CN101363855B - Test paper strip for rapidly detecting lept specificity antibody colloidal gold - Google Patents
Test paper strip for rapidly detecting lept specificity antibody colloidal gold Download PDFInfo
- Publication number
- CN101363855B CN101363855B CN 200810112722 CN200810112722A CN101363855B CN 101363855 B CN101363855 B CN 101363855B CN 200810112722 CN200810112722 CN 200810112722 CN 200810112722 A CN200810112722 A CN 200810112722A CN 101363855 B CN101363855 B CN 101363855B
- Authority
- CN
- China
- Prior art keywords
- ompl1
- lipl32
- leptospira
- specific antigen
- antigen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention provides a test strip for rapid detection of a leptospira antibody, which comprises a reaction film and a conjugate release pad. The reaction film has a detection band simultaneously coated with Leptospira specific antigen ompL1 and LipL32, and a quality control band of polyclonal antibody coated with rabbit anti-Lebtospira specific antigen. The conjugate release pad is coated with colloidal gold labeled Leptospira specific antigens ompL1 and LipL32, and a membrane chromatography double antigen sandwich method is adopted to detect the Leptospira specific antigens ompL1 and LipL32 in a specimen. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base and site detection and epidemiological investigation, and has auxiliary effect on the diagnosis of leptospiral infection.
Description
Technical field
The invention belongs to field of biological detection, be specifically related to Leptospira detection of specific antibody test strips and application thereof.
Background technology
Leptospirosis is by the caused acute infectious disease of pathogenic Leptospira (abbreviation coupler body).Muroid, pig and other domestic animal are the main infection sources.Coupler body is discharged with the animal urine that carries disease germs, polluted source, and the people infects by skin, mucous membrane when Human Water Contact.Morbidity is many cuts rice season or after the heavy rain flood at Xia Qiu.After the people infected Leptospirosis, latent period was many in 1～3 week.At first form septicemia, various clinical symptoms can be arranged, comprise plain edition, empsyxis type, icterohemorrhagic form, meningoencephalitis type.About about 1 week of morbidity, morbidity enters the immune response phase, shows many nervous symptoms.Its diagnosis is except foundation epidemiology and clinical symptoms, and the laboratory is detected and is absolutely necessary, and its specific detection that relates to has:
1. pathogen isolation
Coupler body is easy coloring not, and general microscope is difficult to observe, and must adopt black matrix illumination method directly to search coupler body.Can from blood and cerebrospinal fluid, isolate coupler body in morbidity in 10 days.Can detect coupler body in the second week urine.Coupler body separates from body fluid or tissue and needs special laboratory technique and nutrient culture media.
Directly check pathogen with the methods such as direct Microscopical Method For Detection, fluoresent antibody staining, former blood sheet silver impregnation method and toluene blue dyeing behind the ultracentrifugation collection bacterium recently, can reach the quick diagnosis purpose, positive rate helps early diagnosis about 50%.
Animal inoculation pvaccination is a kind of reliable method of bacterial isolate body, and patient's blood or other body fluid is inoculated in animal (Baby guinea pig and the Golden Hamster) abdominal cavity, and late case can be inoculated in the animal subcutaneous abdomen with urine.Inoculate 3～5 days, check peritoneal fluid with dark field, the blood examination of also can coring when inoculating 3～6 days is looked into.The positive rate of animal inoculation pvaccination is higher, but required time is longer, and required expense is large.
2. serological test
(1) the molten valency of aggegation is tested (agglutination lysis test): higher specificity and susceptibility are arranged, but need different type viable bacterias operations, agglutinin generally occurred at 7～8 days after being ill, raise gradually, and positive to tire above 1: 400, the sustainable several months is to the several years.Interval two all paired seras, tiring, it is positive to increase more than 4 times.
(2) enzyme linked immunosorbent assay (ELISA): more Zao and sensitiveer than the positive time of occurrence of agglutination lysis test.Total coincidence rate of finding microscope agglutination test and ELISA reaches 86.2%.Abroad in Recent Years generally adopts the IgM against leptospira technology, and high degree of specificity is arranged.
(3) indirectly hemagglutination test (HA test): a kind of antigenic component that will from the coupler body thalline, extract, it is adsorbed in people " O " type erythrocyte surface sensitization, run into allo-antibody, hemagglutination namely occurs, the genus specificity that this test tool coupler body infects and without the specificity of group or type, occurring early than agglutination lysis test is positive, easy and simple to handle, do not need specific installation, suitable basic unit applies.
(4) indirect hemolysis test: with the coupler body antigenic substance with fresh sheep red blood cell (SRBC) sensitization, generation haemolysis when under the condition that complement exists, mixing with the serum that contains antibody, the sensitivity of more indirect hemagglutination test (HA test) is height.
(5) indirect fluorescent antibody technique: this method is that standard coupler body bacterial strain is made smear, the serum that then will detect patient drops on the slide of known bacterial strain, through washing, as having antibody among the patients serum, the therewith compound combination of antihuman globulin fluorescence antibody is used in the antigen-antibody combination again, and fluorescence occurs, namely positive, this method is without the special method of type.This law detect antibody time and the moon turn the time all aobvious solidifying test antibody have certain early diagnosis meaning for early.
Above-mentioned every detection all is to detect the corresponding antibodies that occurs in the blood with known coupler body antigen, can not accomplish early diagnosis.Carried out in recent years LAIT, reverse indirect hemagglutination assay and indirect fluorescent antibody stain test etc. can be measured the early stage coupler body that exists in the blood, has obtained the initial achievements of early diagnosis.
3. other diagnosis
(1) Leptospira DNA probe technique: be applied to already clinically, schoone etc. 1984 confirm, type Wijnberg strain DNA prepares probe with jaundice hemorrhage group Copenhagen, can detect at nitrocellulose filter the homologous dna of 2pg.And the different sero-group Patoc of pathogenic coupler body I strain submission justice hybridization phenomenon.The author thinks that the dna probe hybridization technique is the high method of early diagnosis of a kind of susceptibility.
(2) DNA gene amplification: the DNA cloning technology of polymerase chain reaction (PCR) has been introduced the diagnostic field of Leptospirosis at present.As long as just can test because PCR has primer, and method is easy, and is applicable to the epidemiology survey of large quantity sample.VanEys etc. 1989 have done to detect research with the pcr amplification technology to the ox urine of breathing out burnt type coupler body and infecting, and propose the novel method that PCR DNA cloning technology can be done the Leptospirosis diagnosis fully.
4. the research of leptospira membrane protein: there are some researches prove, ompL1 and Lip32 are that leptospiral main memebrane protein, particularly Lip32 are that content is the highest in the known membrane albumen.ELISA studies confirm that, ompL1 and Lip32 have a large amount of expression in the body of infection animal, all have good immunogenicity.
Summary of the invention
The purpose of invention provides a kind of easy to use, quick, for detection of the test strips of Leptospira specific antibody, detects Leptospira specific antibody in the mankind or the zoological specimens, is used for the auxiliary diagnosis of leptospiral infection.
Another object of the present invention is to provide the preparation method of above-mentioned test strips.
Test strips of the present invention comprises that reaction film and bond discharge pad, and described reaction film has the detection band that wraps simultaneously Leptospira genus-specific antigen ompL1 and LipL32 and is coated with the quality control band of the polyclonal antibody of the anti-Leptospira genus-specific antigen of rabbit; Described bond discharges Leptospira genus-specific antigen ompL1 and the LipL32 that pad is coated with colloid gold label.
Wherein, reaction film can be nitrocellulose membrane, and bond discharges pad and can be glass fibre membrane.
The present invention obtains respectively the gene engineering antigen of ompL1 and LipL32 by genetic engineering means, this can significantly improve the specificity of test strips.
The present invention also provides a kind of method for preparing above-mentioned test strip, and it comprises the steps:
1) preparation Leptospira genus-specific antigen ompL1 and LipL32;
2) with step 1) the Leptospira genus-specific antigen ompL1 of preparation and the polyclonal antibody of LipL32 and the anti-Leptospira genus-specific antigen of rabbit form respectively on reaction film and detect band and quality control band, and be for subsequent use;
3) with collaurum difference mark Leptospira genus-specific antigen ompL1 and LipL32, coated in bond release pad;
4) with the reaction film for preparing and bond discharges pad and sample pad, adsorptive pads and reaction holder are assembled into test strips.
Technical scheme of the present invention is: the polyclonal antibody difference solid phase (NC film) on nitrocellulose membrane that adopts Leptospira genus-specific antigen ompL1/LipL32 and the anti-Leptospira genus-specific antigen of rabbit of purifying, the Leptospira genus-specific antigen of association colloid gold mark is used rete and is analysed the principle of dual-antigen sandwich method and detect Leptospira specific antibody in the sample.
Test strips of the present invention can be used for detecting the Leptospira specific antibody.
Test strips of the present invention utilizes colloidal gold-labeled method and rete to analyse technology, is used for the Leptospira specific antibody that fast qualitative half-quantitative detection sample may exist, and reaches the Rapid Screening patient and the animal that is contaminted, and in time controls the purpose of epidemic situation.Save a large amount of manpower and materials, easily and fast, simple and direct, do not needed special instruments and equipment, do not needed professional training, the result is clear easily to be distinguished, simple to operate, is easy to promote, be fit to basic unit, be suitable for Site Detection and epidemiology survey, leptospiral Infect And Diagnose is played booster action.
Description of drawings
Fig. 1: the front schematic view of A test strips of the present invention; The side schematic view of B test strips of the present invention.Wherein, 1: adsorptive pads; 2: nitrocellulose membrane (T: by Leptospira genus-specific antigen ompL1 and LipL32; C: the Quality Control band of anti-leptospiral polyclonal antibody); 3: the glass fibre membrane that contains colloid gold label Leptospira genus-specific antigen ompL1 and LipL32; 4: golden labeling antibody diaphragm; 5: the reaction holder.
Fig. 2: testing result schematic diagram.Wherein, be followed successively by from left to right: T, two line positives of C; Line feminine gender of C; T, two line feminine genders of C are invalid.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize, the conventional means that used technological means is well known to those skilled in the art among the embodiment.
The clonal expression of embodiment 1 Leptospira genus-specific antigen ompL1 and LipL32
(1) ompL1 (accession number is EU022021) and LipL32 (accession number is AM936999)
The amplification of gene
Design primer according to the genes of interest fragment sequence:
The LipL32 primer sequence
5’GCCGAATTCATGAAAAAACTTTCGATTTTG 3’
5’GCCCTCGAGTTACTTAGTCGCGTCAGAAGC 3’
PCR parameter: 95 ℃ of 5min; 95 ℃ of 1min, 50 ℃ of 30s, 70 ℃ of 1min, 30 circulations; Last 70 degree extend 10min.
The ompL1 primer sequence
5’GCCGATATCATGAGAAAATTATCTTCTCTA 3’
5’GCACTCGAGTTACTTTGCGTTGCTTTCGTC 3’
PCR parameter: 95 ℃ of 5min; 95 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 1min, 30 circulations; Last 72 degree extend 10min.
(2) screening of the clone of genes of interest and positive recombinant
Will cut behind two kinds of pcr amplification product electrophoresis glue reclaim, after PMD-18T cloning vector 16 is spent night and is connected, be transformed in the DH5 α competent cell, picking monoclonal bacterial strain, 37 spend night cultivates, behind the extraction plasmid, carry out PCR take plasmid as template and identify the positive colony bacterial strain, measure sequence.
(3) structure of fusion expression vector
With restriction enzyme EcoR1, Xho1 respectively enzyme cut T/ompL1 and LipL32 and pGEX-4T-1,1% agarose electrophoresis is cut the large fragment after glue reclaims purpose fragment and pGEX-4T-1 double digestion, spending night with T4 ligase 16 connects, connect product and change the BL21 competent cell over to, the LB solid medium was cultivated 8～10 hours, extract plasmid after the picking list bacterium colony overnight incubation, identify respectively with PCR and restriction enzyme EcoR I, Xho1 double digestion, PCR product and enzyme are cut product and are analyzed with 1% agarose electrophoresis, screening positive clone is with the plasmid order-checking of restructuring.
(4) abduction delivering of albumen
The positive colony bacterium that filters out shakes the bacterium overnight incubation in the LB nutrient culture media after, the bacterium that will spend the night is seeded in the 1000mlLB fluid nutrient medium according to 1: 100 ratio, and 37 degree shaking tables are cultivated.The genetic transformation bacterium was best induction starting time (OD600nm 0.5) in rear 2 hours in inoculation, for ompL1, and IPTG concentration 0.3mmol/L, for LipL32, IPTG concentration is 0.5mmol/L, all spends abduction deliverings 8 hours in 29.
(5) purifying of expressing protein, evaluation
Spend 1000ml bacterium liquid 12000r/m, 4 in (4) centrifugal, abandon supernatant, with thalline cell pyrolysis liquid cracking, use contains the affinity chromatography pillar purified fusion protein of GST label, with GST-fusion protein purification kit (B-PER bacterium GST tag fusion protein pillar purifying Kit article No.: the silent generation that science and technology that flies of 78200 matches), carry out purifying by kit recommendation step and system, purified product carries out the SDS-PAGE electrophoresis to judge purification effect, records productive rate more than 95% by the ultraviolet thin layer.
The Western-Blot of fusion identifies
Cutting half glue turns on nitrocellulose filter with the half-dried electroporation that BioRad company produces, carry out the trace test, primary antibodie is Leptospira monoclonal antibody (Beijing Bo Aosen Bioisystech Co., Ltd), and after the TMB colour developing, the result has the specific proteins band to occur.
In above-mentioned steps (2), (3), (4) and (5) described step, ompL1 is parallel with LipL32.That is, ompL1 and LipL32 all adopt above-mentioned steps to express and identify.
The preparation of embodiment 2 ompL1 and LipL32 polyclonal antibody
(1) animal immune:
Select the New Zealand white rabbit of 1-2kg, usefulness ompL1 albumen is subcutaneous multi-point injection in the back, and immunizing dose is 1mg/kg.Immunity is 4 times altogether.
(2) immunizing potency detects:
The ELISA Plate of coated ompL1 albumen, every hole 4 μ g.Detect tiring of immune serum by indirect elisa method.Serum titer reaches more than 1: 20000, can gather serum.
(3) antibody is purified and calibrating:
Adopt conventional sad method to purify.Purity is examined and determine with non-sex change PAGE electrophoresis, shows albumen one band.The active ELISA of employing examines and determine, and tires greater than 1: 20000.
The preparation of LipL32 polyclonal antibody is identical with the ompL1 method
(1) preparation of collaurum-antigen bond:
Definite through testing, be 8.4 with its best combination pH value of expressing protein (ompL1 and LipL32 were by mixing in 1: 1) the colloid mark that mixes, the proportioning of collaurum and antigen is 50 μ g/ml collaurums.The mark collaurum by the amount of every square centimeter of 65 μ l, is got collaurum-antibody conjugates solution after stabilizing agent (0.5%BSA, pH8.0,0.01M Tris damping fluid) is processed, evenly is adsorbed on the glass fibre, and freeze drying, and in dry environment, preserve.
(2) envelope antigen is in nitrocellulose membrane:
The expressing protein (ompL1 and LipL32 mixed by 1: 1) that mixes is diluted to 3mg/ml with 0.01M PBS.The Anti-TNF-α body and function 0.01M PBS of anti-ompL1 and LipL32 is diluted to 2mg/ml.With Membrane jetter the two speed with 1 μ l/cm is sprayed on the nitrocellulose membrane, forms respectively detection line and control line.Article two, be spaced apart 0.5cm between the line.
The cellulose nitrate that is fixed with antigen-antibody was put in 37 ℃ of baking boxs dry 2 hours.Save backup in the dry environment.
(3) the Leptospira antibody assay kit forms
The reaction holder is 6.5cm * 0.4cm PCV plate; Adsorptive pads is the filter paper for oil of 2cm * 0.4cm; 1.8cm the nitrocellulose membrane of * 0.4cm is coated with the polyclonal antibody of ompL1 and LipL32, the specific expressed albumen ompL1 of Leptospira and LipL32, the people ompL1 that contains colloid gold label of 0.4cm * 0.4cm and the glass fibre of LipL32 successively; Gold labeling antibody diaphragm (sample pad) is the filter paper fibre of 2.7cm * 0.4cm; Namely formed Leptospira antibody test test strips (colloidal gold method).
(4) Leptospira antibody assay kit specificity and susceptibility experiment:
Specific detection: detect normal human serum with this product, typhoid human serum, influenza patients serum, patients with respiratory tract infection serum, snail fever human serum, diarrhoeal diseases human serum, all negative.
Susceptibility detects: ELISA method screening IgG positive serum, totally 10 parts.Testing result is as follows:
The contrast of table 1 and ELISA method
| The serum numbering | ELISA tires | The colloidal gold |
| 1 | 1∶320 | 1∶40 |
| 2 | 1∶160 | 1∶40 |
| 3 | 1∶320 | 1∶20 |
| 4 | 1∶320 | 1∶20 |
| 5 | 1∶640 | 1∶20 |
| 6 | 1∶320 | 1∶20 |
| 7 | 1∶160 | 1∶40 |
| 8 | 1∶160 | 1∶20 |
Embodiment 4 detection methods (referring to Fig. 2)
Sample to be checked (whole blood, blood plasma or serum) directly is added dropwise to embodiment 2 test strips " 4 " locates, sample liquid is up along film, 10-15 minute sentence read result.
The result:
As containing Leptospira antibody in the sample, then with test strips on the Leptospira genus-specific antigen of colloid gold label form corresponding compound, up Leptospira genus-specific antigen on being coated on nitrocellulose membrane is combined, and forms red lines, namely forms red stripes at the T place.
No matter whether contain Leptospira antibody, the Leptospira polyclonal antibody that colloid gold label Leptospira genus-specific antigen continues upwards to creep with being coated on the film forms the red precipitate line, namely locates to form red stripes at " C ".This line is nature controlling line, loses efficacy such as collaurum, and this line just can not occur, and illustrates that test strips lost efficacy.
Sequence table
＜110〉Beijing Zhuangdi Haohe Biomedicine Science and Technology Co., Ltd
＜120〉a kind of Leptospira specificity antibody colloidal gold Rapid detection test strip
<130>
<160>4
<170>PatentIn version 3.3
<210>1
<211>30
<212>DNA
＜213〉artificial sequence
<400>1
gccgaattca tgaaaaaact ttcgattttg 30
<210>2
<211>30
<212>DNA
＜213〉artificial sequence
<400>2
gccctcgagt tacttagtcg cgtcagaagc 30
<210>3
<211>30
<212>DNA
＜213〉artificial sequence
<400>3
gccgatatca tgagaaaatt atcttctcta 30
<210>4
<211>30
<212>DNA
＜213〉artificial sequence
<400>4
gcactcgagt tactttgcgt tgctttcgtc 30
Claims (3)
1. test strip, comprise that reaction film and bond discharge pad, described reaction film has the quality control band that is coated with simultaneously the detection band of Leptospira genus-specific antigen ompL1 and LipL32 and is coated with the polyclonal antibody of the anti-Leptospira genus-specific antigen of rabbit; Described bond discharges Leptospira genus-specific antigen ompL1 and the LipL32 that pad is coated with colloid gold label; Described reaction film is nitrocellulose filter, and bond discharges pad and is glass fibre membrane; Leptospira genus-specific antigen ompL1 and the LipL32 of described colloid gold label prepare by the following method: the expressing protein ompL1 and the LipL32 that mix are pressed the 1:1 mixing, the pH value of colloid gold label is 8.4, and the proportioning of collaurum and antigen is 50 μ g/ml collaurums; The collaurum of mark-antigen bond is behind stabilizer treatment, and the amount by every square centimeter of 65 μ l evenly is adsorbed on the glass fibre, freeze drying, and in dry environment, preserve, described stabilizer formula is 0.5%BSA, pH8.0,0.01M Tris damping fluid;
The method of envelope antigen is on the nitrocellulose filter: expressing protein ompL1 and LipL32 are pressed the 1:1 mixing, be diluted to 3mg/ml with 0.01M PBS, the Anti-TNF-α body and function 0.01M PBS of anti-ompL1 and LipL32 is diluted to 2mg/ml, with Membrane jetter the two amount with 1 μ l/cm is sprayed on the nitrocellulose membrane, form respectively detection line and control line, article two, be spaced apart 0.5cm between the line, the cellulose nitrate that is fixed with antigen-antibody was put in 37 ℃ of baking boxs dry 2 hours, saved backup in the dry environment.
2. test strips as claimed in claim 1 is characterized in that, wherein said Leptospira genus-specific antigen ompL1 and LipL32 are the recombinant expressed acquisitions of using gene engineering method.
3. method for preparing each described test strips of claim 1 ~ 2, it comprises the steps:
1) preparation Leptospira genus-specific antigen ompL1 and LipL32;
2) the Leptospira genus-specific antigen ompL1 of step 1) preparation and the polyclonal antibody of LipL32 and the anti-Leptospira genus-specific antigen of rabbit are formed respectively detection band and quality control band on reaction film, for subsequent use;
3) with collaurum difference mark Leptospira genus-specific antigen ompL1 and LipL32, and coated in bond release pad;
4) reaction film after will preparing and bond discharge pad and sample pad, adsorptive pads and reaction holder are assembled into test strips.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810112722 CN101363855B (en) | 2008-05-26 | 2008-05-26 | Test paper strip for rapidly detecting lept specificity antibody colloidal gold |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810112722 CN101363855B (en) | 2008-05-26 | 2008-05-26 | Test paper strip for rapidly detecting lept specificity antibody colloidal gold |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101363855A CN101363855A (en) | 2009-02-11 |
| CN101363855B true CN101363855B (en) | 2013-03-06 |
Family
ID=40390336
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200810112722 Active CN101363855B (en) | 2008-05-26 | 2008-05-26 | Test paper strip for rapidly detecting lept specificity antibody colloidal gold |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101363855B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101592665B (en) * | 2008-05-26 | 2013-06-19 | 北京庄笛浩禾生物医学科技有限公司 | Leptospira IgM antibody quick detection test strip |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1963508A (en) * | 2005-11-10 | 2007-05-16 | 北京庄笛浩禾生物医学科技有限公司 | Test paper bar for testing colloidal gold of capsular antibody of Bacillus anthracis |
| CN1963510A (en) * | 2005-11-10 | 2007-05-16 | 北京庄笛浩禾生物医学科技有限公司 | Test paper bar for testing colloidal gold of F1 antibody of plague bacterium |
-
2008
- 2008-05-26 CN CN 200810112722 patent/CN101363855B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1963508A (en) * | 2005-11-10 | 2007-05-16 | 北京庄笛浩禾生物医学科技有限公司 | Test paper bar for testing colloidal gold of capsular antibody of Bacillus anthracis |
| CN1963510A (en) * | 2005-11-10 | 2007-05-16 | 北京庄笛浩禾生物医学科技有限公司 | Test paper bar for testing colloidal gold of F1 antibody of plague bacterium |
Non-Patent Citations (1)
| Title |
|---|
| 李晓华.胶体金标记技术及应用.《生物学通报》.2004,第39卷(第12期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101363855A (en) | 2009-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mackay et al. | Differentiating infection from vaccination in foot-and-mouth disease using a panel of recombinant, non-structural proteins in ELISA | |
| CN104198703B (en) | People's mycoplasma pneumoniae gold label silver stain immunochromatographytest test kit and its preparation method and application | |
| CN109254155A (en) | A kind of detection African swine fever virus antigen colloidal gold immune chromatography test paper and preparation method and application | |
| CN103293306B (en) | Preparation method for African swine fever virus antibody detection colloidal gold immunochromatography test paper strip | |
| EP3633375A1 (en) | Mycoplasma pneumoniae immunological detection method and kit | |
| CN101363859B (en) | Test paper strip for rapidly detecting brucellosis antibody | |
| CN105203754B (en) | Method and kit for fast detection of moraxella catarrhalis based on magnetic resolution and quantum dot labelling | |
| CN105567644A (en) | Monoclonal antibodies capable of resisting Newcastle disease virus | |
| CN101363858B (en) | Test paper strip for detecting PRRSV antibody colloidal gold, method for making same and applications | |
| Thomason et al. | STAINING BACTERIAL SMEARS WITH FLUORESCENT ANTIBODY VI: Identification of Salmonellae in Fecal Specimens | |
| CN101362800A (en) | Test strip for rapid detection of brucella | |
| CN109970851A (en) | The preparation method of monoclonal antibody of CCV virus M protein and preparation method thereof, immunity colloidal gold test paper strip | |
| CN105319359B (en) | Streptococcus pneumoniae quantum dot immunochromatographic assay detection card and preparing method and application thereof | |
| CN101363864B (en) | Test paper strip for detecting encephalitis virus specificity IgG antibody, method for making same and applications | |
| CN101363855B (en) | Test paper strip for rapidly detecting lept specificity antibody colloidal gold | |
| KR100593286B1 (en) | Kit for detecting canine distemper virus antibody using immunochromatography | |
| CN101363862A (en) | Test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold | |
| CN101592665B (en) | Leptospira IgM antibody quick detection test strip | |
| CN101363865B (en) | Test paper strip for detecting PRRSV antibody colloidal gold, method for making same and application | |
| CN110824163A (en) | Colloidal gold test strip and reagent card for simultaneously detecting deer's disease and tuberculosis | |
| CN204028084U (en) | People's Chlamydia pneumoniae quantum dot immune chromatography test card | |
| Ison et al. | Enzyme-linked immunosorbent assay (ELISA) to detect antibodies in gonorrhea using whole cells. | |
| CN104628834B (en) | A kind of tuberculosis infection T cell immunodetection antigen and application thereof | |
| Tobin et al. | Immunoelectroosmophoresis in the diagnosis of meningococcal infections | |
| CN101363866A (en) | Test paper strip for detecting encephalitis virus IgM antibody colloidal gold, method for making same and applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20161205 Address after: 125208 Suizhong Binhai Economic Zone, Liaoning, No. 25 1-10 Patentee after: Liaoning Di Hao Biotechnology Co., Ltd. Address before: 100043 West Street, Shijingshan District, Beijing, No. 33 Patentee before: Beijing Zhuangdi Haohe Biomedicine Science and Technology Co., Ltd. |