CN101432440A - Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction - Google Patents
Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction Download PDFInfo
- Publication number
- CN101432440A CN101432440A CNA2007800147625A CN200780014762A CN101432440A CN 101432440 A CN101432440 A CN 101432440A CN A2007800147625 A CNA2007800147625 A CN A2007800147625A CN 200780014762 A CN200780014762 A CN 200780014762A CN 101432440 A CN101432440 A CN 101432440A
- Authority
- CN
- China
- Prior art keywords
- oligonucleotide
- detection
- sequence
- sequence numbering
- fluorescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
A method for the detection and multiple, simultaneous quantification of any combination of Listeria sp., Staphylococcus aureus, Campylobacter jejuni and/or Escherichia coli O157.-H7, in one or more test samples, by multiplex amplification reaction, using real-time polymerase chain reaction (PCR). The steps in the method are: (a) extracting DNA from the test sample or samples; (b) preparing a reaction mixture specific for the pathogens to be detected and quantified, such that the reaction mixture contains the necessary reagents for enzymatic amplification of the extracted DNA and identification of the pathogens to be detected and quantified; (c) amplifying the reaction mixture by means of multiplex amplification reaction using PCR; and (d) simultaneously determining the presence or absence of and quantification of the pathogens in the test sample or samples. The method has the special feature that (i) the reaction mixture for enzymatic amplification of the DNA has sets of pairs of oligonucleotide primers identified as SEQ ID No. 1 and SEQ ID No. 2, SEQ ID No. 4 and SEQ ID No. 5, SEQ ID No. 7 and SEQ ID No. 8, and SEQ ID No. 10 and SEQ ID No. 11, and probes with oligonucleotide sequences identified as SEQ ID No. 3, SEQ ID No. 6, SEQ ID No. 9 and SEQ ID No. 12; (ii) the presence or absence of and quantification of said pathogens in any combination is determined by means of a fluorescent signal or fluorescence emission specific for each pathogen.
Description
Technical field
From it in essence, this new invention is one and is used for carrying out the new technology that volumeization detects in real time, identifies for pathogenic agent.What is particularly worth mentioning is that, this technology that this invention provides is by using the polymerize chain reaction real time reaction, expand propagation on a large scale, can carry out volumeization to all pathogenic agent and detect evaluation in real time, such as: the listeria bacteria, streptococcus aureus, campylobacter jejuni, Escherichia coli O 157: H7, and can detect these four kinds of pathogenic agent make up appearance in sample situation.
Background technology
In fact, pass through these pathogenic agent of dietetic spread easily at these, (such as: the listeria bacteria, streptococcus aureus and Escherichia coli O 157: detection H7) is a medical circle and public health educational circles great task for a long time.Moreover, the agricultural and the starting material of foodstuffs industry and manufacturer, the dealer of primary products also pay special attention to for the detection of these pathogenic agent, demonstrate keen interest equally.Based on this reason, had been found that the technology that much detects and identify for these pathogenic agent.
In the technology of many these pathogenic agent of detection of using, more effective a kind of method is based on molecular engineering at present.This technology uses polymerase chain reaction,PCR to react, and this technology is exactly to be the known round pcr of people at present.Particularly in the detection of testing sample for a lot of censorships and identifying, this technology be considered to a kind of can be with the technology that detects pathogen nucleic acid of the fastest speed and sensitive precision.We can be in a series of patents in United States Patent (USP) department application of Kai Rui-ratio-Mu Yisi: United States Patent (USP)-4683195, United States Patent (USP)-4683202, United States Patent (USP)-4800159, United States Patent (USP)-4889818, United States Patent (USP)-4965188, United States Patent (USP)-5008182, United States Patent (USP)-5038852, United States Patent (USP)-5079352, United States Patent (USP)-5176995, United States Patent (USP)-5310652, United States Patent (USP)-5310893, United States Patent (USP)-5322770, United States Patent (USP)-5333675, United States Patent (USP)-5352600, United States Patent (USP)-5374553, United States Patent (USP)-5386022, United States Patent (USP)-5405774, United States Patent (USP)-5407800, United States Patent (USP)-5418149 finds these descriptions for this technology in the United States Patent (USP)-5420029.
In order to utilize round pcr to detect, just must depend on archaeal dna polymerase and carry out the enzymatic building-up reactions under the condition of template DNA, primer and four kinds of deoxyribonucleotide existence at pathogenic agent.In this reaction, archaeal dna polymerase is template with the single stranded DNA, starts syntheticly by a bit of double-stranded DNA, combines with one section complementary sequence in the single stranded DNA template by the Oligonucleolide primers of one or two synthetic, forms partially double stranded.Under suitable temperature and environment, archaeal dna polymerase is added to primer 3 ＇-OH end with deoxymononucleotide, and as starting point, extends along template 5 ＇ → 3 ＇ directions, synthetic new DNA complementary strand.The basic fundamental flow process of Here it is round pcr.
Owing to use round pcr can in sample, detect the existence of pathogenic agent individuality rapidly and observantly, use this technology also can detect the concrete quantity of a large amount of pathogenic agent in the sample simultaneously.But undoubtedly, use round pcr to detect for the multiple pathogenic agent that exists in the same duplicate samples simultaneously very big doubt and difficulty are still arranged.Because the obstacle that utilizes round pcr to carry out the detection of multiple pathogenic agent in the duplicate samples simultaneously is, owing to used multiple nucleotide sequence, except the reaction that the detected result needs occur, the reaction of other a plurality of intersections also can appear, thus the precision as a result that influence detects.
Utilize round pcr, detect with the relevant narration of identifying and in following file, to find for the pathogenic agent that exists in the sample: the WO-0314704 international patent application of John-Wei-Si Saka, and Lin Xiaowo etc. is in a series of patents of the U.S.: United States Patent (USP)-5612473, United States Patent (USP)-5738995, United States Patent (USP)-5753444, United States Patent (USP)-5756701 and United States Patent (USP)-5846783.
According to the correlation technique flow process narration of being done in the WO-0314704 international patent application of having announced, this part patent application has related to a kind of relatively unique technique method.By this technological method, can detect the various bacteria of different campylobacters simultaneously in a duplicate samples.Comprise that campylobacter jejuni and large intestine Campylobacter can be detected.These samples of censorship can be the samples of food, also can be water samples, or a series of sample that extracts once more from the top layer of submitted sample.This method is used the round pcr of expansion, and the powerful sequence that the widow examines Nucleotide is partly carried out suitable modification.A large amount of different types of pathogenic agent can be detected in primary first-order equation.
In other a series of United States Patent (USP)s: United States Patent (USP)-5612473, United States Patent (USP)-5738995, United States Patent (USP)-5753444, United States Patent (USP)-5756701, United States Patent (USP)-5846783 has been described another technology.By this technology, can in same duplicate samples, pass through primary first-order equation, detect multiple infectious pathogenic agent rapidly.These infectious pathogenic agent that can be detected comprise: Salmonellas, dysentery bacterium, Campylobacter, the defective of this technology of being narrated in above-mentioned these patents of colon bacillus and Yersinia and Escherichia coli O 157: H7. and being limited in, examine in the expansion breeding of Nucleotide and other nucleotide sequence the widow, allow few nuclear Nucleotide and probe that minimum cross reaction takes place.
What obtained using now, in these all molecular engineerings, the technology that has has obtained business-like application aspect the pathogenic agent in detecting food samples.The technology that has also can obtain very sensitive result by DNA (the unidirectional tracer technique of gene), but whole process will expend 50 hours nearly.The nucleic acid expansion technique (Bacchus, Buddhist Mu Si-Du Pont, cloth Nuo Boliya, the diagnosis of Sai Nuofei pasteur) that passes through that has needs 24 hours.Above-mentioned any technology all can not draw detected result on the same day what send food samples, can not draw real-time probation report.
In all above-mentioned technology, detect at some specific pathogenic agent, need to increase the sensitivity of above-mentioned technology, so that draw rapid and reliable result.Because the pathogenic agent that exists in the food can constitute a threat to the healthy of human consumer, for quantity and the concentration that defines pathogenic agent in the food, so need carry out how quantized detection for the pathogenic agent in the sample in the detection that has.
According to these above narrations as can be seen, it no matter is angle from foodstuffs industry, still from the healthy and safe angle of human food prods, have a kind of can be in five hours, and to detect the technology that whether has pathogenic agent in the sample fast be very important.Can detected pathogenic agent, should comprise most important four kinds of pathogenic agent of propagating by diet or public place easily, such as the listeria bacteria, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: H.This real-time volume detection technique realizes by carrying out a large amount of expanded application for polymerase chain reaction,PCR.It is low that this technology has the detection cost, weak point consuming time, because foodstuffs industry has strict requirement for the foodstuff production time period, so this technology also has extremely crucial meaning and value for foodstuffs industry.
Summary of the invention
Mentioned multinomial technology above, but all exist weak point, in order to find the insufficient method of improving above-mentioned technology, the invention provides and a kind ofly can in same duplicate samples or many parts of biased samples, detect the technology of pathogenic agent in real time by the reaction volumeization of polymerize chain reaction.Can detected these pathogenic agent comprise most important listeria bacteria, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: H.The whole flow process of present technique is such: 1, extract the DNA of the appearance in sample and the test sample book.2, to need to prepare the special reaction of the multiple pathogenic agent of volume detection, also comprise for extract and discern pathogenic agent and quantize to detect and the DNA expansion enzyme activated.3, DNA expansion, thereby by use round pcr to expand on a large scale to obtain different pathogenic agent exclusive different special reactions.4, real-time detect the existence whether pathogenic agent is arranged in the submitted sample.5, for the quantification of extracting and discern pathogenic agent detects, utilize the DNA expansion enzyme to carry out hybrid reaction, identify the listeria bacteria, streptococcus aureus, any array configuration that campylobacter jejuni and Escherichia coli O 157: H exists in sample.(and this step comprises following part: a, the widow who needs preparation to identify examines the start-up portion of Nucleotide, be labeled as sequence numbering: 1 and sequence numbering: 2 and sequence numbering: 3 probe, this probe are that first target nucleic acid such as the homing sequence of listeria bacteria nucleic acid react.B, the widow who need to prepare to identify examines the second section part of Nucleotide, is labeled as sequence numbering: 4 and sequence numbering: 5 and sequence numbering: 6 probe, this probe and second target nucleic acid streptococcus aureus nucleic acid react.C, the widow who need to prepare to identify examines the third part part of Nucleotide, is labeled as sequence numbering: 7 and sequence numbering: 8 and sequence numbering: 9 probe, this probe and the 3rd target nucleic acid campylobacter jejuni nucleic acid react.D, the widow who need to prepare to identify examines the 4th part part of Nucleotide, is labeled as sequence numbering: 10 and sequence numbering: 11 and sequence numbering: 12 probe, this probe and the 4th target nucleic acid Escherichia coli O 157: H nucleic acid reacts.) 6, the listeria bacteria, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: H has a lot of combination existence forms in submitted sample.By fluorescence or the special sign of radioactivity in each expansion product, whether the combination existence form of each above-mentioned four kinds of pathogenic agent exists in submitted sample, just can be detected.
The another one purpose of our this technology is, a kind of so few nuclear Nucleotide can be provided, it comprises by serial number: 1, and sequence numbering: 2 and sequence numbering: 3 formed nucleotide sequences, and this nucleotide sequence is chosen and obtain identification.
One of purpose of our technology is that a kind of so few nuclear Nucleotide can be provided, and it comprises by serial number: 4, and sequence numbering: 5 and the sequence numbering of NO: 6 formed nucleotide sequences, and this nucleotide sequence is also chosen and obtain identification.
One of purpose of our technology is that a kind of so few nuclear Nucleotide can be provided, and it comprises by serial number: 7, and sequence numbering: 8 and the sequence numbering of NO: 9 formed nucleotide sequences, and this nucleotide sequence is also chosen and obtain identification.
One of purpose of our technology is that a kind of so few nuclear Nucleotide can be provided, it comprises by serial number: 10, sequence numbering: 11 and the sequence numbering of NO: 12 formed nucleotide sequences, and this nucleotide sequence is also chosen and obtain identification.
Link together with above-mentioned target, present technique also can provide a probe that has been identified, and this probe comprises sequence numbering: 3 widow examines Nucleotide, and this probe can be used as a mark at least.
The probe that present technique also can provide another one to be identified, this probe comprises sequence numbering: 6 widow examines Nucleotide, and this probe can be used as a mark at least.
The probe that present technique also can provide another one to be identified, this probe comprises sequence numbering: 9 widow examines Nucleotide, and this probe can be used as a mark at least.
The probe that present technique also can provide another one to be identified, this probe comprises sequence numbering: 12 widow examines Nucleotide, and this probe can be used as a mark at least.
At last, also can be used as be that final detected result is made in the detection of a submitted sample in our this technological invention.This technology is the reaction by polymerize chain reaction, and volumeization detects the listeria bacteria in real time, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: H, and these four kinds of pathogenic agent each combination existence form in a or many parts of submitted samples.Detected result comprises: 1, according to be identified by serial number: 1, sequence numbering: 2 and sequence numbering: 3 formed nucleotide sequences, by serial number: 4, sequence numbering: 5 and the sequence numbering of NO: 6 formed nucleotide sequences, serial number: 7, sequence numbering: 8 and the sequence numbering of NO: 9 formed nucleotide sequences, detect the existence of one or more few nuclear Nucleotide.2, according to the sequence numbering that has been identified: 3 formed nucleotide sequences, sequence numbering: 6 formed nucleotide sequences, sequence numbering: 9 formed nucleotide sequences, sequence numbering: 12 formed nucleotide sequences, detect the widow who has above sequence and examine the formed probe of Nucleotide.3, in order to detect required other compositions and reagent.
Description of drawings
Some detailed features about the present technique invention will be explained in detail in the paragraph below.And also have some images to present in the lump as evidence.The purpose of taking out these images is clearly to define in order to make one to this invention, but the effect of these images is not limited thereto.
Image one has showed that YITIAOGEN draws according to this technology, has scale and can be used to calculate listerial curve.On this image, A1 be draw under the high density condition can be for reference curve, A4 be under a low consistency conditions, draw can be for reference curve.And in order to understand UFC/ml better, when the data image of a sample is read, inserted the data image that other can sample for reference.
That image two has been showed is that YITIAOGEN draws according to this technology, have scale and can be used to calculate the curve of streptococcus aureus.On this image, A1 be draw under the high density condition can be for reference the result, A4 is the following result that can be for reference who draws a low consistency conditions.And in order better to understand UFC/ml, in the reading, inserted the data image that other can sample for reference to the data plot of a sample.
That image three has been showed is that YITIAOGEN draws according to this technology, have scale and can be used to calculate the curve of campylobacter jejuni.On this image, A1 be under a high density condition, draw can be for reference the result, A2 be under a low consistency conditions, draw can be for reference the result.And in order better to understand UFC/ml, when the data image of a sample is read, inserted the data image that other can sample for reference.
That image four has been showed is that YITIAOGEN draws according to this technology, have scale and can be used to calculate the curve of Escherichia coli O 157: H7.On this image, A1 be under a high density condition, draw can be for reference the result, A3 be under a low consistency conditions, draw can be for reference the result.And in order better to understand UFC/ml, when the data image of a sample is read, inserted the data image that other can sample for reference.
Detailed Description Of The Invention
The DNA expansion enzyme is used this term, as employed in the present description of this paper, this term refers to by the reaction that utilizes polymerize chain reaction (PCR), in the sequence of a lot of blended DNA, and the technology that the particular sequence among some DNA is increased.And the particular sequence of this DNA said target sequence that is exactly us is amplified by large-scale expansion.
This term of start-up portion only is the homing sequence part of the few nuclear of the finger Nucleotide of limitation.And this part homing sequence of few nuclear Nucleotide is connected with target sequence is complementary just.Comprised a upstream sequence in the homing sequence of few nuclear Nucleotide, and the nucleic acid in this upstream sequence forms complementary the connection with upstream sequence in the target sequence.And the homing sequence of few nuclear Nucleotide has also comprised a downstream sequence, the nucleic acid in this downstream sequence also with target sequence in downstream sequence formed complementary the connection.
A large amount of these terms of amplified reaction the meaning, as employed in the present description of this paper, be a kind of PCR-based technology and the amplification procedure that carries out.This amplification procedure is to increase for the many target dna sequences in certain specific submitted sample.
In this new technological invention, by utilizing round pcr, utilize the reaction of polymerize chain reaction, volumeization can realize detecting in real time four kinds of pathogenic agent.Technology with other is compared, and this technology need not carried out multiplication culture in advance for the pathogenic agent that will detect, and does not also need to prepare many their test tubes of special reaction separately that have for each pathogenic agent that will detect.Need benly to be, this technological invention has realized huge breakthrough aspect four kinds of pathogenic agent detecting in real time, has surmounted other technologies from far away, and has saved the time of assay greatly, and the shortest need 2.5 hours just can draw detected result.Present technique only needs a blended special reaction reagent, and unlike other technologies, needs a lot of parts of such reagent.Except the sensitivity of using present technique to detect is very high, preparation (being included in 2.5 hours) for sample also helps to obtain detected result better, because there are not those factors that may have a negative impact to expansion process, these factors are eliminated.
This this method that technological invention provides, can for these these pathogenic agent of propagating by dietetic spread and public place environment easily (such as: the listeria bacteria, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: H7), at a or the foodstuff samples of many parts of censorships, in water sample or other samples, expand propagation on a large scale, detect in real time and evaluation thereby submitted sample is carried out volumeization by the reaction that utilizes polymerize chain reaction.Whether the sample of censorship can be the sample of any kind, polluted by above-mentioned four kinds of pathogenic agent as long as wonder this duplicate samples, just can detect.Under specific situation, the sample that we mentioned generally is meant foodstuff samples, such as, meat product and milk-product, or skin-material and receive the ambient air material of pollution.
Few nuclear Nucleotide: the calligraphy or painting model of sequence and information storage
The widow who mentions in this technological invention examines Nucleotide, and the purpose that they are used is in differentiating a submitted sample, detects the listeria bacteria, streptococcus aureus, and the specificity of campylobacter jejuni and Escherichia coli O 157: H7 exists.Release may occur, and also has other pathogenic agent in a submitted sample, and test result is by the existence of other pathogenic agent and disturbed situation.
(campylobacter jejuni and Escherichia coli O 157: H7), the widow of each pathogenic agent examines the Nucleotide homing sequence for listeria bacteria, streptococcus aureus at first to need to be grasped four kinds of pathogenic agent that will detect.And these few nuclear Nucleotide homing sequences all have their formed upstream sequence itself, and the upstream sequence that this specially emphasizes out to be 5 ' top sequence with target nucleic acid form complementary the link.And these homing sequences also have their all downstream sequences itself, and the downstream sequence that this requires emphasis especially to be 3 ' top sequence with target nucleic acid form complementary link.The sequence of these nucleic acid should have the homing sequence part that the widow that these pathogenic agent had separately that will detect examines Nucleotide.Therefore, for each pathogenic agent that will detect, through these processes, the few nuclear of these that they had Nucleotide has all formed a new synthetic link in test.These few nuclear Nucleotide of synthetic are detailed sees chart 1:
| Identification types | Type | The pathogenic agent kind | Nucleotide sequence |
| Sequence numbering: 1 | " upstream " homing sequence F | The listeria bacteria | CTTGACATCCTTTGACCACTCTG |
| Sequence numbering: 2 | " downstream " homing sequence R | The listeria bacteria | GACTTAACCCAACATCTCACGAC |
| Sequence numbering: 3 | The P test | The listeria bacteria | AGCTGACGACAACCATGCACCACC |
| Sequence numbering: 4 | " upstream " homing sequence F | Streptococcus aureus | AACAAAACAGACCATCTTTAAGCG |
| Sequence numbering: 6 | The P test | Streptococcus aureus | ACTCAACCGACGACACCGAACCCT |
| Sequence numbering: | " upstream " homing sequence F | Campylobacter jejuni | GCAGCAGTAGGGAATATTGCG |
| 7 | |||
| Sequence numbering: 8 | " downstream " homing sequence R | Campylobacter jejuni | TACGCTCCGAAAAGTGTCATCC |
| Sequence numbering: 9 | The P test | Campylobacter jejuni | AACCCTGACGCAGCAACGCCGC |
| Sequence numbering: 10 | " upstream " homing sequence F | Escherichia coli O 157: H7 | GCAGATAAACTCATCGAAACAAGG |
| Sequence numbering: 11 | " downstream " homing sequence R | Escherichia coli O 157: H7 | TAAATTAATTCCACGCCAACCAAG |
| Sequence numbering: 12 | The P test | Escherichia coli O 157: H7 | ACCCTGTCCACACGATGCCAATGT |
Chart 1
What use was recommended by institute in present technique invention is sequence numbering: 3, and sequence numbering: 6, sequence numbering: 9, the sequence of sequence numbering 12, they are to be used as detection probes.The fluorescence processing has been done on their 5 ' sequence top, or is processed by a kind of dyestuff that can radiant.Their 3 ' preface is caught the row top and has been removed fluorescence, or is handled by a kind of dyestuff that can catch the energy that fluorescence emits.In order to detect and identify the listeria bacteria, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: H7, these have sequence fluorescence and that do not have fluorescence is to be used as mark, does not have cross reaction between them.And other integral part li all clearly shows up at table 2:
| Identification types | Pathogen type | Nucleotide sequence | 5 ' top has fluorescent substance to indicate | 3 ' top does not have fluorescent substance to indicate |
| Sequence numbering: 3 | The listeria bacteria | AGCTGACGACAACCATGCACCACC | TET | BHQ-1 |
| Sequence numbering: 6 | Streptococcus aureus | ACTCAACCGACGACACCGAACCCT | TxR | BHQ-2 |
| Sequence numbering: 9 | Campylobacter jejuni | AACCCTGACGCAGCAACGCCGC | Cy5 | BHQ-3 |
| Sequence numbering: 12 | Escherichia coli O 157: H7 | ACCCTGTCCACACGATGCCAATGT | FAM | BHQ-1 |
Chart 2
The preparation of DNA material in a or many parts of submitted samples
For the method according to this technological invention and creation detects, need prepare for submitted sample according to following step:
At first get one section sample to be detected, foodstuff samples or other sample immerse sample to be checked in the salt brine solution subsequently, allow sample suspend wherein.To carry out centrifugal treating for sample subsequently, thereby obtain the settling of the first layer.But for follow-up step, remove in this surface sediments with solution in moisture.
After obtaining the settling of submitted sample, with N,O-Diacetylmuramidase for handling in these settlings, thereby the cell walls of the cell in the destruction settling, in step subsequently, come the settling that added N,O-Diacetylmuramidase is handled with Proteinase K, thereby make the protein component complete hydrolysis become amino acid, comprise that the N,O-Diacetylmuramidase that back uses also can be fallen by protease hydrolysis.
After removing protein component and other fat-soluble cpdss, should handle by the solvent that chloroform-alcohol-phenol is handled.After taking out treated sample, with regard to sprinkling ethanolic soln immediately.Add ethanolic soln then and stir rapidly, the DNA that needs subsequently just separates out from solution, should do and leaves standstill processing and draw a large amount of DNA like this.
At last, a large amount of DNA that obtain are carried out heat treated under about 65 degrees centigrade temperature condition, these DNA that obtain in sample can be dissolved rapidly.
Related factor in each experimentation is all confirmed repeatedly by relevant test institute.Such as: add the quantity of reagent, the time of spin hatching, repetitive scrubbing, current factor is all by repetition test, up to finding a best condition.In the whole process of preparing sample, should consider a such requirement: all reagent and sample must be deposited under the refrigerative condition in whole process.
Following part will be narrated and prepare the portion or the exemplary step of multiple sample:
Example one: in a or many parts of meat products or cheese product sample to be checked, extract required DNA
All processes
1. place the foodstuff samples to be detected of 25g in a volume is the aseptic tapered tube of 50ml, adds the stroke-physiological saline solution of 40ml simultaneously, the brinish temperature keeps at ambient temperature.
2. the vertical placement of test tube 10 minutes, so that the sample in the test tube is fully precipitated
3. the processing sample uses whizzer with per minute 3500 rotating speed (min
-1) centrifugal treating sample 15 minutes, and careful taking-up supernatant liquid, do not run into following settling.
4. roll concussion 10 seconds of settling
5. whole settlings being transferred to a volume is in the sterile test tube of 2ml, and with the stroke-physiological saline solution flushing taper test tube of 1ml, and liquid and settling after the flushing are incorporated in the same sterile test tube.
6. change (14 000min with per minute 14 000
-1) speed, centrifugal treating 8 minutes.
7. draw all supernatant liquids with auto buret.
8. add 100 μ l, the Tris-HCl solution of 100mmol and 30 μ g, the N,O-Diacetylmuramidase of pH=8, concussion mixed for 10 seconds.
9. in 37 degrees centigrade water temperature, heating in water bath 30 minutes.
10. add TE 1X solution and the 1% SDS solution of 100 μ l, and the K proteolytic enzyme (20mg/ml) of 3 μ l.
11. mix, and under 55 degrees centigrade water temperature condition, heating in water bath 30 minutes.
12. add 500 μ l phenol-chloroforms-alcohol isoamyl solution (allocation ratio is 24:24:1), add 100 μ l TE 1X again, and be inverted concussion 5 minutes.
13. speed (min with 13 500 rpms
-1) centrifugal treating 8 minutes, and from an other test tube transferase 12 50 μ l of last course.
14. add the dehydrated alcohol of 582.5 μ l, and in refrigerator stored refrigerated 10 minutes.
15. carry out centrifugal treating with 13500 rpms speed, the time is 8 minutes.
16. clarify and drying treatment.
17. add the TE 1X of 25 μ l once more, guarantee that the DNA of bottom also dissolves.
18. heated 15 minutes, temperature is 65 degrees centigrade.
Handled 30 minutes 19. at room temperature leave standstill.
Example two: the Overall Steps that from air sample and material to be checked top layer sample, extracts required DNA.
1. nuzzle up at sample surfaces to be detected with a 20cm x 20cm sterile gauze, so that finish the sampling process of test.
2. in aseptic ware, overstock this piece gauze, the liquid of the inside is flowed out.Effusive liquid is poured in the aseptic taper test tube of a 50ml, and added the stroke-physiological saline solution of 40ml.
3. the processing sample uses whizzer with per minute 3500 rotating speed (min
-1) centrifugal treating sample 15 minutes, and careful taking-up supernatant liquid, do not run into following settling.
4. 10 seconds of left and right sides oscillating and shaking settling
5. whole settlings being transferred to a volume is in the sterile test tube of 2ml, and with the stroke-physiological saline solution flushing taper test tube of 1ml, and liquid and settling after the flushing are incorporated in the same sterile test tube.
6. change (14 000min with per minute 14000
-1) speed, centrifugal treating 8 minutes.
7. clean again twice with the stroke-physiological saline solution of 1.5ml.
8. draw all supernatant liquids with auto buret.
9. add 100 μ l, the Tris-HCl solution of 100mmol and 30 μ g, the N,O-Diacetylmuramidase of pH=8, concussion mixed for 10 seconds.
10. under 37 degrees centigrade water temperature condition, heating in water bath 30 minutes.
11. add TE 1X solution and the 1%SDS solution of 100 μ l, and the K proteolytic enzyme (20mg/ml) of 3 μ l.
12. mix, and under 55 degrees centigrade water temperature condition, heating in water bath 30 minutes.
13. add 500 μ l phenol-chloroforms-alcohol isoamyl solution (allocation ratio is 24:24:1), add 100 μ l TE 1X again, and be inverted concussion 5 minutes.
14. speed (min with 13 500 rpms
-1) centrifugal treating 8 minutes, and from an other test tube transferase 12 50 μ l of last course.
15. add the dehydrated alcohol of 582.5 μ l, and in refrigerator stored refrigerated 10 minutes.
16. carry out centrifugal treating with 13500 rpms speed, the time is 8 minutes.
17. clarify and drying treatment.
18. add the TE 1X of 25 μ l once more, guarantee that the DNA of bottom also dissolves.
19 heating 15 minutes, temperature is 65 degrees centigrade.
Handled 30 minutes 20. at room temperature leave standstill.
The set-up procedure of hybrid reaction
Obtain a or many parts of dna samples after, just begin to prepare the needed all ingredients of hybrid reaction, the reagent that need use sees table 3:
Chart 3
Step subsequently begins to prepare a hybrid reaction that has 100 kinds of compositions to participate in, and reacts required reagent and sees form 44:
Form 4
Should make reagent mix even by reagent being inverted the method for concussion.And utilize several different methods to dispose the solvent of 19.75 μ l.Wherein have the reagent of 0.5ml should be under the condition of lucifuge stored refrigerated.
Utilize PCR to expand the real-time volume detection of multiplication technique on a large scale and identify multiple pathogenic agent
This method that technological invention provides is promptly used the extensive in real time expansion multiplication technique of PCR, compares with other the conventional round pcr that only a kind of target is detected, and has extremely remarkable advantages.Utilize PCR to expand multiplication technique on a large scale and react, need carry out amplified reaction, and the probe of special reaction is arranged, will carry out amplified reaction too for target sequence with the pathogenic agent that will detect for the homing sequence that the widow examines Nucleotide.By this method, this temperature range of 40 degrees centigrade to 65 degrees centigrade, the homing sequence of few nuclear Nucleotide and probe can compatiblely exist, and also can issue biochemical reaction in identical condition, and permission at last hybridization occurs or connects.By this hybridization, two sections complementary nucleotide sequences have been bound up on together.In this simultaneously, in whole expansion breeding, the homing sequence of few nuclear Nucleotide and probe but can not with other any other nucleotide sequences, the cross reaction or the associative reaction of any kind take place.
In sum, homing sequences of all other few nuclear Nucleotide next, all be used to other, the nucleic acid of the target pathogenic agent that detect reacts.A pair ofly be used for identifying listerial few nuclear nucleotide sequence, i.e. the sequence numbering 1 known to and sequence numbering 2, the few nuclear of this group Nucleotide can be used to listerial genome in sequence carry out hybridization and associative reaction.A pair ofly be used for identifying that the widow of streptococcus aureus examines nucleotide sequence, i.e. the sequence that the sequence numbering 4 known to and sequence numbering 5, the few nuclear of this group Nucleotide can be used in the genome with streptococcus aureus is carried out hybridization and associative reaction.A pair ofly be used for identifying that the widow of campylobacter jejuni examines nucleotide sequence, i.e. the sequence that the sequence numbering 7 known to and sequence numbering 8, the few nuclear of this group Nucleotide can be used in the genome with campylobacter jejuni is carried out hybridization and associative reaction.The a pair of widow who is used for identification of escherichia coli O157:H7 examines nucleotide sequence, i.e. the sequence numbering 7 known to and sequence numbering 8, and the few nuclear of this group Nucleotide can be used to and Escherichia coli O 157: the sequence in the genome of H7 is carried out hybridization and associative reaction.
Employed evaluation probe, i.e. sequence numbering in utilizing the extensive real-time extension multiplication technique of round pcr: 3, sequence numbering: 6, sequence numbering: 9, sequence numbering: 12.These nucleotide sequences are examined Nucleotide by the widow of dual sign.Nucleotide sequence after these widow's nuclear Nucleotide and the extensive expansion of process complementary pair is one by one answered, and forms new link.Each probe on its 5 ' top by fluorescence, or dyestuff that can radiant indicates, and 3 ' top of each probe is all by dimness, or can absorb above-mentioned dyestuff emits another dyestuff of energy and indicate.For this point, Na Salunke is mentioned in his No. 5866336, United States Patent (USP).How about he has write the fluorescent substance that can shift energy in patent, and in the extensive expansion technique of nucleic acid, and this material is examined the widow and is applied in the Nucleotide.
In the method that the present technique invention provides, the fluorescent substance that uses is TET, TxR, Cy5, FAM, and the endergonic material that uses in this test procedure is BHQ-1, BHQ-2 y BHQ-3. is used as probe in testing process widow examines nucleotide sequence (sequence numbering 3, sequence numbering 6, sequence numbering 9, sequence numbering 12) all according to the combination in the form of above being mentioned two, indicates on their 3 ' and 5 ' top.
In the method that the present technique invention provides, be under following condition, to prepare as the extensive dna sample of expanding:
The submitted sample of milk-product sample and air: the vial solutions of thawing needs with the mixing solutions of preparing 19.75 μ l in advance, and adds the thermophilic archaeal dna polymerase of 0.25 μ l, the DNA of the water of 4 μ l and 1 μ l analysis to be detected.
The submitted sample of meat product and cheese product: the vial solutions of thawing needs with the mixing solutions of preparing 19.75 μ l in advance, the DNA of the thermophilic archaeal dna polymerase of 0.25 μ l and 5 μ l analysis to be detected.
When utilizing PCR to expand multiplication technique on a large scale to react, need a kind of instrument and control real-time extensive expansion breeding.Losail-Butterworth pauses and describes to some extent for this instrument in the patent EP-640828 of European Union that he has announced.The main composition of this instrument is: can put into wherein instrument stand to the test tube that carries out pathogenic agent DNA cloning to be detected in a large number for one.Special light source on the instrument stand for a plurality of test tubes on the instrument stand provide light source, and a fluorescent probe, can detect the fluorescence of release in real time.
For the microorganism that exists in the volume test sample, need make every kind of pathogenic agent to be detected (listeria bacteria, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: the H) curve that has quantity in solution.By the opacity of test tube is adjusted 0.5 Mc Farland unit, and be 10 with solution dilution
-1, 10
-2, 10
-3, 10
4, 10
5, 10
6, 10
7 Y 10
8Multiple, the foodstuff samples to be checked with 25g joins in every part of solution subsequently, every part of solution all adds the sample of same share.Then carry out the extraction of dna sample, and note the reaction of every bottle of different solutions, determine the quantity of corresponding pathogenic agent in the different solution.CT of the unit of adding and ug/g on image have at last just obtained at last the curve of pathogenic agent quantity in the solution.Listerial curve sees image one, and the curve of streptococcus aureus sees image two, and the curve of campylobacter jejuni sees image three, Escherichia coli O 157: the curve of H sees image four.
In the method that present technique provides, the instrument that uses comprises the fluorescence detection instrument of real-time detection fluorescence, can detect the instrument of extensive expansion breeding in real time.A kind of instrument that uses in this flow process is that Sai Puyide company produces " sensitive circulation instrument ".
Detect the pathogenic agent of identifying in the sample in real time by the DNA volumeization
(campylobacter jejuni and Escherichia coli O 157: whether all array configurations that H) may occur in sample exist and can both be detected these four kinds of pathogenic agent for listeria bacteria, streptococcus aureus.The result who detects is displayed by the different fluorescence that DNA had or radioactive fluorized marking in the sample very intuitively.Therefore to determine the wavelength of different fluorescence, so just can must pick out which kind of fluorescence easily and be launched by which kind of DNA.
Detected result
The method that provides according to present technique, chart five has shown the condition that finishes whole extensive spread step, chart six has shown the level that can reach that detects, chart seven has shown four kinds of pathogenic agent (listeria bacterias in the detected result that reads out, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: concentration H), detected result is taken self cooling meat respectively, milk-product and the sample that obtains from the top layer, by utilizing a kind of single mix reagent, four kinds of widows from different pathogens examine Nucleotide and mix in the process of amplification under uniform temp.Certainly, image 1 has also shown the volume detected result.
Chart 5
Chart 6
Chart 7
The method of using present technique to provide detects and does not need submitted sample is cultivated in advance, and therefore the time of whole process has been shortened a lot.The shortest about 2.5 hours, just can draw concrete detected result, this result comprises the value volume and range of product of concrete pathogenic agent.
The diagnosis of relevant configuration
In general, the diagnosis of this technology relevant configuration comprises: the pathogenic agent (listeria bacteria that each is to be detected, streptococcus aureus, campylobacter jejuni and Escherichia coli O 157: H) the widow of peculiar correspondence examine the homing sequence part of Nucleotide, and detect needed and every kind of pathogenic agent each probe of special correspondence.By above-mentioned step, utilize the material of above-mentioned steps can realize that at last carrying out volumeization for each pathogenic agent in four kinds of specific pathogenic agent detects in real time.According to the different needs under the different situations, the combination of four kinds of pathogenic agent exists combination also can carry out volumeization by above-mentioned method to detect (only using few nuclear Nucleotide homing sequence part and corresponding probe) in real time.
The employed relevant reagent of the method that present technique provided comprises the nucleotide sequence that can be contained in the box, or the more aforementioned few nuclear Nucleotide start-up portion sequence or the vessel of probe of being equipped with.In order to finish detection, should have following condition: some are equipped with all or the container of part reagent, and pure sterilized water, NTPs (dATP, dCTP, dGTP, y dTTP), what the expansion enzyme process was suitable replenishes and deposit, a kind of thermophilic archaeal dna polymerase (such as, archaeal dna polymerase Taq), a kind of magnesium salts is (such as MgCl
2).The configuration that above-mentioned these all should be correlated with as required and additional.According to the employed reagent of the method that provides of present technique, also comprise filling the listeria bacteria in addition, streptococcus aureus, the vessel of campylobacter jejuni and Escherichia coli O 157: H are used as the comparison of positive control.
According to mentioned above,, narrated the step and the program of a lot of detections in order to carry out above-mentioned detection.In these testing processes, should carry out maximum improvement for all these conditions that need, in the hope of obtaining best detected result.The step of these detections that comprise above being narrated and the condition of detection, these can not change.Above these are narrated, and all may have the leeway of correction, and these are responsible for by us, and this point needs attention especially.
Sequence table
＜110〉Sigma Alimentos S. A. de C. V.,
Jar (unit of capacitance) Sa Paul Gonzales, the Ai Er Wella
Rich Gus's Padilla, Francisco Ha Weier
Jos Ka Pana, Victor Man Nuaier
＜120〉survey and the method for carrying out multiple quantification of pathogens simultaneously by real-time polymerase chain reaction
＜130〉the suitable horse of PCT003
<140>PCT/MX2007/000052
<141>2007-04-19
<150>MXNL/a/2006/000028
<151>2006-04-24
<160>12
＜170〉version 3 .3 patent
<210>1
<211>24
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide, listerial upper reaches F
<400>1
<210>2
<211>23
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide, listerial downstream R
<400>2
<210>3
<211>24
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of listeria bacteria check P
<400>3
<210>4
<211>24
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of streptococcus aureus " upstream " F
<400>4
<210>5
<211>24
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of streptococcus aureus " downstream " R
<400>5
<210>6
<211>24
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of streptococcus aureus test P
<400>6
<210>7
<211>21
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of campylobacter jejuni " upstream " F
<400>7
<210>8
<211>22
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of campylobacter jejuni " downstream " R
<400>8
<210>9
<211>22
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of campylobacter jejuni test P
<400>9
<210>10
<211>24
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of intestinal bacteria " upstream " F
<400>10
<210>11
<211>24
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of intestinal bacteria " downstream " R
<400>11
<210>12
<211>24
<212>DNA
＜213〉synthetical
<220>
＜223〉oligonucleotide of coli test P
<400>12
Claims (43)
1. (these pathogenic agent are from by the listeria bacteria for any pathogenic agent of multiple quantification that detects and carry out simultaneously, streptococcus aureus, select in the group that campylobacter jejuni and Escherichia coli O 157: H7 forms) in one or more specimen, react the method that acts on polymerase chain reaction in real time by composite amplification, comprise following step:
A) the on-the-spot DNA that extracts above-mentioned sample or test sample;
B) the peculiar reaction mixture of preparing above-mentioned pathogenic agent detects and quantizes, and this reaction mixture comprises for the necessary reagent of the amplification of the enzyme of the DNA that extracts with to the detection and the quantized evaluation of these pathogenic agent;
C) by acting on the composite amplification reaction of polysaccharase, strengthen the reaction of this mixture;
D) determine that simultaneously in the existence of above-mentioned sample or check sample whether and quantize these pathogenic agent; Wherein:
I) this reaction mixture is for amplification and any listeria bacteria of the DNA enzyme that extracts, streptococcus aureus, and the detection and the quantification of the combination of campylobacter jejuni and/or Escherichia coli O 157: H7 comprise:
First pair of oligonucleotide sequence is defined as identifier numbering 1 and numbering 2, and probe is defined as serial number 3, and these are Listerias of crossing or bundling the nucleotide sequence of first target;
Second pair of oligonucleotide sequence is defined as identifier numbering 4 and numbering 5, and probe is defined as serial number 6, and these are streptococcus aureuses of crossing or bundling the nucleotide sequence of second target;
The 3rd pair of oligonucleotide sequence is defined as identifier numbering 7 and numbering 8, and probe is defined as serial number 9, and these are campylobacter jejunis of crossing or bundling the nucleotide sequence of the 3rd target;
The 4th pair of oligonucleotide sequence is defined as identifier numbering 10 and numbering 11, and probe is defined as serial number 12, and these are the Escherichia coli O 157 of crossing or bundle the nucleotide sequence of the 4th target: H7;
The ii) listeria bacteria of these pathogenic agent in above-mentioned sample or check sample, streptococcus aureus, the existence of arbitrary combination of campylobacter jejuni and Escherichia coli O 157: H7 whether with quantize to be by the emission decision of a kind of fluorescent signal or the peculiar fluorescence of each pathogenic agent.
2. the method for claim 1 is characterized in that above-mentioned sample or test sample are a kind of sample or environmental samples of processed food.
3. the method for claim 1 is characterized in that the on-the-spot process of extracting DNA from above-mentioned sample or test sample comprises this several steps:
Test sample is positioned in the physiological saline;
Remove water soluble molecules, and obtain enriched material.
4. the method for claim 1 is characterized in that reaction mixture comprises:
Have at least 200 picomole oligonucleotide to make a start and be defined as sequence numbering 1;
Have at least 200 picomole oligonucleotide to make a start and be defined as sequence numbering 2;
Have at least the oligonucleotide detection of 50 picomole to be defined as sequence numbering 3;
Have at least 200 picomole oligonucleotide to make a start and be defined as sequence numbering 4;
Have at least 200 picomole oligonucleotide to make a start and be defined as sequence numbering 5;
Have at least the oligonucleotide detection of 50 picomole to be defined as sequence numbering 6;
Have at least 300 picomole oligonucleotide to make a start and be defined as sequence numbering 7;
Have at least 200 picomole oligonucleotide to make a start and be defined as sequence numbering 8;
Have at least the oligonucleotide detection of 350 picomole to be defined as sequence numbering 9;
Have at least 200 picomole oligonucleotide to make a start and be defined as sequence numbering 10;
Have at least 200 picomole oligonucleotide to make a start and be defined as sequence numbering 11; With or
Have at least the oligonucleotide detection of 50 picomole to be defined as sequence numbering 12.
5. the method for claim 1, it is characterized in that it has listed one or many in and surveyed testing product or polymerase chain reaction enhanced product, wherein each probe is and detects the listeria bacteria, sequence in the streptococcus aureus, the sequence of arbitrary combination of campylobacter jejuni and/or Escherichia coli O 157: H7 is complementary.
6. method as claimed in claim 5 is characterized in that first probe comprises:
Oligonucleotide that is defined as sequence numbering 3 and
At least one mark.
7. method as claimed in claim 6 is characterized in that the end points 5 ' with fluorescence or dye marker that can emitted energy of first probe at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
8. method as claimed in claim 7 is characterized in that above-mentioned fluorescence is tsiklomitsin.
9. method as claimed in claim 7 is characterized in that above-mentioned deoscillator is BHQ-1.
10. method as claimed in claim 5 is characterized in that second probe comprises:
Oligonucleotide that is defined as sequence numbering 6 and
At least one mark.
11. method as claimed in claim 10 is characterized in that the end points 5 ' with fluorescence or dye marker that can emitted energy of second probe at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
12. method as claimed in claim 11 is characterized in that above-mentioned fluorescence is TxR.
13. method as claimed in claim 11 is characterized in that above-mentioned deoscillator is BHQ-2.
14. method as claimed in claim 5 is characterized in that the 3rd probe comprises:
Oligonucleotide that is defined as sequence numbering 9 and
At least one mark.
15. method as claimed in claim 14 is characterized in that the end points 5 ' with fluorescence or dye marker that can emitted energy of the 3rd probe at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
16. method as claimed in claim 15 is characterized in that above-mentioned fluorescence is Cy5.
17. method as claimed in claim 15 is characterized in that above-mentioned deoscillator is BHQ-3.
18. method as claimed in claim 5 is characterized in that the 4th probe comprises:
Oligonucleotide that is defined as sequence numbering 12 and
At least one mark.
19. method as claimed in claim 18 is characterized in that the end points 5 ' with fluorescence or dye marker that can emitted energy of the 4th probe at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
20. method as claimed in claim 19 is characterized in that above-mentioned fluorescence is FAM.
21. method as claimed in claim 19 is characterized in that above-mentioned deoscillator is BHQ-1.
22. method as claimed in claim 5 is characterized in that above-mentioned these probes all are the end points 5 ' with fluorescence or dye marker that can emitted energy at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
23. method as claimed in claim 22 is characterized in that above-mentioned fluorescence is from by TET, TxR selects in the group that Cy5 and FAM form.
24. method as claimed in claim 22 is characterized in that above-mentioned deoscillator is from by BHQ-1, selects in the group that BHQ-2 and BHQ-3 form.
25. an oligonucleotide is characterized in that having a series of Nucleotide, wherein this serial Nucleotide is to be defined as sequence numbering 1 from those, selects in the group that the series of sequence numbering 2 and sequence numbering 3 is formed.
26. an oligonucleotide is characterized in that having a series of Nucleotide, wherein this serial Nucleotide is to be defined as sequence numbering 4 from those, selects in the group that the series of sequence numbering 5 and sequence numbering 6 is formed.
27. an oligonucleotide is characterized in that having a series of Nucleotide, wherein this serial Nucleotide is to be defined as sequence numbering 7 from those, selects in the group that the series of sequence numbering 8 and sequence numbering 9 is formed.
28. an oligonucleotide is characterized in that having a series of Nucleotide, wherein this serial Nucleotide is to be defined as sequence numbering 10 from those, selects in the group that the series of sequence numbering 11 and sequence numbering 12 is formed.
29. once markd detection is characterized in that comprising oligonucleotide and at least one mark that is defined as sequence numbering 3.
30. markd detection as claimed in claim 29 is characterized in that the end points 5 ' with fluorescence or energy penetrate the dye marker of energy of this detection at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
31. markd detection as claimed in claim 30 is characterized in that above-mentioned fluorescence is TET.
32. markd detection as claimed in claim 30 is characterized in that above-mentioned deoscillator is BHQ-1.
33. once markd detection is characterized in that comprising oligonucleotide and at least one mark that is defined as sequence numbering 6.
34. markd detection as claimed in claim 33 is characterized in that the end points 5 ' with fluorescence or energy penetrate the dye marker of energy of this detection at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
35. markd detection as claimed in claim 34 is characterized in that above-mentioned fluorescence is TxR.
36. markd detection as claimed in claim 34 is characterized in that above-mentioned deoscillator is BHQ-2.
37. once markd detection is characterized in that comprising oligonucleotide and at least one mark that is defined as sequence numbering 9.
38. markd detection as claimed in claim 37 is characterized in that the end points 5 ' with fluorescence or energy penetrate the dye marker of energy of this detection at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
39. markd detection as claimed in claim 38 is characterized in that above-mentioned fluorescence is Cy5.
40. markd detection as claimed in claim 38 is characterized in that above-mentioned deoscillator is BHQ-3.
41. once markd detection is characterized in that comprising oligonucleotide and at least one mark that is defined as sequence numbering 12.
42. markd detection as claimed in claim 41 is characterized in that the end points 5 ' with fluorescence or energy penetrate the dye marker of energy of this detection at it, at its end points 3 ' maybe can catch with the deoscillator dye marker of the energy that this fluorescence vibration sends.
43. markd detection as claimed in claim 42 is characterized in that above-mentioned fluorescence is FAM.
44. markd detection as claimed in claim 42 is characterized in that above-mentioned deoscillator is BHQ-1.
45. (these pathogenic agent are from by the listeria bacteria to any pathogenic agent of multiple quantification that is used to detect and carries out simultaneously, streptococcus aureus, select in the group that campylobacter jejuni and Escherichia coli O 157: H7 forms) in one or more specimen, act on the diagnostic kit of polymerase chain reaction in real time by composite amplification reaction, it is characterized in that comprising following some:
According to claim 25 in the claim 28 any one situation and fixed one or more Nucleotide;
According to claim 29 in the claim 44 any one situation and fixed one or more markd detection;
Be used for finishing other reagent or the required composition of test.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MXNL/A/2006/000028 | 2006-04-24 | ||
| MXNL/A/2006/000028A MXNL06000028A (en) | 2006-04-24 | Method for the multiple and simultaneous detection and quantification of pathogens by means of an in real-time polymerase chain reaction | |
| PCT/MX2007/000052 WO2007123386A1 (en) | 2006-04-24 | 2007-04-19 | Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101432440A true CN101432440A (en) | 2009-05-13 |
| CN101432440B CN101432440B (en) | 2013-08-21 |
Family
ID=38625236
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007800147625A Expired - Fee Related CN101432440B (en) | 2006-04-24 | 2007-04-19 | Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US8206923B2 (en) |
| EP (1) | EP2020449B1 (en) |
| CN (1) | CN101432440B (en) |
| BR (1) | BRPI0710889A2 (en) |
| DK (1) | DK2020449T3 (en) |
| ES (1) | ES2396453T3 (en) |
| WO (1) | WO2007123386A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886120A (en) * | 2010-03-05 | 2010-11-17 | 江苏出入境检验检疫局动植物与食品检测中心 | Campylobacter jejuni fluorescence quantitative PCR detection kit and detection method thereof |
Families Citing this family (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2616051T3 (en) | 2008-12-02 | 2017-06-09 | Wave Life Sciences Japan, Inc. | Method for the synthesis of modified nucleic acids in the phosphorus atom |
| AU2010270714B2 (en) | 2009-07-06 | 2015-08-13 | Wave Life Sciences Ltd. | Novel nucleic acid prodrugs and methods use thereof |
| FI20096013A (en) * | 2009-10-02 | 2011-04-03 | Finnzymes Oy | Process for preparation of reaction mixture and related products |
| US10428019B2 (en) | 2010-09-24 | 2019-10-01 | Wave Life Sciences Ltd. | Chiral auxiliaries |
| EP2734208B1 (en) | 2011-07-19 | 2017-03-01 | Wave Life Sciences Ltd. | Methods for the synthesis of functionalized nucleic acids |
| JP6246121B2 (en) | 2012-07-13 | 2017-12-13 | 株式会社新日本科学 | Chiral nucleic acid adjuvant |
| MX2015000577A (en) | 2012-07-13 | 2015-08-14 | Wave Life Sciences Pte Ltd | Chiral control. |
| CN107011400B (en) | 2012-07-13 | 2021-05-25 | 波涛生命科学有限公司 | Asymmetric auxiliary group |
| ES2540158B1 (en) * | 2013-09-27 | 2016-04-21 | Universidad De Oviedo | Method for the simultaneous detection of pathogenic microorganisms |
| US10322173B2 (en) | 2014-01-15 | 2019-06-18 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent |
| US10144933B2 (en) | 2014-01-15 | 2018-12-04 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator |
| US10149905B2 (en) | 2014-01-15 | 2018-12-11 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having antitumor effect and antitumor agent |
| KR102423317B1 (en) | 2014-01-16 | 2022-07-22 | 웨이브 라이프 사이언시스 리미티드 | Chiral design |
| GB201401584D0 (en) * | 2014-01-29 | 2014-03-19 | Bg Res Ltd | Intelligent detection of biological entities |
| EP3601616A1 (en) * | 2017-03-27 | 2020-02-05 | Imicroq, S.L. | Rapid pcr method for detection of pathogenic microorganisms |
| MX2018008742A (en) * | 2018-07-16 | 2020-01-17 | Sigma Alimentos Sa De Cv | Method and diagnostic kit for simultaneously and multiple detecting a combination of positive gram bacteria and/or negative gram bacteria. |
| CN114350831A (en) * | 2020-10-12 | 2022-04-15 | 谱尼测试集团上海有限公司 | Primer probe and method for detecting cocoa-derived components in cocoa powder |
| CN112538544B (en) * | 2020-12-30 | 2022-06-14 | 广东省微生物研究所（广东省微生物分析检测中心） | Detection method and application of food-borne pathogenic bacteria standard strain viable bacteria with specific molecular targets |
| CN116287330B (en) * | 2022-12-30 | 2023-12-05 | 中国科学院生态环境研究中心 | High-flux real-time fluorescent quantitative PCR chip capable of detecting multiple virulence genes and detection method thereof |
Family Cites Families (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US5386022A (en) | 1985-03-28 | 1995-01-31 | Hoffman-La Roche Inc. | Primes and probes for the amplification and detection of aids associated nucleic acids |
| US5038852A (en) | 1986-02-25 | 1991-08-13 | Cetus Corporation | Apparatus and method for performing automated amplification of nucleic acid sequences and assays using heating and cooling steps |
| US5333675C1 (en) | 1986-02-25 | 2001-05-01 | Perkin Elmer Corp | Apparatus and method for performing automated amplification of nucleic acid sequences and assays using heating and cooling steps |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US5176995A (en) | 1985-03-28 | 1993-01-05 | Hoffmann-La Roche Inc. | Detection of viruses by amplification and hybridization |
| US5008182A (en) | 1986-01-10 | 1991-04-16 | Cetus Corporation | Detection of AIDS associated virus by polymerase chain reaction |
| US4800159A (en) | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
| US5310893A (en) | 1986-03-31 | 1994-05-10 | Hoffmann-La Roche Inc. | Method for HLA DP typing |
| US4889818A (en) | 1986-08-22 | 1989-12-26 | Cetus Corporation | Purified thermostable enzyme |
| US5322770A (en) | 1989-12-22 | 1994-06-21 | Hoffman-Laroche Inc. | Reverse transcription with thermostable DNA polymerases - high temperature reverse transcription |
| US5407800A (en) | 1986-08-22 | 1995-04-18 | Hoffmann-La Roche Inc. | Reverse transcription with Thermus thermophilus polymerase |
| US5079352A (en) | 1986-08-22 | 1992-01-07 | Cetus Corporation | Purified thermostable enzyme |
| US5374553A (en) | 1986-08-22 | 1994-12-20 | Hoffmann-La Roche Inc. | DNA encoding a thermostable nucleic acid polymerase enzyme from thermotoga maritima |
| US5405774A (en) | 1986-08-22 | 1995-04-11 | Hoffmann-La Roche Inc. | DNA encoding a mutated thermostable nucleic acid polymerase enzyme from thermus species sps17 |
| US5352600A (en) | 1986-08-22 | 1994-10-04 | Hoffmann-La Roche Inc. | Purified thermostable enzyme |
| US5310652A (en) | 1986-08-22 | 1994-05-10 | Hoffman-La Roche Inc. | Reverse transcription with thermostable DNA polymerase-high temperature reverse transcription |
| EP0431149B1 (en) | 1989-05-31 | 1995-09-06 | Amoco Corporation | Universal eubacteria nucleic acid probes and methods |
| DK0540693T3 (en) | 1990-07-24 | 1999-09-13 | Hoffmann La Roche | Reduction of non-specific amplification during in vitro nucleic acid amplification using modified nucleic acid |
| US6372424B1 (en) * | 1995-08-30 | 2002-04-16 | Third Wave Technologies, Inc | Rapid detection and identification of pathogens |
| CA2129787A1 (en) | 1993-08-27 | 1995-02-28 | Russell G. Higuchi | Monitoring multiple amplification reactions simultaneously and analyzing same |
| US5654417A (en) * | 1995-04-14 | 1997-08-05 | Children's Hospital And Medical Center | Nucleic acid probes for detecting E. coli O157:H7 |
| US6737248B2 (en) * | 1996-01-05 | 2004-05-18 | Human Genome Sciences, Inc. | Staphylococcus aureus polynucleotides and sequences |
| US5612473A (en) | 1996-01-16 | 1997-03-18 | Gull Laboratories | Methods, kits and solutions for preparing sample material for nucleic acid amplification |
| US5866336A (en) | 1996-07-16 | 1999-02-02 | Oncor, Inc. | Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon |
| WO1998009655A1 (en) | 1996-09-06 | 1998-03-12 | The Trustees Of Columbia University In The City Of New York | Reversal of cancer phenotype by inhibiting expression of prostate tumor inducing gene |
| JP3847481B2 (en) * | 1998-08-17 | 2006-11-22 | 富士写真フイルム株式会社 | Data transfer method and apparatus, and recording medium |
| EP1238071B1 (en) * | 1999-11-29 | 2008-04-23 | Avi Biopharma, Inc. | Uncharged antisense oligonucleotides targeted to bacterial 16s and 23s rrnas and their uses |
| FR2814754B1 (en) * | 2000-10-04 | 2005-09-09 | Pasteur Institut | LISTERIA INNOCUA, GENOME AND APPLICATIONS |
| JP2005511014A (en) | 2001-08-08 | 2005-04-28 | クアリコン・インコーポレーテツド | Rapid and specific detection of Campylobacter |
| FR2844523B1 (en) * | 2002-09-13 | 2011-01-14 | Genesystems | METHOD AND NUCLEOTIDE SEQUENCES FOR THE DETECTION AND IDENTIFICATION OF MICROORGANISMS IN A COMPLEX MIXTURE OR IN WATER |
| FR2844522A1 (en) * | 2002-09-13 | 2004-03-19 | Genesystems | Multiplex detection and identification of bacteria in complex mixtures, useful for testing food and environmental samples, by simultaneous, but spatially resolved amplification |
| US20040248148A1 (en) | 2002-11-26 | 2004-12-09 | Horgen Paul A. | Ultrasensitive detection of pathogenic microbes |
| US20070031850A1 (en) * | 2003-06-05 | 2007-02-08 | Mounts William M | Nucleic acid arrays for detecting multiple strains of a non-viral species |
| US20050227275A1 (en) * | 2004-04-07 | 2005-10-13 | Access Bio, Inc. | Nucleic acid detection system |
| US7323308B2 (en) * | 2004-09-03 | 2008-01-29 | Affymetrix, Inc. | Methods of genetic analysis of E. coli |
| JP2008513409A (en) * | 2004-09-22 | 2008-05-01 | グラクソスミスクライン バイオロジカルズ ソシエテ アノニム | Immunogenic composition |
-
2007
- 2007-04-19 US US12/298,298 patent/US8206923B2/en not_active Expired - Fee Related
- 2007-04-19 WO PCT/MX2007/000052 patent/WO2007123386A1/en active Application Filing
- 2007-04-19 BR BRPI0710889-3A patent/BRPI0710889A2/en not_active IP Right Cessation
- 2007-04-19 DK DK07747198.5T patent/DK2020449T3/en active
- 2007-04-19 CN CN2007800147625A patent/CN101432440B/en not_active Expired - Fee Related
- 2007-04-19 EP EP07747198A patent/EP2020449B1/en not_active Not-in-force
- 2007-04-19 ES ES07747198T patent/ES2396453T3/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886120A (en) * | 2010-03-05 | 2010-11-17 | 江苏出入境检验检疫局动植物与食品检测中心 | Campylobacter jejuni fluorescence quantitative PCR detection kit and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2007123386A1 (en) | 2007-11-01 |
| US20100159448A1 (en) | 2010-06-24 |
| DK2020449T3 (en) | 2013-01-14 |
| BRPI0710889A2 (en) | 2011-08-16 |
| US8206923B2 (en) | 2012-06-26 |
| EP2020449A4 (en) | 2009-12-30 |
| EP2020449B1 (en) | 2012-09-26 |
| EP2020449A1 (en) | 2009-02-04 |
| ES2396453T3 (en) | 2013-02-21 |
| CN101432440B (en) | 2013-08-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101432440A (en) | Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction | |
| JP6760983B2 (en) | Direct amplification and detection of viral and bacterial pathogens | |
| CN102686728B (en) | Chimeric primers with hairpin conformation and its application method | |
| CN106434902B (en) | Multiplex PCR detects bacillus cereus virulence gene primer sets and kit and its detection method | |
| CN106868152A (en) | A kind of detection method of food-borne pathogens salmonella | |
| CN101835905B (en) | Method and kit for detection/quantification of target RNA | |
| CN102719542B (en) | Simultaneous amplification and testing reagent kit for VC (vibrio cholerae) | |
| CN107090480A (en) | The generation of nucleic acid molecules | |
| CN106011310A (en) | Method for amplifying and/or detecting nucleic acids, kits and uses of said method | |
| US20120141976A1 (en) | Method for detecting viable cells in a sample by using a virus | |
| Prasad et al. | DNA based methods used for characterization and detection of food borne bacterial pathogens with special consideration to recent rapid methods | |
| Tamerat et al. | Application of molecular diagnostic techniques for the detection of E. coli O157: H7: a review | |
| US20230265529A1 (en) | Methods and Compositions for Determining Salmonella Presence and Concentration Using PCR Primers of Varying Amplification Efficiencies | |
| CN105331688B (en) | The five weight PCR detection methods and its detection kit of pathogenic bacteria in a kind of detection fresh and live agricultural product | |
| Zende et al. | Loop-Mediated Isothermal Amplification Assay (LAMP): A Rapid Tool for Diagnosis of Food Borne and Zoonotic Pathogens: A Review | |
| CN105331610B (en) | The five weight PCR primers of pathogenic bacteria and probe and kit in a kind of detection fresh and live agricultural product | |
| JP6648559B2 (en) | Bacteria test method, primer set, bacteria test carrier, and bacteria test kit | |
| Kim | Studies on PCR-based rapid detection systems for Salmonella spp. | |
| Bej | PCR amplification of DNA recovered from the aquatic environment | |
| O’Connor | Detection of Listeria monocytogenes using a PCR/DNA probe assay | |
| JPH05176799A (en) | Method for detection and identification of pathogenic living organism using target arrangement as detection body | |
| CN106661626A (en) | Sequences and their use for detection of listeria monocytogenes | |
| Kadyan et al. | Rapid Isothermal Nucleic Acid Dependent Techniques for on-Site Diagnosis of Foodborne Pathogens | |
| KR101414303B1 (en) | Methods for Detecting Salmonella enterica subspecies | |
| Li et al. | Differential expression of ATP-dependent RNA helicase gene in viable but nonculturable Salmonella pullorum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130821 Termination date: 20190419 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |