CN101418277A - Aminoglutaric acid genetic engineering high-producing strains and use thereof - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a high-yield bacterium of glutamic acid genetic engineering and application thereof. The bacterium is corynebacterium glutamicum with deleted dtsR1 gene and over-expression of pyc gene. The invention adopts a carrier pK19mobsacB to knock out the gene dtsR1 of the corynebacterium glutamicum, uses kanamycin resistance and sucrose as selective pressure respectively to obtain a knockout gene strain deltad, and uses a carrier pVWEx1 to lead the pyc gen into an over-expressed pyruvic acid carboxylase in the deltad, thereby directionally reforming and optimizing a glutamic acid biosynthetic path to construct a genetic engineering bacterium deltad-pyc through a gene knockout technology and gene over-expression. The bacterium can improve the yield of glutamic acid and can be used for the mass production of the glutamic acid industrially.

Description

Aminoglutaric acid genetic engineering high-producing strains and application thereof

Technical field

The invention belongs to gene engineering technology field, relate to and utilize genetic engineering technique to transform Corynebacterium glutamicum obtain recombinating L-glutamic acid high yield bacterium and preparation method thereof and the application that utilizes high yield bacterium fermentative production L-glutamic acid aspect.

Background technology

L-glutamic acid is to constitute one of proteinic main amino acid, has widely at food, medicine, aspect agriculture and uses.Aspect food applications, monosodium glutamate not only has intensive meat delicate flavour, and has nutritive value, thereby often is used to foodstuff flavouring.Aspect medical applications, Sodium Glutamate and Potassium glutamate injection liquid and glutamic acid tablet can be used for preventing and treating hepatic coma, separate the ammonia poison, the protection liver, this is the easy and blood ammonia formation paddy phthalein amine in back because L-glutamic acid is absorbed by the body, thereby removes the toxic action of ammonia in the metabolic process; In addition, Sodium Glutamate mixes with VITMAIN B1, B6 and glucose and can be made into the intravenous drip injection liquid, and Calcium glutamate can share with VITAMIN, to strengthen the absorption of calcium.Aspect agricultural application, cupric glutamate can be used as tomato protectiveness and control property sterilant; L-glutamic acid cooperates with some hormone, can be made into the oranges and tangerines sweetener, because L-glutamic acid can increase the sugar degree of citrusfruit, reduces its acidity; In addition, L-glutamic acid cooperates with some physiologically active substance, can develop the plant-growth regulator that makes new advances; L-glutamic acid is also the same with some other amino acid to can be used as little fertile carrier.

The production of L-glutamic acid mainly is to utilize Corynebacterium glutamicum Corynebacterium glutamicum fermentative production at present.Corynebacterium glutamicum C.glutamicum is that people such as Kinoshita separates from nature and obtains nineteen fifty-seven, this is a kind of aerobic, asporogenous gram positive bacterium, the genome size is 3282kb, it can not only utilize glucose to grow for sole carbon source, and can utilize other organic acid of comprising acetate and succsinic acid and carbohydrate to grow for sole carbon source or mixed carbon source.Corynebacterium glutamicum C.glutamicum is the vitamin H defective type, and needing to replenish vitamin H could grow.When the vitamin H in the substratum was excessive, thalline did not produce L-glutamic acid to cell exocrine; When vitamin H is limited the quantity of when adding, thalline then in a large number secretion produce L-glutamic acid, thereby the Corynebacterium glutamicum of wild-type can be limited the quantity of by vitamin H and added secretion inducing and produce L-glutamic acid.In addition, under the excessive situation of vitamin H, also can induce the excessive synthetic L-glutamic acid of Corynebacterium glutamicum by adding certain tensio-active agent such as Twee40 or Tween60.

Although existing many about the heredity of Corynebacterium glutamicum and the research of Physiology and biochemistry aspect, the molecule mechanism that the excessive synthetic justacrine of Corynebacterium glutamicum C.glutamicum produces L-glutamic acid still is in conceptual phase.Propose the seepage model as far back as people such as nineteen sixty-five Takinami, think that the secretion of L-glutamic acid is the result that the cytolemma physicochemical characteristic changes.Yet up-to-date studies show that about L-glutamic acid anabolism stream aspect, the change of L-glutamic acid biosynthetic pathway is brought into play keying action in L-glutamic acid production, in relevant nearly all amino acid whose fermentative production research, the change of metabolism stream is considered to improve the most important factor of thalline production intensity.Discover that ketoglurate dehydrogenase complex body (ODHC) is crucial rate-limiting enzyme in the biosynthetic pathway (Fig. 1) of L-glutamic acid.Vitamin H is limited the quantity of and is added the synthetic inductive condition of L-glutamic acid such as Tween40 or Tween60 and all can cause the active decline of ODHC, and the ODHC activity of decline makes metabolism stream flow to the L-glutamic acid compound direction at ODHC tapping point place.People such as Kimura found that the active decline of DtsR albumen (acetyl CoA carboxylase complex body β subunit) can cause the active decline of ODHC in 1999.The proteic encoding gene of DtsR is dtsR1, total length 1632bp.

L-glutamic acid efficient synthetic also depends on the approach of filling a vacancy provides competent oxaloacetic acid and acetyl-CoA, because the precursor citric acid (Fig. 1) of oxaloacetic acid and acetyl-CoA reaction can formation L-glutamic acid.The approach of filling a vacancy is considered to one of bottleneck of the excessive synthetic L-glutamic acid of Corynebacterium glutamicum.Two reactions of filling a vacancy of main existence in Corynebacterium glutamicum C.glutamicum: the one, generate oxaloacetic acid (OAA) by phosphoric acid enol pyruvic acid carboxylase (PEPC) catalysis phosphoenolpyruvic acid; The 2nd, pyruvate carboxylase (PC) catalysis pyruvic acid generates OAA.The encoding gene of PEPC is ppc, total length 2760bp; The PC encoding gene is pyc, total length 3423bp.The activity of PEPC activity in Corynebacterium glutamicum is lower, and relatively stable, and the activity of PC is then unstable relatively.Metabolic flux analysis finds with gluconate or pyruvic acid to be carbon source when carrying out amino acid fermentation that the carbon distributions between PEPC and the PC is 10/90.Research finds that also gene ppc deletion mutantion strain compares with its wild type strain, cell growth and amino acid are synthetic all not to be affected, the disappearance of gene pyc can obviously reduce the cell growth and amino acid synthesizes, thereby PC catalytic fill a vacancy to be reflected in the amino acid production occupy an leading position, be the main path that replenishes oxaloacetic acid.

Do not have as yet at present and utilize the gene knockout technology to knock out dtsR1 and adopt the gene overexpression technology to cross to express the combine report of transformation glutamate producing bacterium of PC.

Summary of the invention

The object of the present invention is to provide a kind of genetic engineering bacterium of high yield L-glutamic acid.

Another object of the present invention provides the preparation method of said gene engineering bacteria.

A further object of the invention provides the application of said gene engineering bacteria in producing L-glutamic acid.

The present invention utilizes genetic engineering technique to transform L-glutamic acid high yield bacterium, and by gene knockout with cross the synthetic relevant rate-limiting enzyme gene of expression L-glutamic acid, change metabolism stream makes it mobile to the L-glutamic acid compound direction, thereby bacterial classification is carried out directional transformation.

Design philosophy of the present invention is to knock out the dtsR1 gene in Corynebacterium glutamicum, promptly reduces the DtsR protein-active, can suppress the activity of ODHC, thereby makes metabolism stream flow to the L-glutamic acid compound direction, improves glutamic acid yield.In addition, in Corynebacterium glutamicum, cross and express the OAA that the pyc gene can provide competent L-glutamic acid to need in synthetic, improve the synthetic output of L-glutamic acid.

The objective of the invention is to realize by following technical measures:

The genetic engineering bacterium of high yield L-glutamic acid, this bacterium are disappearance dtsR1 genes and cross the Corynebacterium glutamicum of expressing the pyc gene.

Described genetic engineering bacterium wherein makes the method for Corynebacterium glutamicum disappearance dtsR1 gene may further comprise the steps:

A. be template with the Corynebacterium glutamicum gene group, amplification dtsR1 gene upstream and downstream segment couples together this upstream and downstream segment then, forms dtsR1 genetically deficient fragment;

B. dtsR1 genetically deficient fragment is inserted shuttle vectors, make up the dtsR1 gene knockout carrier;

C. the dtsR1 gene knockout carrier that makes up is imported Corynebacterium glutamicum, adopt screening culture medium to cultivate, the clone bacterium of gained is the Corynebacterium glutamicum of dtsR1 genetically deficient.

Described genetic engineering bacterium wherein makes the method for Corynebacterium glutamicum disappearance dtsR1 gene may further comprise the steps:

A. be template with the Corynebacterium glutamicum gene group, utilize the PCR method dtsR1 gene upstream and downstream segment that increases respectively by upstream pulsating primer SEQ ID No.1 and SEQ ID No.2 and downstream segment primer SEQ ID No.3 and SEQ ID No.4, adopt overlap PCR method (overlapping PCR method) that dtsR1 gene upstream and downstream segment is coupled together by primer SEQ ID No.1 and SEQ ID No.4 again, form dtsR1 genetically deficient fragment;

B. utilize E.coli/C.glutamicum shuttle vectors pK19mobsacB, insert dtsR1 genetically deficient fragment and form the dtsR1 gene knockout carrier;

C. the dtsR1 gene knockout carrier is imported Corynebacterium glutamicum, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and be inoculated in the culture medium culturing that contains sucrose, select sucrose resistance clone bacterium, promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene.

Described genetic engineering bacterium, wherein dtsR1 upstream region of gene segment is dtsR1 gene initiation codon upstream 300～500bp segment; DtsR1 gene downstream segment is dtsR1 gene termination codon downstream 300～500bp segment.

Described genetic engineering bacterium wherein makes Corynebacterium glutamicum cross the method for expressing the pyc gene and comprises the following steps:

A. be template with the Corynebacterium glutamicum gene group, amplification pyc gene inserts expression vector with the pyc gene, makes up the pyc expression vector;

B. the pyc expression vector that makes up is imported Corynebacterium glutamicum, resistance culture medium culturing gained resistance clone bacterium is the Corynebacterium glutamicum of pyc gene overexpression.

Described genetic engineering bacterium wherein makes Corynebacterium glutamicum cross the method for expressing the pyc gene and comprises the following steps:

A. be template with the Corynebacterium glutamicum gene group, utilize PCR method amplification pyc gene, the pyc gene is inserted expression vector pVWEx1, make up the pyc expression vector by upstream primer SEQ ID No.5 and downstream primer SEQ IDNo.6;

B. the pyc expression vector that makes up is imported Corynebacterium glutamicum, be inoculated in the culture medium culturing gained resistance clone bacterium that contains kantlex be the Corynebacterium glutamicum of pyc gene overexpression.

Further, described genetic engineering bacterium, this genetic engineering bacterium prepares through the following steps:

A. be template with the Corynebacterium glutamicum gene group, utilize the PCR method dtsR1 gene upstream and downstream segment that increases respectively by upstream pulsating primer SEQ ID No.1 and SEQ ID No.2 and downstream segment primer SEQ ID No.3 and SEQ ID No.4, adopt overlap PCR method that dtsR1 gene upstream and downstream segment is coupled together by primer SEQ ID No.1 and SEQ ID No.4 again, form dtsR1 genetically deficient fragment;

B. utilize E.coli/C.glutamicum shuttle vectors pK19mobsacB, insert dtsR1 genetically deficient fragment and form the dtsR1 gene knockout carrier;

C. be template with the Corynebacterium glutamicum gene group, utilize PCR method amplification pyc gene, the pyc gene is inserted expression vector pVWEx1, make up the pyc expression vector by upstream primer SEQ ID No.5 and downstream primer SEQ IDNo.6;

D. the dtsR1 gene knockout carrier is imported Corynebacterium glutamicum, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and be inoculated in the culture medium culturing that contains sucrose, select sucrose resistance clone bacterium, promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene; Then the pyc expression vector is imported the Corynebacterium glutamicum of disappearance dtsR1 gene, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene and express the pyc gene excessively.

The preparation method of described genetic engineering bacterium comprises the following steps:

A. be template with the Corynebacterium glutamicum gene group, amplification dtsR1 gene upstream and downstream segment couples together this upstream and downstream segment then, forms dtsR1 genetically deficient fragment;

B. dtsR1 genetically deficient fragment is inserted shuttle vectors, make up the dtsR1 gene knockout carrier;

C. be template with the Corynebacterium glutamicum gene group, amplification pyc gene inserts expression vector with the pyc gene, makes up the pyc expression vector;

D. the dtsR1 gene knockout carrier that makes up is imported Corynebacterium glutamicum, the employing screening culture medium is cultivated, the clone bacterium of gained is the Corynebacterium glutamicum of dtsR1 genetically deficient, the pyc expression vector is imported the Corynebacterium glutamicum of dtsR1 genetically deficient, resistance culture medium culturing gained resistance clone bacterium is dtsR1 genetically deficient and crosses the Corynebacterium glutamicum of expressing the pyc gene again.

Further, the preparation method of described genetic engineering bacterium specifically comprises the following steps:

A. be template with the Corynebacterium glutamicum gene group, utilize the PCR method dtsR1 gene upstream and downstream segment that increases respectively by upstream pulsating primer SEQ ID No.1 and SEQ ID No.2 and downstream segment primer SEQ ID No.3 and SEQ ID No.4, adopt overlap PCR method that dtsR1 gene upstream and downstream segment is coupled together by primer SEQ ID No.1 and SEQ ID No.4 again, form dtsR1 genetically deficient fragment;

B. utilize E.coli/C.glutamicum shuttle vectors pK19mobsacB, insert dtsR1 genetically deficient fragment and form the dtsR1 gene knockout carrier;

C. be template with the Corynebacterium glutamicum gene group, utilize PCR method amplification pyc gene, the pyc gene is inserted expression vector pVWEx1, make up the pyc expression vector by upstream primer SEQ ID No.5 and downstream primer SEQ IDNo.6;

D. the dtsR1 gene knockout carrier is imported Corynebacterium glutamicum, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and be inoculated in the culture medium culturing that contains sucrose, select sucrose resistance clone bacterium, promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene; Then the pyc expression vector is imported the Corynebacterium glutamicum of disappearance dtsR1 gene, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene and express the pyc gene excessively.

The application of described genetic engineering bacterium in producing L-glutamic acid.

The selection of concrete screening culture medium can be determined according to the characteristic of carrier that uses or bacterial strain.As block that resistance substratum (containing 50 μ g/ml-100 μ g/ml kantlex), contain the substratum (containing 10%-40% sucrose) of sucrose.

Beneficial effect of the present invention:

The present invention utilizes genetic engineering technique to make up the novel yield glutamic acid strains in high of a strain, this bacterial strain called after △ d-pyc.The present invention improves glutamic acid yield with gene knockout technology and protein expression technological transformation L-glutamic acid anabolism stream.The glutamic acid fermentation experiment shows that bacterial strain △ d-pyc just produces the L-glutamic acid of higher concentration (80.0mM) when the excessive cultivation of vitamin H, and the synthetic with this understanding L-glutamic acid of wild-type Corynebacterium glutamicum.Limit the quantity of and inductive condition such as Tween40 interpolations grade can further improve glutamic acid yield again at vitamin H, the rate ratio wild-type of △ d-pyc under these two kinds of inductive conditions under equal conditions improved 13% and 18% respectively.

The present invention is used for gene knockout technology and protein expression technology the structure of L-glutamic acid high yield bacterium first, provides a kind of new method for transforming L-glutamic acid high yield bacterium.The present invention at first will suppress L-glutamic acid synthetic DtsR albumen with the gene knockout technology and knock out, used the PC in the synthetic approach of filling a vacancy of expression vector expression L-glutamic acid again, come orientation optimizes L-glutamic acid metabolic pathway of synthesizing with this, make metabolism stream flow to the L-glutamic acid compound direction in a large number, improve glutamic acid yield.

Description of drawings

Fig. 1: the biosynthetic pathway of L-glutamic acid.

Fig. 2: gene knockout carrier pK19ms-△ d enzyme is cut evaluation: M, DNAmarker; 1, the positive colony DNA that the HindIII enzyme was cut.

Fig. 3: gene overexpression carrier pVWEx1-pyc enzyme is cut evaluation: M, DNA marker; 1, the positive colony DNA that PstI and SalI double digestion are crossed.

Fig. 4: genetically deficient clone △ d southern blot identifies figure: 1, and the hybridization signal of wild-type; 2, the hybridization signal of △ d.

Fig. 5: glutamic acid fermentation production experiment under the excessive condition of vitamin H: (a) growth of wild type strain under the excessive condition of vitamin H, glucose consumption and L-glutamic acid production; (b) growth of aminoglutaric acid genetic engineering high-producing strains △ d-pyc under the excessive condition of vitamin H, glucose consumption and L-glutamic acid production; ■ represents thalline OD ₆₀₀▲ represent L-glutamic acid production; ◆ represent glucose consumption.

Fig. 6: the vitamin H glutamic acid fermentation production experiment under the condition of limiting the quantity of: (a) growth of wild type strain under vitamin H is limited the quantity of condition, glucose consumption and L-glutamic acid production; (b) growth of aminoglutaric acid genetic engineering high-producing strains △ d-pyc under vitamin H is limited the quantity of condition, glucose consumption and L-glutamic acid production; ■ represents thalline OD ₆₀₀▲ represent L-glutamic acid production; ◆ represent glucose consumption.

Fig. 7: glutamic acid fermentation production experiment under the Tween40 adding conditional: (a) growth of wild type strain under the Tween40 adding conditional, glucose consumption and L-glutamic acid production; (b) growth of aminoglutaric acid genetic engineering high-producing strains △ d-pyc under the Tween40 adding conditional, glucose consumption and L-glutamic acid production; ■ represents thalline OD ₆₀₀▲ represent L-glutamic acid production; ◆ represent glucose consumption.

Embodiment

The invention will be further elaborated by the following examples:

The structure of embodiment 1, gene knockout carrier pK19ms-△ d and gene overexpression carrier pVWEx1-pyc

1) .PCR amplification dtsR1 gene upstream and downstream fragment: the genome that extracts wild-type Corynebacterium glutamicum C.glutamicum ATCC13032 (ATCC purchase) with genome DNA extracting reagent kit (Promega company product).According to C.glutamicum ATCC13032 whole genome sequence among the Gene Bank (Gene Bank No:NCg10678) design primer.With extractive genome is template, A1 (SEQ ID No.1) and A2 (SEQ ID No.2) are primer, pcr amplification dtsR1 upstream region of gene fragment (dtsR1 gene initiation codon upstream 400bp) under Taq enzyme (Takara company product) effect, the PCR parameter is: 95 ℃ of 30s, 54 ℃ of 40s, 72 ℃ of 25s, totally 26 circulations.With A3 (SEQID No.3) and A4 (SEQ ID No.4) is primer, pcr amplification dtsR1 gene downstream fragment (dtsR1 gene termination codon downstream 400bp), and the PCR parameter is: 95 ℃ of 30s, 56 ℃ of 40s, 72 ℃ of 25s, totally 26 circulations.Above-mentioned primer sequence is respectively:

A1: AAGCTTGCGGCTCTCTGGATCGTG (underscore is the HindIII restriction enzyme site)

A2:CGCAGTACGCTCCACCGAATACGGTGCCGTCC (italic is a complementary sequence)

A3:CCGTATTCGGTGGAGCGTACTGCGTGATGGGTTC (italic is a complementary sequence)

A4: AAGCTTCAGTGGCATGTGGCCGTGC (underscore is the HindIII restriction enzyme site)

The PCR product is carried out agarose gel electrophoresis, and dtsR1 gene upstream and downstream clip size is 400bp.Reclaim test kit (Shen, the Shanghai energy gaming product) recovery of tapping rubber with glue then.

2) .overlap PCR connection dtsR1 gene upstream and downstream fragment: with 1) the upstream and downstream fragment (pressing 1:1 mixes) of amplification is a template, and A1 and A4 are the primer PCR amplification, and the PCR parameter is: 95 ℃ of 30s, 51 ℃ of 40s, 72 ℃ of 40s, totally 30 circulations.The PCR product carries out agarose gel electrophoresis, and size is 800bp, and rubber tapping is reclaimed.To reclaim fragment and be connected by 5:1 with pMD19-T (Takara company product) and spend the night, transform DH5 α competence, picking ammonia benzyl resistance clone, bacterium colony PCR identifies the PCR fragment of whether inserting recovery among the pMD19-T.The PCR fragment of identifying insertion by order-checking (Invitrogen company mensuration) is dtsR1 gene upstream and downstream junction fragment really.

3). the structure of gene knockout carrier pK19ms-△ d: with 2) in insert junction fragment the pMD19-T carrier cut with HindIII (Takara company product) enzyme, 37 ℃ of insulations 3 hours are carried out the electrophoresis recovery with the junction fragment (800bp) that cuts out.Simultaneously with carrier pK19mobsacB (Eggeling L, Bott M.Handbook of Corynebacteriumglutamicum.CRC press, Boca Raton, FL, USA2005) cut with the HindIII enzyme, 37 ℃ are incubated 2 hours, and electrophoresis reclaims, and the carrier segment that reclaims is carried out dephosphorylation with alkaline phosphatase (CIAP) (Takara company product) react, to prevent that carrier is from connecting.The junction fragment that reclaims is connected by 7:1 with carrier segments spends the night, transform DH5 α competence, that resistance clone of picking card, bacterium colony PCR preliminary evaluation positive colony, extraction positive colony plasmid, enzyme is cut further evaluation (see figure 2).With the gene knockout carrier called after pK19ms-△ d that builds.

4). the structure of gene overexpression carrier pVWEx1-pyc: with 1) genome that extracts is template, and B1 (SEQ IDNo.5) and B2 (SEQ ID No.6) they are primer, and the pyc gene increases, the pcr amplification parameter is: 95 ℃ of 30s, 51 ℃ of 40s, 72 ℃ of 2min, totally 28 circulations.Primer sequence is as follows:

B1:GTTGTTCT GCAGTCTGCAGGTGGAAGC (underscore is the PstI restriction enzyme site)

B2:GTTGTT GTCGACCCCTTCGTGCGGC (underscore is the SalI restriction enzyme site)

The PCR product size that amplifies is 3423bp, electrophoresis reclaims after PstI and SalI double digestion, with carrier pVWEx1 (Peters-Wendisch PG through same double digestion, Schiel B, Wendisch VF, Katsoulidis E, Mokel B, Sahm H, Eikmanns BJ.Pyruvate carboxylase is a major bottleneck for glutamate and lysineproduction by Corynebacterium glutamicum.J.Mol.Microbiol.Biotechnol.2001 3:295-300) spends the night by the 7:1 connection, transform DH5 α competence, that resistance clone of picking card extracts the positive colony plasmid, and enzyme is cut the evaluation (see figure 3).With the gene overexpression carrier called after pVWEx1-pyc that builds.

The preparation of the Corynebacterium glutamicum △ d of embodiment 2, dtsR1 genetically deficient

1). the competent preparation of Corynebacterium glutamicum: Corynebacterium glutamicum ATCC13032 on the fresh plate of picking, inoculation goes into to contain in the 2ml liquid LB substratum of 0.5% (mass volume ratio) glucose, 30 ℃, 200r/min cultivated 12 hours, be inoculated among the 50ml LB that contains 3% (mass volume ratio) glycine and 0.1% (volume ratio) Tween80 by 1% (volume percent of inoculum size and substratum) again, make initial OD ₆₀₀Reach 0.3, in 30 ℃, continue to be cultured to OD ₆₀₀Reach 0.9.With bacterium liquid ice bath 15 minutes, centrifugal collection thalline, with 10% (volume percent) glycerine re-suspended cell of precooling, with the packing of 1.5ml centrifuge tube, every pipe 80 μ l.Competent cell is put-70 ℃ of refrigerators and preserved or be directly used in the electric shock conversion.

2). electric shock transforms plasmid pK19ms-△ d: competent cell is taken out from refrigerator and melted in frozen water, add 1-5 μ l plasmid pK19ms-△ d and go in the competent cell mixing.Mixed solution is transferred in the 0.1cm electric shock cup (BioRad company product), in 1.8kv, go up electric shock at electric shock instrument (BioRad company product) under the 5ms condition, add the 1ml liquid LB substratum that contains 0.5% (mass volume ratio) glucose, mixing gently then immediately.Mixed solution is changed in the 1.5ml centrifuge tube, 46 ℃ of water-baths 6 minutes, 30 ℃ of water-baths 1 hour, centrifugal concentrated thalline is to 100-200 μ l.To be coated on behind the thalline mixing on the solid LB substratum that contains 0.5% glucose and 25 μ g/ml kantlex, in incubator, cultivated 36 hours for 30 ℃.

3) preparation of the Corynebacterium glutamicum △ d of .dtsR1 genetically deficient: at first with that resistance screening of card, as 2) as described in, the thalline after the electricity commentaries on classics is coated on the solid LB substratum that contains that resistance of card, select resistance clone, extract the cloned genes group, carry out PCR and identify positive colony.With A1/A4 is primer amplification, and the PCR parameter is: 95 ℃ of 30s, 51 ℃ of 40s, 72 ℃ of 1min40s, totally 26 circulations.Pcr amplification product is 800bp fragment and the positive clone of the segmental clone of 2600bp, because plasmid integration can amplify two kinds of different big or small fragments after going into genomic dna.The positive colony of picking out inoculated contain overnight incubation in that the liquid LB substratum of card, the bacterium that will spend the night is coated on the solid LB substratum that contains 10% (mass volume ratio) sucrose and cultivated 36 hours.Because the expression product of sacB gene in Corynebacterium glutamicum can not be grown it containing on the sucrose medium on the pK19mobsacB carrier, breaks away from genomic dna so the sucrose screening pressure just impels carrier pK19mobsacB to carry goal gene.To extract containing the cloned genes group that grows on the sucrose medium, be the primer PCR amplification with A1/A4, and parameter is the same.Pcr amplification product has only the positive clone of the segmental clone of 800bp, and promptly dtsR1 genetically deficient is cloned, called after △ d.

4) .southern blot (southern blotting) identifies dtsR1 genetically deficient clone △ d: extraction 3) the dtsR1 genetically deficient cloned genes group of screening, genomic dna is cut with the BamHI enzyme, 37 ℃ are incubated 4 hours, carry out 0.8% (mass volume ratio) sepharose (not adding staining fluid EB) electrophoresis then.Gel was soaked in the sex change liquid 1 hour, then, added neutralizer 30 minutes with rinsed with deionized water 1 time.Gel is placed on the platform that is covered with filter paper, and platform places and fills with the box that shifts liquid, will be placed on the gel with the nylon membrane that transfer liquid soaked then, covers (about 5-8 cm thick) on the nylon membrane with filter paper again, presses a weight on it again.Placement is spent the night, and DNA is transferred on the nylon membrane.Detect hybridization signal (seeing the test kit process specifications) with the DNA on digoxin marker detection test kit (Roche company product) the mark nylon membrane and with probe hybridization.The Corynebacterium glutamicum △ d of disappearance dtsR1 gene hybridizes the signal of 1900bp size, and wild-type hybridizes the signal (see figure 4) of 3600bp size.

Sex change liquid: 1.5mol/L NaCl, 0.5mol/L NaOH;

Neutralizer: 1mol/L Tris-Cl, 1.5mol/L NaCl

Shift liquid: 3mol/L NaCl; 0.3mol/L Trisodium Citrate; PH7.0

Embodiment 3, dtsR1 genetically deficient and the preparation of crossing the Corynebacterium glutamicum △ d-pyc that expresses PC

1). the preparation of △ d-pyc: change the carrier pVWEx1-pyc electric shock that builds among the bacterial strain △ d (method is seen embodiment 2), with that resistance screening positive colony of card.The clone that will grow on that flat board of card inoculates overnight incubation among the liquid LB that contains that resistance of card, extract plasmid with plasmid extraction kit (Promega company product), the plasmid size was consistent before the agarose gel electrophoresis result showed its size and electricity changes, illustrated that expression vector pVWEx1-pyc successfully changed among the bacterial strain △ d, with dtsR1 genetically deficient that filters out and the Corynebacterium glutamicum called after △ d-pyc that expresses PC excessively.

2) the active mensuration of .PC: △ d-pyc is gone into to contain among that the liquid LB of card by 1:30 (volume ratio of inoculum size and substratum) inoculation, and 30 ℃ of concussions are cultured to OD ₆₀₀Reach 0.6 (or 0.4-0.6), adding final concentration is 1mM isopropylthiogalactoside (IPTG) abduction delivering, and 24 ℃ are continued concussion and cultivated 4 hours.Get the ultrasonication of 5ml bacterium liquid, the centrifugal supernatant that goes is a crude enzyme liquid.Crude enzyme liquid adds 100mM TES-NaOH (PH7.6), 25mM NaHCO ₃, 20mM pyruvic acid, 4mM ATP, 2mM L-glutamic acid, 20 μ M pyridoxal phosphates and 2 unit Pigs Hearts glutamic-oxal(o)acetic transaminases (GOT), 30 ℃ of reactions of mixing 3 minutes.The aspartic acid that reaction generates is obtained the activity of PC again by the high performance liquid chromatograph analysis after thiocarbanil (PITC) derivation.The PC activity is 91U/mg among the bacterial strain △ d-pyc, and wild-type only is 35U/mg, compares with wild-type, and the activity of PC has improved nearly 3 times among the △ d-pyc, illustrates that gene pyc is expressed in Corynebacterium glutamicum efficiently.

The fermenting experiment of embodiment 4, △ d-pyc

1). three kinds of fermention mediums:

The excessive substratum GH1:30g/L of vitamin H glucose, 15g/L (NH ₄) ₂SO ₄, 1g/L KH ₂PO ₄, 0.4g/LMgSO ₄7H ₂O, 0.01g/L FeSO ₄7H ₂O, 0.01g/L MnSO ₄4H ₂O, 200 μ g/L vitamins Bs ₁, 300 μ g/L vitamin Hs, 1.4% (volume percent) soybean protein hydrolyate and 50g/L CaCO ₃[degerming separately] regulates pH to 8.0.(degerming is meant 50g/L CaCO separately ₃Part.Soybean protein hydrolyate is the product that market can have been bought, producer: west, Shanghai king's Dian Fentang company limited, production code member: S2008092351394)

The vitamin H substratum GH2:50g/L glucose of limiting the quantity of does not contain vitamin H, and all the other are with the GH1 substratum.

Add Tween40 substratum GH3:50g/L glucose, 30g/L (NH ₄) ₂SO ₄With 60 μ g/L vitamin Hs, 5mg/ml Tween40, all the other are with the GH1 substratum.

2). glucose and L-glutamic acid assay: wild-type Corynebacterium glutamicum ATCC13032 and △ d-pyc are cultivated in above-mentioned three kinds of fermention mediums respectively, and regularly getting fermented liquid analyzes glucose and L-glutamic acid content on high performance liquid chromatograph.L-glutamic acid needs through Phthalyldicarboxaldehyde (OPA) derivation before measuring, and the chromatographic column model is Shim-Pack CLC-ODS 250mm * 4mm, 5 μ m, and mobile phase A is 0.1M KC ₂H ₃O ₂(pH5.89), Mobile phase B is a methyl alcohol, and flow velocity is 1mlmin ^-1, column temperature is 40 ℃, surveys absorption value at the 210nm place.The chromatographic column model of glucose assays is

HPX-87H, 7.8mm * 300mm, moving phase is 0.005M H ₂SO ₄, flow velocity is 0.5mlmin ^-1, column temperature is 55 ℃, detects with the differential detector.The genetic engineering bacterium △ d-pyc that makes up just can produce L-glutamic acid under the excessive condition of vitamin H, ferment that aminoglutaric acid concentration reaches 80.0mM after 28 hours, and wild-type is not produced the L-glutamic acid (see figure 5) under the equal conditions.Explanation just can make Corynebacterium glutamicum produce L-glutamic acid under non-inductive condition by changing and optimize metabolism stream.Simultaneously, vitamin H is limited the quantity of and the Tween40 interpolation waits inductive condition can further improve glutamic acid yield again, and the rate ratio wild-type of △ d-pyc under these two kinds of inductive conditions under equal conditions improved 13% and 18% (seeing Fig. 6 and Fig. 7) respectively.This just provides a kind of new bacterial strain for industrial mass production L-glutamic acid, provides a novel method for screening L-glutamic acid high yield bacterium simultaneously.

＜110〉Chinese People's Liberation Army Medical Research Institute Of Nanjing Military Region of China Medicine University

＜120〉aminoglutaric acid genetic engineering high-producing strains and application thereof

<160>6

<210>1

<211>14

<212>DNA

＜213〉artificial sequence

<220>

＜223〉upstream primer

<400>1

aagcttgcgg?ctctctggat?cgtg?14

<210>2

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉downstream primer

<400>2

cgcagtacgc?tccaccgaat?acggtgccgt?cc?32

<210>3

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉upstream primer

<400>3

ccgtattcgg?tggagcgtac?tgcgtgatgg?gttc?34

<210>4

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉downstream primer

<400>4

aagcttcagt?ggcatgtggc?cgtgc?25

<210>1

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉upstream primer

<400>1

gttgttctgc?agtctgcagg?tggaagc?27

<210>6

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉downstream primer

<400>6

gttgttgtcg?accccttcgt?gcggc?25

Claims (10)

1. a genetic engineering bacterium that produces L-glutamic acid is characterized in that this bacterium is disappearance dtsR1 gene and crosses the Corynebacterium glutamicum of expressing the pyc gene.

2. genetic engineering bacterium according to claim 1 is characterized in that making the method for Corynebacterium glutamicum disappearance dtsR1 gene may further comprise the steps:

A. be template with the Corynebacterium glutamicum gene group, amplification dtsR1 gene upstream and downstream segment couples together this upstream and downstream segment then, forms dtsR1 genetically deficient fragment;

B. dtsR1 genetically deficient fragment is inserted shuttle vectors, make up the dtsR1 gene knockout carrier;

C. the dtsR1 gene knockout carrier that makes up is imported Corynebacterium glutamicum, adopt screening culture medium to cultivate, the clone bacterium of gained is the Corynebacterium glutamicum of dtsR1 genetically deficient.

3. genetic engineering bacterium according to claim 2 is characterized in that making the method for Corynebacterium glutamicum disappearance dtsR1 gene may further comprise the steps:

A. be template with the Corynebacterium glutamicum gene group, utilize the PCR method dtsR1 gene upstream and downstream segment that increases respectively by upstream pulsating primer SEQ ID No.1 and SEQ ID No.2 and downstream segment primer SEQ ID No.3 and SEQ ID No.4, adopt overlap PCR method that dtsR1 gene upstream and downstream segment is coupled together by primer SEQ ID No.1 and SEQ ID No.4 again, form dtsR1 genetically deficient fragment;

B. utilize E.coli/C.glutamicum shuttle vectors pK19mobsacB, insert dtsR1 genetically deficient fragment and form the dtsR1 gene knockout carrier;

C. the dtsR1 gene knockout carrier is imported Corynebacterium glutamicum, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and be inoculated in the culture medium culturing that contains sucrose, select sucrose resistance clone bacterium, promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene.

4,, it is characterized in that dtsR1 upstream region of gene segment is dtsR1 gene initiation codon upstream 300～500bp segment according to claim 2 or 3 described genetic engineering bacteriums; DtsR1 gene downstream segment is dtsR1 gene termination codon downstream 300～500bp segment.

5. genetic engineering bacterium according to claim 1 is characterized in that making Corynebacterium glutamicum to cross the method for expressing the pyc gene and comprises the following steps:

A. be template with the Corynebacterium glutamicum gene group, amplification pyc gene inserts expression vector with the pyc gene, makes up the pyc expression vector;

B. the pyc expression vector that makes up is imported Corynebacterium glutamicum, resistance culture medium culturing gained resistance clone bacterium was the Corynebacterium glutamicum of expressing the pyc gene.

6. genetic engineering bacterium according to claim 5 is characterized in that making Corynebacterium glutamicum to cross the method for expressing the pyc gene and comprises the following steps:

A. be template with the Corynebacterium glutamicum gene group, utilize PCR method amplification pyc gene, the pyc gene is inserted expression vector pVWEx1, make up the pyc expression vector by upstream primer SEQ ID No.5 and downstream primer SEQ IDNo.6;

B. the pyc expression vector that makes up is imported Corynebacterium glutamicum, be inoculated in the culture medium culturing gained resistance clone bacterium that contains kantlex and be the Corynebacterium glutamicum of expressing the pyc gene.

7. genetic engineering bacterium according to claim 1 is characterized in that this genetic engineering bacterium prepares through the following steps:

A. be template with the Corynebacterium glutamicum gene group, utilize the PCR method dtsR1 gene upstream and downstream segment that increases respectively by upstream pulsating primer SEQ ID No.1 and SEQ ID No.2 and downstream segment primer SEQ ID No.3 and SEQ ID No.4, adopt overlap PCR method that dtsR1 gene upstream and downstream segment is coupled together by primer SEQ ID No.1 and SEQ ID No.4 again, form dtsR1 genetically deficient fragment;

B. utilize E.coli/C.glutamicum shuttle vectors pK19mobsacB, insert dtsR1 genetically deficient fragment and form the dtsR1 gene knockout carrier;

C. be template with the Corynebacterium glutamicum gene group, utilize PCR method amplification pyc gene, the pyc gene is inserted expression vector pVWEx1, make up the pyc expression vector by upstream primer SEQ ID No.5 and downstream primer SEQ IDNo.6;

D. the dtsR1 gene knockout carrier is imported Corynebacterium glutamicum, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and be inoculated in the culture medium culturing that contains sucrose, select sucrose resistance clone bacterium, promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene; Then the pyc expression vector is imported the Corynebacterium glutamicum of disappearance dtsR1 gene, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene and express the pyc gene excessively.

8, the preparation method of genetic engineering bacterium as claimed in claim 1 is characterized in that comprising the following steps:

A. be template with the Corynebacterium glutamicum gene group, amplification dtsR1 gene upstream and downstream segment couples together this upstream and downstream segment then, forms dtsR1 genetically deficient fragment;

B. dtsR1 genetically deficient fragment is inserted shuttle vectors, make up the dtsR1 gene knockout carrier;

C. be template with the Corynebacterium glutamicum gene group, amplification pyc gene inserts expression vector with the pyc gene, makes up the pyc expression vector;

D. the dtsR1 gene knockout carrier that makes up is imported Corynebacterium glutamicum, the employing screening culture medium is cultivated, the clone bacterium of gained is the Corynebacterium glutamicum of dtsR1 genetically deficient, again the pyc expression vector is imported the Corynebacterium glutamicum of dtsR1 genetically deficient, the employing screening culture medium is cultivated, and gained resistance clone bacterium is dtsR1 genetically deficient and crosses the Corynebacterium glutamicum of expressing the pyc gene.

9, the preparation method of genetic engineering bacterium according to claim 8 is characterized in that comprising the following steps:

A. be template with the Corynebacterium glutamicum gene group, utilize the PCR method dtsR1 gene upstream and downstream segment that increases respectively by upstream pulsating primer SEQ ID No.1 and SEQ ID No.2 and downstream segment primer SEQ ID No.3 and SEQ ID No.4, adopt overlap PCR method that dtsR1 gene upstream and downstream segment is coupled together by primer SEQ ID No.1 and SEQ ID No.4 again, form dtsR1 genetically deficient fragment;

B. utilize E.coli/C.glutamicum shuttle vectors pK19mobsacB, insert dtsR1 genetically deficient fragment and form the dtsR1 gene knockout carrier;

C. be template with the Corynebacterium glutamicum gene group, utilize PCR method amplification pyc gene, the pyc gene is inserted expression vector pVWEx1, make up the pyc expression vector by upstream primer SEQ ID No.5 and downstream primer SEQ IDNo.6;

D. the dtsR1 gene knockout carrier is imported Corynebacterium glutamicum, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and be inoculated in the culture medium culturing that contains sucrose, select sucrose resistance clone bacterium, promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene; Then the pyc expression vector is imported the Corynebacterium glutamicum of disappearance dtsR1 gene, be inoculated in the culture medium culturing that contains kantlex, select that resistance clone bacterium of card and promptly get the Corynebacterium glutamicum that lacks the dtsR1 gene and express the pyc gene excessively.

10, the application of the described genetic engineering bacterium of claim 1 in producing L-glutamic acid.

Images