CN101445829A - Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites - Google Patents
Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites Download PDFInfo
- Publication number
- CN101445829A CN101445829A CN 200810184121 CN200810184121A CN101445829A CN 101445829 A CN101445829 A CN 101445829A CN 200810184121 CN200810184121 CN 200810184121 CN 200810184121 A CN200810184121 A CN 200810184121A CN 101445829 A CN101445829 A CN 101445829A
- Authority
- CN
- China
- Prior art keywords
- seq
- microballoon
- probe
- detection
- exon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detection probe, a liquid phase chip and a detection method thereof for EGFR gene mutation sites. The EGFR gene mutation detection liquid phase chip mainly comprises a microsphere for wrapping the probe; and a primer used for being amplified with a target sequence with 19 exons and/or 21 exons. By adopting the EGFR gene mutation detection liquid phase chip and the detection method, the gene mutation sites with higher relative frequency can be detected simultaneously, the 19 exons and the 21 exons can be detected separately, and also can be detected simultaneously, the reaction conditions during the detection are uniform, the specificity of the detected result is good, the sensitivity is high, the detection accuracy reaches above 90 percent, and the detection time is short. The detection method not only can detect the EGFR gene mutation in the tumor tissue sample, but also can detect the EGFR gene mutation in the body fluid of the patient with tumor and also can perform dynamic detection.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, the concrete detection probes that relates to the EGFR gene mutation site, liquid-phase chip and detection method thereof.
Technical background
EGF-R ELISA (epidermal growth factor receptor, EGFR) be a kind of multi-functional glycoprotein that is distributed widely on each cell membranes in tissue of human body, have tyrosine kinase activity, be one of four members of ErbB family, therefore have another name called HER1 or ErbB1.EGFR is activated the back by part and starts the intracellular signal conduction, through the cascade reaction of adaptin, enzyme in the tenuigenin, regulates transcribing of transcription factor activated gene, instructs cell migration, sticks, propagation, differentiation and apoptosis.Studies show that, in many noumenal tumours, have high expression level or the unconventionality expression of EGFR, for being the oncotherapy of target with EGFR and providing theoretical basis and experimental basis at the signal transduction therapeutic intervention of EGFR signal transduction pathway.Therefore, serve as that the molecular targeted treatment for the treatment of target becomes the focus that domestic and international tumour circle is paid close attention to EGF-R ELISA (EGFR).Wherein, EGFR receptor tyrosine kinase inhibitors Gefitinib (Genfitinib, Irressa) and Tarceva (Erlotinib, Te Luokai Tarceva) are used for the treatment of nonsmall-cell lung cancer in late period (NSCLC) by U.S. food Drug Administration approval.China has also ratified Gefitinib in February, 2005 and has entered clinical.These medicines are used for the treatment of other tumours (as mammary cancer, colorectal carcinoma and cancer of the stomach etc.), have also entered clinical experimental stage at present.
Gefitinib, Tarceva is a kind of oral small molecules EGFR antagonist, thereby the ATP binding pocket that can combine EGFR Tyrosylprotein kinase district with the ATP competition suppresses the activity of EGFR, being applied to late period and the clinical treatment that is not suitable for the nonsmall-cell lung cancer patient of traditional chemotherapy regimen, is at present for the most effective medicine of part NSCLC patient treatment.Yet the patient is relevant with individual genetic background to the reactivity of this molecular targeted agents.In June, 2004, the report that takes the lead in such as the researchist Lynch of U.S. Harvard Medical School etc. and Paez, the sudden change of EGFR Tyrosylprotein kinase coding region gene is the prerequisite condition that target therapeutic agent proves effective in the lung carcinoma cell.Result of study shows, to EGFR tyrosine kinase gene coding region mutant tumour, and Gefitinib efficient up to more than 80%, and invalid substantially to the wild-type tumour said medicine of not having sudden change.Be subjected to various countries scholars' great attention after this current research result delivers, and in not enough year, confirmed (Pao W etc., 2004 by the U.S., Japan, Korea S and China (comprising Taiwan) scholar's institute in succession; Han SW etc., 2005; Mitsudomi T etc., 2005; Huang SF etc., 2004; Mu XL etc., 2005).Therefore, carrying out Gefitinib, before strategic point sieve replaces the Buddhist nun to wait pharmacological agent, detect the patient and whether have the functional sudden change of relevant EGFR, accurately the validity of predictive molecule targeted drug treatment is convenient to clinical accurate medication, significantly improve curative effect of medication, patient is benefited to greatest extent, and the patient medical expense that can avoid non-rational use of drug to cause simultaneously increases and the waste of social medical resource, reduces the timeliness loss and the financial loss of unnecessary treatment.
At present, the examination criteria of EGFR (Tyrosylprotein kinase district) transgenation is the direct order-checking of tissue DNA sample.This method is by reports that takes the lead in such as Lynch etc. and Pacz, and advantage is definitely to understand the scope and the type of EGFR transgenation, and the relation of transgenation and Gefitinib clinical efficacy has obtained sure.Yet also there are many obstacles in gene sequencing as routine clinical diagnostic method, remains to be got rid of.At first, the detection difficult of microcomponent's sample.Tissue DNA carries out gene sequencing behind pcr amplification, the DNA requirement is at least more than 100ng.The sample that detects the EGFR transgenation is at present mainly taken from the tissue samples of postoperative, yet 70%-80% cancer patients has been difficult to carry out the radical surgery excision when making a definite diagnosis, and can't obtain tissue sample and carry out EGFR transgenation mensuration.The unique approach that can obtain to organize of patients with advanced cancer is aspiration biopsy.But the sample of tumour aspiration biopsy tissue is very little.Usually only contain tens thousand of cells.Thereby the EGFR gene test of microcomponent's sample is quite difficult.The domestic report that does not also have success of the EGFR gene test of this class sample.Secondly, tumour aspiration biopsy operation only is suitable for the part patient, and the difficulty of collection of specimens is bigger.The late tumor many places are in the hemorrhage high-risk status that breaks, and there is certain medical-risk in aspiration biopsy as a kind of damaging operation.And quite a few patient is owing to the residing special region of anatomy of focus (as brain transfer, the contiguous heart of focus and great vessels etc.) is not suitable for carrying out this operation.Cause to provide tumor tissues to carry out gene diagnosis.At last, this method is to the requirement height of technology, interpretation time and effort consuming as a result.Though gene sequencing is the most intuitive and accurate detection method, the scope and the type thereof of the sudden change of can clarifying a diagnosis.But its sense cycle is long, sends report from receiving sample to be checked to finishing smoothly to detect, and needs successive 15-21 hours.As to detect normal working hours, reality needs just can send test results report 3 working dayss at least, therefore, is difficult to satisfy and instructs the ageing requirement of clinical application.Simultaneously, because the sudden change more than 95% belongs to heterozygosity sudden change (promptly having wild-type and mutant amplified production simultaneously), accurately diagnosis mutation type difficulty is bigger, the gene mutation spectrum more complicated of exons 19 especially, and many samples need be by determining its mutation type after the gene clone.Thereby this method only is fit to the superior laboratory of minority technical equipment and carries out, and domestic existing research all relies on key university and scientific research institution (as the Chinese Academy of Sciences and the medical university that coordinates) to finish, and hospitals at different levels seldom can independently carry out this diagnosis.
Therefore, the detection of EGFR transgenation will become a routine clinical diagnostic techniques, press for and solve two key issues: 1. need to seek suitable tumor tissues equivalent material (surrogate source), can make patients with advanced cancer needn't from tumor tissues, obtain material and also can advance the EGFR gene diagnosis.2. be necessary to develop the detection new technology that specificity is good, susceptibility is high, simple and easy to do, hospitals at different levels all had ready conditions carry out this gene diagnosis project.
Therefore, set up a kind ofly sample conveniently, patient's misery is little, specificity good, highly sensitive, accurately quick, simple and easy to do and EGFR transgenation diagnostic method that need not tissue sample is that NSCLC patient uses EGFR TKIs treatment and needs the major issue that solves.
Have a large amount of free nucleic acid (DNA or RNA) in the body fluid of tumour patient (blood plasma, serum or hydrothorax etc.), its content is about more than 10 times of healthy people.The free nucleic acid of this class is mainly from the cancer cell-apoptosis necrosis, and its hereditary property is identical with oncogene group DNA.Thereby free serum nucleic acid can be used for the oncogene mutation detection.But free nucleic acid may only have mutator gene very in a small amount, and contain a large amount of wild type genes, the a large amount of wild type genes of miscellaneous can hinder detecting of mutator gene, therefore need a kind of hypersensitivity and specific mutant detection method to assess the EGFR transgenation.
According to present bibliographical information, the occurrence frequency of the transgenation that EGFR is relevant with curative effect of medication is about 30%-50% in the Asia, mainly concentrate on the base deletion sudden change (△ E746-750A comprises two kinds of common types, sees the following form) of 19 exons and the point mutation (L858R) of 21 exons.In China, the point mutation that the base deletion of 19 exons sudden change accounts for 54.5%, 21 exon of sudden change sum accounts for 40.3%, and the sudden change of other exons only accounts for 5.2%.For this reason, the present invention selects 19 the highest exons of mutation rate and 21 exons to detect.
Summary of the invention
One of purpose of the present invention is to be provided for the probe sequence of EGFR detection in Gene Mutation.
The technical scheme that realizes above-mentioned purpose is as follows:
The probe that is used for the EGFR detection in Gene Mutation: include
Be selected from SEQ ID NO.1～SEQ ID NO.3 any, at the wild-type probe of Exon19 exon, and be selected from SEQ ID NO.4～SEQ ID NO.6 any, at del E746-A750 (1) the mutant probe of Exon19 exon, and/or be selected from SEQ ID NO.29～SEQ ID NO.31 any, at mutant del E746-A750 (2) probe of Exon19 exon; And/or
Be selected from SEQ ID NO.7～SEQ ID NO.9 any at the wild-type probe of Exon21 exon and be selected from any mutant probe of SEQ ID NO.10～SEQ ID NO.12 at the Exon21 exon.
Another object of the present invention provides the liquid-phase chip of EGFR detection in Gene Mutation.This liquid-phase chip can be used for detecting the relevant sudden change on EGFR gene 19 and 21 exons, thereby can be used for predicting Gefitinib, and sieve in distress waits the pharmacological agent curative effect for Buddhist nun.
The technical scheme that realizes above-mentioned purpose is as follows:
A kind of liquid-phase chip of EGFR detection in Gene Mutation, mainly include: be coated with base sequence be selected from SEQ IDNO.1～SEQ ID NO.3 any, microballoon at the amido modified probe of Exon19 exon wild-type, and be coated with base sequence be selected from SEQ ID NO.4～SEQ ID NO.6 any, at the microballoon of the amido modified probe of Exon19 exon delE746-A750 (1) mutant, and/or be coated with base sequence be selected from SEQ ID NO.29～SEQ ID NO.31 any, microballoon at the amido modified probe of Exon19 exon del E746-A750 (2) mutant; And/or
Be coated with base sequence and be selected from any microballoon of SEQ ID NO.7～SEQ ID NO.9 at the amido modified probe of Exon21 exon wild-type, with be coated with base sequence and be selected from any microballoon of SEQ ID NO.10～SEQ ID NO.12 at the amido modified probe of Exon21 exons mutation type, be connected with spacerarm between the base sequence of above-mentioned every kind of probe and the amino, above-mentioned every kind of microballoon has the different colours coding;
And the primer that is used to amplify the target sequence with 19 exons and/or 21 exons mutation sites, and the end of this target sequence has biotin labeling.
The above spacerarm is to be used for specific probe and microsphere surface is spaced apart or specific probe is placed the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between probe sequence and amino, can reduce sterically hinderedly, improve the efficient of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n 〉=3) are as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-30 T, more preferably 10 T.
Composition SEQ ID NO. with amido modified probe of spacerarm
5’NH2-TTTTTTTTTTcaaggaattaagagaagcaacat3’ 1
5’NH2-TTTTTTTTTTaa
ggaattaagagaagcaac3’ 2
5’NH2-TTTTTTTTTTgttgcttctcttaattcctt3’ 3
5’NH2-TTTTTTTTTTgtcgctatcaaaacatctccg3’ 4
5’NH2-TTTTTTTTTTtcgctatc
aaaacatctccg3’ 5
5’NH2-TTTTTTTTTTcggagatgttttgatagcga3’ 6
5’NH2-TTTTTTTTTTagattttgggcTggccaaact3’ 7
5’NH2-TTTTTTTTTTgattttgggcTggccaaact3’ 8
5’NH2-TTTTTTTTTTagtttggccAgcccaaaatc3’ 9
5’NH2-TTTTTTTTTTtttgggcGggccaaactctg3’ 10
5’NH2-TTTTTTTTTTgattttgggcGggccaaact3’ 11
5’NH2-TTTTTTTTTTagtttggccCgcccaaaatc3’ 12
5’NH2-TTTTTTTTTT ccgtcgctatcaagacatctc3’ 29
5’NH2-TTTTTTTTTT cgtcgctatcaagacatct3’ 30
5’NH2-TTTTTTTTTT gagatgtcttgatagcgacgg3’ 31。
Preferably, the primer that is used to amplify the target sequence with 19 exons mutation sites includes SEQ ID NO.13～SEQ ID NO.15 primer sequence, has at least one to have terminal biotin labeling in the described primer; And/or be used to amplify the SEQ ID NO.16～SEQ ID NO.18 primer of target sequence with 21 exons mutation sites, have at least one to have terminal biotin labeling in the described primer.
Another object of the present invention also is to provide a kind of detection method of EGFR transgenation, this method is quick, accurate, easy and simple to handle, a plurality of mutational sites of parallel detection simultaneously, and sample to be tested can be a tissue samples, can also be serum, blood plasma or hydrothorax.
A kind of detection method of using the liquid-phase chip EGFR transgenation of above-mentioned EGFR detection in Gene Mutation may further comprise the steps:
(1) behind the DNA in the extraction sample to be detected, carries out first round pcr amplification with the primer that is used to amplify target sequence with 19 exons and/or 21 exons mutation sites;
(2) enzyme is cut enrichment first round pcr amplification product;
(3) cutting product with enzyme is that template is carried out second and taken turns pcr amplification;
(4) second take turns pcr amplification product and the above-mentioned microballoon that is coated with probe sequence is hybridized;
(5) add Streptavidin-phycoerythrin behind the hybridization and react, then by Luminex instrument detecting signal.
Preferably, carry out primer that first round pcr amplification uses to being: SEQ ID NO.13, SEQ ID NO.14 and/or SEQID NO.16, SEQ ID NO.17.
Carrying out second, to take turns the primer that pcr amplification uses right: SEQ ID NO.13, SEQ ID NO.15 and/or SEQ ID NO.18, SEQ ID NO.17.
Preferably, the temperature of hybridization is 55-60 ℃.
Preferably, every kind of preparation method who is coated with the microballoon of probe comprises that step is as follows:
(1) get the microballoon mother liquor, vortex fully is mixed into the microballoon suspension;
(2) take out 8 μ l microballoon mother liquors, contain 0.8 * 10 altogether
5-1.2 * 10
5Individual microballoon is to the 0.5ml centrifuge tube;
The centrifugal 10min of (3) 15,000rpm, careful abandoning supernatant;
(4) add 10 μ l coupling liquid (pH4.5), vortex makes it abundant mixing;
(5) add 2pmol/ μ l probe working fluid 2 μ l;
(6) the EDC working fluid of adding 2.5 μ l 10mg/ml is hatched 30min for 25 ℃; Repeat this step once;
(7) add the 0.2ml washings, vortex makes it abundant mixing, and 12, the centrifugal 5min of 000g, careful abandoning supernatant; Repeat this step once;
(8) add 500 μ lTE solution, vortex makes it abundant mixing;
The centrifugal 5min of (9) 12,000g, careful abandoning supernatant;
(10) add 17 μ lTE solution, vortex makes it abundant mixing, and microballoon concentration should be about 5 * 10
3Individual/μ l;
(11) get 2 μ l, 50 times of dilute with waters, counting is stored in 2-8 ℃.
Major advantage of the present invention is:
(1) adopts EGFR gene mutation detection liquid-phase chip provided by the invention, can detect the higher site of EGFR transgenation relative frequency simultaneously, can each detects separately to 19 exons and 21 exons, also can both detect simultaneously, reaction conditions homogeneous during detection, the detected result specificity is good, and is highly sensitive, and accuracy in detection reaches more than 90%.
(2) detection method step of the present invention is simple, thereby has avoided many uncertain factors of existing in the complex operations process, thereby can improve the detection accuracy rate greatly.
(3) the needed time of detection method provided by the present invention meets clinical needs especially well below sequencing technologies commonly used.
(4) the present invention's method of adopting enzyme to cut enrichment is carried out the pcr amplification of target sequence and then is used for detecting, and has avoided a large amount of wild-type sequences in the product to interference that detected result caused.
(5) detection method provided by the present invention can not only detect the EGFR transgenation in the tumor tissues sample, also can detect simultaneously the EGFR transgenation in the tumour patient body fluid, thereby has that sampling is convenient, painful little, a advantage that can dynamic monitoring of patient.
Embodiment
With the carrier of polystyrene microsphere, as detection platform, nucleic acid molecule is carried out high-throughout many indexs parallel detection with fluorescence detector as reaction.In the manufacturing processed of microballoon, mix the ruddiness and the infrared light staining agent of different ratios, thereby form the microballoon of 100 kinds of different colours codings of as many as.Different microballoon covalent attachment at the nucleic acid molecule of difference thing to be detected as probe molecule, reporter molecules is with biotin labeling, and uses high-sensitive fluorescent dyeing.These microballoons and determinand, reporter molecules, fluorescent marker just form complete microballoon detection architecture and are used for reading of Luminex system.Excitated red respectively laser of Luminex reading system and green laser are used for the detection of microsphere system, and wherein red laser detects the red classification of microsphere surface intensity of fluorescence, and according to different color in the microballoon and number class, thereby determine the type of reaction; Green laser detects the fluorescence intensity of fluorescent marker in the sample, detects microballoon kind, quantity by machine and computer automatic statistical analysis laser again, thereby judges sample to be tested plurality of target tester concentration separately.
Solution formula:
Coupling liquid (pH4.5): 0.1mol/L MES (Sigma M-2933)
Washings: 0.2ml/LTween-20 (Sigma P-9416), 1g/L SDS (SigmaL-4390)
TE (pH8.0) (storage liquid): 10mmol/L Tris (Sigma337501), 1mmol/L EDTA (Sigma E-5134) 2 * Tm hybridization buffer
| Reagent | The source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | SigmaT3038 | 0.2M | 50ml |
| 5MNaCl | Sigma S5150 | 0.4M | 20ml |
| Triton X-100 | Sigma T8787 | 0.16％ | 0.4ml |
Be stored in 4 ℃ after the filtration
1 * Tm hybridization buffer
| Reagent | The source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | SigmaT3038 | 0.1M | 25ml |
| 5MNaCl | Sigma S5150 | 0.2M | 10ml |
| Triton X-100 | Sigma T8787 | 0.08％ | 0.2ml |
Be stored in 4 ℃ after the filtration.
Embodiment 1
The preparation of the liquid-phase chip of EGFR detection in Gene Mutation
One, probe sequence design and microballoon bag quilt
Wild-type and mutant sequence at EGFR gene 19,21 exons design special oligonucleotide probe.5 ' end of probe is an amino group, then is the spacerarm of 10 T.Probe is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Probe is coupled at (bag is by process) with the microballoon (available from Luminex company) of different colours coding by covalent attachment respectively.Probe sequence is as shown in the table:
The concrete steps of every kind of microballoon bag quilt are as follows:
(1) with probe dry powder 10, the centrifugal 1min of 000rpm;
(2) use ddH
2O is dissolved to 0.1mM (0.1nmol/ μ l, about 70 μ l);
(3) centrifugal in short-term solution is gathered managed the end;
(4) be packed as 10 μ l and 2 μ l, be stored in-20 ℃;
(5) get the microballoon mother liquor, vortex fully is mixed into the microballoon suspension;
(6) take out 1 * 10 respectively
5Microballoon (totally 8 μ l mother liquors) is to the 0.5ml centrifuge tube;
The centrifugal 10min of (7) 15,000rpm, careful abandoning supernatant;
(8) add 10 μ l coupling liquid (pH4.5), vortex makes it abundant mixing;
(9) get 2 μ l probe mother liquors, be diluted to 2pmol/ μ l with coupling liquid (pH4.5);
(10) in the centrifuge tube that microballoon is housed, add corresponding 2pmol/ μ l probe working fluid 2 μ l;
(11) use ddH
2O prepares EDC working fluid (10mg/ml);
(12) each reaction tubes respectively adds 2.5 μ l EDC working fluids, and remaining EDC working fluid is abandoned;
Hatch 30min for (13) 25 ℃;
(14) each reaction tubes respectively adds 2.5 μ l EDC working fluids again;
Hatch 30min for (15) 25 ℃;
(16) add the 0.2ml washings, vortex makes it abundant mixing;
The centrifugal 5min of (17) 12,000g, careful abandoning supernatant;
(18) repeating step (16), (17) are once;
(19) add 500 μ lTE solution (pH8.0), vortex makes it abundant mixing;
The centrifugal 5min of (20) 12,000g, careful abandoning supernatant;
(21) add 17 μ l TE solution (pH8.0), vortex makes it abundant mixing.(microballoon concentration should be about 5 * 10
3Individual/μ l);
(22) get 2 μ l, 50 times of dilute with waters, counting;
(23) be stored in 2-8 ℃.
Two, the microballoon bag is by the detection of effect
19 exons and 21 exons are provided with 6 groups of experiments respectively.With 19 exons is example, and the microballoon bag is contained wild-type probe bag quilt in the effect detection first group reaction system microballoon is E19w-P+E19w-b with wrapping the biotin labeled reverse complementary sequence of being used by effect detection accordingly; The microballoon that contains wild-type probe bag quilt in the second group reaction system, the microballoon of mutant probe bag quilt and the reverse complementary sequence of biotin labeled wild-type probe are E19w-P+E19m-P+E19w-b; Containing the microballoon of mutant probe bag quilt and the reverse complementary sequence of biotin labeled wild-type probe in the 3rd group reaction system is E19w-P+E19m-b; Containing the microballoon of mutant probe bag quilt and the reverse complementary sequence of biotin labeled mutant probe in the 4th group reaction system is E19m-P+E19m-b; The microballoon that contains mutant probe bag quilt in the 5th group reaction system, the microballoon of wild-type probe bag quilt and the reverse complementary sequence of biotin labeled mutant probe are E19w-P+E19m-P+E19m-b; Containing the microballoon of mutant probe bag quilt and the reverse complementary sequence of biotin labeled wild-type probe in the 6th group reaction system is E19m-P+E19w-b.The microballoon bag of 21 exons is by effect detection experimental design 19 exons together.The concrete operations flow process is as follows:
(1), makes the abundant mixing of microballoon with microballoon pipe vortex;
(2) with 1.5 * Tm hybridization solution microballoon is diluted to 75/μ l (every reaction needs microballoon working fluid 33 μ l);
(3) microballoon working fluid vortex is made it abundant mixing;
(4) every hole adds 33 μ l microballoon working fluids;
(5) with TE (pH8.0) will wrap the biotin labeled probe reverse complementary sequence used by effect detection (be E19w-b, E19m-b, E21w-b E21m-b) is diluted to 25fmol/17 μ l;
(6) the background hole adds 17 μ l TE (pH8.0);
(7) other every holes add respectively the biotin labeled probe reverse complementary sequence that 17 μ l bag used by effect detection (be E19w-b, E19m-b, E21w-b, E21m-b) working fluid (being dissolved in TE solution);
(8) mixing gently;
(9) covering Sptting plate (pipe lid) avoids evaporating;
(10) PCR instrument program is set: 95 ℃ of 3min; 15min is hatched in 60 ℃ of hybridization;
(11) with 1 * Tm hybridization solution preparation SA-PE to 10ug/ml;
(12) every hole adds 25 μ l SA-PE, mixings gently;
5min is hatched in (13) 60 ℃ of hybridization;
(14) the Luminex instrument is set to hybridization temperature, reading.
The microballoon bag is as follows by the effect detection result
| 19 exons | MFI | 21 exons | MFI |
| E19w-P+E19w-b | 3777 | E21w-P+E21w-b | 3368 |
| E19w-P+E19m-P+E19w-b | 2860 | E21w-P+E21m-P+E21w-b | 4674.5 |
| E19w-P+E19m-b | 5 | E21w-P+E21m-b | 92 |
| E19m-P+E19m-b | 6866.5 | E21m-P+E21m-b | 5657 |
| E19w-P+E19m-P+E19m-b | 5011 | E21w-P+E21m-P+E21m-b | 5932 |
| E19m-P+E19w-b | 0 | E21m-P+E21w-b | 425 |
Experimental result shows, the 19 exon wild-type probe that the present invention is designed, and 19 exons mutation type probes, 21 exon wild-type probe, 21 exons mutation type probes all can be discerned corresponding complementary sequence well, and the fluorescent value after the hybridization is all more than 2500.Simultaneously, there is not cross reaction between 19 exon wild-type probe and the 19 exons mutation type probes; Have the part cross reaction between 21 exon wild-type probe and the 21 exons mutation type probes, but cross reacting rate does not influence detected result basically in 10%.
Primer design and mark
Gene order at EGFR gene 19 and 21 exons, design following primer respectively:
| The primer title | SEQIDNO | Primer sequence (5 ' → 3 ', bp) | Size (bp) |
| Exon19-S1 | 13 | F：ATCCCAGAAGGTGAGAAAGATAAAATTC | Sudden change: 123 is wild: 138 |
| Exon19-As1 | 14 | R：CCTGAGGTTCAGAGCCATGGA | |
| Exon19-S1 | 13 | F：ATCCCAGAAGGTGAGAAAGATAAAATTC | Sudden change: 100 is wild: 115 |
| Exon19-As2 | 15 | R：ACCCCCACAGCAAAGCAG | |
| Exon21-S1 | 16 | F：CAGCCAGGAACGTACTGGTGA | Be 157 |
| Exon21-As1 | 17 | R：TCCCTGGTGTCAGGAAAATGCT | |
| Exon21-S2 | 18 | F：CGCAGCATGTCAAGATCACAGAT | Be 130 |
| Exon21-As1 | 17 | R：TCCCTGGTGTCAGGAAAATGCT |
Primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized.Wherein, Exon19-S1 and Exon19-As1 are used for the first round pcr amplification of 19 exons, and biotin labeling Exon19-S1 and Exon19-As2 are used for second of 19 exons and take turns pcr amplification; Exon21-S1 and Exon21-As1 are used for the first round pcr amplification of 21 exons, and Exon21-As1 and biotin labeled Exon21-S2 are used for second of 21 exons and take turns pcr amplification.
The liquid-phase chip of the EGFR detection in Gene Mutation for preparing includes:
Be coated with SEQ ID NO.3's, microballoon at the amido modified probe of wild-type of Exon19 exon, be coated with SEQID NO.6's, microballoon at the amido modified probe of del E746-A750 (1) mutant of Exon19 exon, be coated with SEQID NO.31's, microballoon at the amido modified probe of del E746-A750 (2) mutant of Exon19 exon, be coated with microballoon at the amido modified probe of wild-type of Exon21 exon in SEQ ID NO.9, with the microballoon at the amido modified probe of mutant of Exon21 exon that is coated with SEQ ID NO.12, above-mentioned every kind of microballoon has the different colours coding; And
The primer sequence of SEQ ID NO.13-15 and SEQ ID NO.16-18, wherein 5 ' of SEQ ID NO.13 and SEQ IDNO.18 base sequence end adds biotin labeling respectively.
Embodiment 2
The liquid-phase chip of the EGFR detection in Gene Mutation among the utilization embodiment 1 is to the detection of nonsmall-cell lung cancer serum sample
One, the preparation of sample to be tested (extraction of the free nucleic acid of blood plasma, serum and hydrothorax supernatant):
Extract the test kit explanation in a small amount with reference to AxyPrep whole blood genome, detailed step is as follows:
(1) get the about 2.5ml of patient's anti-freezing venous blood or hydrothorax, centrifugal 15 minutes of 3000rpm gets 300 μ l supernatants and is added in the clean aseptic centrifuge tube of a 1.5ml;
(2) in centrifuge tube, add 500 μ l AP1 damping fluids, the vortex abundant mixing that vibrates;
(3) add 100 μ l AP2 damping fluids, the vortex abundant mixing that vibrates;
(4) under the room temperature 12, centrifugal 10 minutes of 000rpm;
(5) carefully draw supernatant and add among the adsorption column AxyPrep that is placed on the 2ml collection tube, cover lid, with 6, centrifugal 1 minute of 000rpm;
(6) outwell waste liquid in the waste collection pipe, with 800 μ l damping fluid W1 washing 1 time, with 6, centrifugal 1 minute of 000rpm;
(7) outwell waste liquid in the waste collection pipe, add 800 μ l damping fluid W2, with 12, centrifugal 1 minute of 000rpm; Outwell the waste liquid in the waste collection pipe, add 500 μ l damping fluid W2, with 12, centrifugal 1 minute of 000rpm discards waste liquid;
(8) adsorption column AxyPrep is put back in the sky collection tube, 12, centrifugal 1 minute of 000rpm;
(9) adsorption column AxyPrep is placed a clean aseptic 1.5ml centrifuge tube, add 40 μ l TE damping fluids, placed 1 minute under the room temperature, 12, centrifugal 1 minute eluted dna of 000rpm, electrophoresis detection ,-20 ℃ of preservations.
Two, the pcr amplification of testing sample and enzyme are cut enrichment:
(1) pcr amplification of sample DNA and enzyme are cut enrichment
It is as follows that the enzyme of exons 19 mutants is cut the enrichment pcr amplification:
1. first round pcr amplification
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
Pre-95 ℃ of 5min 1 of sex change
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend 72 ℃ of 10min 1 at last
2.PCR product Mse I enzyme is cut:
Reaction system is as follows:
10×Mse I Buffer 1μl
PCR product 3 μ l
100×BSA 0.1μl
Mse I 0.5μl(50U/μl)
Add sterilization distilled water to 10 μ l
37 ℃ of incubations 2 hours, 65 ℃ of 20 minutes inactivators.
3. second take turns pcr amplification
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
Pre-95 ℃ of 5min 1 of sex change
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend 72 ℃ of 10min 1 at last
It is as follows that the enzyme of exon 21 mutant is cut the enrichment pcr amplification:
1. first round pcr amplification
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
Pre-95 ℃ of 5min 1 of sex change
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend 72 ℃ of 10min 1 at last
2.PCR product Msc I enzyme is cut:
Reaction system is as follows:
10×Msc I Buffer 1μl
PCR product 3 μ l
Msc I 0.5μl(10U/μl)
Add no enzyme water to 10 μ l
37 ℃ of incubations 2 hours, 65 ℃ of 20 minutes inactivators.
3. second take turns pcr amplification
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
Pre-95 ℃ of 5min 1 of sex change
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend 72 ℃ of 10min 1 at last
Perhaps carry out the synchronous amplification (multiplex PCR amplification) of EGFR gene 19,21 exons mutation types and wild-type sequence
1.19 exon, 21 exon first round pcr amplifications and enzyme are cut same as described above, and different is second takes turns the method that pcr amplification is taked synchronous amplification.
2. second take turns pcr amplification (19,21 exon wild-type sequences and mutant sequence increase simultaneously)
The PCR reaction system:
The PCR reaction conditions:
Step temperature-time cycle index
Pre-95 ℃ of 5min 1 of sex change
95 ℃ of 30sec of sex change
60 ℃ of 30sec 30 of renaturation
Extend 72 ℃ of 45sec
Extend 72 ℃ of 10min 1 at last
Three, hybridization and last machine testing
(1) will be coated with 19 exon wild-type probe (E19w-P), 19 exon del E746-A750 (1) mutant probes (E19m-P), 19 exon del E746-A750 (2) mutant probes (E19m-P11), 21 exon wild-type probe (E21w-P), 21 exons mutation type probes (E21m-P), the microballoon of negative control probe (N-P) is vortex 30s respectively, supersound process 30s;
(2) contain the mixing microballoon working fluid that is coated with probe with 1.5 * Tm hybridization solution preparation, make that every kind of microballoon concentration is 75/μ l in the solution;
(3) will mix microballoon working fluid vortex 30s, supersound process 30s;
(4) every hole adds 33 corresponding μ l mixing microballoon working fluids, makes and finally contains each about 2500 of every kind of microballoons in the reaction system;
(5) the background hole adds 17 μ l TE (pH8.0); Other every holes add second of 19 exons of each sample and 21 exons respectively and take turns each 2-17 μ l of PCR product, add TE to 17 μ l; Mixing gently; Covering Sptting plate (pipe lid) avoids evaporating;
(6) PCR instrument program is set: 95 ℃ of 5min; 15min is hatched in 60 ℃ of hybridization;
(7) with 1 * Tm hybridization solution preparation SA-PE to 2ug/ml (75 μ l/ hole);
(8) with reaction tubes (plate) 12, the centrifugal 5min of 000g, careful abandoning supernatant.Perhaps be transferred in the filter plate, suction filtration is removed liquid;
(9) every hole adds 75 μ l SA-PE (streptavidin phycoerythrin) working fluid (SA-PE that contains 150ng), mixings gently;
(10) place hybridization temperature (60 ℃), hatch 5min at once;
(11) the Luminex instrument is set to hybridization temperature, reading.
Four, detected result and data analysis
The reaction after product is by Luminex serial analysis instrument detecting, and detected result is as shown in table 1.There are not cross reaction in 19 exon wild-types and mutant (disappearance) probe, therefore with mutant fluorescent value (two kinds of mutant fluorescent value the higher person) divided by negative control fluorescent value (being M/N) 25 as positive decision content (cut-off value).As 19 exon detected result M/N〉25 the time, then judge this sample for there being the disappearance of 19 exons, otherwise judge that this sample is 19 exon wild-types.There are cross reaction (cross reacting rate is in 10%) in 21 exon wild-type probe and mutant probe, therefore, with (mutant fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value) i.e. ((M-N)/(W-N))〉2 as positive decision content (cut-off value).As 21 exon detected results ((M-N)/(W-N))〉2 the time, judge that there is the L858R point mutation of 21 exons in this sample, otherwise judge that this sample is 21 exon wild-types.
According to this criterion, 10 increments that present embodiment detected are in this, and there is the disappearance (No. 3, No. 5, No. 7 samples) of 19 exons in 3 examples, and there are the point mutation (No. 2, No. 10 samples) of 21 exons in 2 examples.Detected result and traditional polyacrylamide gel electrophoresis carry out the result that silver dyes again makes comparisons, and calculates the rate of coincideing.The detection rate of coincideing that the detection of the 19 exons rate of coincideing reaches 100%, 21 exon also reaches 90%.The whole rate of coincideing is 95%.Therefore, use EGFR gene mutation detection liquid-phase chip provided by the present invention and detection method thereof can accurately detect the deletion mutantion of EGFR gene 19 exons and the point mutation of 21 exons, accuracy rate is up to 95%, be the assessment Gefitinib, strategic point sieve is for the validity of targeted drugs such as Buddhist nun treatment, be convenient to clinical accurate medication, avoid the timeliness loss and the financial loss of unnecessary treatment that important detection means is provided.
The detected result of table 1 serum sample
| Sequence number | Negative control | E19w | E19m1 | E19m2 | E21w | E21m |
| NO. | (MFI) | (MFI) | (MFI) | (MFI) | (MFI) | (MFI) |
| 1 | 13 | 1751 | 70 | 56 | 189 | 21 |
| 2 | 14 | 1366.5 | 39.5 | 49 | 40 | 1299 |
| 3 | 9 | 1373 | 1593.5 | 29.5 | 194 | 23 |
| 4 | 7 | 1132 | 40 | 36.5 | 69 | 75.5 |
| 5 | 4 | 236 | 53 | 1876.5 | 154.5 | 21.5 |
| 6 | 10.5 | 656 | 51.5 | 54 | 38 | 31 |
| 7 | 19 | 661.5 | 1818 | 78 | 61 | 99 |
| 8 | 4 | 83 | 91 | 38 | 71.5 | 58.5 |
| 9 | 15 | 46 | 9 | 7.5 | 35 | 38.5 |
| 10 | 11.5 | 1169 | 48.5 | 29 | 189 | 412 |
Table 2 serum sample EGFR mutation type analytical results
| Catalogue number(Cat.No.) | Mutant fluorescent value/negative control fluorescent value (M/N) | (mutagenicity fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value ((M-N)/(W-N)) | The mutation type analytical results | The detected through gel electrophoresis analytical results |
| 19 exons | 21 exons | |||
| 1 | 5.38 | 0.05 | Wild-type | Wild-type |
| 2 | 3.50 | 49.42 | 21 exon point mutation | 21 exon point mutation |
| 3 | 177.06 | 0.08 | 19 Exon deletion | 19 Exon deletion |
| 4 | 5.71 | 1.10 | Wild-type | Wild-type |
| 5 | 469.13 | 0.12 | 19 Exon deletion | 19 Exon deletion |
| 6 | 5.14 | 0.75 | Wild-type | Wild-type |
| 7 | 95.68 | 1.90 | 19 Exon deletion | 19 Exon deletion |
| 8 | 22.75 | 0.81 | Wild-type | Wild-type |
| 9 | 0.60 | 1.18 | Wild-type | Wild-type |
| 10 | 4.22 | 2.26 | 21 exon point mutation | Wild-type |
Embodiment 3
The liquid-phase chip of the EGFR detection in Gene Mutation among the utilization embodiment 1 is to the detection of cancerous lung tissue sample
The cancerous lung tissue sample of getting used patient 1-10 of the foregoing description 2 detects, and detailed process is as follows:
One, the preparation of sample to be tested
The extraction of DNA in the cancerous lung tissue sample: get the tissue sample 5-50mg of lung cancer postoperative or biopsy, after the grinding, the PBS solution washing of usefulness pH7.4 2 times; Tissue sample after the washing is resuspended in Digestive system (50mmol/L Tris, the 1mmo/LNa of 1ml
2EDTA, 0.5% Tween-20, the Proteinase K 200 of 200ug/ml, pH8.5), 55 ℃ of water-baths digested 99 ℃ of water-bath 15min inactivated proteases K 1 hour; 12000 rev/mins centrifugal 10 minutes; Get supernatant, by phenol-chloroform-primary isoamyl alcohol method extracting, ethanol precipitation obtains to be used for the DNA sample of PCR reaction.Also can extract DNA by microcentrifugation post method;
Two, the pcr amplification of testing sample and enzyme are cut enrichment:
Concrete grammar is with embodiment 2.
Three, hybridization and last machine testing:
Concrete grammar detects with embodiment 2.
Four, detected result and data analysis
The reaction after product is by Luminex serial analysis instrument detecting, shown in detected result such as the table 3, table 4.Criterion is described with embodiment 2.Experimental result shows that the analytical results of cancerous lung tissue pattern detection is consistent with the result who carries out check and analysis with serum sample, i.e. the deletion mutantion (No. 3 of existence 3 examples 19 exons in the 10 routine samples, No. 5, No. 7 samples), there is the point mutation (No. 2, No. 10 samples) of 2 examples, 21 exons.Illustrate that method of carrying out the EGFR detection in Gene Mutation with free serum nucleic acid provided by the present invention is feasible, illustrate that also method provided by the present invention is reliable and stable.
The detected result of table 3 cancerous lung tissue sample
| Sequence number NO. | Negative control (MFI) | E19w (MFI) | E19m1 (MFI) | E19m2 (MFI) | E21w (MFI) | E21m (MFI) |
| 1 | 15 | 1987 | 77 | 54 | 201 | 41 |
| 2 | 10 | 1421 | 41 | 47 | 45 | 1412 |
| 3 | 9 | 1405 | 1657.5 | 36 | 231 | 35 |
| 4 | 8 | 1387 | 39 | 25.5 | 62.5 | 84.5 |
| 5 | 6 | 321 | 65.5 | 1905.5 | 275 | 51 |
| 6 | 12 | 761.5 | 84 | 62 | 42 | 54 |
| 7 | 5 | 657 | 1854 | 81 | 55 | 76 |
| 8 | 9 | 91 | 132 | 36.5 | 81 | 73.5 |
| 9 | 13 | 41 | 17 | 11 | 56 | 51 |
| 10 | 12.5 | 1241.5 | 53.5 | 34 | 215 | 451 |
Table 4 cancerous lung tissue sample EGFR mutation type analytical results
| Catalogue number(Cat.No.) | Mutant fluorescent value/negative control fluorescent value (M/N) | (mutant fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value ((M-N)/(W-N)) | The mutation type analytical results |
| 19 exons | 21 exons | ||
| 1 | 5.13 | 0.14 | Wild-type |
| 2 | 4.70 | 40.06 | 21 exon point mutation |
| 3 | 184.17 | 0.12 | 19 Exon deletion |
| 4 | 4.88 | 1.40 | Wild-type |
| 5 | 317.58 | 0.17 | 19 Exon deletion |
| 6 | 7.00 | 1.40 | Wild-type |
| 7 | 370.80 | 1.42 | 19 Exon deletion |
| 8 | 14.67 | 0.90 | Wild-type |
| 9 | 1.31 | 0.88 | Wild-type |
| 10 | 4.28 | 2.17 | 21 exon point mutation |
Embodiment 4
One, the liquid-phase chip of preparation EGFR detection in Gene Mutation
According to the method for embodiment 1 with the probe bag by microballoon:
One, the EGFR sudden change detects other alternative probe design and microballoon bag quilt
At the wild-type and the mutant sequence of EGFR gene 19,21 exons, design two groups of oligonucleotide probes (E19w-P1, E19m-P1, E19m-P13, E21w-P1, E21m-P1 and E19w-P2, E19m-P2, E19m-P12, E21w-P2, E21m-P2).5 ' end of probe is an amino group, then is the spacerarm of 10 T.Probe is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Probe is coupled at (bag is by process) with the microballoon (available from Luminex company) of different colours coding by covalent attachment respectively, and is described with embodiment 1.Probe sequence is as shown in the table:
The liquid-phase chip of the EGFR detection in Gene Mutation of present embodiment includes:
Be coated with SEQ ID NO.2's, microballoon at the amido modified probe of wild-type of Exon19 exon, be coated with SEQID NO.5's, microballoon at the amido modified probe of mutant of Exon19 exon del E746-A750 (1), be coated with SEQ ID NO.30's, microballoon at the amido modified probe of mutant of Exon19 exon del E746-A750 (2), be coated with microballoon at the amido modified probe of wild-type of Exon21 exon in SEQ ID NO.8, with the microballoon at the amido modified probe of mutant of Exon21 exon that is coated with SEQ IDNO.11, above-mentioned every kind of microballoon has the different colours coding; And
The primer sequence of SEQ ID NO.13-15 and SEQ ID NO.16-18, wherein 5 ' of SEQ ID NO.15 and SEQ IDNO.17 base sequence end adds biotin labeling respectively.
Two, the liquid-phase chip of the EGFR detection in Gene Mutation of present embodiment is used for the detection of lung cancer serum sample
Utilization E19w-P1, E19m-P1, E19m-P13, E21w-P1, the microballoon of E21m-P1 probe bag quilt is to the detection of nonsmall-cell lung cancer serum sample.
Select 1-5 used among the embodiment 2 totally five parts of nonsmall-cell lung cancer serum samples detect.The preparation of sample to be tested, the pcr amplification and the enzyme of sample to be tested are cut enrichment, and hybridization is described with embodiment 2 with the experimental procedure of last machine testing.Experimental result is as follows:
The detected result of table 5 serum sample
| Sample | Negative control (MFI) | E19w-P1 (MFI) | E19m-P1 (MFI) | E19m-P13 (MFI) | E21w-P1 (MFI) | E21m-P1 (MFI) |
| 1 | 19 | 1695 | 85.5 | 44 | 192 | 25 |
| 2 | 14 | 1409 | 51 | 57 | 41 | 1305 |
| 3 | 13 | 1327 | 1421 | 36 | 201 | 31 |
| 4 | 10 | 1052 | 39 | 41 | 63 | 81 |
| 5 | 15 | 259 | 54 | 1881 | 167 | 23 |
Table 6 serum sample EGFR mutation type analytical results
| Sample | Mutant fluorescent value/negative control fluorescent value (M/N) | (mutagenicity fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value ((M-N)/(W-N)) | The mutation type analytical results |
| 1 | 4.50 | 0.03 | Wild-type |
| 2 | 4.07 | 47.81 | 21 exon point mutation |
| 3 | 109.31 | 0.10 | 19 Exon deletion |
| 4 | 4.10 | 1.34 | Wild-type |
| 5 | 125.40 | 0.05 | 19 Exon deletion |
Experimental result shows, probe E19w-P1, E19m-P1, E19m-P13, E21w-P1, E21m-P1 can be used for the sudden change of clinical sample EGFR is detected equally, analytical results and usefulness probe (E19w-P, E19m-P, E19m-P11, E21w-P, E21m-P) unanimity as a result of Jian Ceing.
Embodiment 5
One, the liquid-phase chip of preparation EGFR detection in Gene Mutation
The preparation method is with embodiment 1.
The liquid-phase chip of the EGFR detection in Gene Mutation of present embodiment includes:
Be coated with SEQ ID NO.1's, microballoon at the amido modified probe of wild-type of Exon19 exon, be coated with SEQID NO.4's, microballoon at the amido modified probe of mutant of Exon19del E746-A750 (1), be coated with SEQ IDNO.29's, microballoon at the amido modified probe of mutant of Exon19 exon del E746-A750 (2), be coated with microballoon at the amido modified probe of wild-type of Exon21 exon in SEQ ID NO.7, with the microballoon at the amido modified probe of mutant of Exon21 exon that is coated with SEQ ID NO.10, above-mentioned every kind of microballoon has the different colours coding; And
The primer sequence of SEQ ID NO.13-15 and SEQ ID NO.16-18, wherein 5 ' of SEQ ID NO.15 and SEQ IDNO.17 base sequence end adds biotin labeling respectively.
Two, the liquid-phase chip of the EGFR detection in Gene Mutation of present embodiment is used for the detection of lung cancer serum sample
Utilization E19w-P2, E19m-P2, E19mP12, E21w-P2, the microballoon of E21m-P2 probe bag quilt is to the detection of nonsmall-cell lung cancer serum sample
Totally five nonsmall-cell lung cancer serum samples of same selection 1-5 detects.The preparation of sample to be tested, the pcr amplification and the enzyme of sample to be tested are cut enrichment, and hybridization is described with embodiment 2 with the experimental procedure of last machine testing.Experimental result is as follows:
The detected result of table 7 serum sample
| Sample | Negative control (MFI) | E19w-P2 (MFI) | E19m-P2 (MFI) | E19m-P12 (MFI) | E21w-P2 (MFI) | E21m-P2 (MFI) |
| 1 | 11 | 1795 | 74 | 62 | 175 | 33.5 |
| 2 | 17 | 1329 | 43 | 53 | 51 | 1276 |
| 3 | 15 | 1346 | 1542 | 33 | 187 | 41 |
| 4 | 10 | 1075 | 47 | 47 | 52 | 84 |
| 5 | 15 | 241 | 59 | 1796 | 139 | 27 |
Table 8 serum sample EGFR mutation type analytical results
| Sample | Mutant fluorescent value/negative control fluorescent value (M/N) | (mutagenicity fluorescent value-negative control fluorescent value)/(wild-type fluorescent value-negative control fluorescent value ((M-N)/(W-N)) | The mutation type analytical results |
| 1 | 6.73 | 0.14 | Wild-type |
| 2 | 3.12 | 37.03 | 21 exon point mutation |
| 3 | 102.80 | 0.15 | 19 Exon deletion |
| 4 | 4.70 | 1.76 | Wild-type |
| 5 | 119.73 | 0.10 | 19 Exon deletion |
Experimental result shows, probe E19w-P2, E19m-P2, E19m-P12, E21w-P2, E21m-P2 also can be used for the sudden change of clinical sample EGFR is detected analytical results and probe (E19w-P, E19m-P, E19m-P11, E21w-P, E21m-P) unanimity as a result of Jian Ceing.
Sequence table
＜110〉Guangzhou Yishan Biotechnology Co., Ltd.
＜120〉detection probes of EGFR gene mutation site, liquid-phase chip and detection method thereof
<160>34
<170>PatentIn version 3.1
<210>1
<211>23
212>DNA
＜213〉artificial sequence
<400>1
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<400>2
<210>3
<211>20
<212>DNA
＜213〉artificial sequence
<400>3
<210>4
<211>21
<212>DNA
＜213〉artificial sequence
<400>4
<210>5
<211>20
<212>DNA
＜213〉artificial sequence
<400>5
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<400>6
<210>7
<211>21
<212>DNA
＜213〉artificial sequence
<400>7
<210>8
<211>20
<212>DNA
＜213〉artificial sequence
<400>8
<210>9
<211>20
<212>DNA
＜213〉artificial sequence
<400>9
<210>10
<211>20
<212>DNA
＜213〉artificial sequence
<400>10
<210>11
<211>20
<212>DNA
＜213〉artificial sequence
<400>11
<210>12
<211>20
<212>DNA
＜213〉artificial sequence
<400>12
<210>13
<211>28
<212>DNA
＜213〉artificial sequence
<400>13
<210>14
<211>21
<212>DNA
＜213〉artificial sequence
<400>14
<210>15
<211>18
<212>DNA
＜213〉artificial sequence
<400>15
<210>16
<211>21
<212>DNA
＜213〉artificial sequence
<400>16
<210>17
<211>22
<212>DNA
＜213〉artificial sequence
<400>17
<210>18
<211>23
<212>DNA
＜213〉artificial sequence
<400>18
<210>19
<211>23
<212>DNA
＜213〉artificial sequence
<400>19
<210>20
<211>21
<212>DNA
＜213〉artificial sequence
<400>20
<210>21
<211>21
<212>DNA
＜213〉artificial sequence
<400>21
<210>22
<211>20
<212>DNA
＜213〉artificial sequence
<400>22
<210>23
<211>20
<212>DNA
＜213〉artificial sequence
<400>23
<210>24
<211>20
<212>DNA
＜213〉artificial sequence
<400>24
<210>25
<211>20
<212>DNA
＜213〉artificial sequence
<400>25
<210>26
<211>20
<212>DNA
＜213〉artificial sequence
<400>26
<210>27
<211>20
<212>DNA
＜213〉artificial sequence
<400>27
<210>28
<211>20
<212>DNA
＜213〉artificial sequence
<400>28
<210>29
<211>21
<212>DNA
＜213〉artificial sequence
<400>29
<210>30
<211>19
<212>DNA
＜213〉artificial sequence
<400>30
<210>31
<211>21
<212>DNA
＜213〉artificial sequence
<400>31
<210>32
<211>21
<212>DNA
＜213〉artificial sequence
<400>32
<210>33
<211>21
<212>DNA
＜213〉artificial sequence
<400>33
<210>34
<211>21
<212>DNA
＜213〉artificial sequence
<400>34
Claims (10)
1. be used for the probe sequence of EGFR detection in Gene Mutation, it is characterized in that: include:
Be selected from SEQ ID NO.1～SEQ ID NO.3 any, at the wild-type probe of Exon19 exon, and be selected from SEQ ID NO.4～SEQ ID NO.6 any, at del E746-A750 (1) the mutant probe of Exon19 exon, and/or be selected from SEQ ID NO.29～SEQ ID NO.31 any, at del E746-A750 (2) the mutant probe of Exon19 exon; And/or
Be selected from SEQ ID NO.7～SEQ ID NO.9 any, at the wild-type probe of Exon21 exon and be selected from SEQ ID NO.10～SEQ ID NO.12 any, at the mutant probe of Exon21 exon.
2. be used for the liquid-phase chip of EGFR detection in Gene Mutation, it is characterized in that: mainly include:
A. be coated with the microballoon of probe: be coated with base sequence be selected from SEQ ID NO.1～SEQ ID NO.3 any, microballoon at the amido modified probe of Exon19 exon wild-type, and be coated with base sequence be selected from SEQ IDNO.4～SEQ ID NO.6 any, at the microballoon of the amido modified probe of Exon19 exon del E746-A750 (1) mutant, and/or be coated with base sequence be selected from SEQ ID NO.29～SEQ ID NO.31 any, microballoon at the amido modified probe of Exon19 exon del E746-A750 (2) mutant; And/or
Be coated with base sequence and be selected from any microballoon of SEQ ID NO.7～SEQ ID NO.9 at the amido modified probe of Exon21 exon wild-type, with be coated with base sequence and be selected from any microballoon of SEQ ID NO.10～SEQ ID NO.12 at the amido modified probe of Exon21 exons mutation type, be connected with spacerarm between the base sequence of above-mentioned every kind of probe and the amino, above-mentioned every kind of microballoon has the different colours coding; And
B. primer: be used to amplify the primer of target sequence, and the end of this target sequence has biotin labeling with 19 exons and/or 21 exons mutation sites.
3. the liquid-phase chip of EGFR detection in Gene Mutation according to claim 2, it is characterized in that, the microballoon of dressing probe is: be coated with base sequence and be SEQ ID NO.3, at the microballoon of the amido modified probe of Exon19 exon wild-type, with be coated with base sequence be SEQ ID NO.6, at the microballoon of the amido modified probe of Exon19 exons mutation type and be coated with base sequence be SEQ ID NO.31, at the microballoon of the amido modified probe of Exon19 exons mutation type; Be coated with the microballoon that base sequence is SEQ ID NO.9 at the amido modified probe of Exon21 exon wild-type, with to be coated with base sequence be SEQ ID NO.12, at the microballoon of the amido modified probe of Exon21 exons mutation type, be connected with spacerarm between the base sequence of above-mentioned every kind of probe and the amino, above-mentioned every kind of microballoon has the different colours coding.
4. the liquid-phase chip that is used for the EGFR detection in Gene Mutation according to claim 2 is characterized in that: described spacerarm is 5-30 T.
5. the liquid-phase chip that is used for the EGFR detection in Gene Mutation according to claim 4 is characterized in that: described spacerarm is 10 T.
6. according to each described liquid-phase chip that is used for the EGFR detection in Gene Mutation of claim 2-5, it is characterized in that: be used to amplify the SEQ ID NO.13～SEQ ID NO.15 primer of target sequence, have at least one to have terminal biotin labeling in the described primer with 19 exons mutation sites; And/or be used to amplify the SEQ ID NO.16～SEQ ID NO.18 primer of target sequence with 21 exons mutation sites, have at least one to have terminal biotin labeling in the described primer.
7. the detection method of an EGFR transgenation is characterized in that: use the liquid-phase chip of the described EGFR detection in Gene Mutation of claim 2, may further comprise the steps:
1) DNA in the extraction sample to be detected carries out first round pcr amplification with the primer that is used to amplify the target sequence with 19 exons and/or 21 exons mutation sites;
2) enzyme is cut enrichment first round pcr amplification product;
3) cutting product with enzyme is that template is carried out second and taken turns pcr amplification;
4) second take turns pcr amplification product and hybridize with the microballoon that is coated with probe described in the corresponding claim 2;
5) add Streptavidin-phycoerythrin behind the hybridization and react, then detection signal.
8. the detection method of EGFR transgenation according to claim 7 is characterized in that: the primer that step 1) first round pcr amplification is used is to being: SEQ ID NO.13, SEQ ID NO.14 and/or SEQ ID NO.16, SEQ ID NO.17.Step 3) second is taken turns primer that pcr amplification uses to being: SEQ ID NO.13, SEQ ID NO.15 and/or SEQ IDNO.18, SEQ ID NO.17.
9. the detection method of EGFR transgenation according to claim 7 is characterized in that: the described hybridization temperature of step 4) is 55-60 ℃.
10. the detection method of EGFR transgenation according to claim 7 is characterized in that: every kind of described preparation method who is coated with the microballoon of probe comprises that step is as follows:
(1) gets the microballoon mother liquor and fully be mixed into the microballoon suspension;
(2) take out 8 μ l microballoon mother liquors, contain 0.8 * 10 altogether
5-1.2 * 10
5Individual microballoon is to the 0.5ml centrifuge tube;
The centrifugal 10min of (3) 15,000rpm, careful abandoning supernatant;
(4) add 10 μ l coupling liquid, vortex makes it abundant mixing;
(5) add 2pmol/ μ l probe working fluid 2 μ l;
(6) the EDC working fluid of adding 2.5 μ l10mg/ml is hatched 30min for 25 ℃; Repeat this step once;
(7) add the 0.2ml washings, vortex makes it abundant mixing, and 12, the centrifugal 5min of 000g, careful abandoning supernatant; Repeat this step once;
(8) add 500 μ lTE solution, vortex makes it abundant mixing;
The centrifugal 5min of (9) 12,000g, careful abandoning supernatant;
(10) add 17 μ lTE solution, vortex makes it abundant mixing, and microballoon concentration should be about 5 * 10
3Individual/μ l;
(11) get 2 μ l, 50 times of dilute with waters, counting is stored in 2-8 ℃.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810184121 CN101445829B (en) | 2008-04-23 | 2008-12-08 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
| PCT/CN2009/000429 WO2009129693A1 (en) | 2008-04-23 | 2009-04-22 | Probes, liquidchip-based products, and methods for detection of egfr gene mutation |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810027613.9 | 2008-04-23 | ||
| CN200810027613 | 2008-04-23 | ||
| CN 200810184121 CN101445829B (en) | 2008-04-23 | 2008-12-08 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101445829A true CN101445829A (en) | 2009-06-03 |
| CN101445829B CN101445829B (en) | 2013-06-05 |
Family
ID=40741704
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200810184121 Active CN101445829B (en) | 2008-04-23 | 2008-12-08 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN101445829B (en) |
| WO (1) | WO2009129693A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009129693A1 (en) * | 2008-04-23 | 2009-10-29 | 广州益善生物技术有限公司 | Probes, liquidchip-based products, and methods for detection of egfr gene mutation |
| CN102181537A (en) * | 2011-03-22 | 2011-09-14 | 宁波基内生物技术有限公司 | Primer composite, kit and method for detecting mutation of exon 21 of human EGFR (Epidermal Growth Factor Receptor) gene |
| WO2011131145A1 (en) * | 2010-04-23 | 2011-10-27 | 广州益善生物技术有限公司 | Liquid chip for detecting egfr gene mutations |
| CN103045746A (en) * | 2012-12-31 | 2013-04-17 | 上海市胸科医院 | Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113373205A (en) * | 2021-08-03 | 2021-09-10 | 远辰生物科技(苏州)有限公司 | Method for quantitatively detecting site mutation of 19del and L858R of EGFR gene by using digital PCR |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774931B (en) * | 2004-03-31 | 2017-11-10 | 综合医院公司 | Determine method of the cancer to EGF-R ELISA magnetic target therapy reactivity |
| WO2006070667A1 (en) * | 2004-12-28 | 2006-07-06 | Takara Bio Inc. | Method of detecting mutation in egfr gene and detection kit |
| CN1710102A (en) * | 2005-06-20 | 2005-12-21 | 上海市肺科医院 | PCR detecting method of tumour associated gene mutation and reagent system |
| CN1749417A (en) * | 2005-07-27 | 2006-03-22 | 上海奇诺肿瘤生物高新技术有限公司 | Real time quantitative PCR detecting reagent kit and method for epidermal growth factor receptor exon 19 deletion mutation |
| CN101092644B (en) * | 2006-06-21 | 2010-07-14 | 上海基康生物技术有限公司 | Quick detecting gene mutation correlative to curative effect of non small-cell carcinoma of the lung |
| CN101445829B (en) * | 2008-04-23 | 2013-06-05 | 广州益善生物技术有限公司 | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites |
-
2008
- 2008-12-08 CN CN 200810184121 patent/CN101445829B/en active Active
-
2009
- 2009-04-22 WO PCT/CN2009/000429 patent/WO2009129693A1/en active Application Filing
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009129693A1 (en) * | 2008-04-23 | 2009-10-29 | 广州益善生物技术有限公司 | Probes, liquidchip-based products, and methods for detection of egfr gene mutation |
| WO2011131145A1 (en) * | 2010-04-23 | 2011-10-27 | 广州益善生物技术有限公司 | Liquid chip for detecting egfr gene mutations |
| CN102234683A (en) * | 2010-04-23 | 2011-11-09 | 广州益善生物技术有限公司 | Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation |
| CN102234683B (en) * | 2010-04-23 | 2013-07-17 | 广州益善生物技术有限公司 | Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation |
| CN102181537A (en) * | 2011-03-22 | 2011-09-14 | 宁波基内生物技术有限公司 | Primer composite, kit and method for detecting mutation of exon 21 of human EGFR (Epidermal Growth Factor Receptor) gene |
| CN103045746A (en) * | 2012-12-31 | 2013-04-17 | 上海市胸科医院 | Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2009129693A1 (en) | 2009-10-29 |
| CN101445829B (en) | 2013-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101381779B (en) | Detection probe of kRas gene mutation, liquid phase chip and detection method thereof | |
| CN104745679A (en) | Method and kit for non-invasive detection of EGFR (epidermal growth factor receptor) gene mutation | |
| CN107849606A (en) | The method for improving sequencing sensitivity of future generation | |
| CN108315416A (en) | Primer, kit and the method for lung cancer gene mutation site are determined based on high throughput sequencing technologies | |
| CN104561250A (en) | Method and primer for detecting imatinib targeted medication gene | |
| CN101781684A (en) | Liquid phase chip for CYP19A1 gene SNP (Single Nucleotide Polymorphism) detection and detection method thereof | |
| CN108949990A (en) | A kind of kit and method detecting EGFR genetic mutation | |
| CN105779434A (en) | Kit and applications thereof | |
| CN101445829B (en) | Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites | |
| CN102747158A (en) | Human K-ras (K-rat sarcoma) gene mutation parting type fluorescent quantitation PCR (polymerase chain reaction) detecting reagent kit and detecting method | |
| CN102399772A (en) | Preparation method for probes related to breast cancer molecular markers and application of same | |
| CN107312770A (en) | A kind of construction method in tumour BRCA1/2 genetic mutations library detected for high-flux sequence and its application | |
| CN104017887A (en) | Primer pair as well as probe and kit for detecting human BRAF gene mutation | |
| Kolostova et al. | Next generation sequencing of glioblastoma circulating tumor cells: non-invasive solution for disease monitoring | |
| CN105779435A (en) | Kit and application thereof | |
| CN109593847A (en) | Detect primer pair, kit and the method for the site microsatellite NR24 stability | |
| CN113215257A (en) | Nucleic acid composition, kit and detection method for detecting breast cancer related gene methylation | |
| CN105779433A (en) | Kit and applications thereof | |
| CN101463390B (en) | EGFR gene extron 20 mutational detecting probe, liquid phase chip and detecting method thereof | |
| CN1884580B (en) | Fluorescent quantitative PCR reagent kit for detecting epidermal growth factor receptor gene point mutation | |
| CN113637750A (en) | Auxiliary diagnosis, prognosis diagnosis or risk stratification marker for acute myeloid leukemia and application thereof | |
| CN102021228B (en) | Specific primers for tissue or whole blood EGFR gene mutation detection | |
| CN105838779A (en) | Method for monitoring and controlling drug resistance of gastrointestinal stromal tumor patient to imatinib/sunitinib through ddPCR technology | |
| CN101698887A (en) | Liquid-phase chip for detecting expression level of mRNAs of genes related to therapeutic effect of anti-microtubule chemotherapeutic medicament | |
| CN101671728B (en) | Method for detecting expression quantity of carcinoembryonic antigen mRNA and special kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee |
Owner name: SUREXAM BIOTECHNOLOGY CO., LTD. Free format text: FORMER NAME: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. |
|
| CP01 | Change in the name or title of a patent holder |
Address after: Five city moon 510663 Guangzhou Road, Guangdong province science and technology innovation base of Guangzhou No. 80, B, C Patentee after: SUREXAM BIO-TECH Co.,Ltd. Address before: Five city moon 510663 Guangzhou Road, Guangdong province science and technology innovation base of Guangzhou No. 80, B, C Patentee before: GUANGZHOU SUREXAM BIO-TECH Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230720 Address after: 510700, 8th floor, No. 29 Helix 3 Road, Guangzhou International Biological Island, Huangpu District, Guangzhou City, Guangdong Province Patentee after: GUANGZHOU SUREXAM MEDICAL LABORATORY Co.,Ltd. Address before: Five city moon 510663 Guangzhou Road, Guangdong province science and technology innovation base of Guangzhou No. 80, B, C Patentee before: SUREXAM BIO-TECH Co.,Ltd. |