CN101363862A - Test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold - Google Patents

Abstract

The invention provides a test strip for rapid detection of a Brucella IgM antibody, which comprises a reaction film and a conjugate release pad. The reaction film has a detection band simultaneously coated with Brucella specific antigen bp26, and a quality control band coated with a double-antibody. The conjugate release pad is coated with colloidal golden labeled anti-human IgM monoclonal antibody. A membrane chromatography indirect sandwich method is adopted to detect the Brucella specific IgM antibody in a specimen. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, site detection and early diagnosis, and has auxiliary effect on the diagnosis of Brucella infection.

Description

A kind of test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold

Technical field

The invention belongs to field of biological detection, be specifically related to a kind of brucellosis IgM antibody test strip and application thereof.

Background technology

Brucellosis (brucellosis) is the beastly infectious disease of suffering from altogether of people that is caused by Brucella (Brucella), is commonly called as undulant fever.Clinical characters is long-term heating, hidrosis, arthralgia, tired, hepatosplenomegaly etc., and this disease all has in various degree popular in countries in the world.

The people is mainly by skin, mucous membrane, alimentary canal and respiratory tract infection, especially with infect brucella melitensis, ox kind brucella is the most serious.Pig kind brucella infected person is more rare, and kind of dog brucella infected person is rare, and sheep epididymis kind brucella, sarin mouse kind brucella be infected person not substantially.

The easy mistaken diagnosis of brucellosis is the long-term heating cause diagnosis and treatment to be looked into of rheumatic disease, typhoid fever, tuberculosis, virus infections or conduct.The main cause of its long-term misdiagnosis is: (1) clinician is the main cause that causes mistaken diagnosis to the understanding deficiency of brucellosis.(2) the epidemiologic data inquiry is not detailed, particularly medical history, contact history, occupation, eating habit, residence and popular area etc.(3) clinical manifestation variation and atypical symptoms.(4) lack simple to operate, quick, special, responsive detection means.

At present the brucella INFECTION IN DETECTION is mainly carried out in the laboratory.Mainly contain:

(1) etiological diagnosis:

Microexamination: gather tissues such as miscarriage afterbirth, chorion edematous fluid, liver, spleen, lymph node, fetus gastric content, make and smear sheet, with the dyeing of Ke Ziluo Paderewski decoration method, microscopy, brucella is red club shape dialister bacterium, and other bacterium is blue.

Separation and Culture: fresh pathological material of disease can be used tryptose

Medium culture such as agar face or blood agar inclined-plane, liver soup agar slant, 3% glycerine, 0.5% glucose liver soup agar slant; Cultivate after 7～10 days, carry out colony characteristics inspection and monospecific antiserum agglutination test for 37 ℃.

(2) serodiagnosis: main following several, brave red plate agglutination test (RBPT) full milk ring test (MRT), tube agglutination test (SAT), complement fixation test (CFT) (CFT) etc.In recent years, people detect the antibody that infects in the serum with the brucellar antigen development ELISA method detection kit of slightly carrying, and have obtained good effect.

(3) other detects the specific specificity nucleotide of brucella etc. as PCR.

Bp26 albumen is a kind of of brucella outer membrane protein, existing studies show that, bp26 albumen has good immunogenicity, and from gene level, various brucella (B.abortus, B.ovis and B.melitensis etc.) the bp26 gene order almost completely consistent, just nucleotide has fine difference, but the amino acid sequence indifference.Therefore belong to various brucellar common antigens, can be used as brucellar detection antigen, be used for detecting diagnosis.

Summary of the invention

The purpose of invention provides a kind of easy to use, quick, is used to detect the test strips of encephalitis virus specificity antibody, detects brucella specific IgM antibodies in the infected patient sample, the auxiliary diagnosis that the personnel selection brucella infects.

Another object of the present invention is to provide the preparation method of above-mentioned test strips.

Test strips of the present invention comprises that reaction film and bond discharge pad, described reaction film have bag by the detection band of brucella specific antigen bp26 albumen and bag by the quality control band of two anti-IgG; Described bond discharges the anti-people IgM monoclonal antibody that pad is coated with colloid gold label.

Wherein, reaction film can be nitrocellulose membrane, and bond discharges pad and can be glass fibre membrane.

The present invention is by the gene engineering antigen of genetic engineering means acquisition bp26, and this can significantly improve the specificity of test strips.

The present invention also provides a kind of method for preparing above-mentioned test strip, and it comprises the steps:

1) preparation brucella specific antigen bp26;

2) brucella specific antigen bp26 and the two anti-IgG with the step 1) preparation form detection band and quality control band respectively on reaction film, and are standby;

3) with the anti-people IgM of colloid gold label monoclonal antibody, bag is discharged in the pad to bond;

4) with the reaction film for preparing and bond discharges pad and sample pad, adsorptive pads and reaction holder are assembled into test strips.

Test strips of the present invention can be used for detecting the brucellosis IgM antibody in people's sample.

Technical scheme of the present invention is: the brucella specific antigen bp26 albumen and the anti-mouse IgG difference solid phase (NC film) on nitrocellulose membrane that adopt purifying, the anti-people IgM monoclonal antibody of association colloid gold mark is used rete and is analysed the principle of indirect sandwich assay and detect brucellosis IgM antibody in people's sample.

Test strips of the present invention utilizes colloidal gold-labeled method and rete to analyse technology, is used for the brucella specific IgM antibodies that fast qualitative half-quantitative detection sample may exist, and reaches quick screening patient, the purpose of diagnoses and treatment in time.Can save a large amount of manpower and materials, easily and fast, simple and direct, not need special instruments and equipment, not need professional training, the result is clear easily to be distinguished, simple to operate, is easy to promote, be fit to basic unit, be suitable for on-the-spot the detection and early diagnosis, brucellar Infect And Diagnose is played booster action.

Description of drawings

Fig. 1: the front schematic view of A test strips of the present invention; The side schematic view of B test strips of the present invention.Wherein, 1: adsorptive pads; 2: nitrocellulose membrane (T: brucella specific antigen bp26 albumen; C: bag is by the Quality Control band of anti-mouse IgG); 3: the glass fibre membrane that contains the anti-people IgM monoclonal antibody of colloid gold label; 4: golden labeling antibody diaphragm; 5: the reaction holder.

Fig. 2: testing result synoptic diagram.Wherein, be followed successively by from left to right: two line positives of T, C; Line feminine gender of C; Two line feminine genders of T, C are invalid.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.

If do not specialize the conventional means that used technological means is well known to those skilled in the art among the embodiment.

Embodiment 1: the preparation of brucella outer membrane protein bp26 gene engineering antigen

(1) acquisition of genes of interest

The primer that contains the restricted interior enzyme EcoR1 of association, Xho1 restriction enzyme site according to the characteristics design two ends of target gene fragment sequence (the GenBank accession number is AY166769) and pGEX-4T-1 (Pharmacia) expression vector:

5’gaattcatgaacactcgtgct3’

5’gcctcgagttacttgatttcaa3’

Then, from the brucella genome, amplify genes of interest segment bp26, amplification condition: 95 ℃ of sex change 5min; 95 ℃ of 1min, 49.8 ℃ of 1min, 70 ℃ of 1min carry out 35 circulations; Last 70 ℃ are extended 10min.

(2) screening of the clone of genes of interest and positive recombinant

Cut glue behind the pcr amplification product electrophoresis and reclaim, with the PMD-18T cloning vector spend the night for 16 ℃ be connected after, be transformed in the DH5 α competent cell, picking monoclonal bacterial strain, 37 ℃ of incubated overnight are behind the extraction plasmid, with the plasmid is that template is carried out PCR evaluation positive colony bacterial strain, measures sequence.

(3) structure of bp26 fusion expression vector

With restriction enzyme EcoRI, XhoI respectively enzyme cut T/bp26 and pGEX-4T-1,1% agarose electrophoresis is cut the big fragment after glue reclaims bp26 purpose fragment and pGEX-4T-1 double digestion, with the T4 ligase with both 16 ℃ of connections of spending the night, connect product and change the BL21 competent cell over to, the LB solid medium was cultivated 8～10 hours, extract plasmid after the picking list bacterium colony overnight incubation, identify respectively with PCR and restriction enzyme EcoR I, XhoI double digestion, PCR product and enzyme are cut product and are analyzed with 1% agarose electrophoresis, screening positive clone is with the plasmid order-checking of reorganization.

(4) abduction delivering of pGEX-bp26 fusion

The positive colony bacterium that filters out shakes the bacterium overnight incubation in the LB nutrient culture media after, the bacterium that will spend the night is seeded in the 1000ml LB fluid nutrient medium according to the ratio of 1:100, and 37 ℃ of shaking tables are cultivated.Bp26 genetic transformation bacterium is induced opportunity (OD600nm 0.5) back 2 hours of inoculation for the best, and dense ℃ of 0.3mmol/L of IPTG induced 8 hours for 29 ℃, and destination protein is present in the cell pyrolysis liquid supernatant.

(5) purifying of pGEX-bp26 fusion, evaluation

1000ml bacterium liquid 12000r/m in (4), 4 ℃ is centrifugal, abandon supernatant, with thalline cell pyrolysis liquid cracking, use contains the affinity chromatography pillar purified fusion protein of GST label, with GST-fusion purification kit (B-PER bacterium GST tag fusion protein pillar purifying Kit article No.: the silent generation that science and technology that flies of 78200 matches), carry out purifying by kit recommendation step and system, purified product carries out the SDS-PAGE electrophoresis to judge purification effect, records productive rate more than 95% by the ultraviolet thin layer.

The Western-Blot of fusion identifies

Cutting half glue changes on nitrocellulose filter with the half-dried electroporation that BioRad company produces, and carries out the trace test, and one anti-ly is brucella monoclonal antibody (Beijing Bo Aosen Bioisystech Co., Ltd), and after the TMB colour developing, the result has the specific proteins band to occur.

Embodiment 2: test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold (referring to Fig. 1)

(1) preparation of collaurum-anti-people IgM bond:

Definite through testing, its best combination pH value of anti-people IgM monoclonal antibody colloid mark is 8.0, and the proportioning of collaurum and antibody is 28 μ g/ml collaurums.The mark collaurum by the amount of every square centimeter 65 μ l, is got collaurum-antibody conjugates solution after stabilizing agent (0.5%BSA, pH8.0,0.01M Tris damping fluid) is handled, evenly is adsorbed on the glass fibre, and freeze drying, and in dry environment, preserve.

(2) envelope antigen is in nitrocellulose membrane:

Bp26 is diluted to 3mg/ml with 0.01M PBS.To resist mouse IgG to be diluted to 2mg/ml with 0.01M PBS.With Membrane jetter the two speed with 1 μ l/cm is sprayed on the nitrocellulose membrane, forms detection line and control line respectively.Article two, be spaced apart 0.5cm between the line.

The cellulose nitrate that is fixed with antigen-antibody was put in 37 ℃ of baking boxs dry 2 hours.Preserve standby in the dry environment.

(3) reagent strip is formed

The reaction holder is 6.5cm * 0.4cm PCV plate; Adsorptive pads is the filter paper for oil of 2cm * 0.4cm; 1.8cm the nitrocellulose membrane of * 0.4cm wraps successively by anti-mouse IgG, brucella specific antigen bp26 contains the monoclonal antibody glass fibre membrane of the anti-people IgM of 0.4cm * 0.4cm colloid gold label; Gold labeling antibody diaphragm is the glass fibre of 2.7cm * 0.4cm; Promptly formed test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold

(4) brucellosis IgM antibody detection kit specificity and susceptibility detect:

Specificity experiment: detect normal ox, sheep, pig, dog serum with this product, normal human serum, swine fever serum, pig campylobacter jejuni serum, the anti-salmonella typhimurium serum of rabbit, the anti-soil of rabbit draw human relations bacterium serum, the anti-Yersinia ruckeri serum of rabbit, rabbit anticolibacillary serum.The result is all negative, shows that the brucellosis IgM antibody detection kit has good specificity.

Susceptibility experiment: detect cloth Salmonella patient IgM positive serum respectively with this product.Positive serum with the detection of tiring of ELISA kit, and is diluted to different titres, and testing result shows that this product lowest detection output is 1:32 (ELISA).

Embodiment 3 detection methods (referring to Fig. 2)

Patient's whole blood, blood plasma or serum specimen 100-150ul directly are added dropwise to embodiment 2 test strips " 4 " locate, sample liquid is up along film, 10-15 minute sentence read result.

The result:

As detect and contain brucellosis IgM antibody in the sample, then with test strips on the anti-people IgM monoclonal antibody of colloid gold label form corresponding compound, up be coated on nitrocellulose membrane on the brucella specific antigen combine, form red lines, promptly form red stripes at the T place.

No matter whether contain corresponding antibody in the sample, the anti-people IgM monoclonal antibody of colloid gold label continues upwards to creep and the anti-mouse IgG that is coated on the film forms the red precipitate line, promptly locates to form red stripes at " C ".This line is a nature controlling line, loses efficacy as collaurum, and this line just can not occur, and illustrates that test strips lost efficacy.

Sequence table

＜110〉Beijing Zhuangdi Haohe Biomedicine Science and Technology Co., Ltd

＜120〉a kind of test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold

<130>

<160>2

<170>PatentIn?version?3.3

<210>1

<211>21

<212>DNA

＜213〉artificial sequence

<400>1

<210>2

<211>22

<212>DNA

＜213〉artificial sequence

<400>2

Claims (7)

1, a kind of test strip comprises that reaction film and bond discharge pad, described reaction film have bag by the detection band of brucella specific antigen bp26 albumen and bag by the quality control band of two anti-IgG; Described bond discharges the anti-people IgM monoclonal antibody that pad is coated with colloid gold label.

2, test strips as claimed in claim 1 is characterized in that, wherein said brucella specific antigen bp26 albumen is the recombinant expressed acquisition of using gene engineering method.

3, test strips as claimed in claim 1 or 2 is characterized in that, described reaction film is a nitrocellulose filter.

4, test strips as claimed in claim 1 or 2 is characterized in that, described bond discharges pad and is glass fibre membrane.

5, as claim 1 or 2 test strips as described in each, it is characterized in that described two anti-IgG are anti-mouse IgG.

6, a kind of method for preparing each described test strips of claim 1～5, it comprises the steps:

1) preparation brucella specific antigen bp26;

2) brucella specific antigen bp26 and the two anti-IgG with the step 1) preparation form detection band and quality control band respectively on reaction film, and are standby;

3) with the anti-people IgM of colloid gold label monoclonal antibody, bag is discharged in the pad to bond;

4) with the reaction film for preparing and bond discharges pad and sample pad, adsorptive pads and reaction holder are assembled into test strips.

7, the application of the arbitrary described test strips of claim 1-5 in detecting the brucella specific IgM antibodies.

Images