | E19m-P1(MFI) | E19m-P13(MFI) | E21w-P1(MFI) | E21m-P1(MFI) |
| 1 | 19 | 1695 | 85.5 | 44 | 192 | 25 |
| 2 | 14 | 1409 | 51 | 57 | 41 | 1305 |
| 3 | 13 | 1327 | 1421 | 36 | 201 | 31 |
| 4 | 10 | 1052 | 39 | 41 | 63 | 81 |
| 5 | 15 | 259 | 54 | 1881 | 167 | 23 |
Table 6 serum sample EGFR mutation type analytical results
| Sample | Mutant fluorescent value/negative control fluorescent value (M/N) | (mutagenicity fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value ((M-N)/(W-N)) | The mutation type analytical results |
| 1 | 4.50 | 0.03 | Wild-type |
| 2 | 4.07 | 47.81 | 21 exon point mutation |
| 3 | 109.31 | 0.10 | 19 Exon deletion |
| 4 | 4.10 | 1.34 | Wild-type |
| 5 | 125.40 | 0.05 | 19 Exon deletion |
Experimental result shows, probe E19w-P1, E19m-P1, E19m-P13, E21w-P1, E21m-P1 can be used for the sudden change of clinical sample EGFR is detected equally, analytical results and use probe (E19w-P, E19m-P, E19m-P11, E21w-P, E21m-P) result that detects is consistent.
Embodiment 5
One, the liquid-phase chip of preparation EGFR detection in Gene Mutation
The preparation method is with embodiment 1.
The liquid-phase chip of the EGFR detection in Gene Mutation of the present embodiment includes:
be coated with SEQ ID NO.1's, microballoon for the amido modified probe of wild-type of Exon19 exon, be coated with SEQID NO.4's, microballoon for the amido modified probe of mutant of Exon19 del E746-A750 (1), be coated with SEQ IDNO.29's, microballoon for the amido modified probe of mutant of Exon19 exon del E746-A750 (2), be coated with the microballoon for the amido modified probe of wild-type of Exon21 exon in SEQ ID NO.7, with the microballoon for the amido modified probe of mutant of Exon21 exon that is coated with SEQ ID NO.10, above-mentioned every kind of microballoon has the different colours coding, and
The primer sequence of SEQ ID NO.13-15 and SEQ ID NO.16-18, wherein 5 ' of SEQ ID NO.15 and SEQ IDNO.17 base sequence end adds respectively biotin labeling.
Two, the liquid-phase chip of the EGFR detection in Gene Mutation of the present embodiment is used for the detection of Sera of Lung Cancer sample
Use E19w-P2, E19m-P2, E19mP12, E21w-P2, the detection of the microballoon that the E21m-P2 probe is coated with to the serum of patients with non-small cell lung sample
Totally five serum of patients with non-small cell lung samples of same selection 1-5 detects.The preparation of sample to be tested, pcr amplification and the enzyme of sample to be tested are cut enrichment, and hybridization is described with embodiment 2 with the experimental procedure of upper machine testing.Experimental result is as follows:
The detected result of table 7 serum sample
| Sample | Negative control (MFI) | E19w-P2(MFI) | E19m-P2(MFI) | E19m-P12(MFI) | E21w-P2(MFI) | E21m-P2(MFI) |
| 1 | 11 | 1795 | 74 | 62 | 175 | 33.5 |
| 2 | 17 | 1329 | 43 | 53 | 51 | 1276 |
| 3 | 15 | 1346 | 1542 | 33 | 187 | 41 |
| 4 | 10 | 1075 | 47 | 47 | 52 | 84 |
| 5 | 15 | 241 | 59 | 1796 | 139 | 27 |
Table 8 serum sample EGFR mutation type analytical results
| Sample | Mutant fluorescent value/negative control fluorescent value (M/N) | (mutagenicity fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value ((M-N)/(W-N)) | The mutation type analytical results |
| 1 | 6.73 | 0.14 | Wild-type |
| 2 | 3.12 | 37.03 | 21 exon point mutation |
| 3 | 102.80 | 0.15 | 19 Exon deletion |
| 4 | 4.70 | 1.76 | Wild-type |
| 5 | 119.73 | 0.10 | 19 Exon deletion |
Experimental result shows, probe E19w-P2, E19m-P2, E19m-P12, E21w-P2, E21m-P2 also can be used for the sudden change of clinical sample EGFR is detected, analytical results and probe (E19w-P, E19m-P, E19m-P11, E21w-P, E21m-P) result that detects is consistent.
Sequence table
＜110〉Guangzhou Yishan Biotechnology Co., Ltd.
＜120〉detection probes of EGFR gene mutation site, liquid-phase chip and detection method thereof
<160>34
<170>PatentIn version 3.1
<210>1
<211>23
212>DNA
＜213〉artificial sequence
<400>1
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<400>2
<210>3
<211>20
<212>DNA
＜213〉artificial sequence
<400>3
<210>4
<211>21
<212>DNA
＜213〉artificial sequence
<400>4
<210>5
<211>20
<212>DNA
＜213〉artificial sequence
<400>5
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<400>6
<210>7
<211>21
<212>DNA
＜213〉artificial sequence
<400>7
<210>8
<211>20
<212>DNA
＜213〉artificial sequence
<400>8
<210>9
<211>20
<212>DNA
＜213〉artificial sequence
<400>9
<210>10
<211>20
<212>DNA
＜213〉artificial sequence
<400>10
<210>11
<211>20
<212>DNA
＜213〉artificial sequence
<400>11
<210>12
<211>20
<212>DNA
＜213〉artificial sequence
<400>12
<210>13
<211>28
<212>DNA
＜213〉artificial sequence
<400>13
<210>14
<211>21
<212>DNA
＜213〉artificial sequence
<400>14
<210>15
<211>18
<212>DNA
＜213〉artificial sequence
<400>15
<210>16
<211>21
<212>DNA
＜213〉artificial sequence
<400>16
<210>17
<211>22
<212>DNA
＜213〉artificial sequence
<400>17
<210>18
<211>23
<212>DNA
＜213〉artificial sequence
<400>18
<210>19
<211>23
<212>DNA
＜213〉artificial sequence
<400>19
<210>20
<211>21
<212>DNA
＜213〉artificial sequence
<400>20
<210>21
<211>21
<212>DNA
＜213〉artificial sequence
<400>21
<210>22
<211>20
<212>DNA
＜213〉artificial sequence
<400>22
<210>23
<211>20
<212>DNA
＜213〉artificial sequence
<400>23
<210>24
<211>20
<212>DNA
＜213〉artificial sequence
<400>24
<210>25
<211>20
<212>DNA
＜213〉artificial sequence
<400>25
<210>26
<211>20
<212>DNA
＜213〉artificial sequence
<400>26
<210>27
<211>20
<212>DNA
＜213〉artificial sequence
<400>27
<210>28
<211>20
<212>DNA
＜213〉artificial sequence
<400>28
<210>29
<211>21
<212>DNA
＜213〉artificial sequence
<400>29
<210>30
<211>19
<212>DNA
＜213〉artificial sequence
<400>30
<210>31
<211>21
<212>DNA
＜213〉artificial sequence
<400>31
<210>32
<211>21
<212>DNA
＜213〉artificial sequence
<400>32
<210>33
<211>21
<212>DNA
＜213〉artificial sequence
<400>33
<210>34
<211>21
<212>DNA
＜213〉artificial sequence
<400>34
Claims (4)
1. be used for the liquid-phase chip of EGFR detection in Gene Mutation, it is characterized in that: mainly include:
A. be coated with the microballoon of probe: be coated with base sequence be selected from SEQ ID NO.1～SEQ ID NO.3 any, microballoon for the amido modified probe of Exon19 exon wild-type, and be selected from following any microballoon: be coated with base sequence be selected from SEQ ID NO.4～SEQ ID NO.6 any, microballoon for the amido modified probe of Exon19 exon del E746-A750 (1) mutant, with be coated with base sequence be selected from SEQ ID NO.29～SEQ ID NO.31 any, microballoon for the amido modified probe of Exon19 exon del E746-A750 (2) mutant, and/or be coated with base sequence and be selected from any microballoon for the amido modified probe of Exon21 exon wild-type of SEQ ID NO.7～SEQ ID NO.9, with be coated with base sequence and be selected from any microballoon for the amido modified probe of Exon21 exons mutation type of SEQ ID NO.10～SEQ ID NO.12, be connected with spacerarm between the base sequence of above-mentioned every kind of probe and amino, above-mentioned every kind of microballoon has the different colours coding, and
B. primer: be used for amplifying the SEQ ID NO.13 of the target sequence with 19 exons mutation sites～SEQ IDNO.15 primer, have in described primer at least with the biotin labeling of end; And/or be used for amplifying the SEQ ID NO.16 of the target sequence with 21 exons mutation sites～SEQ ID NO.18 primer, have one in described primer at least with the biotin labeling of end.
2. the liquid-phase chip of EGFR detection in Gene Mutation according to claim 1, it is characterized in that, the microballoon of dressing probe is: be coated with base sequence and be SEQ ID NO.3, for the microballoon of the amido modified probe of Exon19 exon wild-type, with be coated with base sequence be SEQ ID NO.6, for the microballoon of the amido modified probe of Exon19 exons mutation type, and be coated with base sequence be SEQ ID NO.31, for the microballoon of the amido modified probe of Exon19 exons mutation type; Be coated with the microballoon for the amido modified probe of Exon21 exon wild-type that base sequence is SEQ ID NO.9, with to be coated with base sequence be SEQ ID NO.12, for the microballoon of the amido modified probe of Exon21 exons mutation type, be connected with spacerarm between the base sequence of above-mentioned every kind of probe and amino, above-mentioned every kind of microballoon has the different colours coding.
3. the liquid-phase chip for the EGFR detection in Gene Mutation according to claim 1, it is characterized in that: described spacerarm is 5-30 T.
4. the liquid-phase chip for the EGFR detection in Gene Mutation according to claim 3, it is characterized in that: described spacerarm is 10 T.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810184121 CN101445829B (en) | 2008-04-23 | 2008-12-08 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
| PCT/CN2009/000429 WO2009129693A1 (en) | 2008-04-23 | 2009-04-22 | Probes, liquidchip-based products, and methods for detection of egfr gene mutation |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810027613 | 2008-04-23 | ||
| CN200810027613.9 | 2008-04-23 | ||
| CN 200810184121 CN101445829B (en) | 2008-04-23 | 2008-12-08 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101445829A CN101445829A (en) | 2009-06-03 |
| CN101445829B true CN101445829B (en) | 2013-06-05 |
Family
ID=40741704
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200810184121 Active CN101445829B (en) | 2008-04-23 | 2008-12-08 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN101445829B (en) |
| WO (1) | WO2009129693A1 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445829B (en) * | 2008-04-23 | 2013-06-05 | 广州益善生物技术有限公司 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
| CN102234683B (en) * | 2010-04-23 | 2013-07-17 | 广州益善生物技术有限公司 | Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation |
| CN102181537B (en) * | 2011-03-22 | 2013-06-19 | 宁波基内生物技术有限公司 | Primer composite, kit and method for detecting mutation of exon 21 of human EGFR (Epidermal Growth Factor Receptor) gene |
| CN103045746A (en) * | 2012-12-31 | 2013-04-17 | 上海市胸科医院 | Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection |
| CN113373205A (en) * | 2021-08-03 | 2021-09-10 | 远辰生物科技(苏州)有限公司 | Method for quantitatively detecting site mutation of 19del and L858R of EGFR gene by using digital PCR |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1710102A (en) * | 2005-06-20 | 2005-12-21 | 上海市肺科医院 | PCR detecting method of tumour associated gene mutation and reagent system |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1733056B1 (en) * | 2004-03-31 | 2013-05-22 | The General Hospital Corporation | Method to determine responsiveness of cancer to epidermal growth factor receptor targeting treatments |
| JPWO2006070667A1 (en) * | 2004-12-28 | 2008-06-12 | タカラバイオ株式会社 | EGFR gene mutation detection method and detection kit |
| CN1749417A (en) * | 2005-07-27 | 2006-03-22 | 上海奇诺肿瘤生物高新技术有限公司 | Real time quantitative PCR detecting reagent kit and method for epidermal growth factor receptor exon 19 deletion mutation |
| CN101092644B (en) * | 2006-06-21 | 2010-07-14 | 上海基康生物技术有限公司 | Quick detecting gene mutation correlative to curative effect of non small-cell carcinoma of the lung |
| CN101445829B (en) * | 2008-04-23 | 2013-06-05 | 广州益善生物技术有限公司 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
-
2008
- 2008-12-08 CN CN 200810184121 patent/CN101445829B/en active Active
-
2009
- 2009-04-22 WO PCT/CN2009/000429 patent/WO2009129693A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1710102A (en) * | 2005-06-20 | 2005-12-21 | 上海市肺科医院 | PCR detecting method of tumour associated gene mutation and reagent system |
Non-Patent Citations (2)
| Title |
|---|
| 孙大光 等.悬浮点阵技术用于分析β地中海贫血基因突变类型.《中华血液学杂志》.2004,第25卷(第4期),239-241. * |
| 张松 等.液态芯片技术在β地中海贫血基因检测中的应用研究.《热带医学杂志》.2007,第7卷(第7期),642-644. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101445829A (en) | 2009-06-03 |
| WO2009129693A1 (en) | 2009-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101381779B (en) | Detection probe of kRas gene mutation, liquid phase chip and detection method thereof | |
| US11085086B2 (en) | Gene mutations and copy number alterations of EGFR, KRAS and MET | |
| CN108949990B (en) | Kit and method for detecting EGFR gene mutation | |
| CN106591438B (en) | Nucleic acid combination, kit and application for detecting Her2 gene | |
| CN104745679A (en) | Method and kit for non-invasive detection of EGFR (epidermal growth factor receptor) gene mutation | |
| CN108315416A (en) | Primer, kit and the method for lung cancer gene mutation site are determined based on high throughput sequencing technologies | |
| CN101445829B (en) | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites | |
| CN104561250A (en) | Method and primer for detecting imatinib targeted medication gene | |
| CN102747158A (en) | Human K-ras (K-rat sarcoma) gene mutation parting type fluorescent quantitation PCR (polymerase chain reaction) detecting reagent kit and detecting method | |
| Kolostova et al. | Next generation sequencing of glioblastoma circulating tumor cells: non-invasive solution for disease monitoring | |
| CN105671187B (en) | Group of genes for molecular typing of head and neck squamous cell carcinoma and application thereof | |
| CN106148348A (en) | One group of gastric cancer RNA molecule mark and application thereof | |
| Oezkan et al. | Rapid and highly sensitive detection of therapeutically relevant oncogenic driver mutations in EBUS-TBNA specimens from patients with lung adenocarcinoma | |
| CN109182529A (en) | Detect the specific probe and kit in EGFR gene T790M, C797S and the site L798I | |
| CN101463390B (en) | EGFR gene extron 20 mutational detecting probe, liquid phase chip and detecting method thereof | |
| CN102021228B (en) | Specific primers for tissue or whole blood EGFR gene mutation detection | |
| CN105969875B (en) | Primer for detecting PIK3CA gene mutation in microcomponent combines and its application | |
| CN105838779A (en) | Method for monitoring and controlling drug resistance of gastrointestinal stromal tumor patient to imatinib/sunitinib through ddPCR technology | |
| CN101698887A (en) | Liquid-phase chip for detecting expression level of mRNAs of genes related to therapeutic effect of anti-microtubule chemotherapeutic medicament | |
| CN101671728B (en) | Method for detecting expression quantity of carcinoembryonic antigen mRNA and special kit thereof | |
| CN105838781A (en) | Method for monitoring secondary drug resistance to imatinib (Glivec)/nilotinib through ddPCR technology | |
| CN102690881B (en) | For the polymerase chain reaction method of fast constant temperature detection in Gene Mutation | |
| CN114134231B (en) | Brain glioma gene marker based on ecDNA and application thereof | |
| CN103045746A (en) | Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection | |
| CN113637750A (en) | Auxiliary diagnosis, prognosis diagnosis or risk stratification marker for acute myeloid leukemia and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee |
Owner name: SUREXAM BIOTECHNOLOGY CO., LTD. Free format text: FORMER NAME: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. |
|
| CP01 | Change in the name or title of a patent holder |
Address after: Five city moon 510663 Guangzhou Road, Guangdong province science and technology innovation base of Guangzhou No. 80, B, C Patentee after: SUREXAM BIO-TECH Co.,Ltd. Address before: Five city moon 510663 Guangzhou Road, Guangdong province science and technology innovation base of Guangzhou No. 80, B, C Patentee before: GUANGZHOU SUREXAM BIO-TECH Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230720 Address after: 510700, 8th floor, No. 29 Helix 3 Road, Guangzhou International Biological Island, Huangpu District, Guangzhou City, Guangdong Province Patentee after: GUANGZHOU SUREXAM MEDICAL LABORATORY Co.,Ltd. Address before: Five city moon 510663 Guangzhou Road, Guangdong province science and technology innovation base of Guangzhou No. 80, B, C Patentee before: SUREXAM BIO-TECH Co.,Ltd. |