CN101418301A - Upland cotton disease-resistant gene and use thereof - Google Patents
Upland cotton disease-resistant gene and use thereof Download PDFInfo
- Publication number
- CN101418301A CN101418301A CNA2007101761546A CN200710176154A CN101418301A CN 101418301 A CN101418301 A CN 101418301A CN A2007101761546 A CNA2007101761546 A CN A2007101761546A CN 200710176154 A CN200710176154 A CN 200710176154A CN 101418301 A CN101418301 A CN 101418301A
- Authority
- CN
- China
- Prior art keywords
- gene
- plant
- npr1
- sequence
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a disease-resistant gene of upland cotton and application of the disease-resistant gene in cultivating a disease-resistant transgenic plant. The invention initially discovers an npr1 gene which can improve the disease resistance of the plant, constructs a constitutive expression type plant expression vector containing the gene and converts the plant expression vector into a plant cell. Experiments prove that after the gene is expressed in the plant, the obtained transgenic plant remarkably improves the capacity for resisting pathogenicbacteria.
Description
Technical field:
The present invention relates to a kind of upland cotton disease-resistant gene and the application in cultivating disease-resistant transgenic plant thereof.The invention still further relates to the construct that comprises described gene, contain the recombinant expression vector of described construct, by expression vector plant transformed cell, and the transgenic plant that pathogenic bacteria is showed high resistance that produce by transformant.
Background technology
Come controlling plant diseases can bring problem of environmental pollution with chemical pesticide, and pathogenic bacteria can produce resistance.Genetic engineering means is to improve the new way of the disease resistance of plant.
Plant with the long-term common evolutionary process of pathogen in, formed complicated defense mechanism and resisted infecting of pathogen.In not affine cooperating type, the nontoxic gene (avirulence gene, avr gene) that the disease-resistant gene of plant (resistant gene, R gene) identification is special produces microspecies specificity resistance.Avr and R gene are discerned exciton (elicitor) or second messenger ROI (the Reactive Oxygen Intermediates that the back forms mutually, ROI) and Whitfield's ointment (Salicylic Acid, SA) can mediate generation anaphylaxis (Hypersensitive Response, HR), infecting position formation necrotic plaque, subsequently through the intravital defense response of a series of signal conduction activated plant, the genetic expression of coding pathogenesis-related proteins, inducing plant generation systemic acquired resistance (Systemic Acquired Resistance, SAR).
By research, some and the relevant gene of plant defense signal conduction have been found to the arabidopsis mutant body.NPR1 (none expresser of PR gene), NDR1 (non disease resistance), EDS1 (enhanced diseasesusceptibility), RAR1 (requiredfor Mla-specified resistance), SGT1 (suppressor of G2 alleleof SKP1) and Rac1 (ras-related C3 botulinum toxin substrate 1) are the signal proteins of present several involved in plant defense responses of having identified.These albumen itself do not have toxicity or restraining effect to pathogen, but participate in the regulation and control of different plant defense approach as signal element, and the overexpression of these signal elements can improve the resistance of plant to pathogenic bacteria.As overexpression npr1 in paddy rice the resistance of rice leaf spot bacteria is obviously improved.The transgenic paddy rice of constitutive expression OsRac1 shows very high resistance to rice blast.The transgene tobacco of constitutive expression sea island cotton GbSgt1, GbRar1 and GbRac1 obviously improves the resistance of red-star like disease.
Npr1 finds from Arabidopis thaliana that at first different investigators is with its difference called after npr1, NIM1 and SAI1.Npr1 is a center part in the SAR approach, and its effect is positioned after the SA accumulation, before the SAR genetic expression.The npr1 gene has a small amount of expression in normal plant, after with SA, INA processing or pathogen infection, its expression amount can improve about twice.Discover, overexpression npr1 can improve the resistance of plant to multiple pathogenic bacteria, as the transgenic arabidopsis of overexpression npr1 gene to bacterium Pseudomonas syringae pv maculicao es4326 and oomycetes pathogenic bacteria Peronospora parasitica Noco infect the generation resistance, the proteic expression amount of PR such as PR-1 also improves.
The npr1 of Arabidopis thaliana and mammiferous transcriptional regulation protein I-kB[I (kappa) B] have certain homology and a similar structure, all contain ankyrin repeat (ankyrin repeats, ANK) and the necessary phosphorylation Ser residue of functionating, think that in view of the above npr1 is the homologue of Mammals I-kB, infer that its mechanism of action is also similar.I-kB is the inhibitor of eukaryote nf NF-kB (nuclear factor-kappa B).The I-kB molecule contains 3-7 ankyrin repeat, about 33 amino-acid residues of each tumor-necrosis factor glycoproteins.NF-kB is the nucleoprotein factor that a class has multi-functional transcriptional regulation, is present in multiple tissue and the cell, has biologic activity widely, activates the back and participates in many gene transcription regulation and control.In the cell that is infected (resting cell), NF-kB is positioned at tenuigenin, the non-activity (sequestered) with I-kB monomer coupling connection, when cell is subjected to pathogen and infects, the I-kB kinases is activated, and makes the I-kB phosphorylation, the conjuncted depolymerization of NF-kB/I-kB coupling subsequently, NF-kB discharges, and activates the defence expression of gene.Discover, npr1 is usually located in the tenuigenin, form oligomer by intramolecular disulfide bond, after with SA processing or pathogen infection, change intracellular reduction potential (reduction potential), impel npr1 singulation (monomerization), these monomers are transported in the nucleus then, activate the PR expression of gene.
Arabidopis thaliana NPR1 albumen contains BTB/POZ (Broad-Complex, Tramtrack and Bric a brac)/POZ (poxvirus and zinc finger) and ankyrin repeat (ANK).The BTB/POZ structural domain generally is made up of 120 conservative amino-acid residues, mainly is positioned at the protein-bonded N-terminal of zinc finger dna, contains the BTB structural domain in the C2H2 type zinc finger transcription factor as nearly 5%-10%.ANK is present in the numerous protein family, and the number of ANK tumor-necrosis factor glycoproteins can be between 2 to 20 in the albumen.Former studies shows that BTB and ankyrin repeat participate in the mutual work between albumen and the albumen, infers that NPR1 may be by participating in regulating the plant defense that SA mediates with other proteic interaction.The protein that has now proved a kind of TGA of the belonging to family in the Arabidopis thaliana can interact with npr1 expression of gene product, regulates the PR expression of gene by both combinations.TGA albumen belongs to bZIP (basic domain/Leu Zipper) transcription factor, as the defense response of positive and negative regulon mediated plant.In Arabidopis thaliana, when no SA, TGA1 exists with oxidation state, and two conservative halfcystines (Cys) residue forms disulfide linkage.The accumulation of SA is reduced the Cys residue, and the TGA1 that goes back ortho states can interact with NPR1.Interaction between the two strengthens the TGA1 that goes back ortho states and combines with the SA regulating and controlling sequence of many PR gene promoter areas specifically, regulation and control PR expression of gene.In addition, transcription factor WRKY regulates and control the npr1 expression of gene at transcriptional level.WRKY albumen is that the DNA that is present in the higher plant of a class is conjugated protein, can discern defense minister's correlation gene promoter region, be the W frame of core sequence with TGAC, exciton response element as tobacco I type chitinase gene CHN50 promoter region is a W frame, and this W frame can be discerned specifically by the WRKY albumen of pathogenic bacterium inducing.Have three W-frames in the Arabidopis thaliana npr1 promotor, the WRKY albumen of SA abduction delivering can combine with these W frame specificitys, at transcriptional level the expression of npr1 is regulated and control.
But do not see the report of exploitation upland cotton disease-resistant gene npr1 in the prior art.
Summary of the invention
The objective of the invention is the proteic nucleotide sequence of exploitation coding upland cotton Gh-NPR1, for the plant broad spectrum antidisease gene engineering provides new GENE SOURCES.
The invention provides coding upland cotton Gh-NPR1 proteic nucleotide sequence Gh-npr1, its sequence or is carried out disappearance, interpolation and/or the replacement of one or several Nucleotide to described sequence shown in SEQ IDNO:1, but the constant sequence of function.
According to nucleotide sequence of the present invention, wherein, the aminoacid sequence of Gh-NPR1 of its coding shown in SEQ ID NO2, or described sequence carried out one or several amino acid whose disappearance, interpolation and/or replacement, but the constant aminoacid sequence of function.
Nucleotide sequence provided by the invention is lacked, adds and/or replaces one or several Nucleotide, and the disappearance, the interpolation that produce and/or replace the protein that one or several amino-acid residue produces, be defined as functional derivatives, they still have by knowing the function that technology can be verified in this area.This functional derivatives can produce by following method: utilize nucleotide sequence disclosed by the invention, the recombinant technology that is undertaken by method well known in the art or open method; Utilize chemical peptide chain synthetic technology; By revising aminoacid sequence provided by the invention, produce the aminoacid sequence consistent with function of the present invention.
The invention still further relates to the plant expression vector of in vegetable cell, expressing, contain aforesaid nucleotide sequence.
According to plant expression vector of the present invention, this carrier comprises:
A) 5 ' non-translational region
B) nucleotide sequence of coding Gh-npr1 gene;
C) 3 ' non-translational region.
According to plant expression vector of the present invention, wherein a) described 5 ' end non-coding region comprises enhancer sequence, promoter sequence and translation enhancement sequences, and b) nucleotide sequence shown in the SEQ ID NO1 is used alone or in combination; C) described 3 ' end non-translational region comprises the terminator sequence.
The present invention relates to aforesaid nucleotide sequence, the transfer-gen plant that aforesaid plant expression vector is used to improve the purposes of plant disease-resistant ability and obtains pathogenic bacteria is had resistance according to the present invention.
The present invention relates to use method as known in the art, with the nucleotide sequence of Gh-npr1 gene shown in the SEQ ID NO1 provided by the invention be connected to any can the carrier of self-replacation in bacterial cell or vegetable cell on.
The invention still further relates to the expression vector that will obtain imports in the vegetable cell, the method that imports all is well known to those skilled in the art, and these methods are including but not limited to agriculture bacillus mediated conversion method (Agrobacterium-mediated transformation) 1); 2) physics method is as particle bombardment (Particle bombardment or Particle gun or Gene gun), electric shocking method (Electroporation), microinjection (Microinjection), supersonic method (Ultrasonic), laser microbeam method (Laser microwave), silicon carbide fiber mediated method (Silicon carbidefiber), electrophoretic method (Electrophoretic transfection) etc.; 3) chemical method is as the conversion method of PEG mediation, liposome-mediated conversion method etc.; 4) germplasm system conversion method is as pollen-mediated method, pollen tube passage method (ovary injection), infusion method etc.; 5) with conversion methods that virus vector was mediated such as cauliflower mosaic virus (CaMV), geminivirus infection (Geminiviruses) or RNA viruses or the like.
According to expression vector of the present invention, it can further comprise selectable marker gene and reporter gene.
According to expression vector of the present invention, described selectable marker gene is a neomycin phosphotransferase gene.
Plant of the present invention refers to contain the plant and the offspring thereof of aforesaid plant expression vector, comprises the part of plant seed, whole plant or plant materials or histoorgan, cell.
In one embodiment of the invention, used plant is a tobacco.
In the present invention, the recombinant plant expression vector that will comprise the Gh-npr1 gene imports tobacco by agrobacterium-mediated transformation, has obtained transgene tobacco, detects by PCR and Southern hybridization, and the result shows that goal gene has been incorporated in the tobacco gene group.With the excised leaf inoculation method transgene tobacco is carried out disease resistance and identify, find that transgene tobacco obviously improves the resistance of brown spot pathogen.It is considered herein that the Gh-npr1 gene can excite the systemic acquired resistance of plant, improve the resistance against diseases of plant, in the plant broad spectrum antidisease gene engineering, have broad application prospects.
The present invention utilizes homologous sequence cloning and RACE technology to clone upland cotton disease-resistant signal element npr1 gene, and it has the nucleotide sequence shown in the SEQ ID NO1, and the aminoacid sequence of this nucleotide sequence encoding protein is shown in SEQ ID NO2.
For make foreign gene in vegetable cell transcribe with translation skill on obtain to efficiently express, must be connected with suitable expression regulation element at the foreign gene flank.Designed among the present invention in recipient plant, efficiently expressing the required promotor of Gh-npr1 gene, enhanser, terminator, polyadenylic acid sequence and being convenient in suitable substratum screening by the selectable marker gene of transformant etc.
According to a preferred embodiment of the invention, in the constructed plant expression vector of the present invention, described 5 ' non-coding region is by 2 enhancer sequence, a promoter sequence.
Be suitable for being connected with Gh-npr1 gene of the present invention, and start in vegetable cell that this DNA sequences encoding transcribes beginning comprise composing type, induction type, tissue or organ specificity or specific promotor of etap.Include but not limited to cauliflower mosaic virus (CaMV) 35S or 19S promotor, mannopine synthetic enzyme (MAS) promotor, rouge alkali synthetase and octopine synthase promoter, the maize alcohol dehydrogenase promotor, diphosphoribulose carboxylase/oxygenase small subunit promotor, promotor by the mannopine synthase gene merges the promotor that forms mutually with the 35S promoter of cauliflower mosaic virus, the 35S promoter that has the cauliflower mosaic virus of two enhancement sequences, the pathogenic bacterium inducing promotor, the promotor of tissue or organ or growth specifically expressing, and the Ubi that is suitable in monocotyledons, expressing, Emu, ActinI promotor etc.The present invention preferably has the 35S promoter of the cauliflower mosaic virus of two enhancer elements.
According to a preferred embodiment of the invention, in the constructed high-efficiency plant expression vector of the present invention, said 3 ' non-coding region comprises a multi-joint termination codon subsequence, and a mRNA cutting sequence and a mRNA cut post-treatment sequence and polyadenylic acid sequence.
In addition, be applicable to that Gh-npr1 efficient expression vector of the present invention also comprises the terminator sequence, as comprise the terminator or the like of the two-way terminator of T-DNA7 ' 5 ', octopine synthase gene terminator, cauliflower mosaic virus 35S RNA terminator or nopaline synthase (Nos) gene or other genes of plasmid pTiA6.The terminator of the preferred Nos gene of the present invention.
Can use method as known in the art, with the fusion gene construct that is suitable in vegetable cell expressing Gh-npr1 provided by the invention, be connected to any can the carrier of self-replacation in bacterial cell or vegetable cell on.Such carrier for example comprises and is derived from colibacillary plasmid vector pUC18, pUC19 (Yanisch-perronet al., Gene 33:103-119,1985), plant expression vector pBI101 especially, pBI121, (the Jefferson of pBI131 system, et al., EMBO J.16:3901,1987) and (the Hajdukiewicz et al. of pCamBia system, Plant Mol Biol 25:989-994,1994; Hiei et al., The Plant J 6:271-282,1994) or the like.In a preferred embodiment of the invention, the carrier that carries the Gh-npr1 gene construct is pBlueScriptSK, pUC18, pUC19, pCamBia2301 etc., and the latter is particularly suitable for the instrument plasmid vector as the preparation plant bivalent expression vector.
Certainly, as previously mentioned, in order correctly to select and to identify by the plant transformed cell, but above-mentioned recombinant expression vector of the present invention also should contain selectable marker gene.The both sides of employed selectable marker gene can have adjusting sequence separately, to impel their expression in plant.The selective marker that is suitable for is known in the art.Foreign gene and other genes of coding selective marker can be contained in the same expression vector, perhaps are contained in when transforming in the simultaneously applied different carrier.The preferred selectable marker gene of the present invention is the NPTII gene, and together is contained in the same recombinant expression vector, thereby has guaranteed the reliability selected by transformant or plant.
Conclusion is got up, and the plant bivalent expression vector that is suitable for expression Gh-npr1 in vegetable cell provided by the invention comprises:
1) Gh-npr1 expression casette;
A) 5 ' non-coding region;
B) nucleotide sequence of coding Gh-npr1 gene;
C) 3 ' non-coding region.
2) derive from the carrier part of pCamBia2301:
A) NPTII expression cassette;
B) initial replicon and the functional structures such as T-DNA left and right sides border sequence relevant with Plant Transformation.
Can pass through the DNA recombinant technology by the resulting nucleotide sequence that meets SEQ ID NO1 of the present invention, be connected in the expression vector recited above, and make it to import and be incorporated in the Plant Genome.And the expression of Ghnpr1 gene in target plant can be given this plant pathogenic bacteria is had stronger resistance.
Be noted that expression vector recited above is a preferred embodiment of the present invention, it does not limit the present invention.Every application constructed any expression vector of Gh-npr1 gene described in the invention includes within the present invention.Comprise following implementation:
1 with other one or more gene fusion, the expression vector that makes up multivalent genetic also changes plant over to;
2 with other one or more gene recombination, construction of expression vector also imports plant;
3 is collaborative mutually with other one or more genes, makes up plant expression vector respectively, imports same kind of plant acceptor simultaneously or step by step.
For in vegetable cell, expression alien gene in the particularly whole strain plant must use appropriate means will carry in the reorganization bivalent expression carrier conversion of Gh-npr1 gene or transduce appropriate host cell or the plant materials.
With recombinant vectors importing host plant or its intracellular many methods of carrying foreign gene all is well known to those skilled in the art.These methods are including but not limited to agriculture bacillus mediated conversion method (Agrobacterium-mediated transformation) 1); 2) physics method is as particle bombardment (Particle bombardment or Particle gun or Gene gun), electric shocking method (Electroporation), microinjection (Microinjection), supersonic method (Ultrasonic), laser microbeam method (Laser microwave), silicon carbide fiber mediated method (Silicon carbidefiber), electrophoretic method (Electrophoretic transfection) etc.; 3) chemical method is as the conversion method of PEG mediation, liposome-mediated conversion method etc.; 4) germplasm system conversion method is as pollen-mediated method, pollen tube passage method (ovary injection), infusion method etc.; 5) with conversion methods that virus vector was mediated such as cauliflower mosaic virus (CaMV), geminivirus infection (Geminiviruses) or RNA viruses or the like.
Therefore, dna sequence dna, aminoacid sequence, the high-efficiency plant expression vector of the Gh-npr1 gene that the present invention relates to encode, and consequent phytopathogen is had the transgenic plant cells of resistance and the transgenic plant that obtained by transgenic plant cells.
In addition, the present invention also provides the method that obtains pathogenic bacteria is had the plant of resistance, and this method comprises:
1) makes up the plant expression vector that contains the Gh-npr1 gene;
2) with any methods known in the art with 1) in the expression vector that obtains import vegetable cell, and obtain pathogenic bacteria is had the transgenic plant and the offspring of resistance thus, comprise the whole strain of any plant, partly, organ or tissue and seed.
What particularly point out is, though be that example is described the present invention in detail in the following embodiments with the transgene tobacco, and do not mean that Gh-npr1 gene of the present invention and expression vector only are applicable to and produce the transgene tobacco with resistance against diseases.Therefore, every use Gh-npr1 gene of the present invention and expression vector thereof, change any plant or its tissue or cell over to any method known in the art, and thus obtainedly have plant, seed and the offspring of resistance against diseases and part organ, tissue or the cell of plant materials includes in the present invention.
Description of drawings:
Fig. 1 is a plant expression vector pFNPR1 synoptic diagram.Wherein, Nos P: the promotor of rouge alkali synthetase gene Nos; NptII: neomycin phosphotransferase gene provides kalamycin resistance; Nos T: the terminator of rouge alkali synthetase gene Nos; 2E: two cauliflower mosaic virus CaMV 35S enhansers; 35S P: cauliflower mosaic virus CaMV 35S promoter; The RB:T-DNA right margin; The LB:T-DNA left margin.
Fig. 2 is that the anti-Alternaria alternate excised leaf of transgene tobacco is identified, wherein, and a left side: transgene tobacco blade; Right: non-transgenic NC89 blade.
Embodiment:
The clone of embodiment 1 Gh-npr1 gene
1.2.1 the clone of Gh-npr1 gene fragment
Utilize improved method of CTAB to extract cotton DNA, conserved sequence according to known npr1 designs degenerated primer p-F1 (5 ' agg cac (t) tt (g) g ac (t) t cng atg ata (g) tt (a) g a3 ') simultaneously, p-R1 (5 ' tcc (t) c (t) tc (a, t) cg (t) c ata (c) gcagca at (c) g (a) tga ag3 '), by Touch-Down pcr amplification gene fragment.The PCR reaction conditions is: 94 ℃ of sex change 5min; 94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 1min, 2 circulations; 94 ℃ of 30sec, 58 ℃ of 30sec, 72 ℃ of 1min, 2 circulations; 94 ℃ of 30sec, 56 ℃ of 30sec, 72 ℃ of 1min, 2 circulations; 94 ℃ of 30sec, 54 ℃ of 30sec, 72 ℃ of 1min, 2 circulations; 94 ℃ of 30sec, 52 ℃ of 30sec, 72 ℃ of 1min, 30 circulations; 72 ℃ are extended 5min.1.2.2Gh-npr1 the acquisition of gene cDNA 3 ' end.
According to the gene fragment design special primer primer F2:5 ' taactttggatgatgctactgcactccat3 ' that obtains.Utilize hot CTAB method to extract the blade RNA of upland cotton 7124.With reference to 3 ' RACE (TaKaRa, Japan) test kit specification sheets, with 3 Sites Adaptor Primer (5 ' ctgatctagaggtaccggatcc3 ') and p-F2 is primer, and the cDNA that obtains with cotton leaf RNA reverse transcription is a template, and pcr amplification obtains Gh-npr1 3 ' end products.The PCR reaction conditions is: 94 ℃ of sex change 5min; 94 ℃ of 30s, 66 ℃ of 30s, 72 ℃ of 2min, 30 circulations; 72 ℃ are extended 5min.To the pMD18-T carrier, the thermal shock method transforms DH5 α with the purpose fragment cloning that obtains, and the Screening and Identification positive colony checks order to positive colony, obtains 3 ' terminal sequence of gene.
1.2.3 the acquisition of Gh-npr1 gene cDNA 5 ' end
Design and synthesize primer p-R2:5 ' tgccttcaccatcagagagagact3 ' and p-R3:5 ' acagtggaaagcaaccacgaggat3 ' according to the gene order that obtains, according to GeneRacer
TM(Invitrogen, USA) specification sheets at first carry out dephosphorization, raise one's hat blade RNA RACE Ready cDNA test kit, add GeneRacer at 5 ' end then
TMRNAOligo utilizes SuperScirpt
TMThermoScript II, with oligo dT is that primer carries out reverse transcription, with 5 ' RACE primer (5 ' cgactggagcacgaggacactga3 ') and p-R2 (5 ' tgccttcaccatcagagagagact3 '), nested primer (5 ' ggacactgacatggactgaaggagta 3 ') carries out nested PCR with p-R3 (5 ' acagtggaaagcaaccacgaggat 3 ') and obtains 5 ' end products at last.The PCR reaction conditions is: 94 ℃ of sex change 4min; 94 ℃ of 45s, 64 ℃ of 1min, 72 ℃ of 1.5min, 30 circulations; 72 ℃ are extended 5min.The product that RACE obtains be connected to pMD18T-Vector (TaKaRa, Japan) on, Screening and Identification positive colony, and carry out sequencing obtains 5 ' terminal sequence of gene.
1.2.4 the acquisition of Gh-npr1 full length gene cDNA
Obtain the Gh-npr1 full-length cDNA with DNAMAN software analysis assembling 5 ' and 3 ' sequence,
The structure of embodiment 2 plant expression vectors
Upland cotton npr1 cDNA sequence according to obtaining designs primer p-F3 (5 ' ggcctcgagatggcttatttgtctgagccatcatct 3 ') and p-R4 (5 ' cgtctcgagtcacaatttcctatacttgtagg 3 ') respectively.For making things convenient for vector construction, introduce Xho I restriction enzyme site at the 5 ' end of p-F3 and the 3 ' end of p-R4.The first chain cDNA that obtains with blade RNA reverse transcription is that template is carried out pcr amplification, and reaction conditions is: 94 ℃ of sex change 4min; 94 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1.5min, 30 circulations; 72 ℃ are extended 5min.Target gene fragment is connected among the pMD18-T-Vector, obtains pMD-npr1, cuts the pMD-npr1 plasmid with Xho I enzyme, and it is standby to reclaim the Gh-npr1 gene fragment.Cut pBI121 and pT Ω 4A with EcoRI/Hind III enzyme, reclaim the band of 12kb and 1.4kb size respectively, connect the back and constitute intermediate carrier pB4A.Cut this intermediate carrier with Xho I enzyme, reclaim the band of 13.4kb size, reassemble into plant expression vector pF-npr1 with the Gh-npr1 fragment.The Gh-npr1 gene is driven by the CaMV 35S promoter that has two enhancer, and 3 ' end is poly (A)
nTail and NOS terminator (Fig. 1).
Present embodiment utilizes agrobacterium-mediated transformation, successful acquisition have a transgene tobacco of Gh-npr1 gene.
The tobacco receptor material that adopts is NC89, and Agrobacterium is LBA4404, and the concrete operations step is as follows:
1) the competent preparation of agrobacterium tumefaciens lba4404
(1) picking list bacterium colony from the flat board is inoculated into 5ml YEB liquid nutrient medium (containing Streptomycin sulphate Strep 125mg/L), and 28 ℃, 250rpm shaking culture spend the night;
(2) get 2ml bacterium liquid, add in the 50ml YEB liquid nutrient medium (containing Strep125mg/L), 28 ℃, 250rpm shaking culture are to OD
600About about 0.6;
(3) bacterium liquid is gone in the aseptic centrifuge tube of 50ml ice bath 30min.The centrifugal 5min of 5000rpm;
(4) abandon supernatant, precipitation 2ml20mM CaCl
2Resuspended, every part 100 μ l branch installs in the 1.5ml centrifuge tube, preserves standby in the liquid nitrogen.
2) recombinant plasmid dna changes Agrobacterium over to
(1) p2301GAT, p2301G2 and the p2301G2-gat plasmid DNA with about 1 μ g joins in the 100 μ l LBA4404 competent cells mixing, ice bath 5min respectively;
(2) centrifuge tube is put freezing 8min in the liquid nitrogen, gone to temperature bath 5min in 37 ℃ of water-baths rapidly;
(3) add 1ml YEB liquid nutrient medium, 250rpm recovery 4-5h on 28 ℃ of shaking tables;
(4) get an amount of bacterium liquid and be applied on the YEB solid medium that contains Strep250-300mg/L, Rif (Rifampin) 250-300mg/L and Kan (kantlex) 100mg/L, put 28 ℃ and cultivate 24-48h.
3) leaf dish method transformation of tobacco kind NC89
(1) activation of Agrobacterium
The single bacterium colony of picking Agrobacterium is inoculated into (Kan 100mg/L, Strep100mg/L, Rif 300mg/L) in the 5ml YEB liquid nutrient medium from the flat board, and shaking culture is spent the night; Get 1ml bacterium liquid and be inoculated in the 50ml YEB liquid nutrient medium (Kan100mg/L, Strep 100mg/L, Rif 300mg/L), thermal agitation is cultured to OD
600Be 0.4-0.5 (about 3-4h); 5, the centrifugal 5min of 000rpm, thalline MS
0Substratum (not containing hormone) is resuspended, makes OD
600Be 0.1-0.2;
(2) genetic transformation of tobacco
A) cultivate altogether: the leaf piece that will infect is placed on the tobacco bud division culture medium (MS+IAA0.5mg/L+6-BA 2mg/L) that is covered with 2 metafiltration paper, 25 ℃ of dark cultivations 4 days;
B) screening of resistant buds: will transfer on the resistant buds screening culture medium (MS+IAA 0.5mg/L+6-BA 2mg/L+Kan 100mg/L+Cef (Reflin) 500mg/L) through the tobacco explant of cultivating altogether, and can sprout after 2～3 weeks;
Take root: when treating resistant buds length, it is transferred on the root media (MS+Kan 100mg/L+Cef 500mg/L), promptly have adventive root to form after 1～2 week to the 1cm left and right sides.
The disease resistance of embodiment 4 transgene tobaccos is identified
1) cultivation of tobacco brown spot pathogen:, be re-seeded into solid potato culture medium (PDA substratum: 2% potato piece with inoculating needle picking brown spot pathogen culture; 2% sucrose; 2% agar) on, put in 25 ℃ of incubators and secretly cultivate.
2) spore preparation: add the distilled water of 2ml sterilization on the red-star like disease pathogenic bacteria flat board in two weeks of growth, spend the night, collect spore, it is 5 x 10 that microscopy is adjusted spore concentration
4/ mL.
3) get grow fine, tobacco plant and 10 strain acceptor tobaccos (contrast) that Gh-npr1 is changeed in 15 strains of homogeneous are used for detection, win the 3rd leaf in top, blade back places on the aseptic wet gauze up, make microtrauma with quartz sand, inoculate 10 μ l spore suspensions in the wound, in the inoculation 24h, keep 100% relative humidity.
4) inoculation back investigation in 1～7 day incidence.Treat to repeat to connect the bacterium test after selected plant grows young leaves, repeat altogether 3 times.
Test-results is identified the resistance of transgene tobacco to Alternaria alternate with the excised leaf method as shown in Figure 2.The control group blade is after inoculation 2～3 days, and inoculation position begins necrosis, and in the time of 5 days, inoculation position forms the black scab, and the superfluous white hypha of giving birth to, flavescence around the scab, show the Alternaria alternate spore germination after, successfully infect in the leaf tissue.In tobacco, 5 strains (1,3,5 are arranged for the commentaries on classics Gh-npr1 that tries, 6,11) resistance level significantly improves, and when inoculating 3 days, inoculation position does not have considerable change, when inoculating 5 days, the site of injury that inoculation position is made is slightly downright bad, shows tangible hypersensitive necrosis reaction, and scab is not seen further expansion.
The information of SEQ ID NO:1:
(I) sequence signature:
(A) title: Gh-npr1 gene
(B) length: 1764 base pairs
(C) type: Nucleotide
(D) chain: strand
(E) topological framework: linearity
(II) molecule type: the nucleotide sequence of coding Gh-npr1 gene
(III) suppose: non-
(IV) antisense: non-
The information of SEQ ID NO:2:
(I) sequence signature:
(A) title: Gh-NPR1 albumen
(B) length: 587 amino acid
(C) type: amino acid
(D) chain: strand
(E) topological framework: linearity
(II) molecule type: the aminoacid sequence of Gh-npr1 gene
(III) suppose: non-
(IV) antisense: non-
Sequence table SEQ UENCE LISTING
＜110〉Biological Technology institute, Chinese Academy of Agricultural Sciences
＜120〉upland cotton disease-resistant gene and application thereof
<130>07-11
<160>2
<170>PatentIn?version3.3
<210>1
<211>1764
<212>DNA
＜213〉artificial sequence
<400>1
<210>2
<211>587
<212>PRT
＜213〉artificial sequence
<400>2
Claims (5)
1. dna sequence dna that improves disease resistance of plant is shown in SEQ ID NO:1.
2. the aminoacid sequence of the described dna sequence encoding of claim 1 is shown in SEQ ID NO:2.
3. the recombinant vectors that comprises the described DNA of SEQ ID NO:1.
4. with the described recombinant vectors transformed host cells of claim 3.
5. the described dna sequence dna of claim 1 is in the application of cultivating the transgenic plant of improving disease resistance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101761546A CN101418301A (en) | 2007-10-22 | 2007-10-22 | Upland cotton disease-resistant gene and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101761546A CN101418301A (en) | 2007-10-22 | 2007-10-22 | Upland cotton disease-resistant gene and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101418301A true CN101418301A (en) | 2009-04-29 |
Family
ID=40629303
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007101761546A Pending CN101418301A (en) | 2007-10-22 | 2007-10-22 | Upland cotton disease-resistant gene and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101418301A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127550A (en) * | 2010-11-24 | 2011-07-20 | 江苏省农业科学院 | Plant NPR1 (Non-Expressor of PR (Pathogenesis-Related 1)) gene, encoded protein and applications thereof |
| CN108823239A (en) * | 2018-06-07 | 2018-11-16 | 浙江大学 | A kind of raising disease resistance of plant carrier and its application |
| CN110396520A (en) * | 2019-08-30 | 2019-11-01 | 山东省花生研究所 | One cultivate peanut AhNPR1 gene and its improve peanut disease resistance in application |
-
2007
- 2007-10-22 CN CNA2007101761546A patent/CN101418301A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127550A (en) * | 2010-11-24 | 2011-07-20 | 江苏省农业科学院 | Plant NPR1 (Non-Expressor of PR (Pathogenesis-Related 1)) gene, encoded protein and applications thereof |
| CN102127550B (en) * | 2010-11-24 | 2013-04-10 | 江苏省农业科学院 | Plant NPR1 (Non-Expressor of PR (Pathogenesis-Related 1)) gene, encoded protein and applications thereof |
| CN108823239A (en) * | 2018-06-07 | 2018-11-16 | 浙江大学 | A kind of raising disease resistance of plant carrier and its application |
| CN110396520A (en) * | 2019-08-30 | 2019-11-01 | 山东省花生研究所 | One cultivate peanut AhNPR1 gene and its improve peanut disease resistance in application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105802933B (en) | Herbicide tolerance protein, coding gene and application thereof | |
| US8829170B2 (en) | Construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences | |
| CN1230592A (en) | Cotton curve leaf disease virus promoter and its application | |
| US5418153A (en) | Process for production of exogenous gene or its product in plant cells | |
| CN101418301A (en) | Upland cotton disease-resistant gene and use thereof | |
| Özcan et al. | Selectable marker genes engineered for specific expression in target cells for plant transformation | |
| JP6202832B2 (en) | Environmental stress-tolerant plant having high seed yield and its production method | |
| CN100549029C (en) | One plant disease resistance-related SGT1 and encoding gene and application | |
| CN102146402B (en) | Promoter BgIosP594 , preparation method and application | |
| Zakharchenko et al. | Enhanced resistance to phytopathogenic bacteria in transgenic tobacco plants with synthetic gene of antimicrobial peptide cecropin P1 | |
| EP2013231B1 (en) | P15 hairpin constructs and use | |
| CN103320448A (en) | Lilium regle bZIP transcription factor LrbZIP1 and application | |
| CN102146410B (en) | BgIosP526 promoter, preparation method and application of BgIosP526 promoter | |
| CN102295688B (en) | Plant fiber length related protein, and coding gene and application thereof | |
| CN1316023C (en) | Photoinduction expressed Gacab promoter and its expression function in different segments | |
| CN102146406B (en) | Promoter BgIosP535, and preparation method and use thereof | |
| CN102146399B (en) | Promoter BgIosP581 as well as preparation method and application thereof | |
| CN102146397B (en) | BgIosP549 promoter, preparation method and application | |
| CN100510065C (en) | Multiple menace induced peroxidase promoter derived from sweet potato | |
| CN101003570A (en) | Plant against disease relevant protein RAR1, and coding gene, and application | |
| CN102146398B (en) | Promoter BgIosP537, and preparation method and use thereof | |
| JP2003334087A (en) | Promoter originated from plant virus | |
| CN102146405B (en) | Promoter BgIosP529, and preparation method and use thereof | |
| CN102146409B (en) | Promoter BgIosP522 as well as preparation method and application thereof | |
| CN102146385A (en) | Promoter BgIosP576, and preparation method and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090429 |