CN101363854A - Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold - Google Patents
Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold Download PDFInfo
- Publication number
- CN101363854A CN101363854A CNA2008101127201A CN200810112720A CN101363854A CN 101363854 A CN101363854 A CN 101363854A CN A2008101127201 A CNA2008101127201 A CN A2008101127201A CN 200810112720 A CN200810112720 A CN 200810112720A CN 101363854 A CN101363854 A CN 101363854A
- Authority
- CN
- China
- Prior art keywords
- streptococcus suis
- specific antigen
- mrp
- type specific
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention provides a test strip for fast detection of Streptococcus suis (serotype2), which comprises a reaction film and a conjugate release pad. The reaction film has a detection band coated with Streptococcus suis (serotype2) specific antigen MRP, and a quality control band of polyclonal antibody coated with anti Streptococcus suis (serotype2) specific antigen. The conjugate release pad is coated with colloidal gold labeled Streptococcus suis (serotype2) specific antigen, and a membrane chromatography double antigen sandwich method is adopted to detect the Streptococcus suis (serotype2) specific antigen. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, large scale detection of an accident and epidemiological investigation, and has auxiliary effect on the diagnosis of Streptococcus suis (serotype2) infection.
Description
Technical field
The invention belongs to field of biological detection, be specifically related to a kind of streptococcus suis 2-type specific antibody test strip and application thereof.
Background technology
Streptococcus suis (Streptococcus suis) can cause the meningitis of pig, diseases such as arthritis and septicemia, and can cause young pig sudden death.This bacterium also can cause human infection, causes serious illness such as meningitis, is a kind of important Amphixenosis's pathogen.It is 35 serotypes that Streptococcus suis is divided into, and wherein streptococcus suis 2-type is distribution on global, and the ratio of clinical separation is the highest.In streptococcus suis 2-type, there is the bacterial strain of strong poison, weak poison and nontoxic 3 kinds of different virulence.The maximum differential of velogen strain and avirulent strain is that the former is MRP+, and the latter is MRP-.The Streptococcus suis of MRP+ often can cause serious clinical symptoms, the then unlikely any symptom of the bacterial strain of MRP-, and visible MRP is the important virulence factor of this bacterium.
Epidemic characteristic: streptococcus is distributed widely in nature.People and multiple animal all have neurological susceptibility, and the neurological susceptibility of pig is higher.The pig at various ages all can fall ill, but septicemia type and encephalitis type are more common in piglet, and the purulent lymphadenitis type is more common in middle pig.Sick pig, clinical rehabilitation pig and health pig all can be carried disease germs, when they contact with each other, but through port, nose, skin wound and infect.It is popular generally to be region, after this disease is imported into, often occurs successively in swinery.
Clinical symptoms: the latent period of natural infection is about 1d.Acute sudden onset, fervescence are to 41-42 ℃, and be dead in a few hours.Mortality ratio is up to more than 50%.Above-mentioned symptom such as malpractice can transfer subacute or chronic type to, and the course of disease is long repeatedly more than ten day, and be low when high when showing as body temperature, poor appetite, and the joint shows enlargement, and it is serious to walk lamely, become thin, the proper rehabilitation gradually of treatment nursing, otherwise worsening changes extremely.In addition, also have a kind of simple chronic infection, show that neck or other many places, position are long, the purulence born of the same parents, swollen lymph node, the inflammation of a plurality of joints, the swelling and ache row of occur crossing mountains causes dysarthrasis if arthritis treatment is improper. influence outlet and plant usefulness, or the long slow reduction price of deed of bringing back to life.
Laboratory examination: take corresponding inspection method according to different sick types,, make smear, with alkaline methylene blue dyeing liquor and gram staining liquid dyeing as abscess, suppuration kitchen range, liver, spleen, capsular ligament liquid, celiolymph and brain tissue etc.Microexamination.See single, paired, short chain or be the coccus of long-chain, Gram is purple (positive), can confirm as this disease.Also can carry out the bacterium separation and Culture identifies.
Yet these detection methods can only be done simple sick inspection, can not determine the type of Streptococcus suis, and are with a low credibility.In addition, need experiment conditions such as microscope during detection, be not easy to pig farm or other environment measuring.
The diagnosis of streptococcus suis 2-type antigen mainly is a smear for microscopic examination, gets disease pig blood, liver, spleen, lymph node smear staining microscopy, finds the gram-positive cocci of single, 3-4, a 4-5 short chain or 7-8 long-chain; Martin's bouillon is cultivated, and pathological material of disease is inoculated cultivated 48h in the broth bouillon and find to be muddy and a large amount of white flocculent deposits are arranged, and the culture microscopy finds to have equally gram-positive cocci; Biochemistry detection: separator is done biochemical reaction, all do not produce acid with glucose, maltose, lactose, fructose, SM, and wood sugar, dulcitol, sorbierite and synanthrin nutrient culture media do not turn sour.But the complex operation complexity, the time is long.
In the fast detecting, use latex agglutination test more.The Davies fluorescent antibody technics, Serhir once detected streptococcus suis 2-type antigen in the disease pig sample with double-antibodies sandwich ELISA, and this method sensitivity and specificity reach 98-100%.
Along with the continuous development of immunological technique, finger-print, nucleic acid amplification (PCR) have successively occurred but all had problems such as the expensive instrument of needs, complicated operation, time are long, need professional.
Colloidal gold immunity chromatography (Immunochromatography Assay) starts from the mid-90 in last century, is to grow up on the basis of immunity percolation method.It is the combination of immune affine technology, engram technology, immunolabelling technique and chromatographic technique.With envelope antigen, colloid gold label antibody immobilization, combine with sample sorbing material etc., be prepared as immunochromatography diagnostic test/plate, only need be during use inserting sample solution under the test strips, several minutes just can judged result.With the immunity percolation method relatively, good stability operate easylier, quick, and owing to be strip/test plate (panel) form, need not cryopreservation, accumulating makes things convenient for.
Yet, have or not at present a kind of convenient, fast, method for detecting specificity that can the specific detection streptococcus suis 2-type.
Summary of the invention
The purpose of invention is to provide a kind of easy to use, quick, is used to detect the test strips of streptococcus suis 2-type specific antibody, is used for the auxiliary diagnosis that streptococcus suis 2-type infects.
Another object of the present invention is to provide the preparation method of above-mentioned test strips.
Test strip of the present invention comprises that reaction film and bond discharge pad, described reaction film have bag by the detection band of streptococcus suis 2 type specific antigen MRP and bag by the quality control band of the polyclonal antibody of anti-streptococcus suis 2 type specific antigens; Described bond discharges the streptococcus suis 2 type specific antigen MRP that pad is coated with colloid gold label.
Wherein, reaction film can be nitrocellulose membrane, and bond discharges pad and can be glass fibre membrane.
Wherein, the package amount of streptococcus suis 2 type specific antigen MRP is preferably 3-4mg/ml, and it can prepare by prokaryotic expression.
The present invention also provides a kind of method for preparing above-mentioned test strip, and it comprises the steps:
1) polyclonal antibody of preparation streptococcus suis 2 type specific antigen MRP and anti-streptococcus suis 2 type specific antigens;
2) antigen and the antibody sandwich with the step 1) preparation forms detection line and nature controlling line respectively to reaction film, and be standby;
3) the streptococcus suis 2 type specific antigen MRP with colloid gold label wraps by to the bond pad;
4) with 2) and 3) bond for preparing discharges pad, reaction film and sample pad, adsorptive pads and reaction holder and be assembled into test card.
The invention also discloses the application of described test strips in detecting Streptococcus suis antibody.
Technical scheme of the present invention is: the polyclonal antibody difference solid phase (NC film) on nitrocellulose membrane that adopts the streptococcus suis 2 type specific antigen MRP and anti-streptococcus suis 2 type specific antigens of purifying, the streptococcus suis 2 type specific antigen MRP of association colloid gold mark uses rete and analyses the principle of dual-antigen sandwich method and detect streptococcus suis 2-type specific antibody in the sample.
Test strips of the present invention utilizes colloidal gold-labeled method and rete to analyse technology, is used for the streptococcus suis 2-type antibody that fast qualitative half-quantitative detection sample may exist, and reaches quick screening patient and sick pig, in time controls the purpose of epidemic situation.For next step isolation identification has been created into advantage, save a large amount of manpower and materials, easily and fast, simple and direct, do not needed special instruments and equipment, do not need professional training, the result is clear easily to be distinguished, simple to operate, is easy to promote, be fit to basic unit, the mass field that is suitable for accident detects, and is fit to epidemiology survey, and the Infect And Diagnose of streptococcus suis 2-type is played booster action.
Description of drawings
Fig. 1: the front schematic view of A test strips of the present invention; The side schematic view of B test strips of the present invention.Wherein, 1: adsorptive pads; 2: nitrocellulose membrane (T: streptococcus suis 2 type specific antigen MRP; C: the Quality Control band of the polyclonal antibody of anti-streptococcus suis 2 type specific antigens); 3: the glass fibre membrane that contains colloid gold label streptococcus suis 2 type specific antigen MRP; 4: golden labeling antibody diaphragm; 5: the reaction holder.
Fig. 2: testing result synoptic diagram.Wherein, be followed successively by from left to right: two line positives of T, C; Line feminine gender of C; Two line feminine genders of T, C are invalid.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize the conventional means that used technological means is well known to those skilled in the art among the embodiment.
The clonal expression of embodiment 1 streptococcus suis 2 type specific antigen MRP
(1) amplification of mrp gene
The PCR design of primers
According to MRP nucleotide sequence (the GenBank number of landing is EF520110); design a pair of primer; the primer two ends are added Sac I and Hind III restriction enzyme site and protectiveness base respectively, can the increase fragment of 529bp between streptococcus suis 2-type mrp gene open reading frame (ORF) 298～827bp of primer P1 and P2.Primer sequence is respectively:
Upstream primer P1:5 ' GTAGAGCTCGAACAGGTAACATCAGA3 ';
Downstream primer P2:5 ' CAGAAGCTTAAGAGTAACGAATGTAGG3 '.
Pcr amplification
Add the go forward side by side performing PCR amplification of each reactant successively with condition in the following order.Template DNA 2 μ L, 10 * buffer, 10 μ L, 25mmol/L MgCl
28 μ L, 215mmol/L dNTPs8 μ L, each 1 μ L of primer P1 and P2 (0.1 μ mol/L), ddH
2O 68 μ L, Taq enzyme (5UP μ L) 3 μ L.The condition of amplification is: 94 ℃ of 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 60s, 30 circulations; 72 ℃ of 10min.
The recovery and the enzyme of PCR product are cut
The PCR product is at 1% agarose gel electrophoresis, and the back is reclaimed kit with DNA and reclaimed the purpose fragment, and cuts 2h, 65 ℃ of 15min cessation reactions with Sac I and Hind III enzyme.
Construction of recombinant plasmid and evaluation
The single bacterium colony of DH5 α Escherichia coli of pET32a (+) empty plasmid is carried in inoculation in the LB meat soup that contains 100 μ g/mL Amp, 37 ℃ of shakes are cultivated 12～16h, with plasmid extraction kit extracting plasmid, behind Sac I and the Hind III double digestion, reclaim kit recovery enzyme with DNA and cut product.The PCR double digestion is reclaimed product be connected with empty plasmid double digestion recovery product, and the DH5 α host bacterium of transformed competence colibacillus.The preparation of competence bacterium, transform and all to carry out according to a conventional method, utilize the resistance of Amp and restriction enzyme recombinate screening and the evaluation of bacterium, Preliminary Identification has obtained positive colony 10 strains.
The order-checking of recombinant plasmid and sequential analysis
The sequencing of recombinant plasmid adopts the terminal cessation method of the two deoxidations of Sanger, company limited finishes by precious bioengineering (Dalian), verifying its reading frame, and carry out homology analysis with BLAST software, the result shows that the positive colony and the aim sequence that are obtained are in full accord.
Expression and the purifying of recombinant plasmid in Escherichia coli
With the recombinant plasmid e. coli bl21 of transformed competence colibacillus according to a conventional method, utilize Amp resistance screening reorganization bacterium, to choose in single colony inoculation LB meat soup and (contain 100 μ g/mL Amp), 37 ℃ of violent shakes are cultivated 2～4h, when bacterial concentration reaches A
6000.5～0.6 o'clock, add IPTG to final concentration 1mmol/L, 37 ℃ are continued violent shake and cultivate 2～4h.The centrifugal 5min of 6000r/min, precipitation is washed 3 times with the PBS of pH7.210mmol/L, adds isopyknic electrophoresis sample-loading buffer and boils 10min, and SDS PAGE detects.Also equally after IPTG induces processing, SDS PAGE detects expression to the e. coli bl21 that contains sky pET32a (+).With the reorganization bacterium that ultrasonic disruption is induced, collect supernatant, carry out affinity chromatography with QIAgen nickel affinity chromatography post, concrete steps are undertaken by operation instructions.
The test of recombinant protein immunoassays
With the recombinant protein and the full bacterial immunity mouse of streptococcus suis 2-type of collecting, prepare immune serum respectively.Bag is detected the reactivity of MRP and full bacterial immunity serum and MRP immune serum respectively by the MRP ELISA Plate.The result confirms that expressed albumen has good immunogenicity and immunoreactivity.
Embodiment 2:MRP Polyclonal Antibody Preparation
(1) animal immune:
Select the New Zealand white rabbit of 1-2kg, usefulness MRP albumen is subcutaneous multi-point injection in the back, and immunizing dose is 1mg/kg.Immunity is 4 times altogether.
(2) immunizing potency detects:
Bag is by the ELISA Plate of MRP albumen, every hole 4 μ g.Detect tiring of immune serum by indirect elisa method.Serum titer reaches more than the 1:20000, can gather serum.
(3) antibody is purified and calibrating:
Adopt conventional sad method to purify.Purity is examined and determine with non-sex change PAGE electrophoresis, shows albumen one band.The active ELISA of employing examines and determine, and tires greater than 1:20000.
Embodiment 3: the development of streptococcus suis 2-type antibody fast test strip (referring to Fig. 1)
(1) preparation of collaurum-MRP bond:
Definite through testing, the best combination pH value of MRP antigen colloid mark is 8.0, and the proportioning of collaurum and antigen is 50 μ g/ml collaurums.The mark collaurum by the amount of every square centimeter 65 μ l, is got collaurum-MRP bond solution after stabilizing agent (0.5%BSA, pH8.0,0.01M Tris damping fluid) is handled, evenly is adsorbed on the glass fibre, and freeze drying, and in dry environment, preserve.
(2) envelope antigen is in nitrocellulose membrane:
MRP is diluted to 3.5mg/ml with 0.01M PBS.The polyclonal antibody of anti-MRP is diluted to 2mg/ml with 0.01M PBS.With Membrane jetter the two speed with 1 μ l/cm is sprayed on the nitrocellulose membrane, forms detection line and control line respectively.Article two, be spaced apart 0.5cm between the line.
The cellulose nitrate that is fixed with antigen was put in 37 ℃ of baking boxs dry 2 hours.Preserve standby in the dry environment.
(3) streptococcus suis 2-type antibody test reagent strip is formed
The reaction holder is 6.5cm * 0.4cm PCV plate; Adsorptive pads is the filter paper for oil of 2cm * 0.4cm; 1.8cm the nitrocellulose membrane of * 0.4cm wraps successively by the polyclonal antibody of anti-MRP, the specific expressed albumen MRP of streptococcus suis 2-type, the glass fibre of the MRP that contains colloid gold label of 0.4cm * 0.4cm; Gold labeling antibody diaphragm (sample pad) is the filter paper fibre of 2.7cm * 0.4cm; Promptly formed streptococcus suis 2-type antibody test test strips (colloidal gold method).
(4) streptococcus suis 2-type antibody test reagent strip specificity and susceptibility
The specificity experiment: Streptococcus suis is divided into a plurality of groups, totally 35 types.Therefore this product specificity designs following specificity Quality Control product at 2 type Streptococcus suis: 30 parts of normal pig serum, pork measles serum, the arc worm serum of pig, pig trichina serum, the sick serum of swine fever, pig campylobacter jejuni serum.Testing result shows, streptococcus suis 2-type antibody test reagent strip and the equal no cross reaction of above-mentioned various control serum.
Susceptibility detects: as positive quality control product, the result shows that this product limit of identification is 1:40 with the streptococcus suis 2-type rh agglutinating serum.
Embodiment 4: detection method (referring to Fig. 2)
Sample to be checked (whole blood, serum or blood plasma) 100-150ul directly is added dropwise to embodiment 2 test strips " 4 " locates, sample liquid is up along film, 10-15 minute sentence read result.
The result:
As containing Streptococcus suis antibody in the sample, then with test strips on the streptococcus suis 2 type specific antigen of colloid gold label form corresponding compound, up be coated on nitrocellulose membrane on the streptococcus suis 2 type specific antigen combine and form red lines, promptly in T place formation red stripes.
No matter whether contain corresponding antibody, the streptococcus suis 2 type specific antigen of colloid gold label continues upwards to creep and is coated on the polyclonal antibody of anti-streptococcus suis 2 type specific antigens on the film, in conjunction with forming the red precipitate line, promptly locate to form red stripes at " C ".This line is a nature controlling line, loses efficacy as collaurum, and this line just can not occur, and illustrates that test strips lost efficacy.
Sequence table
＜110〉Beijing Zhuangdi Haohe Biomedicine Science and Technology Co., Ltd
＜120〉a kind of streptococcus suis 2-type colloidal gold fast detecting test paper strip
<130>
<160>2
<170>PatentIn?version?3.3
<210>1
<211>26
<212>DNA
＜213〉artificial sequence
<400>1
<210>2
<211>27
<212>DNA
＜213〉artificial sequence
<400>2
Claims (8)
1, a kind of test strip comprises that reaction film and bond discharge pad, described reaction film have bag by the detection band of streptococcus suis 2 type specific antigen MRP and bag by the quality control band of the polyclonal antibody of anti-streptococcus suis 2 type specific antigens; Described bond discharges the streptococcus suis 2 type specific antigen MRP that pad is coated with colloid gold label.
2, test strips as claimed in claim 1 is characterized in that, described streptococcus suis 2 type specific antigen MRP prepares by prokaryotic expression.
3, test strips as claimed in claim 1 or 2 is characterized in that, the package amount of streptococcus suis 2 type specific antigen MRP is 3-4mg/ml.
4, test strips as claimed in claim 1 or 2 is characterized in that, described reaction film is a nitrocellulose filter.
5, test strips as claimed in claim 1 or 2 is characterized in that, described bond discharges pad and is glass fibre membrane.
6, a kind of method for preparing each described test strips of claim 1～5 comprises the steps:
1) preparation streptococcus suis 2 type specific antigen MRP and its polyclonal antibody;
2) antigen and the polyclonal antibody bag with the step 1) preparation formed detection line and nature controlling line respectively to reaction film, and be standby;
3) the streptococcus suis 2 type specific antigen MRP with colloid gold label wraps by to the bond pad, and is standby;
4) with 2) and 3) bond for preparing discharges pad, reaction film and sample pad, adsorptive pads and reaction holder and be assembled into test card.
7, method as claimed in claim 6 is characterized in that, the method that described step 1) prepares streptococcus suis 2 type specific antigen MRP is by prokaryotic expression, and expression product is obtained behind affinitive layer purification.
8, the application of the arbitrary described test strips of claim 1-5 in detecting streptococcus suis 2-type.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008101127201A CN101363854A (en) | 2008-05-26 | 2008-05-26 | Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008101127201A CN101363854A (en) | 2008-05-26 | 2008-05-26 | Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101363854A true CN101363854A (en) | 2009-02-11 |
Family
ID=40390335
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008101127201A Pending CN101363854A (en) | 2008-05-26 | 2008-05-26 | Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101363854A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101900729A (en) * | 2009-05-29 | 2010-12-01 | 杨圣佐 | Test paper for detecting streptococcus suis, and preparation method and application thereof |
-
2008
- 2008-05-26 CN CNA2008101127201A patent/CN101363854A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101900729A (en) * | 2009-05-29 | 2010-12-01 | 杨圣佐 | Test paper for detecting streptococcus suis, and preparation method and application thereof |
| CN101900729B (en) * | 2009-05-29 | 2014-10-29 | 杨圣佐 | Test paper for detecting streptococcus suis, and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111217920B (en) | N-S dominant epitope fusion protein of new coronavirus, preparation method and application thereof, expression protein, microorganism, application thereof and kit | |
| CN110658339B (en) | Test paper and kit for detecting African swine fever virus and preparation method thereof | |
| CN105203754B (en) | Method and kit for fast detection of moraxella catarrhalis based on magnetic resolution and quantum dot labelling | |
| Oeding | Antigenic properties of Staphylococcus aureus | |
| CN105384803B (en) | A kind of Schistosoma japonicum recombinant protein SjSAPLP4 and its encoding gene and application | |
| CN101363859B (en) | Test paper strip for rapidly detecting brucellosis antibody | |
| CN103059109B (en) | Mycoplasma pneumonia antigen, preparation method and immunodetection kit | |
| CN104316703B (en) | A kind of Mycoplasma bovis test strip and its preparation method | |
| CN102731615A (en) | Detection reagent and detection method for PRRSV | |
| CN101363858B (en) | Test paper strip for detecting PRRSV antibody colloidal gold, method for making same and applications | |
| CN105061602B (en) | For detecting fusion protein, the preparation method and application of anti-pig enterotoxigenic escherichia coil antibody | |
| WO2006108033A2 (en) | Recombinant antigens for the detection of coxiella burnetii | |
| CN103235119A (en) | A diagnosis antigen for Toxoplasma gondii infection and a preparation method and applications thereof | |
| CN101363865B (en) | Test paper strip for detecting PRRSV antibody colloidal gold, method for making same and application | |
| CN101363864B (en) | Test paper strip for detecting encephalitis virus specificity IgG antibody, method for making same and applications | |
| Tsang et al. | Serological diagnosis of typhoid fever by counterimmunoelectrophoresis. | |
| CN110824163A (en) | Colloidal gold test strip and reagent card for simultaneously detecting deer's disease and tuberculosis | |
| CN101363863A (en) | Test paper strip for detecting swine chain coccus type 2 antibody colloidal gold, method for making same and applications | |
| CN105223352B (en) | Method and kit for rapidly detecting human haemophilus influenzae based on magnetic separation and quantum dot labelling | |
| Yousef et al. | Clinical and research application of an enterovirus group-reactive monoclonal antibody | |
| CN101363854A (en) | Test paper strip for rapidly detecting swine streptococcicosis type 2 colloidal gold | |
| CN102033128A (en) | Edwardsiella tarda rapid detection test paper as well as rapid detection method and application | |
| CN101363862A (en) | Test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold | |
| CN101363866B (en) | Test paper strip for detecting encephalitis virus IgM antibody colloidal gold, method for making same and applications | |
| KR20200081619A (en) | Kit for diagnosing dengue hemorrhagic fever |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20090211 |