CN101370790A - Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase - Google Patents

Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase Download PDF

Info

Publication number
CN101370790A
CN101370790A CNA200780002738XA CN200780002738A CN101370790A CN 101370790 A CN101370790 A CN 101370790A CN A200780002738X A CNA200780002738X A CN A200780002738XA CN 200780002738 A CN200780002738 A CN 200780002738A CN 101370790 A CN101370790 A CN 101370790A
Authority
CN
China
Prior art keywords
alkyl
compound
amino
group
formula
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA200780002738XA
Other languages
Chinese (zh)
Other versions
CN101370790B (en
Inventor
L·F·B·马康内特-德克拉恩
S·F·D·高兰德
P·R·安基鲍德
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Janssen Pharmaceutica NV
Original Assignee
Janssen Pharmaceutica NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Janssen Pharmaceutica NV filed Critical Janssen Pharmaceutica NV
Publication of CN101370790A publication Critical patent/CN101370790A/en
Application granted granted Critical
Publication of CN101370790B publication Critical patent/CN101370790B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/02—Nasal agents, e.g. decongestants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06—Antimalarials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/78—Carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/78—Carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D213/81—Amides; Imides
    • C07D213/82—Amides; Imides in position 3
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/32—One oxygen, sulfur or nitrogen atom
    • C07D239/42—One nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Diabetes (AREA)
  • Pulmonology (AREA)
  • Epidemiology (AREA)
  • Hematology (AREA)
  • Cardiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Obesity (AREA)
  • Rheumatology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Endocrinology (AREA)
  • Transplantation (AREA)
  • Pain & Pain Management (AREA)
  • Ophthalmology & Optometry (AREA)
  • Psychology (AREA)
  • Vascular Medicine (AREA)
  • Emergency Medicine (AREA)
  • Oncology (AREA)

Abstract

This invention comprises the novel compounds of formula (I) wherein R<1>, R<2>, R<3> and X have defined meanings, having histone deacetylase inhibiting enzymatic activity; their preparation, compositions containing them and their use as a medicine.

Description

Pyridine and pyrimidine derivatives as NSC 630176
The compound of (HDAC) inhibitory enzyme activity that the present invention relates to have histon deacetylase (HDAC).The invention further relates to this compounds the preparation method, comprise in such compound compositions and the body thereof and the effect of vitro inhibition HDAC and as the application of medicine, for example be used to suppress proliferative disease such as cancer and psoriasic medicine.
Nucleohistone be known and regulatory gene transcribe with other DNA-template procedure for example duplicate, repair, the overall dynamics element of reorganization and chromosome segregation related mechanism.They be comprise acetylize, phosphorylation, methylate, the object of the posttranslational modification of ubiquitinization and ADP-ribosylation.
Histon deacetylase (HDAC) is called " HDACs " here, for catalytic eliminating comprises the enzyme that the protein lysine residue ethanoyl of core nucleosome histone H2A, H2B, H3 and H4 is modified.With histone acetyltransferase, be called " HATs " here, HDACs can regulate the acetylize level of histone.The nucleosome acetylation of histone is equilibrated in many gene transcription and plays a significant role.The low acetylize of histone is condensing relevant with the chromatin Structure that causes genetic transcription to suppress, and acetylated histones is relevant with more open chromatin Structure and transcriptional activation.
Find 11 kinds of structurally associated HDACs and be divided into two classes.I class HDACs comprises HDAC 1,2,3,8 and 11 and II class HDACs comprises HDAC4,5,6,7,9 and 10.The 3rd class HDACs member and I class are uncorrelated with II class HDACs structure.I/II class HDACs plays a role by the zinc dependent mechanism and III class HDACs is a NAD-dependent form.
Except histone, other protein also is the substrate of acetylizing, especially transcription factor for example p53, GATA-1 and E2F; Nuclear receptor is glucocorticoid receptor, thryoid receptor, estrogen receptor for example; Reach for example pRb of cyclin.The protein acetylize is relevant with protein stabilization, for example p53 stabilization, cofactor raise with DNA in conjunction with increase.P53 is a kind of tumor-inhibiting factor, and it can be to various pressure signals such as dna damage make a response inducing cell cycle arrest or apoptosis.The main effect target of p53 inducing cell cycle arrest is the p21 gene seemingly.After being activated, can identify p21 by its interaction that causes going up in dependency G1 and the cell cycle arrest of G2 phase and cyclin/cyclin-dependent kinases mixture, the aging course to be in harmonious proportion between itself and the proliferating cell nuclear antigen by p53.
The HDACs inhibitor be studies show that they play a significant role in the phenotypic reverse of cell cycle arrest, cytodifferentiation, apoptosis and conversion.
For example inhibitor Trichostatin A (TSA) can cause G1 and G2 phase cell cycle arrest, reverses the conversion phenotype of different clones and induces Fu Luode leukemia cell and the differentiation of other cell.Reported TSA (with suberoylanilide hydroxamic acid SAHA) growth capable of inhibiting cell, induce eventually end differentiation and prevent from mouse, to form tumour (Finnin etc., Nature, 401:188-193,1999).
Reported Trichostatin A and can be used for treating fibrotic disease, for example hepatic fibrosis and liver cirrhosis (Geerts etc., european patent application book EP published on March 11st, 0 827 742,1998).
The pharmacophoric group of hdac inhibitor comprise one can with the containing the interactional melts combine structural domain of zinc reactive site, a joint design territory and a surperficial recognition structure territory or add the cap zone of HDACs, it can interact with the residue at reactive site edge.
Report the HDACs inhibitor and can induce the p21 expression of gene.These inhibitor can promote the activation of p21 gene transcription, and its mode is the histone H 3 of p21 promoter region and the Chromatin Remodeling after the H4 acetylize.The activation of this p21 takes place in the mode of the non-dependence of p53-, so the HADC inhibitor can play a role in the cell with variation p53 gene (sign of kinds of tumors).
In addition, hdac inhibitor also has indirect activity, for example strengthens host immune response and suppresses growth, the obstruction transfer (Mai etc., MedicinalResearchReviews, 25:261-309,2005) that therefore tumor-blood-vessel growth also can suppress primary tumor.
Based on above viewpoint, hdac inhibitor (comprises the tumour with variation p53 gene) and has very big potentiality in treatment cell proliferation disorders or illness.
The patent application EP1472216 that on August 14th, 2003 announced discloses diepoxy oxime hydrochlorate as NSC 630176.
Patent application EP1485099, EP1485348, EP1485353, EP1485354, EP1485364, EP1485365, EP1485370 and the EP1485378 that announced on December 18th, 2003 discloses the piperazinyl pyrimidyl hydroxamic acid that is substituted as the acetylation of histone enzyme inhibitors, and EP1485365 discloses R306465 in addition.
The patent application EP1492534 that announced on October 9th, 2003 discloses and has contained carboxylamine compound that piperazine connects as hdac inhibitor.The patent application EP1495002 that announced on October 23rd, 2003 discloses the piperazinyl phenyl yl-benzamide compound that is substituted as the acetylation of histone enzyme inhibitors.
The patent application EP1501508 that announced in 2003 11 about 13 days discloses benzamides as the acetylation of histone enzyme inhibitors.
The patent application WO04/009536 that announced on January 29th, 2004 disclose between alkyl and hydroxamate, contain the alkyl joint derivative as the acetylation of histone enzyme inhibitors.
The patent application EP1525199 that announced on February 12nd, 2004 discloses the diepoxy oxime hydrochlorate of warp (mixing) arylalkenyl replacement as the acetylation of histone enzyme inhibitors.
The patent application EP1572626 that on June 24th, 2004 announced discloses arylidene-carboxylic acid (2-amino-phenyl)-amide derivatives as pharmacological active substance.
The patent application EP1581484 that announced on July 29th, 2004 discloses N-hydroxyl-benzamide derivatives and has had anti-inflammatory and anti-tumor activity.
The patent application EP1585735 that announced on July 29th, 2004 discloses the aryl oxide oxime acid salt derivant that is substituted as the acetylation of histone enzyme inhibitors.
The patent application EP1592667 that on August 19th, 2004 announced discloses list-acylations-O-phenylenediamine derivative as pharmacological active substance.
The patent application EP1590340 that on August 19th, 2004 announced discloses diaminobenzene (diaminophenylene) derivative as the acetylation of histone enzyme inhibitors.
The patent application EP1592665 that on August 26th, 2004 announced discloses benzamide derivatives as the acetylation of histone enzyme inhibitors.
The patent application WO04/072047 that on August 26th, 2004 announced discloses indoles, benzoglyoxaline and naphthyl imidazoles as NSC 630176.
The patent application EP1608628 that announced on September 30th, 2004 discloses the hydroxamate that is connected with the non-aromatic heterocyclic system as NSC 630176.
The patent application EP1613622 that on October 14th, 2004 announced discloses 9 oxime derivate as NSC 630176.
The patent application EP1611088 that on October 28th, 2004 announced discloses the hydroxamate derivative as NSC 630176.
The patent application WO05/028447 that on March 31st, 2005 announced discloses benzoglyoxaline as NSC 630176.
Patent application WO05/030704 and WO05/030705 that on April 7th, 2005 announced disclose benzamides as NSC 630176.
The patent application WO05/040101 that announced on May 6th, 2005 discloses the acylurea connection and sulfonylurea connects hydroxamate as NSC 630176.
The patent application WO05/040161 that announced on May 6th, 2005 discloses dibenzyl and has connected hydroxamate as NSC 630176.
The patent application WO05/075469 that announced on August 18th, 2005 discloses thiazolyl hydroxamic acid and thiadiazolyl group hydroxamic acid as NSC 630176.
The patent application WO05/086898 that announced on September 22nd, 2005 discloses assorted penta ring hydroxamic acid as NSC 630176.
The patent application WO05/092899 that on October 6th, 2005 announced discloses the alkenyl benzene amides as NSC 630176.The compounds of this invention is different with structure, pharmacological activity and/or the drug effect of prior art.
The problem that need to solve provides has that high enzyme is lived and the dna methylase inhibitor inhibitor of cytoactive, drug effect enhancing in its bioavailability and/or the body.
Novel cpd of the present invention has solved the problems referred to above.The compounds of this invention can show the alive and cytoactive of good dna methylase inhibitor inhibitory enzyme.Compound also has the ability that higher level in cell and body activates the p21 gene.They have needed pharmacokinetic curve and to the low affinity of P450 enzyme system, this can reduce the disadvantageous interaction risk of medicine, has also enlarged safety range.
The favourable characteristics of The compounds of this invention are metabolic stability and/or p21 inducibility.Especially the stability of The compounds of this invention in people's hepatomicrosome increases, and/or p21 promotor inducibility increases in the body.
The present invention relates to formula (I) compound:
Its N-oxide form, pharmacy acceptable addition salt and form of three-dimensional chemical isomer, wherein
X is N or CH;
R 1Group for hydroxyl or formula (a-1)
Figure A200780002738D00122
Wherein
R 4Be hydroxyl or amino;
R 5Can choose wantonly by one or two following group for hydrogen, thienyl, furyl or phenyl and each thienyl, furyl or phenyl and to replace: halogen, amino, nitro, cyano group, hydroxyl, phenyl, C 1-6Alkyl, (two C 1-6Alkyl) amino, C 1-6Alkoxyl group, phenyl C 1-6Alkoxyl group, hydroxyl C 1-6Alkyl, C 1-6Alkoxy carbonyl, hydroxycarbonyl group, C 1-6Alkyl-carbonyl, many halos C 1-6Alkoxyl group, many halos C 1-6Alkyl, C 1-6Alkyl sulphonyl, hydroxycarbonyl group C 1-6Alkyl, C 1-6Alkyl-carbonyl-amino, amino-sulfonyl, amino-sulfonyl C 1-6Alkyl, isoxazolyl, aminocarboxyl, phenyl C 2-6Thiazolinyl, phenyl C 3-6Alkynyl or pyridyl C 3-6Alkynyl;
R 6, R 7And R 8Independent separately is hydrogen, amino, nitro, furyl, halogen, C 1-6Alkyl, C 1-6Alkoxyl group, trifluoromethyl, thienyl, phenyl, C 1-6Alkyl-carbonyl-amino, aminocarboxyl C 1-6Alkyl or-C ≡ C-CH 2-R 9
R wherein 9Be hydrogen, C 1-6Alkyl, hydroxyl, amino or C 1-6Alkoxyl group;
R 2Be amino, C 1-6Alkylamino, aryl C 1-6Alkylamino, C 1-6Alkyl-carbonyl-amino, C 1-6Alkyl sulfonyl-amino, C 3-7Cycloalkyl amino, C 3-7Cycloalkyl C 1-6Alkylamino, glutarimide base, dimaleoyl imino, phthalimide group, succinimido, hydroxyl, C 1-6Alkoxyl group, phenoxy group, the phenyl moiety of wherein said phenoxy group can be chosen wantonly by one or two substituting group and replace, and substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group, cyano group, C 1-6Alkoxy carbonyl and trifluoromethyl;
R 3Be phenyl, naphthyl or heterocyclic radical; Wherein
Each described phenyl or naphthyl can be chosen wantonly by one or two substituting group and replace, and substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group, many halos C 1-6Alkyl, aryl, hydroxyl, cyano group, amino, C 1-6Alkyl-carbonyl-amino, C 1-6Alkyl sulfonyl-amino, hydroxycarbonyl group, C 1-6Alkoxy carbonyl, hydroxyl C 1-6Alkyl, C 1-6Alkoxy methyl, amino methyl, C 1-6Alkylamino methyl, C 1-6Alkyl-carbonyl-amino methyl, C 1-6Alkyl sulfonyl-amino methyl, amino-sulfonyl, C 1-6Alkyl amino sulfonyl and heterocyclic radical;
Aryl is a phenyl or naphthyl; Wherein each described phenyl or naphthyl can be chosen wantonly by one or two substituting group and replace, and substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group, trifluoromethyl, cyano group and hydroxycarbonyl group; And
Heterocyclic radical is a furyl, thienyl, pyrryl, pyrrolinyl, pyrrolidyl, dioxa cyclopentenyl oxazolyl, thiazolyl, imidazolyl, imidazolinyl, imidazolidyl, pyrazolyl, pyrazolinyl, pyrazolidyl isoxazolyl, isothiazolyl oxadiazole base, triazolyl, thiadiazolyl group, pyranyl, pyridyl, piperidyl alkyl dioxin, morpholinyl, the dithiane base, thio-morpholinyl, pyridazinyl, pyrimidyl, pyrazinyl, piperazinyl, triazinyl, the trithian base, the indolizine base, indyl, indolinyl, benzofuryl, benzothienyl, indazolyl, benzimidazolyl-, benzothiazolyl, purine radicals, quinolizinyl, quinolyl, the cinnolines base, phthalazinyl, quinazolyl, quinoxalinyl or naphthyridinyl; Wherein
Each described heterocyclic radical can be replaced by one or two substituting group, and substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group, cyano group, amino and single or two (C 1-4Alkyl) amino.
Term " NSC 630176 " or " inhibitor of histon deacetylase (HDAC) " are used in reference to and can and suppress the compound of its activity, especially its enzymic activity with the histon deacetylase (HDAC) effect.Inhibition of histone deacetylation enzymic activity means the activity of reduction histon deacetylase (HDAC) to remove the ethanoyl of histone.Such suppresses preferred specificity and suppresses, and promptly this histon deacetylase (HDAC) can be in the activity that is lower than the low acetylation of histone enzyme of the needed density loss of some other uncorrelated biological effect of generation to remove the ethanoyl of histone.
In before definition and hereinafter, halogen general reference fluorine, chlorine, bromine and iodine; C 1-2Alkyl straight-chain stable hydrocarbon group contains 1 or 2 carbon atoms, for example methyl or ethyl; C 1-6Alkyl has defined C 1-2Alkyl and the straight chain and the branched-chain saturated hydrocarbon group that contain 3 to 6 carbon atoms, for example propyl group, butyl, 1-methylethyl, 2-methyl-propyl, amyl group, 2-methyl-butyl, hexyl, 2-methyl amyl and similar group; Many halos C 1-6Alkyl has defined the C that contains three identical or different halogenic substituents 1-6Alkyl, for example trifluoromethyl; C 2-6Thiazolinyl has defined the straight or branched hydrocarbon that contains two keys and contain 2-6 carbon atom, for example vinyl, 2-propenyl, 3-butenyl, pentenyl, 3-pentenyl, 3-methyl-2-butene base and similar group; C 3-6Alkynyl has defined straight chain or the straight chain hydrocarbon that contains a triple bond and contain 3 to 6 carbon atoms, for example 2-propynyl, 3-butynyl, 2-butyne base, valerylene base, 3-pentynyl, 3-hexin base and similar group; C 3-7Cycloalkyl comprises the cyclic hydrocarbon radical that contains 3 to 7 carbon, for example cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl ring, hexenyl, suberyl and similar group.
Pharmacy can be accepted additive salt and comprise that pharmacy can be accepted acid salt and pharmacy can be accepted base addition salt.Hereinafter described pharmacy can be accepted acid salt and means and comprise the non-toxic acid additive salt form with therapeutic activity, and it can be by formula I compound formation.Formula I compound with alkalescence can be converted into its pharmacy and can accept acid salt after suitable acid treatment.Suitable acid comprises that for example, mineral acid is haloid acid for example, example hydrochloric acid or Hydrogen bromide; Sulfuric acid; Nitric acid; Phosphoric acid and similarly acid; Or organic acid, for example acetic acid, trifluoroacetic acid, propionic acid, oxyacetic acid, lactic acid, pyruvic acid, oxalic acid, propanedioic acid, succsinic acid (being Succinic Acid), toxilic acid, fumaric acid, oxysuccinic acid, tartrate, citric acid, methylsulfonic acid, ethyl sulfonic acid, Phenylsulfonic acid, right-toluenesulphonic acids, Cyclamic Acid, Whitfield's ointment, right-amino-Whitfield's ointment, pounce on acid and class acidoid.
Having tart formula I compound can convert its pharmacy to and can accept base addition salt through suitable organic or inorganic alkaline purification.Suitable alkaline salt forms comprises that for example ammonium salt, alkaline or alkaline-earth salts are saloid as lithium, sodium, potassium, magnesium, calcium salt and class; With the salt that organic bases forms, for example benzyl star, N-methyl D-glucosamine, sea crust amine salt, and and amino acids formed salt, for example arginine, Methionin and similar amino acid salts.
Term " acid or base addition salt " also comprises hydrate and the solvent addition form that formula I compound can form.This form is hydrate, alcoholate and similar type for example.
Term used herein " formula I compound stereochemistry heterogeneous forms " is used to define the same atoms that is connected by the same keys sequence and forms the possible compound that still has the different three-dimensional structures that formula I compound may have, can not the phase co-conversion between them.Unless otherwise mentioned or indicate, a kind of chemical name of compound comprises the mixture of all possible stereochemistry heterogeneous forms that described compound may have.This mixture can comprise all diastereomers and/or the enantiomorph of described compound basic molecular structure.The pure thing form of all stereochemistry heterogeneous forms of formula I compound or the mixture that forms mutually all belong to category of the present invention.
The N-oxide form of formula I compound means the formula I compound that one or more nitrogen-atoms is oxidizing to so-called N-oxide compound, especially one or more piperidines-, piperazine or pyridazine nitrogen is by the N-oxide compound of N-oxidation.
Some formula I compounds also can its tautomeric form exist.Though clearly do not indicate these forms in the following formula, they also belong to category of the present invention.
Hereinafter the term of Shi Yonging " formula I compound " means and comprises pharmacy acceptable addition salt and all stereoisomeric forms in any ratio.
As used herein term " histon deacetylase (HDAC) " and " HDAC " mean any one member that can remove the enzyme family of acetyl group from the lysine residue of histone N-end.Unless indicate in addition in the literary composition, term " histone " means any histone protein that comes from any species, comprises H1, H2A, H2B, H3, H4 and H5.People HDAC protein or gene product include but not limited to HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10 and HDAC-11.This histon deacetylase (HDAC) also can come from protozoon or fungi.
First group of compound of interest is made up of such formula I compound, wherein R 1Be hydroxyl.
Second group of compound of interest is made up of such formula I compound, wherein R 5Be the group beyond the hydrogen.
The 3rd group of compound of interest is made up of such formula I compound, wherein is suitable for restriction below one or more:
A) X is N;
B) R 1Be the group of hydroxyl or formula (a-1), wherein R 4Be amino, R 5Be hydrogen or thienyl, and R 6, R 7And R 8Respectively be hydrogen.
C) R 2Be amino, C 1-6Alkyl-carbonyl-amino, C 1-6Alkyl sulfonyl-amino, phthalimide group, succinimido or phenoxy group, the phenyl moiety of wherein said phenoxy group can be chosen wantonly by halogenic substituent and replace (for example fluorine); And
D) R 3For being chosen wantonly the phenyl that replaces by one or two substituting group, substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group and many halos C 1-6Alkyl.
The 4th group of compound of interest is made up of such formula I compound, wherein is suitable for restriction below one or more:
A) X is N;
B) R 1Be hydroxyl
C) R 2Be amino, C 1-6Alkyl-carbonyl-amino, C 1-6Alkyl sulfonyl-amino, phthalimide group, succinimido or phenoxy group, the phenyl moiety of wherein said phenoxy group can be chosen wantonly by halogenic substituent and replace (for example fluorine); And
D) R 3For being chosen wantonly the phenyl that replaces by one or two substituting group, substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group and many halos C 1-6Alkyl.
Another group compound of interest is made up of such formula I compound, wherein R 3Be phenyl or naphthyl, wherein each described phenyl or naphthyl is replaced by the substituting group that one or two independently is selected from following group separately: halogen, C 1-6Alkyl, C 1-6Alkoxyl group, many halos C 1-6Alkyl, aryl, hydroxyl, cyano group, amino, C 1-6Alkyl-carbonyl-amino, C 1-6Alkyl sulfonyl-amino, hydroxycarbonyl group, C 1-6Alkoxy carbonyl, hydroxyl C 1-6Alkyl, C 1-6Alkoxy methyl, aminomethyl, C 1-6Alkylamino methyl, C 1-6Alkyl-carbonyl-amino methyl, C 1-6Alkyl sulfonyl-amino methyl, amino-sulfonyl, C 1-6Alkyl amino sulfonyl and heterocyclic radical.
One group of preferred compound of interest is made up of such formula I compound, wherein is suitable for restriction below one or more:
A) X is N;
B) R 1Be hydroxyl
C) R 2Be amino; And
D) R 3For being selected from halogen (preferred fluorine) and C 1-6The optional phenyl that replaces of substituting group of alkoxyl group (preferred methoxyl group).
The compound 2 that especially preferred formula I compound is following indication:
Figure A200780002738D00171
Can be by traditional method preparation I compound, their pharmaceutically acceptable salt and N-oxide compound and stereochemistry heterogeneous forms thereof.Initial substance and some intermediates are the popular response program preparation that known compound and can buying obtains or describes among well-known or patent application EP1485099, EP1485348, EP1485353, EP1485354, EP1485364, EP1485365, EP1485370 and the EP1485378 according to this area.Some preparation methods have hereinafter been described in more detail.Describe other among the embodiment and obtained the method for final formula I compound.
The specific procedure of preparation I compound has below been described:
A) hydroxamic acid of this paper Chinese style I compound (R wherein 1Be hydroxyl) refer to formula (I-a) compound, can be by a intermediate and the preparation of a kind of suitable acid-respons, for example trifluoroacetic acid with formula (II).The described appropriate solvent that is reflected at is for example carried out in methyl alcohol or the methylene dichloride.
Figure A200780002738D00172
B) this paper Chinese style (I) compound (R wherein 1Group for formula (a-1)) refers to formula (I-b) compound, can pass through intermediate prepared in reaction in the presence of suitable reagent (for example benzotriazole-1-base oxygen base three (tetramethyleneimine-1-yl) phosphorus hexafluorophosphate (PyBOP)) with an intermediate (wherein M represents hydrogen or a kind of basic metal, for example sodium or lithium) with the formula IV of formula III.This reaction can be carried out in appropriate solvent (for example mixture of methylene dichloride and tetrahydrofuran (THF)) in the presence of a kind of alkali (for example triethylamine).
Figure A200780002738D00181
Formula II intermediate can by with an intermediate of intermediate of formula III and formula V at suitable reagent (N '-(the ethyl imido is for formyl radical (ethylcarbonimidoyl))-N for example; N-dimethyl-1; the 3-propylene diamine, a hydrochloride (EDC) and 1-hydroxyl-1H-benzotriazole (HOBT)) the following prepared in reaction of existence.This reaction can be carried out in appropriate solvent (for example mixture of methylene dichloride and tetrahydrofuran (THF)) in the presence of alkali (for example triethylamine).
Figure A200780002738D00182
Formula I compound also transforms the phase co-conversion by reaction known in the art or functional group, depends on the susceptibility of other group in the molecule, for example carboxyester hydrolysis is become corresponding carboxylic acid or alcohol; Alcohol can change into ester or ether; Primary amine can change into the second month in a season or tertiary amine; Uncle or secondary amine can change into acid amides or sulfamido; Carbon monoxide under iodo group on the phenyl can exist by suitable palladium catalyst inserts and changes into ester.
Formula (III) intermediate can be by with intermediate of formula (VI) and suitable acid solution (for example hydrochloric acid) or suitable alkali (for example alkali metal base, as sodium hydroxide) (for example pure as ethanol or propyl alcohol or THF) prepared in reaction in appropriate solvent.
Figure A200780002738D00191
The formula II intermediate of this paper (R wherein 2Be amino) refer to formula (II-a) intermediate, can by with formula (VII) intermediate and piperidines in appropriate solvent prepared in reaction in the methylene dichloride for example.
Formula (VII) intermediate can by with formula (VIII) intermediate and formula V intermediate at suitable reagent (N '-(the ethyl imido is for formyl radical)-N for example; N-dimethyl-1; the 3-propylene diamine, a hydrochloride (EDC) and 1-hydroxyl-1H-benzotriazole (HOBT)) the following prepared in reaction of existence.This reaction can be carried out in appropriate solvent (for example mixture of methylene dichloride and tetrahydrofuran (THF)) in the presence of alkali (for example triethylamine).
Figure A200780002738D00201
Formula (VIII) intermediate can be by for example reacting formula (VI-b) intermediate and sodium hydroxide in appropriate solvent in the tetrahydrofuran (THF), then with the hydrochloric acid neutralization, add yellow soda ash and add the intermediate preparation of formula IX.
Formula (VI) intermediate (R wherein 2Be C 1-6Alkyl-carbonyl-amino) can pass through formula (VI-b) intermediate and suitable C 1-6Alkyl alkylating agent (for example halogenide, as muriate) in the presence of alkali (for example triethylamine) in appropriate solvent in (for example methylene dichloride) reaction generate.
The new intermediate of formula VI can be by intermediate and the diisopropyl azodiformate (DIAD) of formula X, three-n-butyl phosphine (PBu3) and suitable nucleophilic reagent R 2H (XI) for example reacts generation in the methylene dichloride in appropriate solvent.
Figure A200780002738D00211
Formula VI compound (R wherein 2Optional replaced by phenoxy group) can be by with formula (X) intermediate and the oxybenzene compound prepared in reaction that is optionally substituted accordingly.Formula (VI) compound (R wherein 2Be phthalimide group) also can pass through formula (X) intermediate and phthalimide prepared in reaction.Perhaps, formula (VI) compound (R wherein 2Be succinimido) can pass through formula (X) intermediate and succinimide prepared in reaction.
Can be with following formula (VI-b) intermediate by (a) with formula (X) intermediate and diisopropyl azodiformate (DIAD), three-n-butyl phosphine (PBu3) and phthalimide for example react in the methylene dichloride in appropriate solvent and form formula (VI-c) intermediate; (b) with gained formula (VI-c) intermediate and hydrazine mono-hydrate in appropriate solvent prepared in reaction in the ethanol for example.
Figure A200780002738D00212
Perhaps, formula (VI-c) intermediate can pass through with formula (XII) intermediate and by Synlett, suitable formula (XIII) epoxide of the step preparation that 2002 (8) 1265-1268 describe appropriate solvent for example among the THF reaction form formula (XIV) intermediate, its can with diisopropyl azodiformate (DIAD), three-n-butyl phosphine (PBu3) and phthalimide for example transform an accepted way of doing sth (VI-c) intermediate in the methylene dichloride during reaction in appropriate solvent.
The new intermediate of formula (X) can be by with formula (XII) intermediate and 1,4-diox-2,5-two pure and mild suitable formula (XV) boric acid (R wherein 3As above definition) for example reacts this easy steps preparation in the alcohol in appropriate solvent.
Formula (XII) intermediate can be by with formula (XVI) (L wherein 3Be leavings group, for example organic alkylsulfonyl is as methane sulfonyl) with piperazine (XVII) in the presence of the alkali (for example salt of wormwood) in appropriate solvent prepared in reaction in the acetonitrile for example.
Figure A200780002738D00231
The present invention also relates to be referred to as formula (B) compound with following formula (II), (III), (VI) and (X) intermediate, wherein Q is C 1-2Alkoxy carbonyl, MO 2C (wherein M is hydrogen or basic metal) or THP trtrahydropyranyl oxygen base aminocarboxyl, R 2aAs to R 2Define or for methylol and X and R 3Such as to formula (I) definition, and N-oxide form, pharmacy can be accepted additive salt form and stereochemistry heterogeneous forms.
Figure A200780002738D00232
According to defined each group of formula (I) compound, can interested in respectively organizing of above-mentioned intermediate, preferably, more there be choosing and most preferred to make definition.
Can have a three-dimensional center at least in the structure of formula (I) compound and some intermediates.This solid center can be R or S configuration.
Be generally the racemic mixture of enantiomer according to formula (I) compound of said process preparation, it can prepare one by one by separable programming known in the art.The racemic mixture of formula I can be by being converted into corresponding diastereo-isomerism salt form with the reaction of suitable chiral acid.This diastereo-isomerism salt can be then separated, for example by selective freezing or fractional crystallization, and discharges correspondence by alkali and reflect the structure body.The method of the enantiomerism form of another kind of separate type I compound relates to the liquid phase chromatography with chiral stationary phase.These pure three-dimensional chemical isomers also can be obtained by the corresponding pure stereochemistry heterogeneous forms of suitable initial substance, and prerequisite is that this reaction is for stereospecific.The specificity steric isomer preferably synthesizes this compound by three-dimensional special preparation method if desired.These methods are preferably used the pure initial substance of mapping.
Formula (I) compound and the acceptable acid salt of pharmacy thereof and stereoisomeric forms in any ratio have important pharmacological property, because they have histon deacetylase (HDAC) (HDAC) restraining effect.
The invention provides the method that comprises the improper growth of cell of transformant by the The compounds of this invention inhibition that gives significant quantity.The improper growth of cell refers to not rely on the cell growth (for example losing contact inhibition) of normal regulating mechanism.This comprises that directly (causing that growth of cancer cells is stagnated, the end breaks up and/or apoptosis eventually) and indirect (suppressing tumor neogenetic blood vessels forms) suppress tumor growth.
The present invention also provides by giving experimenter's (for example needing to carry out the Mammals (especially human) of this treatment) The compounds of this invention of significant quantity and has suppressed the method for tumor growth.The present invention especially provides the method that suppresses tumor growth by the The compounds of this invention that gives significant quantity.Can repressed tumour example include but not limited to lung cancer (for example gland cancer knurl and comprise nonsmall-cell lung cancer), pancreas cancer (cancer of pancreas for example, as the external secretion cancer of pancreas), colorectal carcinoma (colorectal carcinoma for example, as adenocarcinoma of colon and adenoma of colon), prostate cancer comprises terminal illness, pouring is a neoplastic hematologic disorder (acute lymphoblastic leukemia for example, the B-cell lymphoma, Burkitt lymphoma), marrow series leukemia (for example, acute myeloid leukemia (AML)), follicular carcinoma of thyroid, myelodysplastic syndrome (MDS), come from the tumour (for example fibroma and ear,nose ﹠ throat portion rhabdosarcoma) of a matter, melanoma, teratoma, neuroblastoma.Glioma, skin innocent tumor (for example keratoacanthoma), mammary cancer (for example advanced breast cancer), kidney malignant tumour, malignant tumor of ovary, bladder malignant tumour and epithelium malignant tumour.
Also can be used for the other treatment purpose according to compound of the present invention, for example:
A) by before the irradiation tumour, in the process or give afterwards to make tumour to the radiotherapy sensitivity according to compound of the present invention;
B) treatment joint disease and osteopathy, for example rheumatic arthritis, osteoarthritis, property childhood sacroiliitis, gout, polyarthritis, psoriatic arthritis, ankylosing spondylitis and systemic lupus erythematous;
C) suppress smooth muscle cell proliferation and comprise blood vessel hyperplasia disorder, arthrosclerosis and restenosis;
D) treatment inflammatory diseases and tetter, for example ulcerative colitis, Crohn's disease, allergic rhinitis, graft versus host disease (GVH disease), conjunctivitis, asthma, ADRS, Behcet's disease, transplant rejection, urticaria, allergic dermatitis, alopecia areata, scleroderma, rash, eczema, dermatomyositis, seat sore, diabetes, systemic lupus erythematous, mucocutaneous lymphnode syndrome, multiple sclerosis, pulmonary emphysema, cystic fibrosis and chronic tracheitis;
E) treatment endometriosis, fibroma uteri, dysfunctional uterine bleeding and endometrial hyperplasia;
F) the treatment ocular angiogenesisization comprises the vascular disease that influences retina and choroidal artery;
G) treatment cardiac insufficiency
H) suppress immunosuppressant disease and for example treat the HIV infection;
I) treatment renal insufficiency
J) suppress endocrine regulation
K) suppress the glyconeogenesis dysfunction
L) treatment sacred disease, for example Parkinson also maybe can cause the sacred disease of cognitive disorder, for example the relevant mental disorder of Alzheimer or poly glumine;
M) treatment mental disorder, for example schizophrenia, bipolar affective disorder, depression, anxiety and mental anomaly;
N) suppress neuromuscular disease, for example amyotrophic lateral sclerosis
O) treatment Duchenne-Arandisease disease
P) disease of the potential expression treatment of gene is complied with in treatment;
Q) enhancing gene treatment
R) suppress lipogenesis
S) treat for example malaria of parasitosis.
Therefore, the invention discloses formula (I) compound as drug use and use these formulas (I) compound production for treating one or more plant the purposes of above-mentioned disease.
Formula (I) compound and the acceptable acid salt of pharmacy thereof and stereochemistry heterogeneous forms have important diagnostic character, because they can be used for detecting or the identification of organism sample in HDAC, comprise and detect or measure the mixture that forms between tagged compound and the HDAC.
Detection and authentication method can use and be labeled reagent, for example the compound of marks such as emitting isotope, enzyme, fluorescent substance, luminophore.The example of these emitting isotopes comprises 125I, 131I, 3H and 14C.Make the enzyme can be detected by puting together with suitable substrate, it can follow the detectable reaction of catalysis.The example comprises, for example beta-galactosidase enzymes, beta-glucosidase, alkaline phosphatase, peroxidase and malate dehydrogenase (malic acid dehydrogenase), preferred horseradish peroxidase.Luminophore comprises, for example luminol,3-aminophthalic acid cyclic hydrazide, luminol,3-aminophthalic acid cyclic hydrazide derivative, fluorescein, photoprotein and luciferase.
Biological sample may be defined as bodily tissue or body fluid.The body fluid example is cerebrospinal fluid, blood, blood plasma, urine, phlegm and similar body fluid.
In view of can being mixed with motif compound various medicament forms, their available pharmacological property is used for administration.
Be preparation pharmaceutical composition of the present invention, as active ingredient and pharmaceutical acceptable carrier thorough mixing, carrier can be various forms with the acid of certain compound of significant quantity or base addition salt form, and this depends on the required form that gives preparation.These pharmaceutical compositions are required to be the single formulation that is suitable for administration, and preferred oral, rectal administration or enteron aisle are injected outward.For example, during the oral dosage form of preparation said composition, any conventional medicine medium be can use, for example in oral liquid such as suspension, syrup, water, propylene glycol, oil, alcohol and similar mediums made; Perhaps in powder, pill and tablet, use solid carrier, for example starch, sugar, kaolin, lubricant, tackiness agent, disintegrating agent and similar substrates.
Because convenient drug administration, tablet and capsule have been represented most favourable oral dosage unit form, wherein clearly can use solid pharmaceutical carriers.For the outer composition of enteron aisle, its carrier generally includes sterilized water (accounting for major part at least), although also can comprise other compositions of assist in dissolving.In the preparation of injection solution, its carrier comprises the mixture of normal saline solution, glucose solution or physiological saline and glucose solution.Injection suspension also can prepare under the situation of using suitable liquid vehicle, suspensoid and similar reagents.In being applicable to the composition of percutaneous dosing, carrier can be chosen wantonly and contain penetration enhancers and/or suitable wetting agent, can choose wantonly with the suitable a small amount of auxiliary material with any character and mix, and these auxiliary materials can not cause deleterious effect to skin.Described auxiliary material can strengthen percutaneous dosing and/or help to prepare required composition.The administration in every way of these compositions, for example transdermal patch, for example spot-on or ointment.
It is especially favourable for being convenient to administration and dosage homogeneity that aforementioned pharmaceutical compositions is mixed with dosage unit form.The dosage unit form that uses in the specification sheets of this paper and the claim refer to be applicable to single dose with the discontinuous unit of needed pharmaceutical carrier blended physics, per unit contains through calculating the active ingredient with the predetermined amount that produces needed therapeutic action.The example of such dosage unit form is tablet (comprising scored tablet or coating tablet), capsule, pill, powder packets, wafer, injection solution or suspensoid, teaspoon amount, soupspoon amount and similar type, and separated complex form (segregated multiples).
Those skilled in the art can determine significant quantity from the experimental result of hereinafter listing at an easy rate.It has been generally acknowledged that the treatment significant quantity is 0.005mg to a 100mg/ kg body weight, be specially 0.005mg to 10mg/ kg body weight.In one day, also be suitable with twice, three times, four times or divided dose administration more frequently with required dosage.Described divided dose can be mixed with unit dosage form, for example contains 0.5 to 500mg in the per unit dosage form, is specially 10 to 500mg active ingredient.
The present invention has designed the composition of HDAC-inhibitor and another kind of cancer therapy drug on the other hand, especially as medicine, more specifically is used for the treatment of cancer or relative disease.
For above treatment of diseases, can advantageously The compounds of this invention and one or more be planted other drug, more specifically, unite use with other cancer therapy drugs.The example of cancer therapy drug has:
-iridium-platinum complex is cis-platinum, carboplatin or oxaliplatin for example;
-taxane compounds is taxol or Japanese yew terpene for example;
-topoisomerase I inhibitor, Comptothecin compounds for example is as Rinotecan or Hycamtin;
-topoisomerase II inhibitor, for example antitumor podophyllotoxin derivative is as Zuyeyidal or teniposide;
-antitumor vinca alkaloids, for example vinealeucoblastine(VLB), vincristine(VCR) or vinorelbine;
-antitumor nucleotide derivative, for example 5 FU 5 fluorouracil, gemcitabine or capecitabine;
-alkylating agent is mustargen or nitrosourea for example, for example endoxan, Amboclorin, carmustine or Lomustine;
-antitumor anthracycline derivatives, for example daunorubicin, Zorubicin, idarubicin or mitoxantrone;
-HER 2Antibody is trastuzumab for example;
-estrogen receptor antagon or selective estrogen receptor modulators, for example tamoxifen, toremifene, fulvestrant or raloxifene;
-aromatase inhibitor is Exemestane, anastrozole, letrozole and vorozole for example;
-differentiation medicament, for example retinoid, vitamins D and vitamin A acid, metabolic block agent (RAMBA), for example isotretinoin;
-dnmt rna inhibitor is U-18496 for example;
-kinase inhibitor, for example flavophenine, imatinib mesylate or Gefitinib;
-farnesyltransferase inhibitor;
-other hdac inhibitor;
-Ubiquitin-Proteasome Pathway inhibitor, for example Velcade (ten thousand jade-like stones); Or
-?Yondelis。
Term used herein " iridium-platinum complex " refers to any iridium-platinum complex that suppresses growth of tumour cell, and it provides the platinum of ionic species.
Term " taxane compounds " refers to have the taxane-ring system and derived from certain a yew tree extract or a relative compounds.
Term " topoisomerase enzyme inhibitor " is used in reference to the enzyme that can change the eukaryotic cell dna topological framework.They are critical for important cell function and cell increment.Two kinds of topoisomerases are arranged, i.e. I type and II type in the eukaryotic cell.Topoisomerase I is the monomeric enzyme of about 100000 molecular masses.This enzyme can combine with DNA and cause temporary transient single-strand break, and duplex is untwisted (or allowing it to untwist) exposed fracture location then before breaking away from the DNA chain.Topoisomerase II has similar mechanism of action, but its inducing DNA splitting of chain or formation free radical.
Term " Comptothecin compounds " is used in reference to derived from parent Comptothecin compounds or relative compound, and the former is the water-soluble alkaloid derived from Chinese camplotheca acuminata (Camptothecin acuminata) and India's foetid nothapodytes herb (Nothapodytes foetida).
Term " podophyllotoxin compound " is used in reference to and is derived from parent podophyllotoxin or the relative compound of extraction from hemlock eggplant plant.
Term " Anti-tumor Changchun alkaloid " is used in reference to derived from periwinkle (rose Vinca) or relative compound.
Term " alkylating agent " comprise have can be under physiological condition to the important macromole of biology for example DNA all kinds of chemical substances of this common property of alkyl are provided.For the prior reagent of the overwhelming majority for example mustargen and nitrosourea, its alkanisation part is producing in body through the mixture DeR after, and some of them have enzyme work.The most important pharmacological action of alkylating agent is for disturbing and the synthetic basic mechanism relevant with cell fission of cell proliferation especially DNA.It is their therapeutic application and many toxic bases that alkylating agent disturbs DNA function and the ability of mixing the fast breeding tissue.
Term " antitumor anthracycline derivative " comprises microbiotic and the derivative thereof from fungi Strep.peuticus var.caesius, and its characteristics are to have the tsiklomitsin ring structure that comprises rare sugar, gentle amine, and the former combines with the latter by glycosidic link.
The amplification that studies show that human epidermal growth factor receptor 2's albumen in the primary breast cancer (HER 2) is relevant with some patients clinical poor prognosis.Herceptin is highly purified recombinant DNA deutero-Humanized monoclonal antibodies IgG1 κ antibody, and its ectodomain to HER 2 acceptors has high affinity.
Many mammary cancer have estrogen receptor and these growth of tumor can be activated by oestrogenic hormon.Term " estrogen receptor antagon " and " selective estrogen receptor modulators " be used in reference to can with the competitive inhibitor of estrogen receptor (ER) bonded estradiol.When combining with ER, selective estrogen receptor modulators can be induced the change of this receptor 3D shape, regulates it and goes up combining of estrogen response element (ERE) with DNA.
In menopausal women, the estrogenic main source that circulates is for forming oestrogenic hormon (oestrone and estradiol) by suprarenal gland and ovarian androgens (Androstenedione and testosterone) conversion under the effect of peripheral tissues's aromatizing enzyme.By suppress aromatizing enzyme or make its inactivation block oestrogenic hormon be to suffer from hormone-dependent type mammary cancer climacteric patient effectively and have an optionally methods of treatment.
Term used herein " estrogen antagonist medicine " comprises that not only estrogen receptor antagon and selective estrogen receptor modulators also comprise aforesaid arimedex.
Term " differentiation agent " refers to and can suppress cell proliferation and induce the compound of differentiation through variety of way.Known vitamins D and retinoid regulate various normal and worsen in the growth of cellular type and the differentiation and play a significant role.Retinoic acid metabolism blocker (RAMBA ' s) can be by suppressing vitamin A acid the concentration of metabolism raising endogenous vitamin A acid of Cytochrome P450-mediation.
It is modal improper phenomenon in people's adenoma that dna methylation changes.The high methylation of promotor is relevant with the inactivation of genes involved usually in institute's screening-gene.Term " dnmt rna inhibitor " is used in reference to and can suppresses dnmt rna and reactivate the compound that the tumor-inhibiting factor expression of gene plays a role by pharmacology.
Term " kinase inhibitor " comprises the kinase whose potent inhibitor relevant with apoptosis (apoptosis) with cell cycle progression.
Term " farnesyl transferase inhibitor " is used in reference to the compound that is designed to stop Ras albumen and other intracellular protein farnesylations.They have demonstrated the effect to malignant cell propagation and survival.
Term " other hdac inhibitor " includes but not limited to:
-carboxylate, for example butyrates, styracin, 4 butyric acid phenyl ester or valproic acid;
-hydroxamic acid, suberoyl aniline (suberoylanilide) hydroxamic acid (SAHA) for example, the piperazine that contains the SAHA analogue, dibenzyl hydroxamic acid A-161906 and carbozolylether-thereof, tetrahydropyridine-and the Tetralone an intermediate of Sertraline analogue, aryl bicyclic-N-hydroxyl carboxamide, pyroxamide, CG-1521, PXD-101, the White streptocide hydroxamic acid, LAQ-824, LBH-589, Trichostatin A (TSA), oxamflatin, scriptaid, three toroidal molecules that scriptaid is relevant, the two hydroxamic acid (CBHA) of m-o-carboxy cinnamic acid, class CBHA hydroxamic acid, trapoxin-hydroxamic acid analogue, CRA-024781, R306465 and relevant benzoyl and heteroaryl-hydroxamic acid, amino suberic acid and malonyl-diamide;
-cyclic tetrapeptide, for example trapoxin, apidicin, depsipeptide, spiruchostatin-related compound, RedFK-228 contains sulfydryl cyclic tetrapeptide (SCOPs), contains the hydroxamic acid (CHAPs) of cyclic tetrapeptide, TAN-174s and azumamides;
-benzamides is MS-275 or CI-994 for example, or
-depudecin。
Term " ubiquinone protein enzyme body approach restrainer " is used to define the target destructive compound of intracellular protein in the proteasome that can suppress to comprise cyclin.
The compound that is used for the treatment of cancer according to the present invention can give patient with radiation by aforesaid method.Radiation refers to especially gamma-radiation of ionizing rays, the radiation of linear accelerator that generally uses or radionuclide radiation especially nowadays.Radionuclide can be in external or the body to the radiation of tumour.
The present invention also relates to composition according to a kind of cancer therapy drug of the present invention and a kind of hdac inhibitor.
The present invention also relates to be used for the foundation composition of the present invention that therapeutic treatment for example suppresses growth of tumour cell.
The present invention crosses and also relates to the foundation composition of the present invention that is used to suppress growth of tumour cell.
The present invention also relates to suppress in the human experimenter method of growth of tumour cell, it comprises the foundation that gives experimenter's significant quantity composition of the present invention.
The present invention further provides by the foundation that gives significant quantity composition of the present invention and suppressed the method that improper cell comprises the transfectional cell growth.
Other medicament can or give successively with the hdac inhibitor while (for example to separate or single composition).Under latter event, in for some time, give two kinds of compounds and make the amount and the mode that give be enough to guarantee to reach favourable or synergy.Be understandable that the preferred medication of each component in the composition and dosage and dosage regimen that order of administration reaches separately depend on specific another kind of medicine and hdac inhibitor, their route of administration, the specific tumors that quilt is treated and the specific host of being treated that is given.The definite easily best approach of information and order of administration and dosage and dosage regimen that those skilled in the art can use ordinary method and consider to list herein.
The favourable dosage of iridium-platinum complex is 1-500mg/m 2Body surface area, for example 50-400mg/m 2, especially cis-platinum dosage is about 75mg/m 2, carboplatin is about 300mg/m 2/ the course of treatment.
The favourable dosage of taxane compounds is 50-400mg/m 2Body surface area, for example 75-250mg/m 2, especially the dosage of taxol is about 175-250mg/m 2, the Japanese yew terpene is about 75-150mg/m 2/ the course of treatment.
The favourable dosage of Comptothecin compounds is 0.1-400mg/m 2Body surface area, for example 1-300mg/m 2, especially the dosage of Rinotecan is about 100 to 350mg/m 2, Hycamtin is about 1-2mg/m 2/ the course of treatment.
The favourable dosage of antitumor podophyllotoxin derivative is 30-300mg/m 2Body surface area, for example 50-250mg/m 2, especially the dosage of Zuyeyidal is about 35-100mg/m 2, teniposide is about 50-250mg/m 2/ the course of treatment.
The alkaloidal favourable dosage of anti-tumor long spring flower is 2-30mg/m 2The dosage of body surface area, especially vinealeucoblastine(VLB) is about 3-12mg/m 2, vincristine(VCR) is about 1-2mg/m 2, the dosage of vinorelbine is about 10-30mg/m 2/ the course of treatment.
The favourable dosage of antitumor nucleoside derivates is 200-2500mg/m 2Body surface area, for example 200-2500mg/m 2, especially the dosage of 5-FU is 200-500mg/m 2, the dosage of gemcitabine is about 800-1200mg/m 2, capecitabine is about 1000-2500mg/m 2/ the course of treatment.
The alkylating agent for example favourable dosage of mustargen or nitrosourea is 100-500mg/m 2The dosage of body surface area, especially endoxan is about 100-500mg/m 2, the dosage of Amboclorin is about 0.1-0.2mg/m 2, the dosage of carmustine is about 150-200mg/m 2, the dosage of lomustine is about 100-150mg/m 2/ the course of treatment.
The favourable dosage of antitumor anthracycline derivatives is 10-75mg/m 2Body surface area, for example 15-60mg/m 2, especially the dosage of Dx is about 40-75mg/m 2, the dosage of daunorubicin is about 25-45mg/m 2, the dosage of idarubicin is about 10-15mg/m 2/ the course of treatment.
The favourable dosage of trastuzumab is 1-5mg/m 2Body surface area, especially 2-4mg/m 2/ the course of treatment.
The favourable dosage of estrogen antagonist medicine is about 1-100mg/ days, depends on specific medicine and the illness of being treated.
The favourable oral administration dosage of tamoxifen is 5-50mg, and preferred 10-20mg/ two days will treat long enough until reaching and keeping result of treatment.The favourable oral administration dosage of toremifene is about 60mg/ days, will treat long enough until reaching and keeping result of treatment.The favourable oral administration dosage of Anastrozole is about 20-100mg/ days.The favourable oral administration dosage of raloxifene is about 60mg/ days.The favourable oral administration dosage of Exemestane is about 25mg/ days.
These dosage for example can give once, twice or more times per course of treatment, can repeat a treatment in per 7,14,21 or 28 days.
In view of their available pharmacological property, according to the component in the composition of the present invention, for example other medicines and hdac inhibitor can be mixed with various medicament forms and be used for the administration purpose.These components can be mixed with independent pharmaceutical composition respectively or contain the single medicine composition of two kinds of components.
Therefore the present invention also relates to contain other medicines and with the pharmaceutical composition of the hdac inhibitor of one or more pharmaceutical carriers.
The present invention also relates to contain cancer therapy drug and plant the foundation composition of the present invention of pharmaceutical compositions of the hdac inhibitor of pharmaceutical carriers with one or more according to the present invention.
The invention further relates to and use the pharmaceutical composition that is used to suppress growth of tumour cell according to composition production of the present invention.
The invention further relates to and contain according to hdac inhibitor of the present invention as first active ingredient and a kind of cancer therapy drug product as second active ingredient, as combined preparation simultaneously, separately or order be used for the treatment of the patient who suffers from cancer.
Test portion
Hereinafter, " K 2CO 3" refer to salt of wormwood, " Na 2CO 3" refer to yellow soda ash, " CH 2Cl 2" refer to methylene dichloride, " MgSO 4" refer to sal epsom; " DIPE " refers to diisopropyl ether; " DIAD " refers to two (1-methylethyl) esters of azoformic acid; " THF " refers to tetrahydrofuran (THF); " HOBT " refers to 1-hydroxyl-1H-benzotriazole, and " EDC " refers to N '-(the ethyl imido is for formyl radical)-N, N-dimethyl-1; 3-propanediamine mono-hydrochloric salts, " EtOAc " refers to ethyl acetate, " Et 3N " refer to triethylamine, " NH 4OH " refer to ammonium hydroxide.
The preparation of intermediate
Embodiment A 1
A) preparation of intermediate 1
Figure A200780002738D00341
With 2-(1-piperazinyl)-5 pyrimidinecarboxylic acid ethyl esters (0.0169mol), (2-styryl)-boric acid (0.0169mol) and 1,4-diox-2, the mixture of 5-glycol (0.0169mol) in ethanol (250ml) at room temperature stirred 2 days, then evaporating solvent (vacuum).Use CH 2Cl 2And H 2The O dissolution residual substance separates organic phase, dry (MgSO 4), filter and evaporating solvent.(15-40 μ m) (eluent: CH on silica gel 2Cl 2/ CH 3OH 97/1) usefulness column chromatography technology purifying residue.With the evaporation of pure flow point, obtain 4g (61%) intermediate 1 (M.P.:128 ℃; The E-configuration).
B) preparation of intermediate 2
Figure A200780002738D00342
In 5 ℃ of CH to intermediate 1 (0.0026mol) and 1H-isoindole-1,3 (2H)-diketone (0.0039mol) 2Cl 2(50ml) in nitrogen gas stream, dropwise add tributylphosphine (0.0039mol) and DIAD (0.0039mol) in the solution successively.At room temperature this mixture was stirred 15 hours.Add tributylphosphine (0.0039mol) and DIAD (0.0039mol) in 5 ℃.At room temperature this mixture was stirred 24 hours, be poured onto on ice and use CH 2Cl 2Extraction.(eluent: CH on silica gel 2Cl 2/ CH 3OH97/1; 15-40 μ m) with column chromatography technology purifying residue.Collect pure flow point and evaporating solvent, obtain 0.84g (52%) intermediate 2 (M.P:50 ℃; The E-configuration).
C) preparation of intermediate 3
Figure A200780002738D00343
Mixture in ethanol (10ml) stirred 3 hours in 65 ℃ with intermediate 2 (0.0072mol) and bromination one hydrazine hydrate (0.0021mol).Use CH 2Cl 2Extraction leftover.Use H 2O washs organic phase, dry (MgSO 4), filter and evaporating solvent, obtain 2.7g intermediate 3 (E-configuration).
D) preparation of intermediate 4
Figure A200780002738D00351
CH with Acetyl Chloride 98Min. (0.0023mol) 2Cl 2(1ml) solution dropwise adds intermediate 3 (0.0015mol) and N, the CH of N-diethyl ethamine (0.0031mol) in 5 ℃ under nitrogen gas stream 2Cl 2(13ml) solution.Mixture in 5 ℃ of stirrings 30 minutes, was at room temperature stirred 1 hour 30 minutes then.Wash organic phase, drying (MgSO with water 4), filter and evaporating solvent.(eluent: CH on silica gel 2Cl 2/ CH 3OH/NH 4OH 99/1/0.1; 10 μ m) with column chromatography technology purifying residue.Collect pure flow point and evaporating solvent, obtain 0.33g (40%) intermediate 4 (E-configuration).
E) preparation of intermediate 5
Figure A200780002738D00352
With intermediate 4 (0.0007mol) and lithium hydroxide (0.0015mol) at THF (25ml) and H 2Mixture among the O (8ml) stirred 15 hours and used 1N HCl acidifying under room temperature.Evaporation THF.With sedimentation and filtration, water, DIPE washing successively then, drying obtains the hydrochloride (E-configuration) of 0.32g (83%) intermediate 5.
F) preparation of intermediate 6
Figure A200780002738D00353
With EDC (0.0011mol) and HOBT (0.0011mol) in nitrogen gas stream, adding intermediate 5 (0.0007mol), O-(tetrahydrochysene-2H-pyrans-2-yl) azanol (0.0011mol) and N, the CH of N-diethyl ethamine (0.0022mol) under the room temperature 2Cl 2/ THF (50/50) is (40ml) in the solution.This mixture was stirred under room temperature 36 hours, pour H into 2Among the O and use CH 2Cl 2Extraction.With organic phase separation, dry (MgSO 4), filter and evaporating solvent.Crystalline residue from ether.With sedimentation and filtration and dry, obtain 0.34g (92%) intermediate 6 (M.P.:198 ℃; The E-configuration).
Embodiment A 2
A) preparation of intermediate 7
Figure A200780002738D00361
With intermediate 3 (0.0026mol) and lithium hydroxide (0.0039mol) at THF (30ml) and H 2Mixture among the O (15ml) at room temperature stirred 15 hours, added 1N HCl then to neutral.Evaporation THF.Filtering-depositing is used H successively 2O and ether washing, dry then, obtain 0.9g intermediate 7 (E configuration).
B) preparation of intermediate 8
With Na 2CO 3(0.0076mol) add intermediate 7 (0.0025mol) at THF (30ml) and H 2In the mixture among the O (30ml).Stir 10min.Gradation adds 1-[[(9H-fluorenes-9-ylmethyl) carbonyl] oxygen]-2,5-pyrrolidine-diones (0.0025mol).Stirring at room mixture 18 hours is cooled to 5 ℃ then.Add 1N HCl to neutral.Evaporation THF.Filtering-depositing is used H successively 2O and ether washing obtain 1.2g (82%) intermediate 8 (E configuration).
C) preparation of intermediate 9
Figure A200780002738D00363
At room temperature, HOBT (0.0031mol) and EDC (0.0031mol) are added intermediate 8 (0.002mol), O-(tetrahydrochysene-2H-pyrans-2-yl) azanol (0.0031mol) and N, the CH of N-diethyl ethamine (0.0062mol) 2Cl 2In/THF (50/50) solution (130ml).Stirring at room mixture 48 hours, impouring H 2Among the O, use CH 2Cl 2Extract.Separate organic phase, dry (MgSO 4), filter, then evaporating solvent.With silica gel column chromatography purifying residue (eluent: CH 2Cl 2/ CH 3OH 98/2; 15-40 μ m).Collect pure flow point and evaporating solvent, obtain 1.07g (76%) intermediate 9 (E configuration).
D) preparation of intermediate 10
Figure A200780002738D00371
The CH that piperidines (0.0039mol) is added intermediate 9 (0.0012mol) 2Cl 2In the solution (25ml).Stirring at room mixture 24 hours.Use H 2O washs organic phase, dry (MgSO 4), filter, then evaporating solvent.With silica gel column chromatography purifying residue (eluent: CH 2Cl 2/ CH 3OH/NH 4OH 96/4/0.2; 15-40 μ m).Collect required flow point, evaporating solvent obtains 0.32g (56%) intermediate 10 (E configuration).
Embodiment A 3
A) preparation of intermediate 11
Figure A200780002738D00372
In 5 ℃ tributylphosphine (0.0047mol) and DIAD (0.0047mol) are added intermediate 2 (0.0015mol) and 2 successively, the CH of 5-pyrrolidine-diones (0.0047mol) 2Cl 2In the solution (30ml).Stirring at room mixture 48 hours.Add pyrrolidine-diones, tributylphosphine and DIAD.Stirring at room mixture 15 hours inclines on ice, uses CH 2Cl 2Extract.Separate organic phase, dry (MgSO 4), filter, then evaporating solvent.With silica gel column chromatography purifying residue (eluent: CH 2Cl 2/ CH 3OH 99/1; 15-40 μ m).Collect pure flow point, evaporating solvent.With silica gel column chromatography purifying gained residue (eluent: CH 2Cl 2/ EtOAc 80/20; 15-40 μ m).Collect pure flow point, evaporating solvent obtains 0.55g (76%) intermediate 11 (fusing points: 158 ℃; The E configuration).
B) preparation of intermediate 12
Figure A200780002738D00381
THF (40ml) and H with intermediate 11 (0.0008mol) and lithium hydroxide (0.0022mol) 2The mixture of O (20ml) at room temperature stirred 15 hours, then with 3N HCl neutralization.Filtering-depositing is used H successively 2O and ether washing, drying obtains 0.26g (65%) intermediate 12 (E configuration).
C) preparation of intermediate 13
Figure A200780002738D00382
The mixture of intermediate 12 (0.0005mol) in acetate (4ml) stirred 7 hours down in 100 ℃.Add H 2O and ice.Filtering-depositing is used H successively 2The washing of O and ether, drying obtains the acetate (CH of 0.22g (77%) intermediate 13 (E configurations) 3COOH).
D) preparation of intermediate 14
Figure A200780002738D00383
At N 2Under the air-flow, HOBT (0.0006mol) and EDC (0.0006mol) are added intermediate 13 (0.0004mol), O-(tetrahydrochysene-2H-pyrans-2-yl) azanol (0.0006mol) and N, the CH of N-diethyl ethamine (0.0017mol) successively 2Cl 2In/THF (50/50) solution (30ml).At room temperature stirred the mixture impouring H 15 hours 2Among the O, use CH 2Cl 2Extract.Separate organic phase, dry (MgSO 4), filter, then evaporating solvent.With silica gel column chromatography purifying residue (eluent: CH 2Cl 2/ CH 3OH/NH 4OH 99/1/0.1 to 90/10/0.5; 3-5 μ m).Collect pure flow point, evaporating solvent obtains 0.19g (83%) intermediate 14 (E configuration).
Embodiment A 4
A) preparation of intermediate 15
Figure A200780002738D00391
In 5 ℃ at N 2Under the air-flow, tributylphosphine (0.0031mol) and DIAD (0.0031mol) are added successively the CH of intermediate 1 (0.0015mol) and 4-fluorophenol (0.0031mol) 2Cl 2In the solution (30ml).Stirring at room mixture 15 hours.Add 4-fluorophenol (0.0031mol), tributylphosphine (0.0031mol) and DIAD (0.0031mol) once more.Stirring at room mixture 24 hours in the impouring frozen water, is used CH 2Cl 2Extract.Separate organic phase, dry (MgSO 4), filter, then evaporating solvent.With silica gel column chromatography purifying residue (eluent: CH 2Cl 2/ CH 3OH99/1; 15-40 μ m).Collect pure flow point, evaporating solvent.With silica gel column chromatography purifying residue (eluent: hexanaphthene/EtOAc 75/25; 15-40 μ m).Collect pure flow point, evaporating solvent obtains 0.54g (72%) intermediate (oily; The E configuration).
B) preparation of intermediate 16
Figure A200780002738D00392
THF (50ml) and H with intermediate 15 (0.001mol) and lithium hydroxide (0.0026mol) 2Mixture among the O (25ml) at room temperature stirred 15 hours, with 3N HCl acidifying.Evaporation THF.Filtering-depositing is used H successively 2The washing of O and ether, drying obtains the hydrochloride (HCl) of 0.47g (92%) intermediate 16 (E configuration).
C) preparation of intermediate 17
At room temperature, N 2Under the air-flow, HOBT (0.0014mol) and EDC (0.0014mol) are added intermediate 16 (0.0009mol), O-(tetrahydrochysene-2H-pyrans-2-yl) azanol (0.0014mol) and N, the CH of N-diethyl ethamine (0.0038mol) successively 2Cl 2In/THF (50/50) solution (60ml).Stirred the mixture impouring H 15 hours 2Among the O, use CH 2Cl 2Extract.Separate organic phase, dry (MgSO 4), filter evaporating solvent.With silica gel column chromatography purifying residue (eluent: CH 2Cl 2/ CH 3OH/NH 4OH 99/1/0.1 to 90/10/0.5; 3-5 μ m).Collect pure flow point, evaporating solvent obtains 0.2g (38%) intermediate 17 (E configuration).
Embodiment A 5
A) preparation of intermediate 18
Figure A200780002738D00401
With intermediate 2 (0.0011mol) and lithium hydroxide (0.0023mol) at THF (30ml) and H 2Mixture among the O (15ml) at room temperature stirred 15 hours, with 3N HCl neutralization.Filtering-depositing, drying obtains 0.51g intermediate 18 (E configuration).
B) preparation of intermediate 19
Figure A200780002738D00402
The mixture of intermediate 18 (0.0019mol) and acetate (15ml) was stirred evaporation then 5 hours in 100 ℃.Residue is added H 2Among the O, use K then 2CO 3Neutralization.Filtering-depositing is used H successively 2O and ether washing, drying obtains 0.8g (86%) intermediate 19 (E configuration).
C) preparation of intermediate 20
Figure A200780002738D00403
At room temperature, to the CH of intermediate 19 (0.0002mol) 2Cl 2Thionyl chloride (0.0021mol) in the solution (4ml).Backflow stirred the mixture 15 hours, evaporated then, obtained the hydrochloride (.HCl) (E configuration) of intermediate 20.
D) preparation of intermediate 21
In 5 ℃ to [2-amino-4-(2-thienyl) benzene]-1, drip the CH of intermediate 20 (0.0002mol) in the pyridine solution (6ml) of 1-dimethyl ethyl ester carboxylamine (0.0003mol) 2Cl 2(2ml) solution.Stirring at room mixture 15 hours.The evaporation pyridine.Residue is added CH 2Cl 2In.Use H 2O washs organic phase, dry (MgSO 4), filter evaporating solvent.Gained residue (0.2g) purification by silica gel column chromatography (eluent: CH 2Cl 2/ CH 3OH 98/2; 15-40 μ m).Collect required flow point, evaporating solvent obtains 0.12g intermediate 21 (E configuration).
Embodiment A 6
A) preparation of intermediate 22
With 1,4-dioxane-2,5-glycol (0.0093mol) adds in the ethanolic soln (200ml) of [2-(4-fluoro phenyl) vinyl] boric acid (0.0093mol).Add 6-(1-piperazinyl)-3-pyridine carboxylic acid ethyl ester (0.0085mol).Stirring at room mixture 15 hours filters then.Evaporated filtrate.Residue is added among the EtOAc.Wash organic phase with saturated nacl aqueous solution, dry (MgSO 4), filter evaporating solvent.(3.3g) is dissolved in ether with this flow point.In 5 ℃ of Dropwise 5s-6N HCl (2ml).Filtering-depositing is with ether washing, drying.This flow point (3g) is added H 2Among the O, add K then 2CO 3Use CH 2Cl 2Extract mixture.Separate organic phase, dry (MgSO 4), filtering, evaporating solvent obtains 2.7g (79%) intermediate 22 (E configuration).
B) preparation of intermediate 23
Figure A200780002738D00413
At 5 ℃, N 2Under the air-flow, to the CH of intermediate 22 (0.004mol) and 1H-isoindole-1,3 (2H)-diketone (0.006mol) 2Cl 2Drip triphenyl phosphine (0.006mol) and DIAD (0.006mol) in the solution (80ml) successively.Stirring at room mixture 15 hours.Add 1H-isoindole-1,3 (2H)-diketone (0.006mol), triphenyl phosphine (1.5eq) and DIAD (1.5eq) successively in 5 ℃.Stirring at room mixture 15 hours in the impouring ice, is used CH 2Cl 2Extract.Separate organic phase, dry (MgSO 4), filter evaporating solvent.With this flow point of purification by silica gel column chromatography (11.4g) (eluent: hexanaphthene/EtOAc 70/30; 15-40 μ m).Collect pure flow point, evaporating solvent.This flow point (3.7g) is added in the toluene/isopropanol (96/4).Filtering-depositing, drying.This flow point of crystallization from (1.2g, 57%) DIPE/ ether.Filtering-depositing, drying obtains 0.93g (fusing point: 132 ℃; The E configuration) intermediate 23.
C) preparation of intermediate 24
In 65 ℃ intermediate 23 (0.0018mol), a hydrogen borate hydrazine (0.0056mol) mixture in ethanol (100ml) was stirred 4 hours.Ethanol evaporation.Residue is added CH 2Cl 2Use H 2O washs organic phase, dry (MgSO 4), filter evaporating solvent.With this flow point of purification by silica gel column chromatography (0.95g) (eluent: CH 2Cl 2/ CH 3OH/NH 4OH 96/4/0.1; 15-40 μ m).Collect pure flow point, evaporating solvent obtains 0.54g (72%) intermediate 24 (E configuration).
D) preparation of intermediate 25
Under 5 ℃, to intermediate 24 (0.0004mol) and Et 3The CH of N (0.0013mol) 2Cl 2(10ml) drip methylsulfonyl chloride (0.0006mol) in the solution.Stirred the mixture under the room temperature 15 hours.Use H 2O washs organic phase, dry (MgSO 4), filter evaporating solvent.With this flow point of purification by silica gel column chromatography (0.25g) (eluent: CH 2Cl 2/ CH 3OH 99/1; 15-40 μ m).Collect pure flow point, evaporating solvent obtains 0.2g intermediate 25 (E configuration).
E) preparation of intermediate 26
Figure A200780002738D00431
At THF (18ml) solution and the H of room temperature with intermediate 25 (0.0003mol) and lithium hydroxide (0.0018mol) 2The mixture of O (9ml) stirred 24 hours and used 3N HCl acidifying.Evaporation THF.Filtering-depositing is used H successively 2The washing of O and ether, drying obtains the hydrochloride (.HCl) (E configuration) of 0.11g intermediate 26.
F) preparation of intermediate 27
Figure A200780002738D00432
At room temperature, HOBT (0.0003mol) and EDC (0.0003mol) are added intermediate 26 (0.0002mol), O-(tetrahydrochysene-2H-pyrans-2-yl) azanol (0.0003mol) and Et successively 3The CH of N (0.0009mol) 2Cl 2In/THF (15ml) solution.Stirring at room mixture 15 hours, impouring H 2Among the O, use CH 2Cl 2Extract.Separate organic phase, dry (MgSO 4), filter evaporating solvent.With this flow point of purification by silica gel column chromatography (0.15g) (eluent: CH 2Cl 2/ CH 3OH 98/2; 10 μ m).Collect pure flow point, evaporating solvent obtains 0.07g (56%) intermediate 27 (E configurations).
Embodiment A 7
A) preparation of intermediate 28
Figure A200780002738D00433
The mixture of intermediate 18 (0.0007mol) with acetate (5ml) stirred 7 hours evaporation then in 100 ℃.Residue is added H 2Among the O.Filtering-depositing is used H successively 2The washing of O and ether, drying obtains the acetate (.CH3COOH) (E configuration) of 0.25g (64%) intermediate 28.
B) preparation of intermediate 29
Figure A200780002738D00441
At room temperature HOBT (0.0006mol) and EDC (0.0006mol) are added intermediate 28 (0.0004mol), O-(tetrahydrochysene-2H-pyrans-2-yl) azanol (0.0006mol) and Et successively 3The CH of N (0.0018mol) 2Cl 2In/THF (40ml) solution.Stirring at room mixture 24 hours, impouring H then 2Among the O, use CH 2Cl 2Extract.Separate organic phase, dry (MgSO 4), filter evaporating solvent.With this flow point of purification by silica gel column chromatography (0.4g) (eluent: CH 2Cl 2/ CH 3OH 98/2; 15-40 μ m).Collect pure flow point, evaporating solvent.This flow point of crystallization (0.24g) from the DIPE/ ether.Filtering-depositing, drying obtains 0.23g (92%) intermediate 29 (E configuration).
B. the preparation of compound
Embodiment B 1
The preparation of compound 1
Figure A200780002738D00442
The CH that under 5 ℃, trifluoroacetic acid (1.4ml) is added intermediate 6 (0.0005mol) 3In OH (28ml) solution.Stirring at room mixture 48 hours, evaporate to dryness.Crystalline residue from acetonitrile/ether.Filter out precipitation, drying obtains 0.27g (92%) compound 1 (fusing point: 166 ℃; The E configuration) trifluoroacetate (.0.83CF 3COOH.0.62H 2O).
Embodiment B 2
The preparation of compound 2
With intermediate 10 (0.0007mol) at trifluoroacetic acid (1.6ml) and CH 3Mixture among the OH (32ml) at room temperature stirred 72 hours, then evaporate to dryness.Crystalline residue in ether.Filtering-depositing, drying obtains 0.375g (87%) compound 2 (fusing points: 124 ℃; The E configuration) trifluoroacetate (.2.11CF 3COOH).
Embodiment B 3
The preparation of compound 3
Figure A200780002738D00452
In 5 ℃ of CH to intermediate 14 (0.0003mol) 3Drip trifluoroacetic acid (0.85ml) in OH (17ml) solution.Stirring at room mixture 48 hours, evaporate to dryness then.Crystalline residue in ether/acetonitrile.Filtering-depositing, drying obtains 0.15g (82%) compound 3 (fusing points: 148 ℃; The E configuration) trifluoroacetate (.0.8CF 3COOH.0.84H 2O).
Embodiment B 4
The preparation of compound 4
Figure A200780002738D00453
In 5 ℃ of CH to intermediate 17 (0.0003mol) 3Drip trifluoroacetic acid (0.85ml) in the OH solution (17ml).Stirring at room mixture 48 hours, evaporate to dryness then.Crystalline residue in ether.Filtering-depositing, drying obtains 0.145g (79%) compound 4 (fusing points: 115 ℃; The E configuration) trifluoroacetate (0.87CF 3COOH.0.79H 2O).
Embodiment B 5
The preparation of compound 5
In 5 ℃ of CH to intermediate 21 (0.0001mol) 2Cl 2(3ml) drip trifluoroacetic acid (0.5ml) in the solution.Stirred the mixture 2 hours in 5 ℃.Add ice and water.Add K 2CO 3Use CH 2Cl 2Extract mixture twice.Separate organic phase, dry (MgSO 4), filter evaporating solvent.With purification by silica gel column chromatography gained residue (0.15g) (eluent: CH 2Cl 2/ CH 3OH98/2; 15-40 μ m).Collect pure flow point, evaporating solvent.Crystallization is with this flow point (0.082g) in the DIPE/ Virahol.Filtering-depositing, drying obtains 0.072g (59%) (fusing point: 120 ℃; The E configuration) compound 5.
Embodiment B 6
The preparation of compound 6
In 5 ℃ of CH to intermediate 27 (0.0001mol) 3Drip trifluoroacetic acid (0.33ml) in OH (7ml) solution.Stirring at room mixture 24 hours, evaporate to dryness then.Crystalline residue in ether.Filtering-depositing, drying obtains 0.062g (88%) (fusing point: 131 ℃; The E configuration) trifluoroacetate (.98CF of compound 6 3COOH).
Embodiment B 7
The preparation of compound 7
Figure A200780002738D00463
In 5 ℃ of CH to intermediate 29 (0.0003mol) 3Drip trifluoroacetic acid (1ml) in OH (21ml) solution.Stirring at room mixture 48 hours, evaporate to dryness then.Crystalline residue in ether/acetonitrile.Filtering-depositing, drying obtains 0.19g (86%) (fusing point: 140 ℃; The E configuration) trifluoroacetate (0.9CF of compound 7 3COOH.84H 2O).
Table F-1 has listed the compound according to the preparation of one of the foregoing description.
Table F-1
Figure A200780002738D00471
The C pharmacological examples:
The inhibition to the work of HDAC enzyme of external test (seeing Embodiment C .1) detection formula (I) compound that histon deacetylase (HDAC) suppresses.
In the A2780 tumour cell, detect the cytoactive (Mosmann Tim, Journal of Immunological Methods 65:55-63,1983) (seeing Embodiment C .2) of measurement formula (I) compound with cytotoxicity or survival rate.
A kind of solubleness of compound can be weighed it and stay in ability in the solution.In first method, the mensuration compound rests on the ability (seeing Embodiment C .3a) in the aqueous solution when diluted.The DMSO storing solution is diluted in different consecutive steps with single water-containing buffering liquid.In this method (C.3.a), with BD Gentest solubleness scanner scanning mixture to detect sedimentary generation.Measure the solubleness (seeing Embodiment C .3.b) of compound under the different pH in the second approach with the chemoluminescence Nitrogen detector.
The perviousness of medicine has showed it and has moved to or passed the ability of another kind of medium from a kind of medium.Especially it passes the ability that the enteron aisle film enters blood and/or enters target position from blood.Can measure perviousness (seeing Embodiment C .4) by the immobilized artificial rust phospholipid bilayer of filter.In the immobilized artificial rust phospholipid bilayer of filter detects, between 96-hole microwell plate and 96-hole filter plate, form in " interlayer ", each composite holes is divided into two Room like this, the bottom is a donor solution, the top is a receptor solution, isolate (0.45 μ m hole) by 125 μ m micro-filtration dishes, with dodecane solution 2% (wt/v) the bag quilt of dioleoyl phospholipid acyl-choline, condition is for forming the plurality of layers of double molecular layer in the filter channel interior when system contacts with water-containing buffering liquid.It is that unit measures with cm/s that compound sees through this artificial membrane permeability.Its purpose is to seek medicine and sees through parallel artificial membrane permeability when two different pH (4.0 and 7.4).Optimal wavelength place between 250-500nm measures compound with the UV-spectrometry.
But drug metabolism means fat-soluble external or endogenous compound is become polar, water miscible and excretory meta-bolites by enzymatic conversion.The major organs of drug metabolism is a liver.Meta-bolites is usually lower or inactive than parent drug activity.But some meta-bolitess may actively increase or have toxic action.Therefore drug metabolism can comprise " detoxification " and " poisoning " process.The main enzyme system that the decision body is handled medicine and chemical substance ability is represented as the P450 monooxygenase, and it is a DADPH dependent form enzyme.Can use ubcellular people tissue (seeing Embodiment C .5.) to measure the metabolic stability of compound.The compound metabolic stability here be expressed as these compounds and microsome incubation after 15 minutes by the per-cent of metabolic drug.
Research has shown that multiple antitumor drug can activate p21 albumen, comprises dna damage agent and NSC 630176.The dna damage agent can activate the p21 gene by tumor-inhibiting factor p53, and NSC 630176 can be by transcribing property of transcription factor Spl activation p21 gene.Therefore the dna damage agent activate the p21 promotor by the p53 response element and NSC 630176 by sp1 site (be positioned at-60bp relevant extremely+40bp district) activation p21 promotor with the TATA box.When the p21 promotor in the cell by p211300bp promoter fragment (not comprising the p53 response element) when forming, it is non-responsiveness to the dna damage agent correspondingly.
Can come assessing compound to induce the ability of p21 by the ability that detection compound induces p21 to cause the HDAC cell levels to suppress.The expression vector stable transfected cells of the available p21 of containing 1300bp promoter fragment (not containing the p53 response element), and compare with control level wherein that reporter gene expression increases, determine that compound has the p21 inducibility.This report gene is that the expression of fluorescence protein and reporter gene is detected (seeing Embodiment C .6.a) with the form of the amount of radiofluorescence.
Second method is a method in the body, wherein uses the pharmaceutical active of mouse SCREENED COMPOUND.The tumour cell of the aforementioned stable transfection of significant quantity can be given mouse to produce tumour.After tumour cell forms tumour through the enough time, can give the compound that animal has lateral reactivity, estimate of the effect of described compound by the expression of measuring reporter gene to animal.The expression that can cause comparing reporter gene with control level with the pharmaceutically active compound incubation increases (seeing Embodiment C .6.b).
The specificity hdac inhibitor should not suppress other enzyme, for example Feng Fu CYP P450 protein.CYP P450 (E.coli expression) protein 3A4,2D6 en 2C9 change into fluorescence molecule with its specific substrate.CYP3A4 albumen transforms 7-benzyloxy-trifluoromethyl tonka bean camphor (BFC) and generates 7-hydroxyl-trifluoromethyl tonka bean camphor.CYP2D6 protein can transform 3-[2-(N, N-diethyl-N-methylamino-) ethyl]-7-methoxyl group-4-methylcoumarin (AMMC) generation 3-[2-(N, N-diethylamino) ethyl]-7-hydroxyl-4-hydrochloride methyl tonka bean camphor.CYP2C9 protein can transform 7-methoxyl group-4-trifluoromethyl tonka bean camphor (MFC) and generate 7-hydroxyl-trifluoromethyl tonka bean camphor.The compound that suppresses this enzyme reaction can reduce fluorescent signal (seeing Embodiment C .7).
Embodiment C .1: with the inhibition that detects histon deacetylase (HDAC) in the fluorescent mark substrate body
Use Biomol HDAC fluorescence activity detection/medicament research and development test kit (test kit coding: AK-500-0001).HDAC fluorescence activity detection kit is based on Fluor de Lys (fluorescence produces the histon deacetylase (HDAC) lysyl) substrate and developer composition.Fluor de Lys substrate comprises the acetylize lysine side-chain.The deacetylation of substrate is substrate sensitization, thereby can produce fluorophor with the processing of Fluor de Lys photographic developer in second step.
With 60 μ g/ml HeLa nuclear extracts and 75 μ M substrate incubations.Fluor de Lys substrate joined contain 25mM Tris, 137mM NaCl, 2.7mM KCl and 1mMMgCl 2.6H 2In the damping fluid of the pH7.4 of O.The photographic developer that adds 1 volume after 30 minutes.With 355nm optical excitation fluorophor, on fluorescence microplate reader, detect emission light in 450n.
For each test, the parallel contrast (containing HeLa nuclear extract and damping fluid), blank incubation (contain damping fluid and still do not contain the HeLa nuclear extract) and sample (containing the compound and the HeLa nuclear extract that are dissolved in DMSO and further dilute) with damping fluid.Under first kind of situation, 10 -5Detection compound under the M concentration.When compound 10 -5When M shows vigor, draw concentration-effect curve, wherein 10 -5M and 10 -9The M detection compound.All samples all detects 4 times.In detecting each time, from contrast and sample value, deduct blank.Control sample is represented substrate 100% deacetylation.For each sample, fluorescence is expressed as the per-cent of contrast mean value.When being carried out Probability Analysis, ranked data calculates suitable IC 50The time (the meta-bolites amount being reduced to 50% needed drug level of contrast).The effect of testing compound herein is expressed as pIC 50(IC 50The negative log value of-value) (seeing Table F-2).
Embodiment C .2: measure antiproliferative activity to the A2780 cell
All testing compounds are dissolved in DMSO and further dilute with substratum.DMSO final concentration during cell proliferation detects is no more than 0.1% (v/v).Contrast contains A2780 cell and DMSO, does not contain compound, and blank contains DMSO, does not contain cell.MTT is dissolved among the PBS, and concentration is 5mg/ml.Preparation contains 0.1M glycine and 0.1M NaCl, and is adjusted to the glycine buffer (all reagent are all available from Merck) of pH 10.5 with NaOH (1N).
People A2780 ovarian cancer cell (Pennsylvania, America Fox Chase CancerCentre T.C.Hamilton is so kind as to give) is cultivated in being supplemented with RPMI 1640 substratum of 2mM L-glutaminate, 50 μ g/ml gentamicins and 10% calf serum.According to routine cell is remained the monolayer culture thing, condition is 37 ℃, the CO of humidity 5% 2In the environment.Use trypsinase/EDTA cell to be gone down to posterity once weekly with the splitting ratio of 1:40.All substratum and additive are available from Life Technologies.Use gene-probe mycoplasma tissue culture test kit (supplier: BioM é rieux) determine that there is not mycoplasma contamination in cell.
With cell inoculation to NUNC TMLife Technologies) and allow itself and plastics to stick to spend the night (supplier: in 96 orifice plates.Dull and stereotyped concentration of cultivating use is 1500 cells in every hole, and the substratum cumulative volume is 200 μ l.After cell adhesion is to the plate, change substratum, adding medicine and/or solvent to final volume is 200 μ l.After the incubation four days, replace original substratum, use the MTT detection method to measure cell concn and viablity with 200 μ l fresh cultures.In each hole, add 25 μ l MTT solution and cell was continued incubation 2 hours in 37 ℃.Careful sucking-off substratum adds 25 μ l glycine buffers and 100 μ l DMSO successively and makes the blue MTT-first moon for the product solubilising.On the microplate vibrator,, use Emax96 hole-spectrophotometer (supplier: Sopachem) measure absorbancy in the 540nm place with little assay plate vibration 10 minutes.
In each test, the result of each test conditions is the mean value of 3 repeating holes.In order to reach screening purpose originally, use single fixed concentration 10 -6The M detection compound.For active compound, revision test is to set up complete concentration-effect curve.For each test, parallel contrast (not containing medicine) and blank incubation (not containing cell or medicine).From all contrasts and sample value, deduct blank value.For each sample, the mean value (absorbance units) of cell growth is expressed as the per-cent of the mean value of control cells growth.In the time of suitably ranked data is carried out probit analysis and calculate IC 50-value (the cell growth is reduced to contrast 50% needed medication amount) (Finney, D.J., Probit Analyses, 2 NdEd.Chapter10, GradedResponses, Cambridge University Press, Cambridge 1962).The effect of testing compound herein is expressed as pIC 50(IC 50The negative log value of-value) (seeing Table F-2).
Embodiment C .3: solubleness/stability
C.3a. the kinetics solubleness in the water-containing medium
In 96 hole storing solution plates (every hole 200 μ l), the DMSO-storing solution is diluted to 9.8 μ M (1/2 dilution) from 5000 μ M.Every dilution is once with sample mix.The sample aliquot of these DMSO solution (2 μ l) is transferred in two other 96 hole damping fluid plate, and (2 μ l) water-containing buffering liquid is contained in every hole.Each damping fluid plate or contain the water-containing buffering liquid of pH 7.4 or contain the aqueous buffer solution of pH4.0.After the last dilution damping fluid plate is mixed, with sample stabilization 1/2 hour under room temperature.Each compound double dilution is to get rid of random error.Whether there is precipitation to generate with BD gene test solubleness scanner scanning mixture to detect then.Based on existing or do not exist precipitation in the mixture by difference computational dynamics solubleness.Grade is divided three classes.Compound score value with high-dissolvability is 3, and its solubleness is more than or equal to 50 μ M.Compound score value with moderate solubility is 2, its solubleness greater than 10 μ M less than 50 μ M.Compound score value with low solubility is 1, and its solubleness is less than or equal to 10 μ M.
Detected four kinds of compounds: two kinds of compounds are that the score value of 1, two kind of compound during at pH4.0 is 2 at the score value under two pH.
C.3b.pH2.3 solubleness/the stability the time
Also can use chemoluminescence nitrogen detector to measure the solubleness (see Table F-2) of compound when pH2.3.
Embodiment C .4: parallel artificial rust perviousness is analyzed
Storing solution (10 μ l sample aliquot of 5mM storing solution among 100% DMSO) is diluted in the deep-well plates or premix plywood of the water-containing buffering liquid system that contains 2ml pH4 or pH 7.4 (PSR4 System Solution Concentrate (pION)).
Before sample is added the reference plate, 150 μ l damping fluids are added the white UV-of the line space of going forward side by side in the hand-hole measure.The damping fluid that inclines afterwards, with this plate as the reference plate.All are measured all and carry out in anti--UV plate (supplier: Costar or Greiner).
After the reference plate is carried out blank determination, will add donor plate 1 in the 150 μ l dilute samples adding reference plate and with 200 μ l dilute samples.Form solution with 4 μ l artificial rusts and (contain 0.1%2,1 of 6-two-tert-butyl-4-cresols, MAIP N45) and be positioned on the donor plate 1 to form " sandwich of layers " the dodecane solution of 2-two oleoyls-sn-glycerol-3-phosphocholine) bag is by acceptor screen plate (supplier: Millipore, model:.Damping fluid (200 μ l) is added receptor hole top.Sandwich of layers is covered and locate to store 18 hours in the room temperature dark.
Carry out UV-mensuration then by adding 150 μ l damping fluids in the hole and carry out the blank determination of acceptor plate 2.The damping fluid that inclines after acceptor plate 2 is carried out blank determination is passed to acceptor plate 2 with 150 μ l receptor buffer from acceptor filter plate 1.Remove acceptor filter plate 1 from sandwich of layers then.After donor plate 2 is carried out blank determination (as mentioned above), 150 μ l donor buffer are passed to donor plate 2 from donor plate 1.The UV spectrum of scanning (with SpectraMAX 190) donor plate 2, acceptor plate 2 and reference plate hole.All spectrum are handled, used PSR4pCommand computed in software perviousness.All compounds are all measured three times.Use Carbamzepine, grisovin, acycloguanosine, atenolol USP 23, Furosemide and chlorothiazide as standard in each test.Compound is divided into Three Estate: low-permeability (mean effort＜0.5 x 10 -6Cm/s, score value are 1), medium perviousness (1 x 10 -6Cm/s〉mean effort 〉=0.5 x 10 -6Cm/s; Score value is 2) or hypertonicity (〉=1 x 10 -6Cm/s; Score value is 3).
Embodiment C .5: metabolic stability
According to (Xenobiotica 5:453-462,1975) such as Gorrod by the ubcellular tissue preparation is carried out in centrifugation behind the tissue homogenate.With hepatic tissue in ice-cold 0.1M Tris-HCl (pH7.4) damping fluid rinse to draw unnecessary blood.The moisture of tissue is blotted, weighs and shreds with operating scissors.With the Potter-S that the Teflon pestle is installed (Braun, Italy) or SorvallOmni-Mix homogenizer with fragment of tissue homogenate 7 x 10sec in the ice-cold 0.1M phosphoric acid buffer (pH7.4) of 3 volumes.In the homogenate process in both cases, instrument is positioned in the ice/on.
With Sorvall whizzer or Beckman ultracentrifuge with centrifugal 20 minutes of tissue homogenate 9000xg (4 ℃).The supernatant that obtains is stored in-80 ℃ and be labeled as " S9 ".
Available Beckman ultracentrifuge is with centrifugal 60 minutes of the further 100.000xg of S9 flow point (4 ℃).With the careful sucking-off of gained supernatant, five equilibrium and be labeled as " cytosol ".Precipitation is resuspended in (pH 7.4) in the 0.1M phosphoric acid buffer, and the final volume of every 0.5g original structure weight is 1ml, is labeled as " microsome ".
With all ubcellular flow point five equilibriums.Be frozen in the liquid nitrogen-80 ℃ of preservations before the use immediately.
For testing sample, the incubation mixture comprises PBS (0.1M), compound (5 μ M), microsome (1mg/ml) and NADPH-generation structure (0.8mM G-6-P, the glucose-6-phosphate dehydrogenase (G6PD) of 0.8mM magnesium chloride and 0.8 unit).Contain identical material in the control sample, replace but microsome is heated the microsome of inactivation (95 degrees centigrade 10 minutes).The rate of recovery of compound is generally 100% in the control sample.
With mixture in 37 degrees centigrade of preincubation 5 minutes.At time point 0 (t=0) adding 0.8mM NADP initial action and with sample incubation 15 minutes (t=15).The DMSO termination reaction that adds 2 volumes.With centrifugal 10 minutes of sample 900xg, will preserve under the gained supernatant room temperature before analyzing, must not be above 24 hours.All incubations are all parallel does two parts.Analyze supernatant with LC-MS.(Waters US) goes up elution samples for 50 x 4.6mm, 5 μ m at Xterra MS C18.Use Alliance 2790 (supplier: Waters, US) HPLC system.With the buffer A (H of 25mM ammonium acetate (pH5.2) 2O/ acetonitrile solution (95/5)) wash-out, solvent B is an acetonitrile, and solvent C is a methyl alcohol, and flow velocity is 2.4ml/min.Applied gradient with linear mode in 5 minutes with rising to 50%B and 50%C from 0% in the organic phase concentration, in 1 minute, rise to 100%B, organic phase concentration is continued to keep stablizing 1.5 minutes.Total sample size of sample is 25 μ l.
(UK) triple quadrupole mass spectrometer is as detector for supplier: Micromass, Manchester with Quattro that the ESI source is installed.Electrospray ionization source and desolvation temperature be set at respectively 120 and 350 ℃ and with nitrogen as sprays and dry gas.Under anodal scan pattern (single ionic reaction), obtain data.Awl voltage is made as 10V, and the residence time is 1 second.
Metabolic stability is expressed as active particles body (E (act)) and has the metabolism per-cent of incubation compound after 15 minutes down
Figure A200780002738D00542
Metabolism per-cent is defined as the height metabolic stability less than 20% compound.The compound of metabolism between 20-70% is defined as medium stable.Metabolism per-cent is higher than 70% compound and is defined as low metabolic stability.Carrying out including three kinds of reference compounds when any metabolic stability scans.Verapamil is as low metabolic stability compound (% metabolism=73%).Cisapride is as medium metabolic stability compound (% metabolism=45%).Propyl alcohol is as hypermetabolism stability compound (25% metabolism).These reference compounds are used to verify that metabolic stability detects.
Embodiment C .6:p21 inducibility
Embodiment C .6a: cell method
At 5% CO 2In the humidification incubator A2870 cell (ATCC) is incubated at for 37 ℃ in RPMI 1640 substratum that contain 10% FCS, 2mM L-glutaminate and gentamicin.(Gaithersburg MD) provides all cell cultures solution by Gibco-BRL.Other material is provided by Nunc.
From propagation A2780 cell, extract genomic dna and be used as the template that nest-type PRC separates the p21 promotor.20 circulations are carried out in amplification for the first time, and annealing temperature is 55 ℃, use with genomic dna as the oligonucleotide of template GAGGGCGCGGTGCTTGG and TGCCGCCGCTCTCTCACC.Gained contains relevant with the TATA box-4551 to+88 segmental 4.5kb fragment oligonucleotide TCG GGTACCGAGGGCGCGGTGCTTGG and ATA CTCGAGTGCCGCCGCTCTCTCACC increases once more 20 and circulates, and annealing temperature is 88 ℃, obtains the 4.5kb fragment, then with oligonucleotide to TCG GGTACCGGTAGATGGGAGCGGATAGACACATC and ATA CTCGAGTGCCGCCGCTCTCTCACC 20 circulations of increasing, annealing temperature is 88 ℃, obtains containing relevant-1300 to+88 segmental 1.3kb fragments with the TATA box.Restriction site in the oligonucleotide (underscore sequence) XhoI and KpnI are used for subclone.
Luciferase reporting of pGL3-basic model removed and replace (coming from the pZsGreen1-N1 plasmid) with ZsGreen report of KpnI and XbaI restriction site.In XhoI and KpnI site insertion pGL3-basic-ZsGreen, make up pGL3-basic-ZsGreen-1300 by 1.3kb fragment with above-mentioned people p21 promoter region.All Restriction Enzymes are provided by Boehringer Manheim (Germany).With the A2780 cell with 2x10 5The concentration of cell adds in 6 orifice plates, incubation 24 hours, and (Invitrogen, Brussels Belgium) transform with 2 μ g pGL3-basic-ZsGreen-1300 and 0.2 μ g pSV2neo carrier according to operation instruction with Lipofectamine 2000.With G418 (Gibco-BRL, Gaithersburg, MD) incubation screening in 10 days transformant, single cell suspension growth.Obtain single clone after three weeks.
Be seeded to 96 orifice plates with the amplification of screening and cloning of A2780 and with 10000 cells/well.Inoculate back 24 hours, continue to handle 24 hours with compound (the sp1 site of the contiguous p21 promoter region of influence).Then cell is mixed with 4% PFA and also redyed in 30 seconds with the Hoechst dyestuff.The activation of p21 promotor causes generating ZsGreen and therefore produces fluorescence, with AscentFluoroskan (Thermo Labsystems, Brussels, Belgium) monitoring.
For each test, contrast (not containing medicine) and parallel the carrying out of blank incubation (not containing cell or medicine).From all contrasts and sample value, deduct blank value.For each sample, it is the per-cent of p21 value in the contrast that p21 induces value representation.Inducing per-cent to be defined as significantly greater than 130% induces.
Embodiment C .6.b: method in the body
With screening and cloning subcutaneous injection nude mice flank, obtain the tumour that compasses can be surveyed after 12 days.From 12 days with solvent and 20-40mpk compound oral or intravenously administrable animal (every 4-10 animal) every day, continue 6 days.With the automatic whole body imaging system of inside research and development (be equipped with the GFP filter and with CCD camera (model
Figure A200780002738D00561
CV-M90 is by based on National
Figure A200780002738D00562
The software control of IMAQ vision) link coupled fluorescent and stereo microscope, model
Figure A200780002738D00563
SZX12) detect tumour fluorescence.Compound R 306465 (WO03/76422) uses as reference.Compound is divided into nonactive (not having detectable fluorescence), more weak, identical or stronger than R306465.
Embodiment C .7:P450 suppresses ability
All compounds are dissolved among the DMSO (5mM) also further with dilution in acetonitrile to 510 -4M.Damping fluid further dilutes (0.1M NaK phosphoric acid buffer pH7.4) and final concentration is not higher than 2% with detecting then.
The CYP3A4 Protein Detection comprises every hole 15pmol P450/mg albumen (0.01M NaK phosphoric acid buffer+1.15% KCl), NADPH generation structure (3.3mM G-6-P, 0.4U/ml glucose-6-phosphate dehydrogenase (G6PD), 1.3mM NADP and 3.3mMMgCl 2.6H 2The detection buffer soln of O) and compound, total detection volume is 100 μ l.The detection buffer soln initial action that adds 150 μ M fluorescent probe substrate B FC in 37 ℃ of preincubation after 5 minutes.At room temperature incubation adds the acetonitrile termination reaction of 2 volumes after 30 minutes.Under 405nm exciting light and 535nm emission light, measure fluorescence.KETOKONAZOL (IC in this test 50-value=3 X 10 -8M) add as reference compound.The CYP2D6 protein detection comprises every hole 6pmol P450/mg albumen (0.01M NaK phosphoric acid buffer+1.15% KCl), NADPH generation structure (0.41mM G-6-P, 0.4U/ml glucose-6-phosphate dehydrogenase (G6PD), 0.0082mM NADP and 0.41mM MgCl 2.6H 2The detection buffer soln of O) and compound, total detection volume is 100 μ l.The initial enzyme reaction of detection buffer soln that adds 3 μ M fluorescent probe substrate A MMC in 37 ℃ of preincubation after 5 minutes.At room temperature incubation adds the acetonitrile termination reaction of 2 volumes after 45 minutes.Under 405nm exciting light and 460nm emission light, measure fluorescence.Quinidine (IC in this test 50-value＜5 X 10 -8M) add as reference compound.
The CYP2C9 protein detection comprises every hole 15pmol P450/mg albumen (0.01M NaK phosphoric acid buffer+1.15% KCl), NADPH generation structure (3.3mM G-6-P, 0.4U/ml glucose-6-phosphate dehydrogenase (G6PD), 1.3mM NADP and 3.3mMMgCl 2.6H 2The detection buffer soln of O) and compound, total detection volume is 100 μ l.The initial enzyme reaction of detection buffer soln that adds 200 μ M fluorescent probe substrate MFC in 37 ℃ of preincubation after 5 minutes.At room temperature incubation adds the acetonitrile termination reaction of 2 volumes after 30 minutes.Under 405nm exciting light and 535nm emission light, measure fluorescence.This test sulfaphenazole (IC 50-value=6.8 X 10 -7M) add as reference compound.
For initial scanning, at single fixed concentration 1 X 10 -5Detection compound under the M repeats this test to set up complete concentration-effect curve.For each test, contrast (not containing medicine) and parallel the carrying out of blank incubation (not containing enzyme or medicine).All compounds all detect four times.From all contrasts and sample value, deduct blank value.For each duplicate samples, sample P 450 active mean values (relative fluorescence unit) are expressed as the per-cent of the active mean value of contrast P450.Percentage suppresses to be expressed as 100% and deducts sample P 450 active mean values.Calculate IC in the time of suitably 50-value (the p450 activity is reduced to contrast 50% required drug level).
Table F-2: according to result's (blank expression does not have the numerical value of related compound) of Embodiment C .1, the compound that C.2 and C.3.b detects
Table F-2
Compound number. C.1 enzyme lives pIC50 Cytoactive pIC50 C.2 Solubleness is pH=2.3 (mg/ml) C.3.b.
6 7.0 5.3
4 7.3 5.8
3 7.5 5.1
1 8.2 6.4 2.4
2 8.2 7.1 3.1
D. composition embodiment: thin membrane coated tablet
The label preparation
The mixture of 100g formula (I) compound, 570g lactose and 200g starch mixed and with water (about 200ml) solution-wet of 5g sodium lauryl sulphate and 10g polyvinylpyrrolidone.With the wet powder mixture sieve, dry and sieve again.Add 100g Microcrystalline Cellulose and 15g hydrogenated vegetable oil then.Integral body is mixed and suppresses in flakes, obtain 10000, each sheet comprises 10mg formula (I) compound.
Dressing
Methylene dichloride (150ml) solution that in Denatured alcohol (75ml) solution of 10g methylcellulose gum, adds the 5g ethyl cellulose.Add 75ml methylene dichloride and 2.5ml1 then, 2, the 3-glycerol.The 10g polyoxyethylene glycol is dissolved and be dissolved in the methylene dichloride of 75ml.Back one solution is added in the last solution, add then that 2.5g Magnesium Stearate, 5g polyvinylpyrrolidone and 30ml concentrate the pigment suspension and whole mixing.In coating device, use the gained mixture with the label dressing.

Claims (12)

1. formula (I) compound,
Figure A200780002738C00021
Its N-oxide form, pharmacy acceptable addition salt and form of three-dimensional chemical isomer,
Wherein
X is N or CH;
R 1Group for hydroxyl or formula (a-1)
Figure A200780002738C00022
Wherein
R 4Be hydroxyl or amino;
R 5Replaced by one or two following group for hydrogen, thienyl, furyl or phenyl and each thienyl, furyl or phenyl are optional: halogen, amino, nitro, cyano group, hydroxyl, phenyl, C 1-6Alkyl, (two C 1-6Alkyl) amino, C 1-6Alkoxyl group, phenyl C 1-6Alkoxyl group, hydroxyl C 1-6Alkyl, C 1-6Alkoxy carbonyl, hydroxycarbonyl group, C 1-6Alkyl-carbonyl, many halos C 1-6Alkoxyl group, many halos C 1-6Alkyl, C 1-6Alkyl sulphonyl, hydroxycarbonyl group C 1-6Alkyl, C 1-6Alkyl-carbonyl-amino, amino-sulfonyl, amino-sulfonyl C 1-6Alkyl, isoxazolyl, aminocarboxyl, phenyl C 2-6Thiazolinyl, phenyl C 3-6Alkynyl or pyridyl C 3-6Alkynyl;
R 6, R 7And R 8Independent separately is hydrogen, amino, nitro, furyl, halogen, C 1-6Alkyl, C 1-6Alkoxyl group, trifluoromethyl, thienyl, phenyl, C 1-6Alkyl-carbonyl-amino, aminocarboxyl C 1-6Alkyl or-C ≡ C-CH 2-R 9
R wherein 9Be hydrogen, C 1-6Alkyl, hydroxyl, amino or C 1-6Alkoxyl group;
R 2Be amino, C 1-6Alkylamino, aryl C 1-6Alkylamino, C 1-6Alkyl-carbonyl-amino, C 1-6Alkyl sulfonyl-amino, C 3-7Cycloalkyl amino, C 3-7Cycloalkyl C 1-6Alkylamino, glutarimide base, dimaleoyl imino, phthalimide group, succinimido, hydroxyl, C 1-6Alkoxyl group, phenoxy group, the phenyl moiety of wherein said phenoxy group is optional to be replaced by one or two substituting group, and substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group, cyano group, C 1-6Alkoxy carbonyl and trifluoromethyl;
R 3Be phenyl, naphthyl or heterocyclic radical; Wherein
Each described phenyl or naphthyl can be chosen wantonly by one or two substituting group and replace, and substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group, many halos C 1-6Alkyl, aryl, hydroxyl, cyano group, amino, C 1-6Alkyl-carbonyl-amino, C 1-6Alkyl sulfonyl-amino, hydroxycarbonyl group, C 1-6Alkoxy carbonyl, hydroxyl C 1-6Alkyl, C 1-6Alkoxy methyl, amino methyl, C 1-6Alkylamino methyl, C 1-6Alkyl-carbonyl-amino methyl, C 1-6Alkyl sulfonyl-amino methyl, amino-sulfonyl, C 1-6Alkyl amino sulfonyl and heterocyclic radical;
Aryl is a phenyl or naphthyl; Wherein each described phenyl or naphthyl is optional is replaced by one or two substituting group, and substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group, trifluoromethyl, cyano group and hydroxycarbonyl group; And
Heterocyclic radical is a furyl, thienyl, pyrryl, pyrrolinyl, pyrrolidyl, dioxa cyclopentenyl oxazolyl, thiazolyl, imidazolyl, imidazolinyl, imidazolidyl, pyrazolyl, pyrazolinyl, pyrazolidyl isoxazolyl, isothiazolyl oxadiazole base, triazolyl, thiadiazolyl group, pyranyl, pyridyl, piperidyl alkyl dioxin, morpholinyl, the dithiane base, thio-morpholinyl, pyridazinyl, pyrimidyl, pyrazinyl, piperazinyl, triazinyl, the trithian base, the indolizine base, indyl, indolinyl, benzofuryl, benzothienyl, indazolyl, benzimidazolyl-, benzothiazolyl, purine radicals, quinolizinyl, quinolyl, the cinnolines base, phthalazinyl, quinazolyl, quinoxalinyl or naphthyridinyl; Wherein
Each described heterocyclic radical is optional to be replaced by one or two substituting group, and substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group, cyano group, amino and single or two (C 1-4Alkyl) amino.
2. according to the compound of claim 1, wherein:
A) X is N;
B) R 1Be hydroxyl
C) R 2Be amino, C 1-6Alkyl-carbonyl-amino, C 1-6Alkyl sulfonyl-amino, phthalimide group, succinimido or phenoxy group, the phenyl moiety of wherein said phenoxy group is optional to be replaced by halogenic substituent; And
D) R 3For being chosen wantonly the phenyl that replaces by one or two substituting group, substituting group independently is selected from halogen, C separately 1-6Alkyl, C 1-6Alkoxyl group and many halos C 1-6Alkyl.
3. according to the compound of claim 1, wherein:
A) X is N;
B) R 1Be hydroxyl;
C) R 2Be amino; And
D) R 3For being selected from halogen and C 1-6The optional phenyl that replaces of the substituting group of alkoxyl group.
4. according to the compound of claim 1, wherein compound 2 is following indication:
Figure A200780002738C00041
5. pharmaceutical composition contains pharmaceutically acceptable carrier and as each claimed compounds among the claim 1-4 of the treatment significant quantity of active ingredient.
6. preparation is as the method for the claimed pharmaceutical composition of claim 5, wherein with each claimed compounds thorough mixing among pharmaceutical acceptable carrier and the claim 1-4.
7. each claimed compound among the claim 1-4 is as drug use.
8. the purposes of each claimed compound in the medicine of production for treating proliferative disease among the claim 1-4.
9. the combination of each claimed hdac inhibitor among cancer therapy drug and the claim 1-4.
10. prepare the method for the claimed compound of claim 1, it is characterized by:
A) formula (II) compound and suitable acid-respons are formed formula (I-a) compound
Figure A200780002738C00051
B) with formula (III) intermediate (wherein M represents hydrogen or basic metal) and formula (IV) compound reaction formation formula (I-b) compound
Figure A200780002738C00052
11. formula (B) compound, wherein Q is C 1-2Alkoxy carbonyl, MO 2C (wherein M is hydrogen or basic metal) or tetrahydro-pyran oxy aminocarboxyl, R 2aAs to R 2Define or for methylol X and R 3Such as to formula (I) definition, and N-oxide compound, pharmacy acceptable addition salt and three-dimensional chemical isomer
Figure A200780002738C00053
12. prepare the method for the desired compound of claim 11, it is characterized by:
A) with formula (III) intermediate and formula V intermediate reaction production (B) intermediate, wherein Q is the tetrahydro-pyran oxy aminocarboxyl, is represented by following formula (II)
Figure A200780002738C00061
B) with formula (VI) intermediate and suitable acid solution or suitable alkali metal base reaction production (B) intermediate, wherein Q is MO 2C is represented by following formula (III)
Figure A200780002738C00062
C) with formula (X) intermediate and azoformic acid diisopropyl ester (DIAD), three-just-butyl phosphine (PBu 3) and suitable nucleophilic reagent R 2H (XI) reaction production (B) intermediate, wherein Q is C 1-2Alkoxy carbonyl is represented by following formula (VI)
Figure A200780002738C00063
D) with the intermediate and 1 of formula (XII), 4-diox-2, the acid reaction that 5-two pure and mild formulas (XV) are suitable (R wherein 3As above definition) production (B) intermediate, wherein Q is C 1-2Alkoxy carbonyl, R 2aMethylol for following formula (X) expression
Figure A200780002738C00071
CN200780002738.XA 2006-01-19 2007-01-16 As pyridine and the pyrimidine derivatives of NSC 630176 Active CN101370790B (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP06100570 2006-01-19
EP06100570.8 2006-01-19
PCT/EP2007/050371 WO2007082874A1 (en) 2006-01-19 2007-01-16 Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase

Publications (2)

Publication Number Publication Date
CN101370790A true CN101370790A (en) 2009-02-18
CN101370790B CN101370790B (en) 2015-10-21

Family

ID=36499585

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200780002738.XA Active CN101370790B (en) 2006-01-19 2007-01-16 As pyridine and the pyrimidine derivatives of NSC 630176

Country Status (10)

Country Link
US (3) US8114876B2 (en)
EP (1) EP1979326B1 (en)
JP (1) JP5247470B2 (en)
CN (1) CN101370790B (en)
AU (1) AU2007206942B2 (en)
CA (1) CA2630717C (en)
DK (1) DK1979326T3 (en)
ES (1) ES2396986T3 (en)
HK (1) HK1128281A1 (en)
WO (1) WO2007082874A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108586359A (en) * 2018-06-26 2018-09-28 杭州科巢生物科技有限公司 A kind of synthetic method for disliking La Geli

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL205531B1 (en) * 2002-03-13 2010-04-30 Janssen Pharmaceutica Nv Carbonylamino-derivatives as novel inhibitors of histone deacetylase
PL208401B1 (en) 2002-03-13 2011-04-29 Janssen Pharmaceutica Nv Piperazinyl-, piperidinyl- and morpholinyl-derivatives as novel inhibitors of histone deacetylase
MXPA04007776A (en) 2002-03-13 2004-10-15 Janssen Pharmaceutica Nv Sulfonylamino-derivatives as novel inhibitors of histone deacetylase.
EP1485353B1 (en) 2002-03-13 2011-08-24 Janssen Pharmaceutica NV New inhibitors of histone deacetylase
RS51189B (en) * 2004-07-28 2010-10-31 Janssen Pharmaceutica N.V. Substituted propenyl piperazine derivatives as novel inhibitors of histone deacetylase
AP2336A (en) * 2004-07-28 2011-12-08 Janssen Pharmaceutica Nv Subsituted indolyl alkyl amino derivatives as novel inhibitors of histone deacetylase.
AU2006248938B2 (en) 2005-05-18 2011-09-29 Janssen Pharmaceutica N.V. Substituted aminopropenyl piperidine or morpholine derivatives as novel inhibitors of histone deacetylase
ATE509920T1 (en) * 2005-10-27 2011-06-15 Janssen Pharmaceutica Nv SQUARE ACID DERIVATIVES AS INHIBITORS OF HISTONE DEACETYLASE
DK1981874T3 (en) * 2006-01-19 2009-09-28 Janssen Pharmactuica N V Aminophenyl derivatives as novel inhibitors of histone deacetylase
EP1979327A1 (en) 2006-01-19 2008-10-15 Janssen Pharmaceutica, N.V. Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase
EP1981875B1 (en) 2006-01-19 2014-04-16 Janssen Pharmaceutica N.V. Substituted indolyl-alkyl-amino-derivatives as inhibitors of histone deacetylase
ES2402213T3 (en) * 2006-01-19 2013-04-29 Janssen Pharmaceutica N.V. Pyridine and pyrimidine derivatives as histone deacetylase inhibitors
CA2630717C (en) 2006-01-19 2015-02-24 Janssen Pharmaceutica N.V. Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase
AU2009289649B2 (en) 2008-09-03 2016-05-05 Biomarin Pharmaceutical Inc. Compositions including 6-aminohexanoic acid derivatives as HDAC inhibitors
BRPI1004899B8 (en) 2009-01-08 2021-05-25 Curis Inc phosphoinositide 3-kinase inhibitor compound, pharmaceutical composition and use of a compound
US8957066B2 (en) 2011-02-28 2015-02-17 Biomarin Pharmaceutical Inc. Histone deacetylase inhibitors
US10059723B2 (en) 2011-02-28 2018-08-28 Biomarin Pharmaceutical Inc. Histone deacetylase inhibitors
ES2712803T3 (en) 2011-02-28 2019-05-14 Biomarin Pharm Inc Histone deacetylase inhibitors
WO2012117421A1 (en) 2011-03-02 2012-09-07 Orchid Research Laboratories Ltd Histone deacetylase inhibitors
EP2683371B1 (en) 2011-03-09 2020-10-21 Cereno Scientific AB Compounds and methods for improving impaired endogenous fibrinolysis using histone deacetylase inhibitors
SI2694075T1 (en) 2011-04-01 2016-07-29 Curis, Inc. Phosphoinositide 3-kinase inhibitor with a zinc binding moiety
ES2680224T3 (en) 2013-03-15 2018-09-05 Biomarin Pharmaceutical Inc. HDAC inhibitors
US11234986B2 (en) 2018-09-11 2022-02-01 Curis, Inc. Combination therapy with a phosphoinositide 3-kinase inhibitor with a zinc binding moiety

Family Cites Families (97)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB901749A (en) 1957-12-06 1962-07-25 Ciba Ltd New 2-substituted pyrimidines
NL297170A (en) 1963-04-04 1900-01-01
US3459731A (en) 1966-12-16 1969-08-05 Corn Products Co Cyclodextrin polyethers and their production
US4049811A (en) 1968-07-23 1977-09-20 Boehringer Mannheim G.M.B.H. Compositions using cycloalkano-quinolone derivatives and their method of use
US3966743A (en) 1968-07-23 1976-06-29 Boehringer Mannheim G.M.B.H. Ortho fused cycloalkano-4-quinolone-3-carboxylic acid derivatives
GB1345872A (en) 1970-09-03 1974-02-06 Wyeth John & Brother Ltd Amino-and acylamino-pyridine and hydropyridine derivatives
DE2939292A1 (en) 1979-09-28 1981-04-09 Boehringer Mannheim Gmbh, 6800 Mannheim N-PHENOXYALKYLPIPERIDINE DERIVATIVES, METHOD FOR THE PRODUCTION THEREOF, AND MEDICINAL PRODUCTS CONTAINING THESE COMPOUNDS
PH17194A (en) 1980-03-06 1984-06-19 Otsuka Pharma Co Ltd Novel carbostyril derivatives,and pharmaceutical composition containing the same
CA1183847A (en) 1981-10-01 1985-03-12 Georges Van Daele N-(3-hydroxy-4-piperidinyl)benzamide derivatives
CA1307786C (en) 1984-12-14 1992-09-22 Keiichi Yokoyama Quinazoline derivatives and antihypertensive preparations containing same as effective components
HU206337B (en) 1988-12-29 1992-10-28 Mitsui Petrochemical Ind Process for producing pyrimidine derivatives and pharmaceutical compositions
JP2664238B2 (en) 1989-03-01 1997-10-15 日清製粉株式会社 Nicotinic acid or its ester derivatives
US5342846A (en) 1990-12-05 1994-08-30 Synphar Laboratories, Inc. 7-substituted-6-fluoro-1,4-dihydro-4-oxo-quinoline-3-carboxylic acid compounds and 7-(substituted triazolyl pyrrolidin-1-yl) 4-oxoquinoline-3-carboxylic acid derivatives useful as antibacterial agents
DE4228792A1 (en) 1992-08-29 1994-03-03 Hoechst Ag New piperidinyl:amino-pyridine derivs. - useful as agricultural and technical fungicides.
US5338738A (en) 1993-04-19 1994-08-16 Bristol-Myers Squibb Company Cerebral function enhancers: acyclic amide derivatives of pyrimidinylpiperidines
US5459151A (en) 1993-04-30 1995-10-17 American Home Products Corporation N-acyl substituted phenyl piperidines as bronchodilators and antiinflammatory agents
FR2722788B1 (en) 1994-07-20 1996-10-04 Pf Medicament NOVEL PIPERAZIDES DERIVED FROM ARYL PIPERAZINE, PROCESSES FOR THEIR PREPARATION, THEIR USE AS MEDICAMENTS AND PHARMACEUTICAL COMPOSITIONS COMPRISING THE SAME
US6083903A (en) 1994-10-28 2000-07-04 Leukosite, Inc. Boronic ester and acid compounds, synthesis and uses
ES2104509B1 (en) 1995-06-13 1998-07-01 Ferrer Int NEW COMPOUNDS DERIVED FROM 2- (3,4-DISSTITUTED-1-PIPERAZINYL) -5-FLUOROPYRIMIDINE.
PL189122B1 (en) 1995-11-23 2005-06-30 Janssen Pharmaceutica Nv Solid mixtures of cyclodextrins obtained by extrusion of a melt
ZA9610745B (en) 1995-12-22 1997-06-24 Warner Lambert Co 4-Subsituted piperidine analogs and their use as subtype selective nmda receptor antagonists
US5952349A (en) 1996-07-10 1999-09-14 Schering Corporation Muscarinic antagonists for treating memory loss
US5866702A (en) 1996-08-02 1999-02-02 Cv Therapeutics, Incorporation Purine inhibitors of cyclin dependent kinase 2
EP0827742A1 (en) 1996-09-04 1998-03-11 Vrije Universiteit Brussel Use of histone deacetylase inhibitors for treating fribosis or cirrhosis
AUPO721997A0 (en) 1997-06-06 1997-07-03 Queensland Institute Of Medical Research, The Anticancer compounds
TR200002760T2 (en) 1998-03-27 2000-12-21 Janssen Pharmaceutica N.V. HIV blocking pyrimidine derivatives
GB9823873D0 (en) 1998-10-30 1998-12-30 Pharmacia & Upjohn Spa 2-ureido-thiazole derivatives,process for their preparation,and their use as antitumour agents
EA004049B1 (en) 1998-11-10 2003-12-25 Янссен Фармацевтика Н.В. Hiv replication pyrimidines
BR9916211A (en) 1998-12-14 2001-09-11 American Home Prod 3,4-diamino-3-cyclobutene-1,2-dione derivatives that inhibit vla-4-mediated leukocyte adhesion
CZ27399A3 (en) 1999-01-26 2000-08-16 Ústav Experimentální Botaniky Av Čr Substituted nitrogen heterocyclic derivatives process of their preparation, the derivatives employed as medicaments, pharmaceutical composition and a compound pharmaceutical preparation in which these derivatives are comprised as well as use of these derivatives for preparing medicaments
KR100396738B1 (en) 1999-03-03 2003-09-03 삼진제약주식회사 Piperazine derivatives and process for the preparation thereof
ES2215570T3 (en) 1999-04-01 2004-10-16 Pfizer Products Inc. COMPOUNDS TO TREAT AND PREVENT DIABETIC COMPLICATIONS.
AU5283600A (en) 1999-05-24 2000-12-12 Cor Therapeutics, Inc. Inhibitors of factor xa
US6518283B1 (en) 1999-05-28 2003-02-11 Celltech R&D Limited Squaric acid derivatives
GB9918035D0 (en) 1999-07-30 1999-09-29 Novartis Ag Organic compounds
DK1233958T3 (en) 1999-11-23 2011-10-17 Methylgene Inc Inhibitors of histone deacetylase
IL150594A0 (en) 2000-01-07 2003-02-12 Ustav Ex Botan Adademie Ved Ce Purine derivatives, process for their preparation and use
US6608052B2 (en) 2000-02-16 2003-08-19 Boehringer Ingelheim Pharmaceuticals, Inc. Compounds useful as anti-inflammatory agents
WO2001070675A2 (en) 2000-03-24 2001-09-27 Methylgene, Inc. Inhibitors of histone deacetylase
WO2002000651A2 (en) 2000-06-27 2002-01-03 Bristol-Myers Squibb Pharma Company Factor xa inhibitors
WO2002018335A1 (en) 2000-08-28 2002-03-07 Yamanouchi Pharmaceutical Co., Ltd. Cyclic amine derivatives
JO2409B1 (en) 2000-11-21 2007-06-17 شركة جانسين فارماسوتيكا ان. في Biphenylcarboxamides useful as lipid lowering agents
US6784173B2 (en) 2001-06-15 2004-08-31 Hoffmann-La Roche Inc. Aromatic dicarboxylic acid derivatives
DE10130374A1 (en) 2001-06-23 2003-01-02 Boehringer Ingelheim Pharma Substituted N-acyl aniline derivatives, their preparation and their use as medicines
JO3429B1 (en) 2001-08-13 2019-10-20 Janssen Pharmaceutica Nv Hiv inhibiting pyrimidines derivatives
US6897220B2 (en) 2001-09-14 2005-05-24 Methylgene, Inc. Inhibitors of histone deacetylase
US7129034B2 (en) 2001-10-25 2006-10-31 Cedars-Sinai Medical Center Differentiation of whole bone marrow
GB0127929D0 (en) 2001-11-21 2002-01-16 Celltech R&D Ltd Chemical compounds
GB0229931D0 (en) 2002-12-21 2003-01-29 Astrazeneca Ab Therapeutic agents
AU2003215112A1 (en) 2002-02-07 2003-09-02 Axys Pharmaceuticals Novel bicyclic hydroxamates as inhibitors of histone deacetylase
EP1485378B1 (en) 2002-03-13 2008-06-18 Janssen Pharmaceutica N.V. Piperazinyl-, piperidinyl- and morpholinyl-derivatives as novel inhibitors of histone deacetylase
EP1485353B1 (en) 2002-03-13 2011-08-24 Janssen Pharmaceutica NV New inhibitors of histone deacetylase
PL205531B1 (en) 2002-03-13 2010-04-30 Janssen Pharmaceutica Nv Carbonylamino-derivatives as novel inhibitors of histone deacetylase
MXPA04007776A (en) 2002-03-13 2004-10-15 Janssen Pharmaceutica Nv Sulfonylamino-derivatives as novel inhibitors of histone deacetylase.
PL208401B1 (en) 2002-03-13 2011-04-29 Janssen Pharmaceutica Nv Piperazinyl-, piperidinyl- and morpholinyl-derivatives as novel inhibitors of histone deacetylase
PL220783B1 (en) 2002-03-13 2016-01-29 Janssen Pharmaceutica Nv Sulfonyl-derivatives as novel inhibitors of histone deacetylase
US6897307B2 (en) 2002-03-28 2005-05-24 Novartis Ag Process for preparing 2,6-diaminopurine derivatives
US7629343B2 (en) 2002-04-03 2009-12-08 Topotarget Uk Limited Carbamic acid compounds comprising a piperazine linkage as HDAC inhibitors
TWI319387B (en) 2002-04-05 2010-01-11 Astrazeneca Ab Benzamide derivatives
GB0209715D0 (en) * 2002-04-27 2002-06-05 Astrazeneca Ab Chemical compounds
DE10233412A1 (en) 2002-07-23 2004-02-12 4Sc Ag New compounds as histone deacetylase inhibitors
WO2004013130A1 (en) 2002-08-02 2004-02-12 Argenta Discovery Limited Substituted thienyl-hydroxamic acids as histone deacetylase inhibitors
ITMI20030025A1 (en) 2003-01-10 2004-07-11 Italfarmaco Spa HYDROXAMIC ACID DERIVATIVES FOR ANTI-INFLAMMATORY ACTIVITY.
US7135493B2 (en) 2003-01-13 2006-11-14 Astellas Pharma Inc. HDAC inhibitor
EP1583736A1 (en) 2003-01-17 2005-10-12 TopoTarget UK Limited Carbamic acid compounds comprising an ester or ketone linkage as hdac inhibitors
TW200424174A (en) 2003-02-06 2004-11-16 Hoffmann La Roche New TP diamide
AU2003900608A0 (en) 2003-02-11 2003-02-27 Fujisawa Pharmaceutical Co., Ltd. Hdac inhibitor
US7244751B2 (en) 2003-02-14 2007-07-17 Shenzhen Chipscreen Biosciences Ltd. Histone deacetylase inhibitors of novel benzamide derivatives with potent differentiation and anti-proliferation activity
CA2518318A1 (en) 2003-03-17 2004-09-30 Takeda San Diego, Inc. Histone deacetylase inhibitors
TW200424187A (en) 2003-04-04 2004-11-16 Hoffmann La Roche New oxime derivatives and their use as pharmaceutically active agents
AU2004230889B2 (en) 2003-04-07 2008-03-13 Pharmacyclics Llc Hydroxamates as therapeutic agents
CA2518950A1 (en) 2003-07-30 2005-02-10 Kyowa Hakko Kogyo Co., Ltd. Indazole derivatives
SI1673349T1 (en) 2003-09-22 2010-10-29 S Bio Pte Ltd Benzimidazole derivatives: preparation and pharmaceutical applications
MY142589A (en) 2003-09-22 2010-12-15 S Bio Pte Ltd Benzimidazole derivatives : preparation and pharmaceutical applications
JP4809228B2 (en) * 2003-09-24 2011-11-09 メチルジーン インコーポレイテッド Inhibitors of histone deacetylase
AR046605A1 (en) 2003-10-27 2005-12-14 S Bio Pte Ltd HYDROXAMATES UNITED TO BIARILO; PREPARATION AND PHARMACEUTICAL APPLICATIONS
JP2007509930A (en) 2003-10-27 2007-04-19 エス＊バイオ プライベート リミティッド Hydroxamates with acylureas and sulfonylureas
GB0402496D0 (en) 2004-02-04 2004-03-10 Argenta Discovery Ltd Novel compounds
US20050197336A1 (en) 2004-03-08 2005-09-08 Miikana Therapeutics Corporation Inhibitors of histone deacetylase
EP1735319B1 (en) 2004-03-26 2017-05-03 MethylGene Inc. Inhibitors of histone deacetylase
AP2336A (en) 2004-07-28 2011-12-08 Janssen Pharmaceutica Nv Subsituted indolyl alkyl amino derivatives as novel inhibitors of histone deacetylase.
AU2005266311B2 (en) * 2004-07-28 2011-08-11 Janssen Pharmaceutica N.V. Substituted propenyl piperazine derivatives as novel inhibitors of histone deacetylase
RS51189B (en) 2004-07-28 2010-10-31 Janssen Pharmaceutica N.V. Substituted propenyl piperazine derivatives as novel inhibitors of histone deacetylase
AU2006248938B2 (en) 2005-05-18 2011-09-29 Janssen Pharmaceutica N.V. Substituted aminopropenyl piperidine or morpholine derivatives as novel inhibitors of histone deacetylase
AU2006260961B2 (en) 2005-06-23 2011-08-11 Janssen Pharmaceutica N.V. Imidazolinone and hydantoine derivatives as novel inhibitors of histone deacetylase
CN101341138B (en) 2005-06-30 2012-11-14 詹森药业有限公司 Cyclic anilino-pyridinotriazines as GSK-3 inhibitors
WO2007016532A2 (en) 2005-08-02 2007-02-08 Novartis Ag Mutations and polymorphisms of hdac4
ATE509920T1 (en) 2005-10-27 2011-06-15 Janssen Pharmaceutica Nv SQUARE ACID DERIVATIVES AS INHIBITORS OF HISTONE DEACETYLASE
DK1981874T3 (en) 2006-01-19 2009-09-28 Janssen Pharmactuica N V Aminophenyl derivatives as novel inhibitors of histone deacetylase
ES2402213T3 (en) 2006-01-19 2013-04-29 Janssen Pharmaceutica N.V. Pyridine and pyrimidine derivatives as histone deacetylase inhibitors
EP1981875B1 (en) 2006-01-19 2014-04-16 Janssen Pharmaceutica N.V. Substituted indolyl-alkyl-amino-derivatives as inhibitors of histone deacetylase
EP1979327A1 (en) 2006-01-19 2008-10-15 Janssen Pharmaceutica, N.V. Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase
CA2630717C (en) 2006-01-19 2015-02-24 Janssen Pharmaceutica N.V. Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase
EP1981871B1 (en) 2006-01-19 2011-12-28 Janssen Pharmaceutica N.V. Heterocyclylalkyl derivatives as novel inhibitors of histone deacetylase
AU2007296259A1 (en) 2006-09-15 2008-03-20 Janssen Pharmaceutica Nv Combinations of class-I specific histone deacetylase inhibitors with proteasome inhibitors
EP2234883B1 (en) 2007-12-14 2017-08-02 Urban Aeronautics Ltd. Vtol vehicle and method of operating
GB0901749D0 (en) 2009-02-03 2009-03-11 Oxford Nanopore Tech Ltd Adaptor method

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108586359A (en) * 2018-06-26 2018-09-28 杭州科巢生物科技有限公司 A kind of synthetic method for disliking La Geli

Also Published As

Publication number Publication date
DK1979326T3 (en) 2013-01-07
JP2009526757A (en) 2009-07-23
US9078896B2 (en) 2015-07-14
HK1128281A1 (en) 2009-10-23
US20140135341A1 (en) 2014-05-15
CN101370790B (en) 2015-10-21
WO2007082874A1 (en) 2007-07-26
US20130143898A1 (en) 2013-06-06
CA2630717A1 (en) 2007-07-26
US8114876B2 (en) 2012-02-14
CA2630717C (en) 2015-02-24
AU2007206942B2 (en) 2012-08-23
AU2007206942A1 (en) 2007-07-26
EP1979326B1 (en) 2012-10-03
JP5247470B2 (en) 2013-07-24
US20090143401A1 (en) 2009-06-04
ES2396986T3 (en) 2013-03-01
EP1979326A1 (en) 2008-10-15
US8664223B2 (en) 2014-03-04

Similar Documents

Publication Publication Date Title
CN101370790B (en) As pyridine and the pyrimidine derivatives of NSC 630176
CN101370803B (en) Substituted indolyl-alkyl-amino-derivatives as inhibitors of histone deacetylase
CN101370789B (en) Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase
CN101370791B (en) Pyridine and pyrimidine derivatives as inhibitors of histone deacetylase
CN101370804B (en) Aminophenyl derivatives as novel inhibitors of histone deacetylase
CN101374828B (en) Heterocyclylalkyl derivatives as novel inhibitors of histone deacetylase
CN1993356B (en) Substituted propenyl piperazine derivatives as novel inhibitors of histone deacetylase
JP4948403B2 (en) Substituted indolylalkylamino derivatives as new inhibitors of histone deacetylase
CN100445276C (en) Sulfonylamino-derivatives as novel inhibitors of histone deacetylase
ES2322950T3 (en) DERIVATIVES OF AMINOCARBONYL AS NEW INHIBITORS OF HISTONA-DESACETILASE.
ES2553178T3 (en) Substituted derivatives of aminopropenyl piperidine or morpholine as new histone deacetylase inhibitors
US8426416B2 (en) Substituted propenyl piperazine derivatives as novel inhibitors of histone deacetylase
CN1993353B (en) Substituted indolyl alkyl amino derivatives as novel inhibitors of histone deacetylase

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1128281

Country of ref document: HK

C14 Grant of patent or utility model
GR01 Patent grant
REG Reference to a national code

Ref country code: HK

Ref legal event code: GR

Ref document number: 1128281

Country of ref document: HK