CN101358201A - Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof - Google Patents
Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof Download PDFInfo
- Publication number
- CN101358201A CN101358201A CNA200710075462XA CN200710075462A CN101358201A CN 101358201 A CN101358201 A CN 101358201A CN A200710075462X A CNA200710075462X A CN A200710075462XA CN 200710075462 A CN200710075462 A CN 200710075462A CN 101358201 A CN101358201 A CN 101358201A
- Authority
- CN
- China
- Prior art keywords
- adenovirus
- iron
- regulatory hormone
- gene
- human iron
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The present invention discloses a recombinant human hepcidin adenovirus (Ad-hepc), which contains human hepcidin gene and adenovirus vector. The present invention also discloses a preparation of the recombinant human hepcidin adenovirus and an application thereof. The present invention utilizes defective adenovirus to deliver the human hepcidin gene into the tissue cells of the body, so that the virus can express hepcidin protein in the body of a patient.
Description
Technical field
The present invention relates to gene engineering technology field, particularly relate to a kind of utilize recombinant adenoviral vector to carry human iron-regulatory hormone (Hepcidin) thus gene can independently be expressed recombinant human iron-regulatory hormone adenovirus, its preparation method and the application that iron is transferred fibroin in vivo.
Background technology
It is an antimicrobial polypeptide that is rich in halfcystine that iron is transferred plain (Hepcidin).People such as calendar year 2001 Park are separated to this polypeptide first from people's urine, and its called after iron are transferred plain.Human iron-regulatory hormone includes 20,22 and 25 three kinds of composition forms such as amino acid polypeptide.25 amino acid polypeptides are that iron is transferred plain main existence form.Iron transfers plain gene to be positioned on people's No. 19 karyomit(e), is made up of three exons and two introns, and the mRNA after transcribing is about and is 0.4kb.The analytical results of Northern Bolt shows that iron transfers plain gene at the liver specifically expressing, and heart, spinal cord, lung are expressed seldom, and prostate gland, testis, ovary, small intestine, colon, kidney and bladder are not almost expressed.
Most important breakthrough in the iron metabolism field after iron accent understanding plain and effect in iron is regulated is to enter 21 century.No matter all kinds of anaemias and high iron load relative disease are still treated in clinical diagnosis, its meaning all is huge.Big quantity research comprises that our result is verified, participate in iron metabolism such as absorption of small intestine iron and liver in peripheral tissues, the albumen of reticulocyte and RE system iron transfer, as carrying ferritin (Tf, Transferrin) and acceptor (TfR, Transferrin Receptor), cytochrome b (Dcytb, Duodenal Cytochrome b), divalent-metal ion translocator (DMT1, Divalent MetalTransporter 1), film iron transfer albumen 1 (FP1, Ferroportin 1), copper-protein (CP, Ceruloplasmin) and film iron transfer accessory protein (HP Hephaestin) all has expression in brain.
We are nearest discovers and has at first reported brain in the world and had the ability to express iron and transfer plain.Our experiment shows tentatively that also intracerebral ventricle injection iron transfers element can reduce iron level in the brain, illustrate that iron transfers element can regulate the brain iron metabolism, the keeping of participation brain iron balance.These results show that also exogenous iron accent element may have effective reduction because of the brain iron that increases unusually that a variety of causes causes, reaches the purpose of control nerve degenerative diseases.This project is transferred systematic study intracerebral ventricle injection iron plain to iron level in the Parkinson's disease animal model brain, and the influence of main iron being absorbed albumen (carrying ferritin acceptor and divalent-metal ion translocator 1) and iron release albumen (film iron transfer albumen 1, film iron transfer accessory protein and copper-protein) expression.Finish that we are nearest to discover and at first reported brain in the world and had the ability to express iron and transfer plain.Our experiment shows tentatively that also intracerebral ventricle injection iron transfers element can reduce iron level in the brain, illustrate that iron transfers element can regulate the brain iron metabolism, the keeping of participation brain iron balance.As far back as 1991, we have found that the imbalance and the iron inductive oxidative stress of brain iron, be the major incentive that promotes neurodegeneration.
Experimental data shows, the imbalance of brain iron is some nerve degenerative diseases (one of reason that starts of) onset for example: Parkinson's disease PD and senile dementia AD at least.Iron transfers plain (Hepcidin) will become a kind of new medicine of treatment iron metabolism disorders (disease that any kind iron overload causes).Yet the iron accent is plain because molecular weight of albumen is little, and has 4 disulfide linkage, causes occurring problems such as preparation purification difficult and easy degraded, has greatly limited its range of application as medicine.
Summary of the invention
Purpose of the present invention is exactly the problems referred to above at prior art, thereby provides a kind of iron of can independently expressing in vivo to transfer fibroin to promote the recombinant human iron-regulatory hormone adenovirus of plain (hepcidin) level of iron accent in the body.
Another object of the present invention is to provide the preparation method of above-mentioned recombinant human iron-regulatory hormone adenovirus.
A further object of the present invention is to provide the application of above-mentioned recombinant human iron-regulatory hormone adenovirus aspect the preparation medicine.
For achieving the above object, the present invention has adopted following technical scheme:
The invention discloses a kind of recombinant human iron-regulatory hormone adenovirus (Ad-hepc), it includes human iron-regulatory hormone (hepcidin) gene and adenovirus carrier.
Described human iron-regulatory hormone gene inserts in the described adenoviral gene group.
Described human iron-regulatory hormone gene is a secretor type human iron-regulatory hormone gene.
Described human iron-regulatory hormone expression of gene reading frame comprises the polyA signal in cytomegalovirus (CMV) promotor, secretor type human iron-regulatory hormone (hepcidin) gene and downstream.
Described human iron-regulatory hormone gene contains the sequence shown in the Seq ID No.1 in the ordered list.
Described adenovirus is a defective adenoviral.
Described adenovirus is 1 type adenovirus.
Described adenovirus is the defective adenoviral that has lacked the E1 district.
The invention also discloses the preparation method of above-mentioned recombinant human iron-regulatory hormone adenovirus, described method comprises:
A, human iron-regulatory hormone (hepcidin) gene is connected with the Ad-track shuttle plasmid of described adenovirus makes up the Ad-track-hepcidin recombinant vectors;
B, make the linearizing of described Ad-track-hepcidin recombinant vectors;
The skeleton plasmid transformed competence colibacillus cell of c, adenovirus;
D, Ad-track-hepcidin and adenovirus skeleton plasmid carry out homologous recombination;
E, make the viral skeleton plasmid linearizing of reorganization after transfectional cell carry out the virus packing.
Wherein the cell of step e is preferably the HEK293 cell.
The present invention further discloses above-mentioned recombinant human iron-regulatory hormone adenovirus and be used for the treatment of application in the medicine of iron metabolism disorders in preparation.
Preferably, the disease that described iron metabolism disorders causes for any kind iron overload, perhaps described iron metabolism disorders is the hypoferric anemia of any kind.
Owing to adopted above technical scheme, made the present invention possess following technique effect:
The present invention utilizes defective adenoviral that human iron-regulatory hormone (hepcidin) gene is introduced the body tissue cell, makes virus can independently express iron in patient's body and transfers fibroin.This method can overcome the exogenous protein instability, activity is low, cost is high and shortcoming such as immunogenicity, and the natural characteristic that can keep protein secondary and senior space structure makes this therapy become the treatment approach that Most patients can be accepted and have the ability to pay.
Utilize defective adenoviral as carrier, have the following advantages:
1. the adenovirus carrier technical process is simple, the virus titer height;
2. adenovirus carrier transfection efficiency height, operability is good;
3. the adenovirus carrier host range is wide, and is safe and reliable, pathogenic low;
4. a little less than the adenovirus carrier immune response, exogenous gene expression is stable lasting;
5. transfer plain (hepcidin) to efficiently express by CMV promotor control iron, serum levels of iron level in the control agent;
6. owing to autonomous expressing protein in eukaryotic cell, its product has the conception of native protein with active, can simulate natural expression fully.
Description of drawings
Fig. 1 is the multiple clone site figure of adenovirus shuttle plasmid;
Fig. 2 is recombinant human iron-regulatory hormone (hepcidin) technological process of production figure;
Fig. 3 is Ad-hepc systematic protein expression figure;
Fig. 4 is to be mark with GFP, observes Ad-hepc system cells infected situation map;
Fig. 5 makes up high serum levels of iron animal model and utilizes the Ad-hepc system to carry out the interior serum levels of iron level of testing of body figure as a result.
Fig. 6 be make up high serum levels of iron animal model and utilize that the Ad-hepc system carries out experiment in the body organize iron level figure as a result.
Fig. 7 is that the insertion sequence of Ad-hepc among the embodiment 2 is measured report.
Embodiment
The present invention is directed to iron and transfer the plain recombinant adenovirus expression system (Ad-hepc) that makes up, promote the level that iron is transferred plain (hepcidin) in the body, the concentration of serum levels of iron in the control agent reduces the toxicity of iron for cell, reaches the purpose of iron metabolism relative diseases such as treatment nerve degenerative diseases.
Recombinant human iron-regulatory hormone adenovirus of the present invention (Ad-hepc) comprises and contains secretor type human iron-regulatory hormone gene and defective adenoviral.Defective adenoviral be 1 type adenovirus (Adeasy-1, Ad1).
In the preferred embodiment of the present invention, to have selected to make up iron and transferred plain recombinant adenovirus, its carrier system is Adeasy-1.Adeasy-1 is the skeleton plasmid of defective adenovirus, by its shuttle plasmid Ad-track-CMV allogenic gene and viral skeleton is integrated, and has extensive infective recombinant adenovirus thereby pack out.Pack successful recombinant adenovirus reproducible not in general cell, have advantages such as safe, efficient, simple.
The Ad-hepc structure: recombinant human iron-regulatory hormone adenovirus (Ad-hepc) carrier has lacked the E1 district, can not be packaged as ripe virion in ordinary cells, is defective virus.Human iron-regulatory hormone (hepcidin) gene is a goal gene.We secrete sections with the people and transfer plain gene to insert in the genome of virus, are its promotor with two CMV, and green fluorescent protein (GFP) is its marker, and downstream polyA tail is its termination signal district.
Goal gene human iron-regulatory hormone gene of the present invention contains the sequence shown in the Seq ID No.1 in the ordered list.
Recombinant human iron-regulatory hormone adenovirus (Ad-hepc) technological process of production comprises: construction of recombinant vector, carrier linearizing preparation, transfection HEK293 cell, enlarged culturing, separation and purification, lyophilize and packaged preparation.
Particularly, recombinant human iron-regulatory hormone adenovirus (Ad-hepc) technological process of production comprises:
A, human iron-regulatory hormone (hepcidin) gene is connected with the Ad-track shuttle plasmid of described adenovirus makes up the Ad-track-hepcidin recombinant vectors;
B, make the linearizing of described Ad-track-hepcidin recombinant vectors;
The skeleton plasmid transformed competence colibacillus cell of c, adenovirus;
D, Ad-track-hepcidin and adenovirus skeleton plasmid carry out homologous recombination;
E, make the viral skeleton plasmid linearizing of reorganization after transfectional cell carry out the virus packing.
Wherein the cell of step e is preferably the HEK293 cell.
Recombinant human iron-regulatory hormone adenovirus of the present invention can be used for pharmaceutical compositions, and this pharmaceutical composition can be used for treating the iron metabolism disorders, comprises disease and any kind hypoferric anemia that any kind iron overload causes.
When can be used for pharmaceutical compositions, recombinant human iron-regulatory hormone adenovirus of the present invention can be prepared into liquid preparation, meta-alkalescence, and PH 8.0, are white powder after the freeze-drying, can follow water and any mixed, and is tasteless, can be used as injection, spray.
The present invention utilizes defective adenoviral that human iron-regulatory hormone (hepcidin) gene is introduced the body tissue cell, makes virus can independently express iron in patient's body and transfers fibroin.This method can overcome the exogenous protein instability, activity is low, cost is high and shortcoming such as immunogenicity, and the natural characteristic that can keep protein secondary and senior space structure makes this therapy become the treatment approach that Most patients can be accepted and have the ability to pay.
Utilize defective adenoviral as carrier, have the following advantages:
1, the adenovirus carrier technical process is simple, the virus titer height;
2, adenovirus carrier transfection efficiency height, operability is good;
3, the adenovirus carrier host range is wide, and is safe and reliable, pathogenic low;
4, a little less than the adenovirus carrier immune response, exogenous gene expression is stable lasting;
5, transfer plain (hepcidin) to efficiently express by CMV promotor control iron, serum levels of iron level in the control agent;
6, owing to autonomous expressing protein in eukaryotic cell, its product has the conception of native protein with active, can simulate natural expression fully.
The present invention is described in further detail below by specific embodiment.
Iron transfers plain gene to insert reorganization
As shown in Figure 1, pTrack-CMV is the shuttle plasmid of recombinant adenovirus.We transfer the plain gene two ends to connect Bgl II and Sal I restriction enzyme site iron, and add that the polyA tail is as the termination signal district.Enzyme is cut iron and is transferred plain gene and shuttle plasmid, and both are connected conversion with the T4 ligase enzyme, after screening, is correctly cloned, and send the order-checking of order-checking company to identify.
The Ad-hepc structure: recombinant human iron-regulatory hormone adenovirus (Ad-hepc) carrier has lacked the E1 district, can not be packaged as ripe virion in ordinary cells, is defective virus.Human iron-regulatory hormone (hepcidin) gene is a goal gene.We secrete sections with the people and transfer plain gene to insert in the genome of virus, are its promotor with two CMV, and green fluorescent protein (GFP) is its marker, and downstream polyA tail is its termination signal district.
The recombinant human iron-regulatory hormone adenovirus preparation
Recombinant human iron-regulatory hormone adenovirus (Ad-hepc) technological process of production comprises: construction of recombinant vector, carrier linearizing preparation, transfection HEK293 cell, enlarged culturing, separation and purification, lyophilize and packaged preparation.Specifically see the following detailed and technological process of production figure (see figure 2).
1, goal gene hepcidin's obtains
With contain people's gene group cDNA as template, Pfu high-fidelity enzyme pcr amplification.The hot amplification condition of PCR is 95 ℃ of sex change 5min, 95 ℃ of 80s, 58 ℃ of 100s, 72 ℃ of 120s, 30 circulations, last 72 ℃ of insulation 5min.The about 450bp of product.
Its primer sequence is:
Upstream primer (Seq ID No.2):
CTCAC?AGATCT?GACAGAAGGCAAGATGGCACTAAG
Downstream primer (Seq ID No.3):
TCAAT?GTCGAC?GCTGGGGTAGGACAGGAATAAATA
The PCR reaction conditions is as follows:
Sterilized water 38 μ l
10x?PCR?Buffer 5μl
4x?dNTP 4μl
Primer 11 μ l
Primer 21 μ l
Template 0.5 μ l
Pfu polysaccharase 0.5 μ l
Cumulative volume: 50 μ
2, the structure of Ad-track-hepcidin shuttle plasmid
A. double digestion PCR product and Ad-track plasmid, 37 ℃ of enzymes are cut and are spent the night.It is as follows that enzyme is cut system construction:
10x?buffer 10μl
ddH2O 60μl
Bgl-II 5μl
Sal-I 5μl
Ad-track plasmid 20 μ l
10x?buffer 10μl
ddH2O 60μl
Bgl-II 5μl
Sal-I 5μl
It is disconnected that B.QIAquick Gel extraction kit test kit method gel reclaims the enzyme section;
C.0.8% agarose gel electrophoresis utilizes quantitative Marker nucleic acid concentration according to a preliminary estimate;
The D.T4 ligase enzyme spends the night for 4 ℃, connects gel and reclaims PCR product and digested plasmid, and linked system is as follows:
Ad-track plasmid enzyme restriction segment 5 μ l
The disconnected 7 μ l of PCR product enzyme section
10x?buffer 2μl
ddH2O 4.5μl
T4 ligase enzyme 1.5 μ l
Annotate: elder generation adds dna segment and ddH2O, and 45 ℃ of temperature are bathed 5min, and all reagent add preceding in 0 ℃ of precooling.
E. will connect product and be transformed in the DH-5 α competence bacterium 37 ℃ of 16h that spend the night of coated plate;
F. the less clone of each dull and stereotyped picking next day is 10, and method is extracted plasmid in a small amount;
G. double digestion recombinant plasmid;
H. enzyme is cut product 5% polyacrylamide gel electrophoresis, and silver dyes colour developing;
I. select the clonal expansion that cuts out corresponding small pieces, extract plasmid;
J. preserve bacterial classification and plasmid, the feeding sample order-checking identifies that the result is consistent with expection, as shown in Figure 7.
3, Pme-I linearizing recombinant plasmid
Utilize Pme-I restriction endonuclease linearizing shuttle plasmid, gel reclaims linearization segment.
The enzyme cutting system makes up as follows:
10x?buffer 5μl
100x?BSA 0.5μl
Plasmid DNA 25 μ l
Pme-I 1μl
ddH2O 18.5μl
4, the Adeasy-1 plasmid transforms BJ5183, makes up the Ad-BJ5183 bacterial strain
A. use the aseptic suction nozzle of refrigerative, draw BJ5183 competent cell 200 μ l to aseptic centrifuge tube;
B. proportionally dilute the Adeasy-1 plasmid;
C. get in the 10 μ l adding competent cell for every group;
D. mixing content, ice bath 30min;
E. pipe is put in 42 ℃ of circulator baths, exactly placed 90s, do not shake;
F. go in the ice bath cooling 2min rapidly;
G. every pipe adds 800 μ l antibiotic-free LB substratum; 37 ℃ slow (45rpm) 45min that vibrates;
H. get 200 μ l to the LB agar plate that contains penbritin, evenly be coated with bacterium liquid;
I. be inverted flat board, 37 ℃, 16h.
J. next day observations, see whether growth bacterium colony number consistent with concentration gradient.
5, Ad-track-hepcidin shuttle plasmid and Adeasy-1 homologous recombination
A. goal gene is inserted the multiple clone site of shuttle vectors, Transformed E .coli-DH5 α, shop kalamycin resistance LB flat board, picking clone is inoculated in the 5ml kalamycin resistance LB liquid nutrient medium, and 37 ℃ jolt and spend the night, extract plasmid inferior morning, PCR or enzyme are cut evaluation.
B. the shuttle plasmid of Ti Quing is cut through the Pme-I enzyme and is spent the night, fully linearizing (incomplete digestion often produces higher background, thereby reduces recombination fraction, and the linearization plasmid dephosphorylation is helped to reduce background signal), gel-purified.
C. the linearized vector that reclaims is changed in the Ad-BJ5183 competent cell, shop kalamycin resistance LB flat board places in 37 ℃ of incubators and cultivated 14-16 hour.
D. the less clone 15-20 of picking, be inoculated among that resistance liquid of card LB substratum 5ml, 37 ℃ jolt and spend the night.Receive bacterium inferior morning, extract plasmid immediately, enzyme is cut evaluation, selects the successfully clone of reorganization, a large amount of amplifications, called after Ad-hepcidin.
6, viral skeleton Pac-I linearizing
Utilize the above-mentioned viral skeleton plasmid of Pac-I restriction endonuclease linearizing, 37 ℃ of enzymes are cut and are spent the night, so as in the 293A cell packaging virus.It is as follows that enzyme is cut system construction:
10x?buffer 5μl
100xBSA 0.5μl
Pac-I 1μl
Ad-hepcidin?DNA 40μl
ddH2O 3.5μl
7, viral skeleton is identified and the purifying sterilization
Get 10 linearization of μ l virus skeleton double digestion and identify that system is ditto described.
Purifying enzyme is cut product after identifying:
A. collect the multitube enzyme and cut product, equal-volume phenol-chloroform extracting 2 times;
B. the independent extracting of equal-volume chloroform is 1 time;
C. the dehydrated alcohols that add 1/10 volume 3M NaAC (PH5.2) and 2.5 times of volumes ice, as for-80 ℃ 1 hour;
D.4 ℃, 16000r/min, centrifugal 10min;
E. ice-cold 75% washing with alcohol precipitation, 4 ℃ of placements are spent the night;
F.4 ℃, 12000r/min, centrifugal 5min moves on the super clean bench and operates;
G. abandon supernatant, dry 15min under the gnotobasis;
H.50 the aseptic ddH2O dissolution precipitation of μ l;
I. get 2 μ l electrophoresis, measure nucleic acid concentration.
8, virus packing
A. linearization plasmid is transfected into the HEK292 cell;
B. place about 15 days, changed liquid once every 3 days.Treat that cell comet formation fluorescence occurs and receives poison;
C. a large amount of amplicon virus, cultivate the cell concentration of 100 9cm culture dish approximately after, gradient centrifugation purification exceeds the speed limit;
D. titre is measured in the dialysis back, is stored in-80 degree after the packing.
Embodiment 3
The Ad-hepc system infects and expresses and test
1, inoculation C6 cell 1.5X10
7Individual cell is cultivated in (Corning) in 9cm, and 37 ℃, 5%CO
2Overnight incubation;
2, change the 5ml serum free medium before the infection;
3, each culture dish adds the purified virus for preparing among the 0.5ul embodiment 2;
4, cultivate 0h, 6h, 12h, 24h, 48h respectively
5, according to time point collecting cell;
6, Real-time PCR detection by quantitative different time points iron is transferred plain expression;
7, statistics.
The result is shown in Fig. 3,4, and iron transfers element to express 8.1 times that have reached the blank group about 12 hours, and continuous expression.
Embodiment 4
Experiment in the Ad-hepc body (serum levels of iron is measured with organizing iron)
1. select male female each 10 of 3 monthly age SD rats, be divided into two groups at random by sex;
2. two groups of experimental mouse were all fed 3 months with high ferro feed (available from SIGMA), made up high serum levels of iron rat model, and measured serum iron;
3. experimental group is injected Ad-hepc viral dilution liquid, and each dosage is about 1X10
12Individual virion was injected once in per 3 days, and 3 times is a course of treatment; Control group injection PBS isotonic saline solution;
4. after finishing a course of treatment,, utilize biochemical instrument to measure serum iron according to a conventional method respectively at 3,6,9,12,15,18 days extraction serum.
5. put to death rat at last, dirty, the cerebral tissue sample of coring respectively utilizes survey ferron box to measure and organizes iron level after the freeze-drying.
Found that since the 6th day, the experimental group serum iron began to descend, reached the normal serum iron level in 12 days.Organizing iron to measure the iron-holder of organizing that shows experimental group significantly reduces.Result such as Fig. 5, shown in Figure 6.
Above content be in conjunction with concrete preferred implementation to further describing that the present invention did, can not assert that concrete enforcement of the present invention is confined to these explanations.For the general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, can also make some simple deduction or replace, all should be considered as belonging to protection scope of the present invention.
Sequence table
＜110〉Qian Zhongming
Ge Xiaohu
Ke Ya
Wang Chengyuan
＜120〉recombinant human iron-regulatory hormone adenovirus, its preparation method and application
<130>0710198PJE
<160>3
<170>PatentIn?version?3.3
<210>1
<211>255
<212>DNA
<213>Homo?sapiens
<400>1
atggcactga?gctcccagat?ctgggccgct?tgcctcctgc?tcctcctcct?cctcgccagc 60
ctgaccagtg?gctctgtttt?cccacaacag?acgggacaac?ttgcagagct?gcaaccccag 120
gacagagctg?gagccagggc?cagctggatg?cccatgttcc?agaggcgaag?gaggcgagac 180
acccacttcc?ccatctgcat?tttctgctgc?ggctgctgtc?atcgatcaaa?gtgtgggatg 240
tgctgcaaga?cgtag 255
<210>2
<211>35
<212>DNA
＜213〉artificial sequence
<400>2
ctcacagatc?tgacagaagg?caagatggca?ctaag 35
<210>3
<211>35
<212>DNA
＜213〉artificial sequence
<400>3
tcaatgtcga?cgctggggta?ggacaggaat?aaata 35
Claims (10)
1, a kind of recombinant human iron-regulatory hormone adenovirus (Ad-hepc) is characterized in that: include human iron-regulatory hormone (hepcidin) gene and adenovirus carrier.
2, a kind of recombinant human iron-regulatory hormone adenovirus according to claim 1 is characterized in that: described human iron-regulatory hormone gene inserts in the described adenoviral gene group.
3, a kind of recombinant human iron-regulatory hormone adenovirus according to claim 1 and 2 is characterized in that: described human iron-regulatory hormone gene is a secretor type human iron-regulatory hormone gene.
4, a kind of recombinant human iron-regulatory hormone adenovirus according to claim 3 is characterized in that: described human iron-regulatory hormone expression of gene reading frame comprises the polyA signal in cytomegalovirus (CMV) promotor, secretor type human iron-regulatory hormone (hepcidin) gene and downstream.
5, a kind of recombinant human iron-regulatory hormone adenovirus according to claim 1 and 2 is characterized in that: described adenovirus is a defective adenoviral.
6, a kind of recombinant human iron-regulatory hormone adenovirus according to claim 5 is characterized in that: described adenovirus is 1 type adenovirus.
7, a kind of recombinant human iron-regulatory hormone adenovirus according to claim 5 is characterized in that: described adenovirus is the defective adenoviral that has lacked the E1 district.
8, the preparation method of any described recombinant human iron-regulatory hormone adenovirus in the claim 1～7, described method comprises:
A, human iron-regulatory hormone (hepcidin) gene is connected with the Ad-track shuttle plasmid of described adenovirus makes up the Ad-track-hepcidin recombinant vectors;
B, make the linearizing of described Ad-track-hepcidin recombinant vectors;
The skeleton plasmid transformed competence colibacillus cell of c, adenovirus;
D, Ad-track-hepcidin and adenovirus skeleton plasmid carry out homologous recombination;
E, make the viral skeleton plasmid linearizing of reorganization after transfectional cell carry out the virus packing.
9, any described recombinant human iron-regulatory hormone adenovirus is used for the treatment of application in the medicine of iron metabolism disorders in preparation in the claim 1～7.
10, application according to claim 9 is characterized in that: described iron metabolism disorders is the disease that the iron overload causes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200710075462XA CN101358201A (en) | 2007-07-31 | 2007-07-31 | Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200710075462XA CN101358201A (en) | 2007-07-31 | 2007-07-31 | Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101358201A true CN101358201A (en) | 2009-02-04 |
Family
ID=40330799
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA200710075462XA Pending CN101358201A (en) | 2007-07-31 | 2007-07-31 | Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101358201A (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012163286A1 (en) * | 2011-06-03 | 2012-12-06 | 国家纳米科学中心 | Method and kit for detecting hepcidin |
| CN103251932A (en) * | 2013-04-17 | 2013-08-21 | 钱忠明 | Application of hepcidin in preparation of medicine for treating iron-associated neurodegenerative diseases |
| CN107075574A (en) * | 2014-06-27 | 2017-08-18 | 领导医疗有限公司 | Hepcidin and Mini-hepcidin analog and application thereof |
| US10787490B2 (en) | 2015-07-15 | 2020-09-29 | Protaganist Therapeutics, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| US10941183B2 (en) | 2014-07-17 | 2021-03-09 | Protagonist Therapeutics, Inc. | Oral peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory bowel diseases |
| US11041000B2 (en) | 2019-07-10 | 2021-06-22 | Protagonist Therapeutics, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| US11111272B2 (en) | 2014-10-01 | 2021-09-07 | Protagonist Therapeutics, Inc. | α4α7 peptide monomer and dimer antagonists |
| US11472842B2 (en) | 2015-12-30 | 2022-10-18 | Protagonist Therapeutics, Inc. | Analogues of hepcidin mimetics with improved in vivo half lives |
| US11753443B2 (en) | 2018-02-08 | 2023-09-12 | Protagonist Therapeutics, Inc. | Conjugated hepcidin mimetics |
| US11807674B2 (en) | 2013-03-15 | 2023-11-07 | Protagonist Therapeutics, Inc. | Hepcidin analogues and uses thereof |
| US11840581B2 (en) | 2014-05-16 | 2023-12-12 | Protagonist Therapeutics, Inc. | α4β7 thioether peptide dimer antagonists |
| US11845808B2 (en) | 2020-01-15 | 2023-12-19 | Janssen Biotech, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| US11939361B2 (en) | 2020-11-20 | 2024-03-26 | Janssen Pharmaceutica Nv | Compositions of peptide inhibitors of Interleukin-23 receptor |
-
2007
- 2007-07-31 CN CNA200710075462XA patent/CN101358201A/en active Pending
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9196465B2 (en) | 2011-06-03 | 2015-11-24 | National Center For Nanoscience And Technology | Method and kit for detecting hepcidin |
| WO2012163286A1 (en) * | 2011-06-03 | 2012-12-06 | 国家纳米科学中心 | Method and kit for detecting hepcidin |
| US11807674B2 (en) | 2013-03-15 | 2023-11-07 | Protagonist Therapeutics, Inc. | Hepcidin analogues and uses thereof |
| CN103251932A (en) * | 2013-04-17 | 2013-08-21 | 钱忠明 | Application of hepcidin in preparation of medicine for treating iron-associated neurodegenerative diseases |
| US11840581B2 (en) | 2014-05-16 | 2023-12-12 | Protagonist Therapeutics, Inc. | α4β7 thioether peptide dimer antagonists |
| CN107075574A (en) * | 2014-06-27 | 2017-08-18 | 领导医疗有限公司 | Hepcidin and Mini-hepcidin analog and application thereof |
| US10941183B2 (en) | 2014-07-17 | 2021-03-09 | Protagonist Therapeutics, Inc. | Oral peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory bowel diseases |
| US11884748B2 (en) | 2014-07-17 | 2024-01-30 | Protagonist Therapeutics, Inc. | Oral peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory bowel diseases |
| US11111272B2 (en) | 2014-10-01 | 2021-09-07 | Protagonist Therapeutics, Inc. | α4α7 peptide monomer and dimer antagonists |
| US10787490B2 (en) | 2015-07-15 | 2020-09-29 | Protaganist Therapeutics, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| US11472842B2 (en) | 2015-12-30 | 2022-10-18 | Protagonist Therapeutics, Inc. | Analogues of hepcidin mimetics with improved in vivo half lives |
| US11753443B2 (en) | 2018-02-08 | 2023-09-12 | Protagonist Therapeutics, Inc. | Conjugated hepcidin mimetics |
| US11041000B2 (en) | 2019-07-10 | 2021-06-22 | Protagonist Therapeutics, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| US11845808B2 (en) | 2020-01-15 | 2023-12-19 | Janssen Biotech, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| US11939361B2 (en) | 2020-11-20 | 2024-03-26 | Janssen Pharmaceutica Nv | Compositions of peptide inhibitors of Interleukin-23 receptor |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101358201A (en) | Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof | |
| CN107893076A (en) | CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA | |
| CN102174468A (en) | Method and application for inducing human umbilical cord mesenchyme stem cells to be differentiated into testicular interstitial cells | |
| CN104321426A (en) | Immortalized stem cells and medicinal composition and medicinal preparation comprising product thereof as active ingredient | |
| CN102344906A (en) | Hair follicle stem cell separation culture method | |
| CN107586759A (en) | A kind of construction method of recombinant Newcastle disease virus and application | |
| CN108588026A (en) | The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10 | |
| CN106434542A (en) | Method for enhancing proliferation and post-transplantation survival ability of adipose derived stem cells | |
| CN108048483A (en) | Science recombined adhenovirus HAdV-5 carrier systems and its application | |
| CN105647872A (en) | Liver injury targeted mesenchymal stem cell and preparation method and application thereof | |
| CN104372024A (en) | Method for inducing bovine fibroblast cells/myoblasts to be trans-differentiated into fat cells | |
| CN107119020A (en) | A kind of hepatic injury targeting mescenchymal stem cell based on miR 9 and preparation method and application | |
| CN101210255B (en) | Recombination ferroportin adenovirus, preparation method and application thereof | |
| CN105925544A (en) | Preparation method and application of 4-1BB-containing lentivirus | |
| CN102660579B (en) | HBx and human IL-12 double-gene recombinant vector and liver caner-resistant vaccine | |
| CN103468725A (en) | Construction and application of PTEN gene overexpression recombinant adenoviral vectors | |
| CN1952160B (en) | Recombinant of intelligent adenovirus vector and khp53 gene and application thereof | |
| CN107236702A (en) | A kind of preparation method of perinatal period Mesenchymal Stem Cells from Umbilical Cord master cell bank | |
| CN101993895A (en) | Construction and application method of efficient double promoter PLEGFP-N1-spMyoD1 green fluorescence retrovirus vector | |
| CN102205112A (en) | BMP composition for synergistic induction of ossification differentiation, and application thereof | |
| CN101481692A (en) | Non-blood serum preparation of recombinant human blood coagulation factor IX | |
| CN101875918A (en) | Recombinant adenovirus of human hephaestin gene, preparation method thereof and application thereof | |
| CN101538557A (en) | Recombinant human divalent metal ion transporter adenovirusm and preparation method and application thereof | |
| CN108795987A (en) | A kind of neural stem cell preparation method and application of FerritinH, Bcl2 and EGFP gene combined modification | |
| CN101613679B (en) | Rhabdovirus with recombination superoxide dismutase gene and preparation and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: HONG KONG POLYTECHNIC UNIVERSITY SHENZHEN INSTITUT Free format text: FORMER OWNER: QIAN ZHONGMING Effective date: 20100108 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20100108 Address after: A216 room, Shenzhen Virtual University Park, Nanshan District Science Park, Guangdong, Shenzhen Province, China: 518057 Applicant after: Shenzhen Inst., Hongkong Science &. Engineering Univ. Address before: Postal code of R2-A6 building, Nanshan District science and Technology Park, Shenzhen, Guangdong, China: 518057 Applicant before: Qian Zhong Ming Co-applicant before: Ge Xiaohu Co-applicant before: Ke Ya Co-applicant before: Wang Chengyuan |
|
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20090204 |