CN101356287A

CN101356287A - Methods and compositions for the assessment of cardiovascular function and disorders

Info

Publication number: CN101356287A
Application number: CNA2006800507772A
Authority: CN
Inventors: R·P·扬
Original assignee: Synergenz Bioscience Ltd
Current assignee: Synergenz Bioscience Ltd
Priority date: 2005-11-10
Filing date: 2006-11-10
Publication date: 2009-01-28

Abstract

The present invention provides methods for the assessment of risk of developing acute coronary syndrome (ACS) in smokers and non-smokers using analysis of genetic polymorphisms. The present invention also relates to the use of genetic polymorphisms in assessing a subject's risk of developing ACS. Nucleotide probes and primers, kits, and microarrays suitable for such assessment are also provided.

Description

Be used to assess the method and composition of cardiovascular function and obstacle

Technical field

The present invention relates to use the analysis of genetic polymorphism and changes in gene expression to be used to assess vascular function and/or obstacle, especially for the diagnosis coronary artery disease especially procatarxis of acute coronary syndrome (ACS) and/or the method for severity.The invention still further relates to and be used to diagnose the procatarxis of the damaged blood vessels function relevant and/or the method for severity with ACS.

Background technology

Coronary artery disease (CAD) also win worry or arteriosclerotic heart disease are the primary causes of death of the U.S..According to American Heart Association, the U.S. approximately per 29 seconds just the someone CAD dependent event takes place, approximately per 1 minute just the someone die from such incident.After 40 years old the male sex the lifelong risk of coronary heart disease takes place is 49%, the women then is 32%.Follow female age to increase, this risk also almost is elevated to the male sex's lifelong risk thereupon.In addition, U.S.'s cost of being used for CAD every year is about 1,300 hundred million dollars.

The cardiovascular disorder that causes CAD can be divided into two groups, and the object of this type of obstacle also can be divided into two classes equally.This has been considered to reflect the different causes of disease of this two classes obstacle.The first group of obstacle that is referred to herein as " stable form CAD " shows as deterioration character, comprises late hair style stenocardia and exertional angina pectoris.Stable form CAD generally involves older person, with age (65 years old and more than), hypertension, diabetes, elevated cholesterol (specifically referring to high LDL cholesterol and low HDL cholesterol), lack motion or take exercise with fat relevant.

Second group of obstacle is referred to herein as acute coronary syndrome (ACS), it is believed that relevant with inflammation, patch unstable and/or smoking.ACS comprises myocardial infarction and unstable angina pectoris.Do not wish to be bound by any theory, the present patent application people thinks that genetic risk factor ratio in ACS susceptibility and/or severity is even more important in stable form CAD.

And, do not wish to be subjected to any theoretical institute fetter equally, the present patent application people thinks that the biomarker relevant with stable form CAD can not be correlated with the ACS risk or predict the ACS risk, vice versa.

Having the risk that can be used for evaluation object generation acute coronary syndrome (ACS) or the biomarker of the risk of the relevant damaged blood vessels function of ACS takes place, is desirable and favourable at this object during for the smoker especially.

The present invention relates generally to described biomarker and the purposes in the method for assessing the risk that this class obstacle takes place thereof.

The invention summary

The present invention relates generally to the contact of determining between genotype and the object generation acute coronary syndrome (ACS).As used herein, ACS includes but not limited to myocardial infarction, unstable angina pectoris and relevant acute coronary syndrome.

Therefore, the method that one aspect of the present invention provides a kind of determination object that the risk of ACS takes place, it comprises whether analysis exists one or more to be selected from down the polymorphism of group from the sample of described object:

The gene of coding chyme enzyme 1 (CMA1)-1903A/G

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

Be encoded into the Ser52Ser (223C/T) of the gene of fibroblast growth factor 2 (FGF2);

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

The 874A/T of the gene of the plain γ of coded interference (IFNG);

The gene of coding interleukin-4 (IL-4)-589C/T;

The gene of coding interleukin 10 (IL-10)-1084A/G (1082);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

The 459C/T Intron I of the gene of coding macrophage inflammatory protein 1 α (MIP1A);

The Asn 125 Ser A/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

The 372T/C of the gene of coding tissue inhibitor of metalloproteinase 1 (TIMP1);

Wherein whether the existence of one or more described polymorphisms shows that the risk of ACS takes place object.

Can directly detect or be in described one or more polymorphisms of one or more polymorphisms detections of linkage disequilibrium by detection and described one or more polymorphisms.

Linkage disequilibrium (LD) is a kind of genetics phenomenon, and wherein two or various mutations or polymorphism genetic distance are nearer, make them can be total to heredity.This means in genotyping, detect the existence that a kind of existence of polymorphism can be known another by inference.(people such as Reich DE; Linkagedisequilibrium in the human genome, Nature 2001,411:199-204.)

This method can comprise that also analysis is from whether existing one or more to be selected from down other polymorphisms of group in the sample of described object:

The gene of coding transforminggrowthfactor-(TGFB1)-509C/T;

The Thr26Asn A/C of the gene of coding lymphotoxin α (LTA);

The Asp299Gly A/G of the gene of coding Toll sample acceptor 4 (TLR4);

The Thr399Ile C/T of the gene of coding TLR4;

Inhibitor-like 1 (the Nuclearfactor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1) gene (NFKBIL1) of the nf of coding B cell κ light chain polypeptide genetic enhancer-63T/A;

The gene of coding platelet derived growth factor receptor α (PDGFRA)-1630Ins/Del (AACTT/Del);

-1607 1G/2G (Del/G) of the gene of coding matrix metalloproteinase 1 (MMP1);

12 IN 5C/T of the gene of coding Thr6 PDGF BB α (PDGFA);

The gene of coding L-glutamic acid-halfcystine ligase enzyme modification subunit (GCLM)-588C/T;

The Ile132Val A/G of the gene of coding olfactory receptor analogue OR13G1 (OR13G1);

The Glu288Val A/T (M/S) of the gene of coding alpha1-antitrypsin (α 1-AT);

K469E A/G in coding intercellular adhesion molecule 1 (ICAM1) gene;

The gene of the coding related transcript 1 of HLA-B (BAT1)-23C/G;

The Glu298Asp G/T of the gene of coding nitricoxide synthase 3 (NOS3);

-668 4G/5G of the gene of coding Type 1 plasminogen activator inhibitor 1 (PAI-1); Or

The gene of coding matrix metalloproteinase 7 (MMP7)-181A/G.

Equally, can directly or by detecting the polymorphism that is in linkage disequilibrium with described one or more other polymorphisms carry out the detection of described one or more other polymorphisms.

One or more existence that are selected from down the polymorphism of group may be that the indication that the risk of ACS reduces takes place, and these polymorphisms are:

Ser52Ser (223 C/T) the CC genotype of the gene of coding FGF2;

The Q576R A/GAA genotype of the gene of coding IL4RA;

The Thr26Asn A/C CC genotype of the gene of coding LTA;

The Hom T2437C CC or the CT genotype of the gene of coding HSP70;

The Asp299GlyA/GAG or the GG genotype of the gene of coding TLR4;

The Thr399Ile C/T CT or the TT genotype of the gene of coding TLR4;

874 A/T TT genotype of the gene of coding IFNG;

The gene of coding NFKBIL1-the 63T/AAA genotype;

-1630 Ins/Del (AACTT/Del) Ins/Del or Del/Del genotype of the gene of coding PDGFRA;

-589 C/T CT or the TT genotype of the gene of coding IL-4;

-588 C/T CC genotype of the gene of coding GCLM;

-1084 A/G GG genotype of the gene of coding IL-10;

The K469E A/G AA genotype of the gene of coding ICAM1;

-23 C/G GG genotype of the gene of coding BAT1;

The Glu298Asp G/T GG genotype of the gene of coding NOS3;

The Arg213Gly C/G CG or the GG genotype of the gene of coding SOD3;

-668 4G/5G 5G5G genotype of the gene of coding PAI-1;

-181 A/G GG genotype of the gene of coding MMP7;

The Asn 125 Ser AG or the GG genotype of the gene of coding cathepsin G; Or

372 T/C TT genotype of the gene of coding TIMP1.

One or more existence that are selected from down the polymorphism of group may show that the risk that ACS takes place raises, and these polymorphisms are:

-1903 A/G GG genotype of the gene of coding CMA1;

-509 C/T CC genotype of the gene of coding TGFB1;

-82 A/G GG genotype of the gene of coding MMP12;

Ser52Ser (223C/T) CT or the TT genotype of the gene of coding FGF2;

The Q576R A/G GG genotype of the gene of coding IL4RA;

The Hom T2437C TT genotype of the gene of coding HSP70;

The Asp299Gly A/G AA genotype of the gene of coding TLR4;

The Thr399Ile C/T CC genotype of the gene of coding TLR4;

-1630 Ins/Del (AACTT/Del) Ins Ins (AACTTAACTT) genotype of the gene of coding PDGFRA;

-589 C/T CC genotype of the gene of coding IL4;

-1607 1G/2G (Del/G) Del Del (1G 1G) genotype of the gene of coding MMP1;

12 IN5 C/T TT genotype of the gene of coding PDGFA;

-588 C/T CT or the TT genotype of the gene of coding GCLM;

The Ile132Val A/G AA genotype of the gene of coding OR13G1;

Glu288Val A/T (M/S) AT of the gene of coding for alpha 1-AT or TT (MS or SS) genotype;

The gene of coding MIP1A+459C/T Intron 1 CT or TT genotype;

The Asn 125 Ser AA genotype of the gene of coding cathepsin G;

The I249V TT genotype of the gene of coding CX3CR1;

The Gly 881 Arg G/C CC or the CG genotype of the gene of coding NOD2; Or

372 T/C CC genotype of the gene of coding TIMP1;

The method of the invention is particularly useful for smoker (CS and smoker) in the past.

It should be understood that the polymorphism of two types of the method for the invention discriminatings---promptly relevant polymorphism (can be described as " protectiveness polymorphism ") and the polymorphism (can be described as " susceptibility polymorphism ") that raises and be correlated with the risk that ACS takes place with the risk reduction that ACS takes place.

Therefore, the present invention also provides evaluation object that the method for the risk of ACS takes place, and described method comprises:

Measure whether to exist and reduce relevant at least a protectiveness polymorphism with the risk that ACS takes place; And

Do not exist under at least a protectiveness polymorphism situation, whether mensuration exists and takes place the relevant at least a susceptibility polymorphism of risk rising of ACS;

Wherein the existence of one or more described protectiveness polymorphisms is that the indication that the risk of ACS reduces takes place, and does not have at least a protectiveness polymorphism and exist at least a susceptibility polymorphism then to show the risk that ACS takes place to raise.

Under the preferable case, described at least a protectiveness polymorphism is selected from:

Described at least a susceptibility polymorphism can be selected from:

In a preferred form of the invention, the existence of two or more protectiveness polymorphisms is that the indication that the risk of ACS reduces takes place.

In another preferred form of the present invention, the existence of two or more susceptibility polymorphisms shows that the risk that ACS takes place raises.

In another preferred form of the present invention, no matter whether there are one or more susceptibility polymorphisms, the existence of two or kinds of protect sexual polymorphism shows that the risk that ACS takes place reduces.

On the other hand, the invention provides the method that the risk of ACS takes place determination object, whether described method comprises acquisition results from one or more heredity tests of described object sample, and analyze and exist one or more to be selected from down the polymorphism of organizing among the described result:

-1903 A/G of the gene of coding chyme enzyme 1 (CMA1);

-82 A/G of the gene of coding matrix metalloproteinase 12 (MMP12);

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

The 874A/T of the gene of the plain γ of coded interference (IFNG);

-589 C/T of the gene of coding interleukin-4 (IL-4);

-1084 A/G (1082) of the gene of coding interleukin 10 (IL-10);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

459 C/T Intron I of the gene of coding macrophage inflammatory protein 1 α (MIP1A);

Asn 125 SerA/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

The 372T/C of the gene of coding tissue inhibitor of metalloproteinase 1 (TIMP1); Or

With any in these polymorphisms or multiple one or more polymorphisms that are in linkage disequilibrium;

Show that wherein the result whether one or more described polymorphisms exist is the indication that the risk of ACS takes place object.

On the other hand, the invention provides the method that the risk of ACS takes place determination object, it comprises analyzes the polymorphism that one or more are selected from down group:

-1903 A/G of the gene of coding chyme enzyme 1 (CMA1);

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

Be encoded into the Ser52Ser (223 C/T) of the gene of fibroblast growth factor 2 (FGF2);

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

874 A/T in plain γ (IFNG) gene of coded interference;

-589 C/T of the gene of coding interleukin-4 (IL-4);

-1084 A/G (1082) of the gene of coding interleukin 10 (IL-10);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

-509 C/T of the gene of coding transforminggrowthfactor-(TGFB1);

The Thr26Asn A/C of the gene of coding lymphotoxin α (LTA);

The Asp299Gly A/G of the gene of coding Toll sample acceptor 4 (TLR4);

The Thr399Ile C/T of the gene of coding TLR4;

-63 T/A of the gene of the inhibitor-like 1 (NFKBIL1) of the nf of coding B cell κ light chain polypeptide genetic enhancer;

-1630 Ins/Del (AACTT/Del) of the gene of coding platelet derived growth factor receptor α (PDGFRA);

-1607 1G/2G (Del/G) of the gene of coding matrix metalloproteinase 1 (MMP1);

12 IN 5C/T of the gene of coding Thr6 PDGF BB α (PDGFA);

Coding L-glutamic acid-halfcystine ligase enzyme is modified-588 C/T of the gene of subunit (GCLM);

The Glu288Val A/T (M/S) of the gene of coding alpha1-antitrypsin (α 1-AT);

The K469E A/G of the gene of coding intercellular adhesion molecule 1 (ICAM1);

-23 C/G of the gene of the coding related transcript 1 of HLA-B (BAT1);

The Glu298Asp G/T of the gene of coding nitricoxide synthase 3 (NOS3);

-181 A/G of the gene of coding matrix metalloproteinase 7 (MMP7).

The Asn 125 Ser A/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

With any in these polymorphisms or multiple one or more polymorphisms that are in linkage disequilibrium.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 576th bit codon of the gene of coding IL4RA.

It is the indication that the risk reduction of ACS takes place that glutamine appears at described position.

It is the indication that the risk rising of ACS takes place that arginine appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 26th bit codon of the gene of coding LTA.

It is the indication that the risk reduction of ACS takes place that Threonine appears at described position.

It is the indication that the risk rising of ACS takes place that l-asparagine appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 299th bit codon of the gene of coding TLR4.

It is the indication that the risk reduction of ACS takes place that glycine appears at described position.

It is the indication that the risk rising of ACS takes place that aspartic acid appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid that analyzes now corresponding to the position of the 399th bit codon of the gene of coding TLR4.

It is the indication that the risk reduction of ACS takes place that Isoleucine appears at described position.

It is the indication that the risk rising of ACS takes place that Threonine appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 132nd bit codon of the gene of coding OR13G1.

It is the indication that the risk rising of ACS takes place that Isoleucine appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 288th bit codon of the gene of coding for alpha 1-AT.

It is the indication that the risk rising of ACS takes place that L-glutamic acid appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 496th bit codon of the gene of coding ICAM1.

It is the indication that the risk reduction of ACS takes place that Methionin appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of 298 bit codons of the gene of coding NOS3.

It is the indication that the risk reduction of ACS takes place that L-glutamic acid appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 213rd bit codon of the gene of coding SOD3.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 125th bit codon of the gene of coding cathepsin G.

It is the indication that the risk reduction of ACS takes place that Serine appears at described position.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 249th bit codon of the gene of coding CX3CR1.

In various embodiments, any or multiple aforesaid method comprises the amino acid whose step that analyzes now corresponding to the position of the 881st bit codon of the gene of coding NOD2.

In a preferred form of the invention, in conjunction with the analysis of carrying out the methods described herein risks and assumptions (comprise one or more epidemiology risks and assumptions) relevant with the risk that ACS takes place with one or more.Described epidemiology risks and assumptions includes but not limited to smoking or tobacco smoke exposure, age, sex and ACS family history.

On the other hand, the invention provides the purposes of at least a polymorphism in evaluation object generation ACS risk, wherein said at least a polymorphism is selected from:

-1903 A/G of the gene of coding chyme enzyme 1 (CMA1);

-82 A/G of the gene of coding matrix metalloproteinase 12 (MMP12);

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

874 A/T in plain γ (IFNG) gene of coded interference;

-589 C/T of the gene of coding interleukin-4 (IL-4);

-1084 A/G (1082) of the gene of coding interleukin 10 (IL-10);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

The Asn 125 Ser A/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

Be in one or more polymorphisms of linkage disequilibrium with any described polymorphism.

Randomly, described purposes can be used in combination at least a other polymorphisms that are selected from down group:

The gene of coding transforminggrowthfactor-(TGFB1)-509C/T;

The Thr26Asn A/C of the gene of coding lymphotoxin α (LTA);

The Asp299Gly A/G of the gene of coding Toll sample acceptor 4 (TLR4);

The Thr399Ile C/T of the gene of coding TLR4;

-1607 1G/2G (Del/G) of the gene of coding matrix metalloproteinase 1 (MMP1);

12 IN 5C/T of the gene of coding Thr6 PDGF BB α (PDGFA);

The Glu288Val A/T (M/S) of the gene of coding alpha1-antitrypsin (α 1-AT);

The K469E A/G of the gene of coding intercellular adhesion molecule 1 (ICAM1);

The gene of the coding related transcript 1 of HLA-B (BAT1)-23C/G;

The Glu298Asp G/T of the gene of coding nitricoxide synthase 3 (NOS3);

-668 4G/5G of the gene of coding Type 1 plasminogen activator inhibitor 1 (PAI-1);

-181 A/G of the gene of coding matrix metalloproteinase 7 (MMP7);

Or with these polymorphisms in any or multiple one or more polymorphisms that are in linkage disequilibrium.

On the other hand, the invention provides one group of nucleotide probe and/or primer that is used for the preferred process of the present invention as herein described.Under the preferable case, described nucleotide probe and/or primer are to cross over the probe and/or the primer that maybe can be used to cross over described gene pleiomorphism zone.The present invention also provides one or more nucleotide probes and/or primer, and it contains sequence any in probe as herein described and/or the primer, comprises the sequence that contains any sequence among the SEQ.ID.NO.1 to 124.

Aspect another; the invention provides the nucleic acid microarray that is used for the method for the invention; wherein said microarray comprises base material, described base material present can with the nucleotide sequence of coding one or more susceptibilities as herein described or protectiveness polymorphism or the nucleotide sequence of complementary sequence hybridization with it.

On the other hand; the invention provides the antibody microarray that is used for the method for the invention; wherein said microarray comprises base material; described base material present can with gene expression product bonded antibody; when relevant with susceptibility as herein described or protectiveness polymorphism, described expression of gene can raise or reduce.

On the other hand, the invention provides the method for the object for the treatment of the risk rising that ACS takes place, it is included in genotype or phenotypic level repeats the existence of protectiveness polymorphism and/or the step of functional effect in described object.

Aspect another, the invention provides the method for the object for the treatment of the risk rising that ACS takes place, described object has detectable susceptibility polymorphism, it or raise or reduce certain expression of gene, make the physiologically active concentration of described expressing gene product exceed beyond the normal range for described object age and sex, the physiologically active concentration that described method comprises the described product that recovers genetic expression to the normal range for described object age and sex with interior step.

On the other hand, the invention provides treatment because of there being the method for estimating the polymorphism of ACS susceptible is made the object of the risk rising that ACS takes place, it comprises the functional effect described object from genotype level or the phenotypic level described polymorphism of reverse.

Again on the one hand, the invention provides the method for the object for the treatment of the risk rising that ACS takes place, for described object, determined to be present in the coding MMP12 gene promoter-the GG genotype at 82A/G pleomorphism site place, described method comprises using to described object can regulate the active medicament of described object MMP12.

In one embodiment, described medicament is a kind ofly to increase that one or more tissue inhibitor of metalloproteinase (TIMP) express or active medicament, is preferably among TIMP1, TIMP2, TIMP3 or the TIMP4 one or more expression or activity.In another embodiment, described medicament is a kind of one or more expression that combines MMP with film or active medicaments that reduce.In another embodiment, described medicament is the MMP inhibitor, described MMP inhibitor is selected from 4 under the preferable case, 5-dihydroxyanthraquinone-2-carboxylic acid (AQCA), anthraquinone-mercaptoethylamine (anthraquinyl-mercaptoethyamine), anthraquinone-L-Ala hydroxamic acid (anthraquinyl-alanine hydroxamate) and their derivative.

On the other hand, the invention provides the method for the object for the treatment of the risk rising that ACS takes place, it is for described object, determined to be present in the CC genotype at 372T/C pleomorphism site place in the coding TIMP1 gene, described method comprises using to described object can regulate the active medicament of described object TIMP1.

In one embodiment, described medicament is that a kind of TIMP1 of increasing expresses or active medicament.

On the other hand; the invention provides the method for expression of screening regulatory gene and/or active compound; when described gene is relevant with susceptibility or protectiveness polymorphism; it is expressed and can raise or downward modulation when not relevant with described polymorphism with described gene (expression level compare), and described method comprises the following steps:

Candidate compound is raised with genetic expression or the susceptibility that downward modulation is relevant or the cells contacting of protectiveness polymorphism with containing to be determined; And

Use described candidate compound contact back to measure described expression of gene,

Wherein with before the contact procedure compare, the changes of expression level after the contact procedure represents that described compound regulates described expression of gene and/or active ability.

Under the preferable case, described cell behaviour vascular cell more preferably is people's blood vessel epithelial cell, and it is confirmed to exist described polymorphism by prescreen.

Under the preferable case, described cell comprises and the relevant susceptibility polymorphism of described genetic expression rise that described screening is used to reduce the candidate compound of described genetic expression.

Perhaps, described cell comprises the susceptibility polymorphism relevant with described down regulation of gene expression, and described screening is used to raise the candidate compound of described genetic expression.

In another embodiment, described cell comprises and the relevant protectiveness polymorphism of described genetic expression rise that described screening is used for further raising the candidate compound of described genetic expression.

Perhaps, described cell comprises the protectiveness polymorphism relevant with described down regulation of gene expression, and described screening is used for further reducing the candidate compound of described genetic expression.

On the other hand, the invention provides the method for expression of screening regulatory gene and/or active compound, it was expressed and can raise or downward modulation when described gene was relevant with susceptibility or protectiveness polymorphism, and described method comprises the following steps:

With candidate compound with contain the cells contacting of gene, when this gene is relevant with susceptibility or protectiveness polymorphism its express can rise or reduce, but this expression of gene neither raises also and does not cut in described cell; And

Wherein with before the contact procedure compare, the variation of the gene expression dose after the contact procedure represents that described compound regulates described expression of gene and/or active ability.

Under the preferable case, it was expressed and can reduce when described gene was relevant with the susceptibility polymorphism, in case described screening is used for raising at described cell the candidate compound of described genetic expression.

Under the preferable case, described cell behaviour vascular cell more preferably is people's blood vessel epithelial cell, and it has been confirmed the existence and the baseline expression level of described gene by prescreen.

Perhaps, it was expressed and can raise when described gene was relevant with the susceptibility polymorphism, and described screening is used for the candidate compound in the described genetic expression of described cell downward modulation.

In another embodiment, it was expressed and can raise when described gene was relevant with the protectiveness polymorphism, and described screening is used for raising at described cell the candidate compound of described genetic expression.

Perhaps, it was expressed and can reduce when described gene was relevant with the protectiveness polymorphism, and described screening is used for the candidate compound in the described genetic expression of described cell downward modulation.

Aspect another, the invention provides the risk of assessing existence generation ACS or suffer from the possible reactive method of the object of ACS prevention or treatment processing, described processing relates to physiologically active concentration with gene expression product and returns to for described object age and sex in the due normal range of institute, described method comprise detect susceptibility polymorphism in the described object existence whether, when described susceptibility polymorphism exists or rise or reduce described expression of gene, make the physiologically active concentration of described expressing gene product exceed beyond the described normal range, the existence that wherein detects described polymorphism represents that described object may respond described processing.

On the other hand, the invention provides the test kit that the risk of ACS takes place evaluation object, described test kit comprises whether analysis exists the device of one or more polymorphisms disclosed herein from the sample of described object.

The accompanying drawing summary

Fig. 1: illustrate at SNP fractional ACS frequency from 11 SNP group.

Fig. 2: the SNP fractional ACS frequency at 15 SNP group is shown.

Fig. 3: illustrate according to the SNP mark that is derived from 11 SNP group and have the logarithm advantage of ACS.

Fig. 4: illustrate at SNP fractional ACS frequency from alternate 11 SNP group.

Preferred implementation is described

Use case control study, the smoker of ACS has relatively been taken place and the candidate gene of the contrast of donating blood in the frequency of several genetic variants (polymorphism).These candidate gene great majority have the functional effect of affirmation (maybe may confirm) to genetic expression or protein function.Particularly, the polymorphism frequency of donating blood contrast, resistance smoker (resistant smoker) and suffering from the smoker of ACS compares.

In a kind of embodiment as herein described, identify 20 susceptibility genetic polymorphisms and 20 protectiveness genetic polymorphisms.These polymorphisms are as follows:

Gene pleiomorphism genotype phenotype

CMA1-1903A/G GG susceptibility

TGFB1-509C/T CC susceptibility

MMP12-82A/G GG susceptibility

FGF2 Ser52Ser223C/T CT/TT susceptibility

The CC protectiveness

IL4RA Q576RA/G GG susceptibility

The AA protectiveness

LTA Thr26AsnA/C CC protectiveness

HSP70 Hom T2437C CC/CT protectiveness

The TT susceptibility

TLR4 Asp299GlyA/G AG/GG protectiveness

The AA susceptibility

TLR4 Thr399IleC/T CT/TT protectiveness

The CC susceptibility

IFNG 874A/T TT protectiveness

NFKBIL1-63T/A AA protectiveness

PDGFRA-1630I/D, AACTT/Del I/Del, Del/Del protectiveness

The II susceptibility

IL4-589C/T CT/TT protectiveness

The CC susceptibility

MMP1-16071G/2G, Del/G Del.Del ie1G1G susceptibility

PDGFA 12IN5C/T TT susceptibility

GCLM-588C/T CT/TT susceptibility

The CC protectiveness

OR13G1 Ile132ValA/G AA susceptibility

IL-10-1084A/G (1082) GG protectiveness

α 1-ATS Glu288ValA/T (M/S) AT/TT MS/SS susceptibility

Allelotrope

ICAM1 K469EA/G AA protectiveness

BAT1-23C/G GG protectiveness

NOS3 Glu298AspG/T GG protectiveness

SOD3 Arg213GlyC/G CG/GG protectiveness

PAI-1-6684G/5G 5G5G protectiveness

MIP1A+459C/TIntron1 CT/TT susceptibility

MMP7-181A/G GG protectiveness

The Asn125Ser AG/GG of cathepsin G protectiveness

The AA susceptibility

CX3CR1 I249V TT susceptibility

NOD2 Gly881ArgG/C CC/CG susceptibility

TIMP1 372T/C TT protectiveness

The CC susceptibility

The existence of susceptibility genetic polymorphism is that the indication that the risk of ACS raises takes place.On the contrary, the existence of protectiveness genetic polymorphism represents that the risk that ACS takes place reduces.

As used herein, the risk of ACS " takes place " and means the possibility that faces risk object generation ACS in phrase, and comprises procatarxis and potential morbidity to disease.Therefore, phrase " risk that ACS takes place raises " means genetic predisposition or trend that the object that carries this rising risk has generation ACS.This does not represent this object reality generation at any time ACS, only show with not having and compare that the possibility that ACS takes place for he or she is bigger with raise relevant polymorphism or have of the risk that ACS takes place with general population that the risk that ACS takes place reduces the polymorphism of being correlated with.Carry the object that ACS rising risk takes place and comprise having for example object of trend or preference of ACS procatarxis, its vascular function when assessing.The object that for example has ACS incidence inheritance tendency but have the normal blood vessels function, be in the object of potential risk, comprise object with the slight downtrending of vascular function, as they might suffer from ACS to continue smoking, and object with potential ACS morbidity, they have the trend that vascular function worsens, this during with assessment the ACS state of an illness of discovery consistent.

Similar with it, phrase " reduction of generation ACS risk " means the object that carries this reduction risk and has genetic predisposition or the trend that does not take place or ACS takes place less.This does not represent that this object at no time ACS can take place, only show with having and compare that the possibility that ACS takes place for he or she is littler with raise relevant polymorphism or do not have of the risk that ACS takes place with general population that the risk that ACS takes place reduces the polymorphism of being correlated with.

Be understood that, in the present invention, the probability that two or more alternatively forms (for example allelotrope or genetic marker) that term " polymorphism " means a chromosomal foci occur in same people simultaneously is greater than the probability (usually greater than 1%) of random mutation, and these alternatively forms have different nucleotide sequences or have the repetition nucleotide units of variable number.Referring to Www.ornl.gov/sci/techresources/Human Genome/publicat/97pr/09gloss.html#p. therefore, term " polymorphism " means heritable variation in this article, comprises mononucleotide replacement, Nucleotide insertion and disappearance, tumor-necrosis factor glycoproteins (as little satellite) and all or part of genetically deficient (as null mutation).As used herein, term " polymorphism " also comprises genotype and haplotype.Genotype is the genetic composition at certain specific site or certain group specific site place.Haplotype is one group and is present in closely linked genetic marker on the karyomit(e), and they are difficult for by heavy constituent from, often heredity together, and may be in the linkage disequilibrium.Haplotype can identify by the pattern such as the SNP of polymorphism.Similar with it, term " single nucleotide polymorphism " or " SNP " comprise that in linguistic context of the present invention single nucleotide base replaces and polymorphism is lost and inserted in shortage.

Can be to reduce or rising by analyzing from whether existing the polymorphism that is selected from down group to come the risk that ACS takes place diagnosis object in the sample of described object:

The gene of coding chyme enzyme 1 (CMA1)-1903A/G;

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

The 874A/T of the gene of the plain γ of coded interference (IFNG);

In coding interleukin-4 (IL-4) gene-589C/T;

The gene of coding interleukin 10 (IL-10)-1084A/G (1082);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

The Asn 125 Ser A/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

The 372T/C of the gene of coding tissue inhibitor of metalloproteinase 1 (TIMP1); Or any or multiple polymorphism is in the polymorphism of linkage disequilibrium in one or more and last group.

These polymorphisms also can be united two or more and analyzed, or together analyze with other polymorphisms (being included in top listed polymorphism) that the ACS risk takes place indicated object.

The detection that relates to the polymorphism combination (comprises that high throughput testing (as using the detection of microarray) is preferred.

The statistical study especially statistical results show hereditary check of the present invention of these polymorphism combined effects can be used to measure the risk quotient of any object (comprising the smoker), is in the object of the risk of higher generation ACS especially for evaluation.This class combinatory analysis can only be the combination of susceptibility polymorphism, only is the combination of protectiveness polymorphism or the combination of the two.Analyzing can also proceed step by step, and whether the existence of wherein at first analyzing the protectiveness polymorphism only continues to analyze the susceptibility polymorphism when the unprotect sexual polymorphism.

Therefore, by the frequency of these polymorphisms of systems analysis in the object colony that clearly defines (comprising smoker as described herein and non-smoker), might set up some gene and protein and differentiate that with related also raising the between the ACS morbidity ability of the risk rising of relevant damaged blood vessels function of ACS and ACS takes place which class object based on the prediction purpose.

Result of the present invention shows that the minority smoker's that ACS takes place risk raises really, because they have one or more susceptibility polymorphisms and seldom or do not have a protectiveness polymorphism defined herein.The noxious stimulus and the oxygenant effect that it is believed that the existence of one or more susceptibility polymorphisms and smoking join together to make this group smoker height susceptible in ACS takes place.Other risks and assumptions for example also can exert an influence to the risk status of object in family history, age, body weight, bag year (pack year) etc., and these risks and assumptions can be assessed in conjunction with genetic analysis as herein described.

Can directly detect described one or more polymorphisms or detect described one or more polymorphisms by detecting one or more polymorphisms that are in linkage disequilibrium with described one or more polymorphisms.Discuss as mentioned, linkage disequilibrium is a kind of genetics phenomenon, and wherein two or more sudden changes or polymorphism genetic distance are nearer, make them can be total to heredity.This means when genotyping, detect the existence that a kind of existence of polymorphism can be known another by inference.(people such as Reich DE; Linkagedisequilibrium in the human genome, Nature 2001,411:199-204.)

This paper has provided the aforementioned example that it is reported the polymorphism that is in linkage disequilibrium, these examples comprise MMP12-82 A/G shown in this paper embodiment 1 and the table 33 and MMP1-1607 1G/2G (Del/G) polymorphism, LTA Thr26Asn A/C and NFKBIL 1-63T/A polymorphism and TLR4Asp299Gly A/G and Thr399Ile C/T polymorphism.

It is evident that, raise or reduce the biomarker that polymorphism that relevant polymorphism is in linkage disequilibrium also can be used as generation ACS risk with the risk that ACS takes place with one or more other.The listed data sheet of this paper where there is light is very similar in the frequency of the SNP of linkage disequilibrium.Therefore, the SNP of these genetic linkages can combine with polymorphism analysis and be used to extrapolate the risk level that is similar to the risk level that calculates from former SNP.This paper embodiment 2 has provided a kind of example of this alanysis, and a kind of SNP that wherein is in LD is replaced by another kind of SNP.

Therefore it is evident that one or more polymorphisms that are in linkage disequilibrium with polymorphism as referred to herein can obtain identifying by for example public database.This paper table 35 has provided this class and it is reported the example that is in the polymorphism of linkage disequilibrium with polymorphism as referred to herein.

Also it is evident that, may have multiple naming method usually for any given polymorphism.For example, it is believed that the polymorphism of Arg 213 Gly that this paper is called the gene of the SOD3 that encodes differently is called Arg 312 Gln ,+760 G/C and Arg 231 Gly (rs1799895).When mentioning susceptibility as herein described or protectiveness polymorphism, the present invention also considers the interchangeable another name of this class.

The method of the invention relates generally to the detection and the evaluation of the above-mentioned polymorphism relevant with ACS.These polymorphisms are generally single nucleotide polymorphism.Generally speaking, single nucleotide polymorphism (SNP) is single sequence change or the point mutation that causes heritable variation between the individuality.The occurrence frequency of SNP in human genome is approximately in per 100 to 300 bases 1, and it can occur in coding region or non-coding region.Because the redundancy of genetic code, the SNP of coding region may or may not can change the aminoacid sequence of protein.The SNP that is positioned at non-coding region can be for example by changing genetic expression and influence genetic transcription, processing and translation as promotor, transcription factor binding site point, processing site, ribosome bind site as modifying the regulation and control zone.

SNP helps extensive related genetic research, and people have had very big interest to discovery and the detection of SNP recently.SNP shows the bright prospects as the marker of many phenotypic characters (comprising potential proterties), and the tendency of for example falling ill and severity, healthy tendency and drug responsiveness for example comprise the susceptibility to adverse drug reaction.Understand related and individuality between certain specific SNP and the phenotypic character and whether carry described specific SNP and can realize that targeting diagnosis, prevention and treatment use, handle and increase the understanding of morbid state and finally promote for example discovery of individualized treatment scheme of more effective treatment to realize better disease.

Really, made up at present many databases of known SNP, some SNP has wherein also been made up the database of many biological effects related with SNP.For example, NCBI snp database " dbSNP " is integrated into the Entrez system of NCBI, can use the method identical with GenBank with other Entrez databases such as PubMed to inquire about.This database has been included the SNP more than 1,500,000 that draws on the human genomic sequence.Every dbSNP record comprises the contiguous sequence (sequence context) (sequence promptly) of polymorphism, polymorphism occurrence frequency (colony or individuality) and be used to measure experimental technique, scheme and the condition of variation also comprises the data of the SNP related with the particular phenotype proterties.

To small part is also to put into the method that SNP can be reliably identified in research and development apace because SNP, has big quantity research input to health and healthy potential impact.This is not a gravy jobs, and at least in part because human genome DNA's complicacy, only the monoploid genome just has 3 * 109 base pairs, also has relevant susceptibility in addition and differentiates requirement.

The genotyping method that is used to detect SNP well known in the art comprises dna sequencing, need the allele-specific hybridization of primer or probe, the Nucleotide allele-specific is incorporated into and near or contiguous polymorphism bonded primer (being commonly referred to " single-basic extension " or " micrometering preface "), the oligonucleotide allele-specific connects (connection) (connection chain reaction or connection padlock probe), the allele-specific cutting (restriction fragment length polymorphism analysis or RFLP) that oligonucleotide or PCR product carry out through restriction enzyme or chemical or other agent, distinguish the allelotrope dependency difference of electrophoresis or chromatography mobility or mass spectrum by the structure specific enzymes that comprises invasive structure specific enzymes.When SNP is positioned at the coding region and cause amino acid to change, also can use the amino acid variation analysis.

Dna sequencing allows directly to measure and identify SNP.During screening, full genome even the general advantage that surpasses specificity and accuracy aspect of target subgene group order-checking inherent difficulty.

The micrometering preface relates to the dna sequence dna that allows SNP site in the test sample that primer hybridization studies to being adjacent to.Four kinds of not the fluorescence dideoxy nucleotide of isolabeling (A, C, G or T) and archaeal dna polymerase prolongation primers are carried in use.Having only in four kinds of Nucleotide in a kind of (under the homozygote situation) or four kinds of Nucleotide has two kinds (under heterozygote situations) to be integrated.The base complementrity of integrating is in the Nucleotide that is positioned at the SNP site.

The many methods that are used for the SNP detection at present relate to locus specificity hybridization and/or allele-specific hybridization.These methods are attached on the target sequence that contains purpose SNP with mainly relying on the oligonucleotide distinctiveness.Affymetrix (Santa Clara, Calif.) and Nanogen Inc. (San Diego, technology Calif.) is particularly famous, it is more much lower than the complete paired two strands of base that these technology utilize this fact promptly to contain the dna double chain stability of single base mismatch.Existence by fluoroscopic examination pairing duplex.

Hybridize by locus specificity and to detect or to identify target amplification that the most methods of SNP need be undertaken by for example PCR method to increase susceptibility and specificity (for example referring to U.S. Patent No. 5,679,524, the open WO 98/59066 of PCT, the open WO 95/12607 of PCT).U.S. Patent application 20050059030 (integral body is incorporated this paper into) has been described a kind of method that detects single nucleotide polymorphism among the human total DNA, and it does not need amplification in advance or reduces complexity with enriched target sequence optionally, need not any enzyme reaction yet.Described method has been used the single step hybridization that relates to two hybridisation events.First part's target sequence hybridizes on the capture probe, and the described target sequence of second section hybridizes on the detection probes.Two hybridisation events occur in the same reaction, and the order that hybridization takes place is not vital.

U.S. Patent application 20050042608 (integral body is incorporated this paper into) has been described the improvement to people such as Thorp (U.S. Patent No. 5,871,918) electrochemically detecting nucleic acid hybridizing method.In brief, the design capture probe, wherein every probe all has different SNP bases and has one section probe sequence in the every side of described SNP base.The probe base complementrity is in the corresponding target sequence adjacent with the SNP site.Every capture probe is fixed on the different electrodes, and this electrode has nonconducting skin on the conduction working-surface of matrix.Use transition metal complex after testing the redox reaction at each electrode place detect hybridization degree between every capture probe and the described nucleic acid target.Utilize these differences of different anodizing speed to determine whether selected nucleic acid target has single nucleotide polymorphism in selected SNP site.

Use MEGATYPE ^TM(Hayward, Calif.) technology can be carried out genotyping to a large amount of SNP from big and small genetic material storehouse to the Lynx Therapeutics of technology simultaneously.Two colony's genomes that this technology uses fluorescently-labeled probe relatively to collect can detect and reclaim and cross over the dna fragmentation of distinguishing these two SNP of colony, and need not to carry out in advance the SNP mapping or understand SNP.

Exist many other to be used to detect and identify the method for SNP.These methods comprise uses mass spectrum for example to measure probe with SNP hybridization.This technology changes because of the speed that it carries out, and this technology of functional quality coded markings can realize that the processing of several samples can realize the high-throughput of 40,000 SNP to every day every day.A kind of preferred embodiment is to use mass spectroscopy to comprise the nucleotide sequence of polymorphism of the present invention, and for example this nucleotide sequence comprises the promotor of COX2 gene or complementary sequence.Described mass spectrometry method is known for those skilled in the art, and genotyping method of the present invention can be revised the mass spectrometric detection that is used for polymorphism of the present invention, COX2 promotor polymorphism for example of the present invention.

Also can analyze and determine SNP by ligation-bit.This analyzes the primer that needs two to hybridize with target, wherein has a Nucleotide gap between two primers.Each of four kinds of Nucleotide is joined in the independent reaction mixture that contains archaeal dna polymerase, ligase enzyme, target DNA and primer.Polysaccharase adds Nucleotide with 3 ' of SNP complementary first primer to be held, and ligase enzyme connects together the primer of two vicinities then.After the sample heating, if connect, longer primer will still be in the hybridization state and can detect signal such as fluorescent signal this moment.The further discussion of these methods is found in United States Patent (USP) 5,919,626; 5,945,283; 5,242,794 and 5,952, No. 174.

United States Patent (USP) 6,821,733 (integral body is incorporated this paper into) were described the method that detects two sequence of nucleic acid molecules differences, and it comprises the following steps: two nucleic acid are contacted under the condition that allows formation four-way mixture (four-waycomplex) and branch migration; With four-way mixture and labelled molecule and detection molecules detection molecules can with labelled molecule or four-way mixture bonded condition under contact; And measure and to be exposed to combining between the labelled molecule and detection molecules before and after the four-way mixture.The competition that combines detection molecules between four-way mixture and the labelled molecule shows two kinds of differences between the nucleic acid.

Method based on protein and proteomics also is suitable for polymorphism detection and analysis.Can detect by the described protein of direct analysis and to cause marking protein to change or change related polymorphism with marking protein.This for example generally need by gel electrophoresis or HPLC separate the different proteins in the duplicate samples and for example be derived from as chemistry order-checking or more common mass spectrum evaluation by NMR or protein sequencing as described in sample as described in protein or peptide.Proteomics method is learned and is known by technical field, has wide automatization prospect.For example, integrated system is as the ProteomIQ from Proteome Systems ^TMSystem provides the high-throughput platform for Proteomic analysis, and it combines specimen preparation, protein separation, IMAQ and analysis, protein processing, mass spectrum and bioinformatics technique.

Most proteomics methods of identification of proteins utilize mass spectrum, comprise ion trap mass spectrometry, liquid chromatography (LC) (LC) and LC/MSn mass spectrum, gas chromatography (GC) mass spectrum, Fourier Transform Ion cyclotron Resonance mass spectrograph (FT-MS), MALDI-TOF mass spectrum and ESI mass spectrum and their deriving method.The mass-spectrometry method also is useful for proteinic posttranslational modification as phosphorylation or glycosylated mensuration, therefore can be used for measuring causing the protein post-translational modification variation or changing related polymorphism with protein post-translational modification.

Correlation technique is also known, comprise that for example the protein processing units is as " chemicals ink-jet printer ", it comprises the piezoelectricity printing technique, allows by enzyme or chemicals are directly injected to selected protein spot the protein example from 2-D PAGE gel electrotransfer to film to be carried out original position enzyme or chemical digestion.Behind digestion of protein original position and the incubation, described film can directly be placed on and carry out peptide analysis in the mass spectrograph.

Develop many variable methods of nucleic acid conformation that depend on and detected SNP.

For example, single strand conformation polymorphism (SSCP, people such as Orita., PNAS 1989 86:2766-2770) be a kind of method that in solution, forms the secondary structure ability that relies under certain condition of single-chain nucleic acid.Secondary structure depends on that base constitutes and can change by the mononucleotide replacement, thereby causes the difference of electrophoretic mobility under non-sex change condition.General by radioautograph (if carrying radio-labeling), band silver dye, detectable label probe fragment hybridization or use fluorescence PCR primer (with after for example automated DNA sequenator detection) that various polymorphisms (polymorph) are detected.

The technical field that is improved to of SSCP is known, and comprises the different gel electrophoresis condition of using, for example differing temps or adding additive and different gel matrixs.Other of SSCP are changed to the technician and know, comprise RNA-SSCP, restriction enzyme fingerprint-SSCP, two deoxidation fingerprints (dideoxy sequencing combines with SSCP's), the two-way pair of deoxidation fingerprint (wherein adopting two relative primers to carry out two deoxidation termination reactions simultaneously) and fluorescent PCR-SSCP (PCR product multiple fluorescence dye on inner marker wherein, the available constraints enzyme digests, and carries out SSCP then, and analyzes can detecting on the automated DNA sequenator of fluorescence dye).

Utilize the additive method of the different mobility of different nucleic acid constructs to comprise denaturing gradient gel electrophoresis (DGGE), temperature gradient gel elec-trophoresis (TGGE) (TGGE) and heteroduplex analysis (HET).The dissociated variation of double-stranded DNA herein (for example because base mispairing) causes the variation of electrophoretic mobility.The variation of these mobilities is used to detect nucleotide diversity.

Sex change high pressure liquid chromatography (HPLC) (HPLC) is another method that is used to detect SNP, it uses the HPLC method known in this area to detect homoduplex and heteroduplex with different rates wash-out on the HPLC post as the alternative method of above-mentioned separation method (example gel electrophoresis), thereby can detect the mispairing and the SNP of Nucleotide.

But another method that detects SNP depends on the different susceptibility to various doses of cuttings comprising chemical chop agent and hydrolase nucleic acid of strand and double-strandednucleic acid.For example, RNase A is to the intravital mispairing cutting of RNA:DNA heteroduplex, phage T4 endonuclease YII or T7 endonuclease I are to the cutting of heteroduplex, lyase I is to the cutting of the hairpin loop 5 ' end of joint between strand and the double-stranded DNA and be generally used for chemical chop agent in the Maxam-Gilbert order-checking chemistry and the modification of the mispairing Nucleotide of heteroduplex inside is technical field knows.

Other examples comprise the protein translation test (PTT) that is used to separate the terminator codon that the factorial variation produces, and variation causes the protein of translating of crossing early stopping and shortening and uses the mispairing conjugated protein.By will be for example the component MutS albumen of e. coli dna mismatch repair system or human hMSH2 and GTBP protein binding to the double-stranded DNA heteroduplex that contains base mismatch, detect variation.The dna double chain then with the conjugated protein together incubation of mispairing, detect variation through mobility shift assay.For example, a kind of simple mensuration is based on this fact, i.e. the conjugated protein heteroduplex that is attached to of mispairing protects heteroduplex to avoid the degraded of exonuclease.

Those skilled in the art can understand that specific SNP especially is positioned at the regional SNP as promotor of generegulation and can associates with the genetic expression that changes.Also can cause genetic expression to change when SNP is positioned at the coding region of gene of protein coding, for example SNP and the codon with different codon usages are related also thereby with different tRNA abundance when related.The genetic expression of this change can be measured by method well known in the art, and therefore can be used to detect this class SNP.Equally, when SNP was positioned at the coding region of gene and cause non-synonym aminoacid replacement, this replacement can cause the variation of gene product function.Equally, when gene product was RNA, this SNP can cause the variation of rna gene product function.For example any variation of this class of activity or the detected function of functional assays can be used to detect this class SNP.

Above-mentionedly be used to detect and identify that the method for SNP can be used for the method for the invention.

Certainly, in order to detect according to the present invention and to identify SNP, obtain to contain the sample of detected materials on one's body from object.Described sample can be for may containing any sample of target SNP (or the target polypeptide under some occasion), and can obtain from (blood, urine, the saliva etc.) biopsy of any body fluid or other tissue preparations.

According in numerous methods well known in the art any can be from sample DNA isolation or RNA.Tijssen for example; Laboratory Techniques in Biochemistry and MolecularBiology:Hybridization with nucleic acid probes Part 1:Theory and Nucleicacid preparation, Elsevier, New York, N.Y.1993 and Maniatis, T., Fritsch, E.F.and Sambrook, J., Molecular Cloning Manual 1989 has described the method for purification of nucleic acid.

For whether auxiliary detection polymorphism/SNP exists, can provide nucleic acid probe and/or primer.This class probe has special at the nucleotide sequence that confirms that karyomit(e) that whether polymorphism exists changes, and the material that preferably sends detectable signal when being attached to the target pleomorphism site carries out mark.

Nucleic acid probe can be genomic dna or cDNA or mRNA, or the material of any RNA sample or DNA sample, peptide nucleic acid(PNA) for example, branched DNA etc.Probe can be that justice or antisense polynucleotides probe are arranged.When target polynucleotide was two strands, probe can be justice or antisense strand.When target polynucleotide was strand, probe was the complementary strand.

Can prepare described probe by many synthetic or enzyme schemes well known in the art.The chemical process of can the use technology field knowing (people such as Caruthers., Nucleic Acids Res., Symp.Ser., 215-233 (1980)) all or part of synthetic described probe.Perhaps, can be by all or part of synthetic described probe of enzymatic mode.

Can nucleotide analog be incorporated in the probe by this method well known in the art.Unique requirement is that the nucleotide analog of integrating must carry out base pairing with target nucleotide sequences.For example, some guanylic acid can be replaced by the xanthoglobulin that carries out base pairing with the cytosine(Cyt) residue.But these base pairs do not have the base pair between guanine and the cytosine(Cyt) stable.Perhaps, adenine nucleotide can be replaced by 2,6-diaminopurine, and the latter can form the base pair stronger than base pair between the adenine and thymine.

In addition, probe can comprise by chemical process or Enzymology method deutero-Nucleotide.Typical chemically modified comprises with acyl group, alkyl, aryl or amino deriving of carrying out.

Probe can be fixed on the base material.Preferred substrate is any suitable hard or the upholder of semi-rigid, and it comprises film, filter paper, chip, slide, wafer, magnetic bead or non-magnetic bead, gel, pipeline, plate, polymkeric substance, particulate and kapillary.Base material can have many surface shapes, for example well (well), canal (trench), pin, groove (channel) and pore (pore), and polynucleotide probes can be in conjunction with thereon.Base material is optically transparent under the preferable case.

And probe need not directly to be attached on the matrix, only needs to be attached on the matrix by the joint group.The joint group generally is about 6 to 50 atoms, for the probe that is connected provides exposed space.Preferred joint group comprises ethylene glycol oligomer, diamines, diacid etc.One of reactive group on the stromal surface and terminal portions of joint react so that joint is connected on the matrix.Another terminal portions of joint functionalised and is used for bonding probes then.

Can be distributed to substrate surface or preformed dna fragmentation or clone are distributed to substrate surface probe is connected to base material by being used for probe synthetic reagent.Typical divider comprises the micropipet that solution is transported to base material, and it uses automatic system with the position of control micropipet with respect to base material.Can there be the plurality of distribution device to make reagent can be transported to conversion zone simultaneously.

Nucleic acid microarray is preferred.This class microarray (comprising nucleic acid chip) is known (referring to for example United States Patent (USP) 5,578,832 for technical field; 5,861,242; 6,183,698; 6,287,850; 6,291,183; 6,297,018; 6,306,643; With 6,308, No. 170, wherein incorporate this paper by reference into for every piece).

Perhaps, can make the antibody microarray.The making of this class microarray is basically as Schweitzer﹠amp; Kingsmore, " Measuring proteins on microarrays ", Curr Opin Biotechnol 2002; 13 (1): 14-9; People such as Avseekno., " Immobilization of proteins in immunochemicalmicroarrays fabricated by electrospray deposition ", Anal Chem 2,001 15; 73 (24): 6047-52; Huang, " Detection of multiple proteins in an antibody-based proteinmicroarray system, Immunol Methods 2,001 1; 255 (1-2): 1-13 describes.

The present invention considers that also preparing test kit is used for the present invention.Suitable test kit comprises according to the present invention in suitable containers and packaged material and comprises all ingredients that uses in pipe, bottle and shrink packaging and the blowing packing.

The material that is applicable to exemplary kit of the present invention comprises one or more following materials: renaturation is attached to the gene specific PCR primer of the DNA that is positioned at purpose genetic polymorphism both sides or cDNA sequence domains to (oligonucleotide), distinguished sequence structural domain among amplifiable gene group DNA or the cDNA and need not carry out the reagent of PCR, (the restriction enzyme for example of the required reagent of various possible allelotrope in the sequence domains of differentiation by PCR or non-PCR amplification, preferred renaturation is attached to a kind of allelic oligonucleotide of polymorphism, comprise and modifiedly contain amplification from the enzyme of the signal of oligonucleotide or the oligonucleotide of fluorescence chemical group, they make the allelic differentiation stronger), physical sepn is derived from the required reagent of various allelotrope products and (for example is used for electrophoretic agarose or polyacrylamide and damping fluid, the HPLC post, the SSCP gel, the methane amide gel or be used for the medium carrier of MALDI-TOF).

Being understood that the method for the invention can combine with the analysis of other known risks and assumptions related with ACS carries out.This class risks and assumptions comprises and the relevant epidemiology risks and assumptions of risk rising that ACS takes place.This class risks and assumptions includes but not limited to smoking and/or tobacco smoke exposure, age, sex and family history.When the risk of ACS took place evaluation object, these risks and assumptions can be used to promote the analysis of one or more polymorphisms as herein described.

Forecasting Methodology of the present invention allows the suitability of many therapeutic interventions of assessment and/or treatment plan and allows given object is carried out these therapeutic interventions and/or treatment plan.The simplest method can be to carry out the power that mode of life changes for object provides in these therapeutic interventions and/or the treatment plan, and the power of smoking cessation for example can be provided when the method for the invention when liking the CS.

Come the mode of predicted treatment intervention or processing according to the biological effect of the character of polymorphism and described polymorphism.For example, when the susceptibility polymorphism was related with the variation of genetic expression, intervention or processing were preferably used for recovering the normal expression of described gene, for example by using the medicament that can regulate described genetic expression.When polymorphism with the reduction of gene express when related, treatment can comprise the medicament that gives to increase described genetic expression, on the contrary, when polymorphism and expression of gene rising were related, treatment can comprise used the medicament that can reduce described genetic expression.Expressing useful method for regulatory gene is known by technical field.For example, raise when related, can use the treatment of RNAi for example or antisense method to reduce the abundance of mRNA, thereby reduce described expression of gene in polymorphism and genetic expression.Perhaps, thus treatment can comprise the method for the compensatory described gene unconventionality expression of activity that is used for for example regulating described gene product.

When the gene product level of the gene product function of susceptibility polymorphism and reduction or reduction is related, therapeutic intervention or processing can comprise to be promoted or alternative described function, or the amount of the interior gene product of additional subject, for example by using the functional analogue of described gene product or described gene product.For example, when the enzyme function association of polymorphism and reduction, treatment can comprise to object uses organized enzyme or organized enzyme analogue.Equally, when the gene product function association of polymorphism and rising, therapeutic intervention or handle can comprise and reduces described function, for example maybe can reduce the medicament of described gene product level in subject by the inhibitor of using described gene product.For example, when the enzyme function association of SNP allelotrope or genotype and rising, treatment can comprise to object uses enzyme inhibitors.

Equally, when the rise of protectiveness polymorphism and specific gene or enzyme or other protein expressions were related, treatment can be used for simulating this rise or the expression of the individuality that lacks described resistant gene type, and/or gives this class individual this enzyme or other protein carried.And when the downward modulation of protectiveness polymorphism and specific gene or enzyme or other protein expressions reduce or disappear when related, desirable treatment can be used for simulating this class situation of the individuality of the described protective gene type of shortage.

The relation that (otherwise or) take place between the susceptibility of ACS for the various polymorphisms of above-mentioned evaluation and object can also be applied to the design and/or the screening of candidate therapy.This is particularly like this when showing in rise or the downward modulation by genetic expression of the polymorphism of prediction susceptibility.In this case, can easily detect the effect that candidate therapy raises or reduces this class.

For example, in one embodiment existing people's blood vessel organ and cell culture are carried out the genotypic screening of above-mentioned SNP.(for people's blood vessel organ and cell cultures, for example see also: Clare WiseED., Epithelial Cell Culture Protocols, 2002, ISBN 0896038939, Humana PressInc.NJ; Endothelial Cell Culture, Roy Bicknell, ED., 1996, ISBN 0521550246, Cambridge University Press, UK; Cell Culture Models of Biological Barriers, Claus-Michael Lehr, ED., 2002, ISBN 0415277248, Taylor and Francis, UK; Wherein each piece method integral body is by reference incorporated this paper into).Select to represent the culture of genes involved type group and the culture of supposition " normally " with regard to gene expression dose, this expression of gene or rise or downward modulation in the presence of polymorphism.

The sample of this class culture is exposed to candidate therapeutic compound library and screening: (a) downward modulation of the gene that raises under the normal circumstances in the susceptible gene type; Or the rise of the gene of (b) in the susceptible gene type, reducing under the normal circumstances.Change the adjusting of the gene in the culture with susceptible gene type and/or the ability of effect according to compound and select compound.

Equally, when polymorphism is that a kind of physiologically active concentration that can cause the expressing gene product when it exists is when exceeding polymorphism beyond object (age and the sex are proofreaied and correct) normal range, and when the preventative or therapeutic method of the physiologically active concentration level of exist to recover expressing gene product to normal range, can screen individual subject and benefit from the possibility of this restorative method to determine it.The screening of this class comprises and comes by arbitrary method described herein whether polymorphism exists in the detected object body, and wherein existing the object of described polymorphism to be accredited as is the individuality that possible benefit from treatment.

Now with reference to following non-limiting examples the present invention is described in more detail.

Embodiment 1

The case association study

Foreword

The case-control association study allows selected control group, and wherein the coupling of important risks and assumptions is vital.In this research, comparative diagnoses suffers from the smoker of ACS and does not suffer from the smoker of ACS.This unique control group is a height correlation, because the smoker that can not select ACS to be free from risk in advance, although the smoker of ACS never can take place in i.e. smoking.Have de-luxe compartment year history and the smoker of normal cardiovascular function be used as " low risk " smoker group, this is can not identify more low-risk smoker's group because the present patent application people thinks under existing knowledge.Without wishing to be bound to any theory, the present patent application people thinks that this method allows the low penetrance and the high-frequency polymorphism that may improve the risk that ACS takes place are carried out more strict comparison.Without wishing to be bound to any theory equally, the present patent application people also thinks and may exist protection to a certain degree to avoid the polymorphism of ACS, only is only significantly during as control group (comparator group) when the smoking formation with normal cardiovascular function.Therefore, with have normal cardiovascular function and diagnosis have the smoker of ACS to compare, suffer from the frequency that the ACS smoker has these polymorphisms and estimate lower.

15 bag years of smoking are at least recruited in this research and diagnosis has acute coronary syndrome European descendants' object of (ACS comprises acute myocardial infarction and unstable angina pectoris).Object meets following standard: the clinical manifestation when accepting tertiary care hospital for medical treatment (medical history, ECG, heart biology marker are measured) diagnosis suffers from ACS.The CAG of suffering from the object of ACS confirms the existence of coronary atherosclerosis disease.The object age of suffering from ACS is between 40-60 between year, and is European descendants.148 routine objects have been raised in research, and wherein 85% is the male sex, mean F EV1/FVC (± 1SD) be 74% (± 8), mean F EV1 accounts for 94 (± 15) of predictor percentage ratio.Mean age, every day cigarette number and Bao Nianshi be respectively 50 (± 3) year, 22 cigarette/skies (± 8) and 31 wrap year (± 11).Also studied 460 European objects in addition, they are 15 bag years of smoking at least, never suffer from stenocardia, pectoralgia, heart attack or previously are diagnosed with ischemic heart disease.This control group has been recruited smoker's and CS the volunteer of community in the past, and wherein 55% is made up of the male sex, mean F EV1/FVC (± 1SD) be 75% (± 9), mean F EV1 accounts for predictor per-cent is 98 (± 12).Mean age, every day cigarette number and Bao Nianshi be respectively 60 (± 10) year, 23 cigarette/skies (± 11) and 40 wrap year (± 11).

This studies show that, compares the higher polymorphism of acute coronary syndrome patient frequency with the resistance smoker and may reflect that the susceptibility to life-threatening acute coronary syndrome takes place raises.Equally, the patient compares with acute coronary syndrome, and the polymorphism that resistance smoker's frequency is higher may reflect provide protection.

The summary of ACS formation and resistant control smoker characteristics

Mean parameter (1SD)	Acute coronary syndrome N=148	Resistance smoker N=460	Difference
Mean parameter (1SD)	Acute coronary syndrome N=148	Resistance smoker N=460	Difference	Masculinity proportion (%)	85％	55％	P＜0.05
Age (year)	50(3)	60(10)	P＜0.05	Masculinity proportion (%)	85％	55％	P＜0.05
Age (year)	50(3)	60(10)	P＜0.05	Bag year	31(11)	40(21)	P＜0.05
Cigarette number/sky	22(8)	23(11)	ns	Bag year	31(11)	40(21)	P＜0.05
Cigarette number/sky	22(8)	23(11)	ns	FEV1(L)	3.3(0.7)	2.7(0.6)	P＜0.05
Prediction FEV1%	94(15)	98％(12)	P＜0.05	FEV1(L)	3.3(0.7)	2.7(0.6)	P＜0.05
Prediction FEV1%	94(15)	98％(12)	P＜0.05	FEV1/FVC	74(8)	75(9)	P＜0.05

Mean value and 1SD

The genotyping method

Use Sequenom Autoflex mass spectrograph to carry out the polymorphism genotyping

From whole blood sample, extract genomic dna (Maniatis, T., Fritsch, E.F. and Sambrook, J., Molecular Cloning Manual.1989).With the genomic dna five equilibrium (10ng/ul concentration) of purifying to 96 orifice plates, at Sequenom ^TM(the Sequenom of system ^TMAutoflex mass spectrograph and Samsung 24 pin nano-dispersed devices) go up and adopt following sequence, amplification condition and method that it is carried out genotyping.

Use following condition to be used for the PCR multiple reaction: final concentration is 10 * damping fluid 15mM MgCl ₂1.25 *, 25mM MgCl ₂1.625mM, dNTP mixture 25mM 500 μ M, primer 4 μ M100nM, Taq polysaccharase (Quiagen warm start) 0.15U/ reaction, genomic dna 10ng/ μ l.Cycle index be 95 ℃ following 15 minutes, at 5 ℃ of 15s, 56 ℃ of 30s, 72 ℃ of following 45 circulations of 30s are extended at last and were finished reaction in 3 minutes.We have used 35 ℃ of shrimp alkaline phosphotases of 30 minutes of following incubation (SAP) to handle (each PCR reaction adds 2 μ l to 5 μ l) and extension (SAP handles the back and adds 2 μ l to 7 μ l), and wherein following volume is adopted in each reaction: water, 0.76 μ l; HME 10 * stop buffer, 0.2 μ l; HME primer (10 μ M), 1 μ l; Mass Extend enzyme, 0.04 μ l.The full name of SNP and candidate gene sees table 1-26.

The Sequenom condition of PCR and mass spectrograph genotyping

SNP_ID SNP title the 2nd PCRP the one PCRP

PDGFA PDGFA 12 ACGTTGGATGAAGGCTCTGA ACGTTGGATGATCCGGATTATCG

IN5C/T AGACCTGTTC[SEQ.ID.NO.1] GGAAGAG[SEQ.ID.NO.2]

RS1758 1-antitrypsin ACGTTGGATGCTTGGTGATG ACGTTGGATGTCTTCTTCCTGCC

0 S-allele ATATCGTGGG[SEQ.ID.NO.3] TGATGAG[SEQ.ID.NO.4]

RS1799 NOS3 298 ACGTTGGATGAAACGGTCGC ACGTTGGATGGGGCAGAAGGAA

983 G/T TTCGACGTG[SEQ.ID.NO.5] GAGTTC[SEQ.ID.NO.6]

RS1800 TGFB1 -509 ACGTTGGATGTACAGGTGTC ACGTTGGATGAAGAGGGTCTGT

469 C/T TGCCTCCTGA[SEQ.ID.NO.7] CAACATGG[SEQ.ID.NO.8]

RS1151 OG13G1 132 ACGTTGGATGATAGCCATGAC ACGTTGGATGGGCCATTTGTTTC

640 A/G CATGCTGAG[SEQ.ID.NO.9] CCTCTTC[SEQ.ID.NO.10]

RS2276 MMP12 -82 ACGTTGGATGTTGAGATAGAT ACGTTGGATGGTCCGGGTTCTG

109 A/G CAAGGGATG[SEQ.ID.NO.11] TGAATATG[SEQ.ID.NO.12]

RS4986 TLR4 299 ACGTTGGATGAGCATACTTAG ACGTTGGATGCACACTCACCAG

790 A/G ACTACTACC[SEQ.ID.NO.13] GGAAAATG[SEQ.ID.NO.14]

RS1800 IL-10 -1084 ACGTTGGATGATTCCATGGA ACGTTGGATGGACAACACTACTA

896 A/G GGCTGGATAG AGGCTTC[SEQ.ID.NO.16]

[SEQ.ID.NO.15]

RS5498 ICAM1 ACGTTGGATGACTCACAGAG ACGTTGGATGTGTCACTCGAGA

K469E A/G CACATTCACG[SEQ.ID.NO.17] TCTTGAGG[SEQ.ID.NO.18]

RS1449 FGF2 ACGTTGGATGAGGCGGCGTC ACGTTGGATGCTCGGCCGCTCT

683 Ser52Ser C/T CGCGGAGACA TCTGTCC[SEQ.ID.NO.20]

[SEQ.ID.NO.19]

RS2239 BAT1-23C/G ACGTTGGATGTTACCTAAACA ACGTTGGATGAAGCCTGCAACC

527 GGGAGAGCG[SEQ.ID.NO.21] GGAAGTG[SEQ.ID.NO.22]

RS1799 SOD3 ACGTTGGATGCTCAGGCGGC ACGTTGGATGAGGCGCGGGAG

895 Arg213Gly CTTGCACTC[SEQ.ID.NO.23] CACTCAGA[SEQ.ID.NO.24]

C/G

RS1800 CMA1 -1903 ACGTTGGATGGCTCCACAGC ACGTTGGATGTTCCATTTCCTCA

875 A/G ATCAAGATTC[SEQ.ID.NO.25] CCCTCAG[SEQ.ID.NO.26]

RS1719 MIP1A +459 ACGTTGGATGGGTTCAAGAA ACGTTGGATGAGCTCTGTCCCT

134 C/T GTCATACCCC[SEQ.ID.NO.27] TGGATGTC[SEQ.ID.NO.28]

RS2243 IL-4-589C/T ACGTTGGATGCGACCTGTCC ACGTTGGATGGAATAACAGGCA

250 TTCTCAAAAC[SEQ.ID.NO.29] GACTCTCC[SEQ.ID.NO.30]

RS1801 IL-4RA ACGTTGGATGGAAATGTCCT ACGTTGGATGACCCTGCTCCAC

275 Q576R A/G CCAGCATGGG CGCATGTA[SEQ.ID.NO.32]

[SEQ.ID.NO.31]

RS2227 HASP70Hom ACGTTGGATGTGATCTTGTTC ACGTTGGATGCGAGGTGACGTT

956 T2437C ACCTTGCCG[SEQ.ID.NO.33] TGACATTG[SEQ.ID.NO.34]

RS1799 MMP1 -1607 ACGTTGGATGCTTCAGTATAT ACGTTGGATGGTTATGCCACTTA

750 1G/2G CTTGGATTG[SEQ.ID.NO.35] GATGAGG[SEQ.ID.NO.36]

RS1788 MMP7 -181 ACGTTGGATGGGAGTCAATTT ACGTTGGATGCATCGTTATTGGC

0821 A/G ATGCAGCAG[SEQ.ID.NO.37] AGGAAGC[SEQ.ID.NO.38]

RS4986 TLR4399C/T ACGTTGGATGAGCCCAAGAA ACGTTGGATGAGGTTGCTGTTC

791 GTTTGAACTC[SEQ.ID.NO.39] TCAAAGTG[SEQ.ID.NO.40]

RS1041 LTAThr26Asn ACGTTGGATGGAGGTCAGGT ACGTTGGATGACCCCAAGATGC

981 A/C GGATGTTTAC[SEQ.ID.NO.41] ATCTTGCC[SEQ.ID.NO.42]

PDGFR PDGFRA ACGTTGGATGGGCAACTAGC ACGTTGGATGCAGAGTGCGGAA

A -1630I/D CTAAAAACCC[SEQ.ID.NO.43] TAAAAGGC[SEQ.ID.NO.44]

GCLM GCLM -588 ACGTTGGATGTGAGGTAGAC ACGTTGGATGAAGAGACGTGTA

C/T ACCGCCTCC[SEQ.ID.NO.45] GGAAGCCC[SEQ.ID.NO.46]

RS2430 IGN-G 874 ACGTTGGATGCAGACATTCA ACGTTGGATGGATAGTTCCAAAC

561 A/T CAATTGATT[SEQ.ID.NO.47] ATGTGCG[SEQ.ID.NO.48]

RS2071 NFKBIL1 -63 ACGTTGGATGTAACGCCCCT ACGTTGGATGACTCCAGGCTGG

592 T/A CACAGTTCAC[SEQ.ID.NO.49] AGGAAATG[SEQ.ID.NO.50]

PAI1 PAI-1 -668 ACGTTGGATGCACAGAGAGA ACGTTGGATGTCTTGGTCTTTCC

4G/5G GTCTGGACAC CTCATCC[SEQ.ID.NO.52]

[SEQ.ID.NO.51]

Rs20668 Caspase ACGTTGGATGGTCTGTTGAC ACGTTGGATGTGGTGATCACCC

45 TCTTTTGGC[SEQ.ID.NO.105] AAGGCTTC[SEQ.ID.NO.106]

rs37323 CX3CR1 ACGTTGGATGCATAGAGCTTA ACGTTGGATGTGATCCTTCTGGT

79 AGCGTCTCC[SEQ.ID.NO.107] GGTCATC[SEQ.ID.NO.108]

Organize the CGTTGGATGTCAGTCCCTC ACGTTGGATGAGAAGAGTCAGA of egg cathepsin A

White enzyme G G Asn125Ser CTGGGCTCTA CGGAATCG[SEQ.ID.NO.110]

[SEQ.ID.NO.109]

rs65202 TIMP1 ACGTTGGATGGACTCTTGCA ACGTTGGATGAGTGTAGGTCTT

77 CATCACTACC GGTGAAGC[SEQ.ID.NO.112]

[SEQ.ID.NO.111]

The result

Chyme enzyme 1 (CMA)-1903A/G polymorphism allelotrope and genotype frequency of table 1.ACS patient and resistance smoker

^*Chromosome number (2n)

The genotype GG of ACS smoker antagonism smoker contrast is to AG/AA, odds ratio (OR)=1.9,95% confidence limit 1.2-3.0, χ ²(Mantel-Haenszel)=8.23, p=0.004,

GG genotype=susceptibility

The allelotrope G of ACS smoker antagonism smoker contrast is to A, odds ratio (OR)=1.4,95% confidence limit 1.1-1.9, χ ²(Mantel-Haenszel)=6.52, p=0.01,

G allelotrope=susceptibility

Transforminggrowthfactor-(TGFB1)-509C/T polymorphism allelotrope and genotype frequency of table 2.ACS patient and resistance smoker

^*Chromosome number (2n)

The genotype CC of ACS smoker antagonism smoker contrast is to CT/TT, odds ratio (OR)=1.5,95% confidence limit 1.0-2.2, χ ²(Mantel-Haenszel)=3.96, p=0.05,

CC genotype=susceptibility

The allele C of ACS smoker antagonism smoker contrast is to T, odds ratio (OR)=1.4,95% confidence limit 1.0-1.8, χ ²(Mantel-Haenszel)=3.79, p=0.05,

C allelotrope=susceptibility

Matrix metalloproteinase 12 (MMP12)-82A/G polymorphism allelotrope and genotype frequency of table 3.ACS patient and resistance smoker.

^*Chromosome number (2n)

The genotype GG of ACS smoker antagonism smoker contrast is to AA/AG, odds ratio (OR)=3.2,95% confidence limit 0.8-13, χ ²(Mantel-Haenszel)=3.76, p=0.05,

GG genotype=susceptibility

Table 4.ACS patient and resistance smoker's fibroblast growth factor 2 (FGF2) Ser 52 Ser (223C/T) polymorphism allelotrope and genotype frequency

^*Chromosome number (2n)

The genotype CT/TT of ACS smoker antagonism smoker contrast is to CC, odds ratio (OR)=1.5,95% confidence limit 0.9-2.5, χ ²(Mantel-Haenszel)=3.1, p=0.08,

CT/TT genotype=susceptibility (CC protectiveness)

The allelotrope T of ACS smoking antagonism smoker contrast is to C, odds ratio (OR)=1.5,95% confidence limit 0.9-2.3, χ ²(Mantel-Haenszel)=3.24, p=0.07,

T allelotrope=susceptibility

Table 5.ACS patient and resistance smoker's interleukin-4 α (IL4RA) Q576R A/G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype GG of ACS smoker antagonism smoker contrast is to AA/AG, odds ratio (OR)=2.71,95% confidence limit 1.1-6.9, χ ²(Mantel-Haenszel)=5.52, p=0.02,

GG genotype=susceptibility

The frequency of genotypes AA of ACS smoker antagonism smoker contrast is to AG/GG, odds ratio (OR)=0.47,95% confidence limit 0.07-1.0, χ ²(Mantel-Haenszel)=3.45, p=0.05,

AA genotype=protectiveness

The allelotrope G of ACS smoker antagonism smoker contrast is to A, odds ratio (OR)=1.5,95% confidence limit 1.1-2.0, χ ²(Mantel-Haenszel)=5.56, p=0.02,

G allelotrope=susceptibility

Table 6.ACS patient and resistance smoker's lymphotoxin α (LTA) Thr26Asn A/C polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype CC of ACS smoker antagonism smoker contrast is to AA/AC, odds ratio (OR)=0.66,95% confidence limit 0.4-1.0, χ ²(Mantel-Haenszel)=4.28, p=0.04,

CC genotype=protectiveness

LTA Thr26Asn A/C and NFKBIL1-63T/A are in linkage disequilibrium

Table 7.ACS patient and resistance smoker's heat shock protein(HSP) (HSP) 70 Hom T2437C C/T polymorphism allelotrope and genotype frequencies

^*Chromosome number (2n)

The genotype CC/CT of ACS smoker antagonism smoker contrast is to TT, odds ratio (OR)=0.66,95% confidence limit 0.43-1.0, χ ²(Mantel-Haenszel)=4.33, p=0.04,

CC/CT genotype=protectiveness (TT=susceptibility)

The allele C of ACS smoker antagonism smoker contrast is to T, odds ratio (OR)=0.65,95% confidence limit 0.5-0.9, χ ²(Mantel-Haenszel)=5.75, p=0.02,

C allelotrope=protectiveness

Table 8a.ACS patient and resistance smoker's Toll sample acceptor 4 (TLR4) Asp 299Gly A/G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype AG/GG of ACS smoker antagonism smoker contrast is to AA, odds ratio (OR)=0.54,95% confidence limit 0.3-1.1, χ ²(Mantel-Haenszel)=3.27, p=0.07,

AG/GG genotype=protectiveness (AA=susceptibility)

TLR4 Asp299Gly A/G and TLR4 Thr399Ile C/T are in linkage disequilibrium

Table 8b.ACS patient and resistance smoker's Toll sample acceptor 4 (TLR4) Thr 399Ile C/T polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype CT/TT of ACS smoker antagonism smoker contrast is to CC, odds ratio (OR)=0.54,95% confidence limit 0.3-1.1, χ ²(Mantel-Haenszel)=3.67, p=0.06,

CT/TT genotype=protectiveness (CC=susceptibility)

TLR4 Thr399Ile C/T and TLR4 Asp 299Gly A/G are in linkage disequilibrium

Table 9.ACS patient and resistance smoker's interferon-gamma (IFNG) 874A/T polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype TT of ACS smoker antagonism smoker contrast is to AA/AT, odds ratio (OR)=0.57,95% confidence limit 0.3-0.96, χ ²(Mantel-Haenszel)=4.98, p=0.03,

TT genotype=protectiveness

Nf (the NFKBIL1)-63T/A polymorphism allelotrope and the genotype frequency of table 10.ACS patient and resistance smoker B cell K light chain polypeptide genetic enhancer.

^*Chromosome number (2n)

The frequency of genotypes AA of ACS smoker antagonism smoker contrast is to AT/TT, odds ratio (OR)=0.73,95% confidence limit 0.5-1.1, χ ²(Mantel-Haenszel)=2.66, p=0.10,

AA genotype=protectiveness

NFKBIL1-63 T/A and LTA Thr26Asn are in linkage disequilibrium

Table 11.ACS patient and resistance smoker's platelet derived growth factor receptor α (PDGFRA)-1630 insertion/disappearance) AACTT/Del polymorphism allelotrope and genotype frequency

^*Chromosome number (2n): I=inserts AACTT, the D=disappearance

The genotype ID/DD of ACS smoker antagonism smoker contrast is to II, odds ratio (OR)=0.68,95% confidence limit 0.5-1.0, χ ²(Mantel-Haenszel)=3.69, p=0.05,

ID/DD genotype=protectiveness (II susceptibility)

Interleukin-4 (IL-4)-589C/T polymorphism allelotrope and genotype frequency of table 12.ACS patient and resistance smoker.

^*Chromosome number (2n)

The genotype CT/TT of ACS smoker antagonism smoker contrast is to CC, odds ratio (OR)=0.68,95% confidence limit 0.42-1.1, χ ²(Mantel-Haenszel)=2.57, p=0.11,

CT/TT genotype=protectiveness (CC=susceptibility)

Table 13.ACS patient and resistance smoker's matrix metalloproteinase 1 (MMP1)-1607 1G/2G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype 1G1G of ACS smoker antagonism smoker contrast is to 1G2G/2G2G, odds ratio (OR)=1.4,95% confidence limit 0.9-2.1, χ ²(Mantel-Haenszel)=2.44, p=0.12,

1G1G genotype=susceptibility

Table 14.ACS patient and resistance smoker's thrombocyte derivation growth factor ' alpha ' (PDGFA) 12 IN 5C/T polymorphism allelotrope and genotype frequencies

^*Chromosome number (2n)

The genotype TT of ACS smoker antagonism smoker contrast is to CT/CC, odds ratio (OR)=1.4,95% confidence limit 0.9-2.2, χ ²(Mantel-Haenszel)=2.21, p=0.14,

TT genotype=susceptibility

Table 15.ACS patient and resistance smoker's L-glutamic acid-halfcystine ligase enzyme is modified subunit (GCLM)-588C/T polymorphism allelotrope and genotype frequency

^*Chromosome number (2n)

The genotype CT/TT of ACS smoker antagonism smoker contrast is to CC, odds ratio (OR)=1.4,95% confidence limit 0.9-2.0, χ ²(Mantel-Haenszel)=2.34, p=0.13,

CT/TT genotype=susceptibility (CC protectiveness)

Table 16.ACS patient and resistance smoker's olfactory receptor analogue OR13G1 Ile132Val A/G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The frequency of genotypes AA of ACS smoker antagonism smoker contrast is to AG/GG, odds ratio (OR)=1.4,95% confidence limit 0.9-2.1, χ ²(Mantel-Haenszel)=2.20, p=0.14,

AA genotype=susceptibility

Table 17.ACS patient and resistance smoker's interleukin 10 (IL-10)-1084 A/G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype GG of ACS smoker antagonism smoker contrast is to AA/AG, odds ratio (OR)=0.74,95% confidence limit 0.5-1.2, χ ²(Mantel-Haenszel)=1.74, p=0.19,

GG genotype=protectiveness

Table 18.ACS patient and resistance smoker's alpha1-antitrypsin S-allele Glu 288 Val A/T (M/S) polymorphism allelotrope and genotype frequencies

^*Chromosome number (2n)

The genotype AT/TT of ACS smoker antagonism smoker contrast is to AA, odds ratio (OR)=1.5,95% confidence limit 0.8-2.7, χ ²(Mantel-Haenszel)=1.95, p=0.16,

AT/TT genotype=susceptibility

Table 19.ACS patient and resistance smoker's intercellular adhesion molecule 1 (ICAM1) K469E A/G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The frequency of genotypes AA of ACS smoker antagonism smoker contrast is to AG/GG, odds ratio (OR)=0.70,95% confidence limit 0.5-1.1, χ ²(Mantel-Haenszel)=2.91, p=0.09,

AA genotype=protectiveness

The table related transcript 1 of 20.ACS patient (BAT1)-23C/G polymorphism allelotrope and genotype frequency with resistance smoker's HLA-B.

^*Chromosome number (2n)

The genotype GG of ACS smoker antagonism smoker contrast is to CC/CG, odds ratio (OR)=0.71,95% confidence limit 0.5-1.1, χ ²(Mantel-Haenszel)=2.88, p=0.09,

GG genotype=protectiveness

Table 21.ACS patient and resistance smoker's nitricoxide synthase 3 (NOS3) Glu298Asp G/T polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype GG of ACS smoker antagonism smoker contrast is to GT/TT, odds ratio (OR)=0.72,95% confidence limit 0.5-1.1, χ ²(Mantel-Haenszel)=2.79, p=0.09,

GG genotype=protectiveness

Table 22.ACS patient and resistance smoker's superoxide-dismutase 3 (SOD3) Arg213Gly C/G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype CG/GG of ACS smoker antagonism smoker contrast is to CC, odds ratio (OR)=0.23,95% confidence limit 0.01-1.7, χ ²(Mantel-Haenszel)=2.31, p=0.13,

CG/GG genotype=protectiveness

Type 1 plasminogen activator inhibitor 1 (PAI-1)-668#Del/G (4G/5G) polymorphism allelotrope and genotype frequency of table 23.ACS patient and resistance smoker

^*Chromosome number (2n)

^#Identical with PAI-1-6754G/5G polymorphism

The genotype 5G5G of ACS smoker antagonism smoker contrast is to 4G5G/4G4G, odds ratio (OR)=0.72,95% confidence limit 0.4-1.2, χ ²(Mantel-Haenszel)=1.7, p=0.19,

5G5G genotype=protectiveness

Table 24.ACS patient and resistance smoker's macrophage inflammatory protein 1 alpha (MIP1A) 459 C/T polymorphism allelotrope and genotype frequencies

^*Chromosome number (2n)

The genotype CT/TT of ACS smoker antagonism smoker contrast is to CC, odds ratio (OR)=1.31,95% confidence limit 0.9-2.0, χ ²(Mantel-Haenszel)=1.81, p=0.18,

CT/TT genotype=susceptibility

The allelotrope T of ACS smoker antagonism smoker contrast is to C, odds ratio (OR)=1.33,95% confidence limit 0.9-1.9, χ ²(Mantel-Haenszel)=2.87, p=0.09,

T allelotrope=susceptibility

Table 25.ACS patient and resistance smoker's matrix metalloproteinase 7 (MMP7)-181 A/G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype GG of ACS smoker antagonism smoker contrast is to AA/AG, odds ratio (OR)=0.70,95% confidence limit 0.4-1.2, χ ²(Mantel-Haenszel)=1.73, p=0.19,

GG genotype=protectiveness

Table 26.ACS patient and resistance smoker's the Asn125Ser A/G of cathepsin G polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype AG/GG of ACS smoker antagonism smoker contrast is to AA, odds ratio (OR)=0.58,95% confidence limit 0.27-1.22, χ ²(Mantel-Haenszel)=2.36, p=0.12,

AG/GG genotype=protectiveness (AA susceptibility)

Table 27.ACS object and resistance smoker's chemokine (CX3C motif) acceptor 1 (CX3CR1) I249V C/T polymorphism allelotrope and genotype frequency.

Chromosome number (2n)

The genotype TT vs CC/CT of ACS smoker vs resistance smoker contrast, odds ratio (OR)=1.5,95% confidence limits=0.82-2.81, χ ²(Mantel-Haenszel)=2.04, p=0.15,

TT genotype=susceptibility

Table 28.ACS patient and resistance smoker's Caspase (NOD2) Gly881Arg G/C polymorphism allelotrope and genotype frequency.

^*Chromosome number (2n)

The genotype CC/CG of ACS smoker antagonism smoker contrast is to GG, odds ratio (OR)=2.1,95% confidence limits=0.662-6.6, χ ²(Mantel-Haenszel)=2.05, p=0.15,

CC/CG genotype=susceptibility

Table 29.ACS patient and resistance smoker's the 372T/C of tissue inhibitor of metalloproteinase 1 (TIMP1) polymorphism allelotrope and genotype frequency

Chromosome number (2n)

The genotype TT of ACS smoker antagonism smoker contrast is to CT/CC, odds ratio (OR)=0.27,95% confidence limit=0.13-0.54, χ ²(Mantel-Haenszel)=16.42, p=0.00005,

TT genotype=protectiveness

The genotype CC of ACS smoker antagonism smoker contrast is to CT/TT, odds ratio (OR)=1.4,95% confidence limits=1.0-2.1, χ ²(Mantel-Haenszel)=3.61, p=0.06,

CC genotype=susceptibility

The allelotrope T of ACS smoker antagonism smoker contrast is to C, odds ratio (OR)=0.61,95% confidence limit=0.45-0.81, χ ²(Mantel-Haenszel)=12.64, p=0.0004,

T allelotrope=protectiveness

Following table 30 has been summed up protectiveness and susceptibility SNP that this paper identifies.The susceptibility SNP that selects is accredited as S1 to S13, and the protectiveness SNP that selects is accredited as P1 to P16.The SNP that shows with boldface letter is comprised in hereinafter to discuss and is used for generating SNP fractional SNP group.

Table 30. is summed up for the protectiveness and the susceptibility SNP of acute coronary syndrome

Gene	rs	Polymorphism	Genotype	SNP#	Phenotype	OR	The P value
Gene	rs	Polymorphism	Genotype	SNP#	Phenotype	OR	The P value	CMA1	1800875	-1903 A/G	GG	S1	Susceptibility	1.9	0.004
TGFB1	1800469	-509 C/T	CC	S2	Susceptibility	1.5	0.05	CMA1	1800875	-1903 A/G	GG	S1	Susceptibility	1.9	0.004
TGFB1	1800469	-509 C/T	CC	S2	Susceptibility	1.5	0.05	MMP12	2276109	-82 A/G	GG	S3	Susceptibility	3.2	0.05
FGF2	1449683	Ser52Ser223 C/T	CT/FT (CC)	S4	Susceptibility (protectiveness)	1.5	0.08	MMP12	2276109	-82 A/G	GG	S3	Susceptibility	3.2	0.05
FGF2	1449683	Ser52Ser223 C/T	CT/FT (CC)	S4	Susceptibility (protectiveness)	1.5	0.08	IL4RA	1801275	Q576R A/G	GG AA	S5	The susceptibility protectiveness	2.7 0.47	0.02 0.05
LTA	1041981	Thr26Asn A/C	CC	P1	Protectiveness	0.66	0.04	IL4RA	1801275	Q576R A/G	GG AA	S5	The susceptibility protectiveness	2.7 0.47	0.02 0.05
LTA	1041981	Thr26Asn A/C	CC	P1	Protectiveness	0.66	0.04	HSP70	2227956	Hom T2437C	CC/CT (TT)	P2	Protectiveness (susceptibility)	0.66	0.04
TLR4	4986790	¹Asp299Gly A/G	AG/GG (AA)	P3	Protectiveness (susceptibility)	0.54	0.07	HSP70	2227956	Hom T2437C	CC/CT (TT)	P2	Protectiveness (susceptibility)	0.66	0.04
TLR4	4986790	¹Asp299Gly A/G	AG/GG (AA)	P3	Protectiveness (susceptibility)	0.54	0.07	TLR4	4986791	²Thr399Ile C/T	CT/TT (CC)	P3.1	Protectiveness (susceptibility)	0.54	0.06
IFNG	2430561	874 A/T	TT	P4	Protectiveness	0.57	0.03	TLR4	4986791	²Thr399Ile C/T	CT/TT (CC)	P3.1	Protectiveness (susceptibility)	0.54	0.06
IFNG	2430561	874 A/T	TT	P4	Protectiveness	0.57	0.03	NFKBIL1	2071592	-63 T/A	AA	P11	Protectiveness	0.73	0.10
PDGFRA	-	-1630 I/D， (AACTT/Del)	I/Del， Del/Del (II)	P5	Protectiveness (susceptibility)	0.68	0.05	NFKBIL1	2071592	-63 T/A	AA	P11	Protectiveness	0.73	0.10
PDGFRA	-	-1630 I/D， (AACTT/Del)	I/Del， Del/Del (II)	P5	Protectiveness (susceptibility)	0.68	0.05	IL4	2243250	-589 C/T	CT/TT (CC)	P6	Protectiveness (susceptibility)	0.68	0.11
MMP1	1799750	-1607 1G/2G (Del/G)	Del.Del(ie 1G1G)	S6	Susceptibility	1.4	0.12	IL4	2243250	-589 C/T	CT/TT (CC)	P6	Protectiveness (susceptibility)	0.68	0.11
MMP1	1799750	-1607 1G/2G (Del/G)	Del.Del(ie 1G1G)	S6	Susceptibility	1.4	0.12	PDGFA	-	12IN5 C/T	TT	S7	Susceptibility	1.4	0.14
GCLM	-	-588 C/T	CT/TT (CC)	S8	Susceptibility (protectiveness)	1.4	0.13	PDGFA	-	12IN5 C/T	TT	S7	Susceptibility	1.4	0.14
GCLM	-	-588 C/T	CT/TT (CC)	S8	Susceptibility (protectiveness)	1.4	0.13	OR13G1	1151640	Ile132Val A/G	AA	S9	Susceptibility	1.4	0.14
IL-10	1800896	-1084 A/G(-1082)	GG	P12	Protectiveness	0.74	0.19	OR13G1	1151640	Ile132Val A/G	AA	S9	Susceptibility	1.4	0.14
IL-10	1800896	-1084 A/G(-1082)	GG	P12	Protectiveness	0.74	0.19	α 1-AT S-allele	17580	Glu288Val A/T (M/S)	AT/TT (MS/SS)	S10	Susceptibility	1.5	0.16
ICAM1	5498	K469E A/G	AA	P7	Protectiveness	0.70	0.09	α 1-AT S-allele	17580	Glu288Val A/T (M/S)	AT/TT (MS/SS)	S10	Susceptibility	1.5	0.16
ICAM1	5498	K469E A/G	AA	P7	Protectiveness	0.70	0.09	BAT1	2239527	-23 C/G	GG	P8	Protectiveness	0.71	0.09
NOS3	1799983	Glu298Asp G/T	GG	P9	Protectiveness	0.72	0.09	BAT1	2239527	-23 C/G	GG	P8	Protectiveness	0.71	0.09
NOS3	1799983	Glu298Asp G/T	GG	P9	Protectiveness	0.72	0.09	SOD3	1799895	Arg213Gly C/G	CG/GG	P10	Protectiveness	0.23	0.13
PAI-1	-	-668 4G/5G	5G5G	P13	Protectiveness	0.72	0.19	SOD3	1799895	Arg213Gly C/G	CG/GG	P10	Protectiveness	0.23	0.13
PAI-1	-	-668 4G/5G	5G5G	P13	Protectiveness	0.72	0.19	MIP1A	1719134	+459 C/T Intron 1	CT/TT	S11	Susceptibility	1.31	0.18
MMP7	17880821	-181 A/G	GG	P14	Protectiveness	0.70	0.19	MIP1A	1719134	+459 C/T Intron 1	CT/TT	S11	Susceptibility	1.31	0.18
MMP7	17880821	-181 A/G	GG	P14	Protectiveness	0.70	0.19	Cathepsin G		Asn 125Ser	AG/GG AA	P15	Protectiveness (susceptibility)	0.58	0.12
CX3CR1	3732379	1249V	TT	S12	Susceptibility	1.5	0.15	Cathepsin G		Asn 125Ser	AG/GG AA	P15	Protectiveness (susceptibility)	0.58	0.12
CX3CR1	3732379	1249V	TT	S12	Susceptibility	1.5	0.15	NOD2	2066845	Gly 881 Arg G/C	CC/CG	S13	Susceptibility	2.1	0.15
TIMP1	4898	372 T/C	TT CC	P16	The protectiveness susceptibility	0.27 1.4	0.00005 0.06	NOD2	2066845	Gly 881 Arg G/C	CC/CG	S13	Susceptibility	2.1	0.15

Discuss as this paper, S3 and S6 are in LD, and P1 and P11 are in LD, and P3 and P3.1 are in LD.Do not use these SNP when therefore deriving the SNP mark at same group.

Following table 31 has shown the distribution according to SNP mark ACS patient and smoking contrast.In conjunction with the analysis that 11 SNP that are made up of SNP S1-S5 and P1-P6 shown in table 30 organize, determine the SNP mark that each is individual.Each susceptibility SNP assignment is+1, and each protectiveness SNP assignment is-1.

Fig. 1 has shown this data in the graphic representation mode.

Table 31. is according to distribution-11SNP group of SNP mark ACS patient

Following table 32 has shown the distribution according to SNP fractional ACS object and smoking contrast, and wherein the SNP mark is measured with reference to bigger 15 SNP group.This 15 SNP group is made up of SNP S1-S5 and the P1-P10 shown in the table 30.Equally, each susceptibility SNP assignment is+1, and each protectiveness SNP assignment is-1.Fig. 2 has shown data shown in the table 32 in the graphic representation mode.

Table 32. is according to SNP fractional ACS patient's distribution-15 SNP group

Discuss

The above results discloses several polymorphisms and is associated with the rising or the reduction of the risk that ACS takes place.The association of individual polymorphism is worth although have to differentiate, and acceptable disease forecasting can not be provided.But, integrating, these polymorphic performances make a distinction the susceptible object with resistance object (smoker of ACS is for example taken place and have the smoker that similar smog exposes and have priming the pump).Polymorphism had both been represented promotor polymorphism, thereby it is considered to change genetic expression and changes protein synthesis, also represent the exon polymorphism, known its changed the aminoacid sequence (may express in addition and/or function) of the gene of a lot of coded proteins, and these protein play central role in comprising processes such as inflammation, matrix reconstruction and cytokine activity.

At not having in smoker's (though smoking but the risk of ACS takes place minimum) the comparison of ACS of ACS smoking object and coupling, the occurrence frequency that identifies several polymorphisms is more much higher or much lower than control group.Because ACS patient's formation is little, the polymorphism that therefore only shows difference trend (P=0.06-0.25) also is included into analysis, although only used the polymorphism with significant difference in Conjoint Analysis.

● when analyzing-1903 A/G polymorphisms of chyme enzyme 1 gene, discovery GG genotype is bigger in the ACS formation, and (OR=1.9 P=0.004), meets susceptibility effect (referring to table 1).Find also that in addition significantly (OR=1.4 p=0.01), meets susceptibility effect (table 1) greater than resistance smoking formation for the G allelotrope of ACS formation.

● in the analysis of-509 C/T of TGFB1 gene, find that (OR=1.5 p=0.05), meets susceptibility effect (referring to table 2) greater than resistance smoker formation for the CC genotype of ACS formation.Find also that in addition significantly (OR=1.4 p=0.05), meets susceptibility effect (table 2) greater than resistance smoker formation for the C allelotrope of ACS formation.

● the MMP12 gene-analysis of 82A/G in, find that (OR=3.2 p=0.05), meets susceptibility effect (referring to table 3) greater than resistance smoker formation for the GG genotype of ACS formation.

● in the Ser52Ser of FGF2 gene (223 C/T) polymorphism analysis, (OR=1.5 p=0.08), meets the two each tool susceptibility effect greater than resistance smoker formation for the CT of discovery ACS formation and TT genotype.(OR=1.5 p=0.07), meets the susceptibility effect to the T allelotrope of discovery ACS formation greater than resistance smoker formation.On the contrary, find CC genotype and its protective effect consistent (table 4).

● in the Q576R of IL4RA gene A/G polymorphism analysis, (OR=2.71 p=0.02), meets susceptibility effect (referring to table 5) to the GG genotype of discovery ACS formation greater than resistance smoker formation.Find also that in addition (OR=1.5 p=0.02), meets susceptibility effect (table 5) greater than resistance smoking formation for the G allelotrope of ACS formation.On the contrary, (OR=0.47 p=0.05), meets protective effect (referring to table 5) to the AA allelotrope of discovery resistance smoking formation greater than the ACS formation.

● in the Thr26Asn of LTA gene A/C polymorphism analysis, (OR=0.66 p=0.04), meets protective effect (referring to table 6) to the CC genotype of discovery resistance smoker formation greater than the ACS formation.

● in the HOM T2437C of HSP 70 genes C/T polymorphism analysis, (OR=0.66 p=0.04), meets the two each tool protective effect (referring to table 7) greater than the ACS formation for the CC of discovery resistance smoker formation and CT genotype.(OR=0.65 p=0.02), meets protective effect to the C allelotrope of discovery resistance smoker formation greater than the ACS formation.On the contrary, find TT genotype and its susceptibility effect consistent (referring to table 7).

● in the Asp299Gly of TLR4 gene A/G polymorphism analysis, (OR=0.54 p=0.07), meets the two each tool protective effect (referring to table 8a) greater than the ACS formation for the AG of discovery resistance smoker formation and GG genotype.On the contrary, find AA genotype consistent with the susceptibility effect (referring to table 8a).

● in the Thr399Ile of TLR4 gene C/T polymorphism analysis, (OR=0.54 p=0.06), meets protective effect (referring to table 8b) greater than the ACS formation for the CT of discovery resistance smoker formation and TT genotype.On the contrary, find CC genotype consistent with the susceptibility effect (table 8b).

● in the 874A/T of IFNG gene polymorphism analysis, (OR=0.57 p=0.03), meets protective effect (referring to table 9) to the TT genotype of discovery resistance smoker formation greater than the ACS formation.

● the NFKBIL1 gene-the 63T/A polymorphism analysis in, find that (OR=0.73 p=0.10), meets protective effect (referring to table 10) greater than the ACS formation for the AA genotype of resistance smoker formation.

● in-1630 Ins/Del (AACTT/Del) polymorphism analysis of PDGFRA gene, (OR=0.68 p=0.05), meets protective effect (table 11) greater than the ACS formation for the Ins Del of discovery resistance smoker formation and Del Del genotype.On the contrary, find Ins Ins genotype consistent with the susceptibility effect (referring to table 11).

● in-589 C/T polymorphism analysis of IL-4 gene, (OR=0.68 p=0.11), meets protective effect (referring to table 12) greater than the ACS formation for the CT of discovery resistance smoker formation and TT genotype.On the contrary, find CC genotype and susceptibility effect consistent (table 12).

● in-1607 1G/2G polymorphism analysis of MMP1 gene, (OR=1.4 p=0.12), meets susceptibility effect (referring to table 13) to the 1G1G genotype of discovery ACS formation greater than resistance smoker formation.

● in 12 IN of PDGFA gene, 5 C/T polymorphism analysis, (OR=1.4 p=0.14), meets susceptibility effect (referring to table 14) to the TT genotype of discovery ACS formation greater than resistance smoker formation.

● in-588 C/T polymorphism analysis of GCLM gene, (OR=1.4 p=0.13), meets susceptibility effect (referring to table 15) to the TT genotype of discovery ACS formation greater than resistance smoker formation.On the contrary, find CC genotype consistent with protective effect (referring to table 15).

● in the Ile132Val of OR13G1 gene A/G polymorphism analysis, (OR=1.4 p=0.14), meets susceptibility effect (table 16) to the AA genotype of discovery ACS formation greater than resistance smoker formation.

● in-1084 A/G polymorphism analysis of Il-10 gene, (OR=0.74 p=0.19), meets protective effect (referring to table 17) to the GG genotype of discovery resistance smoker formation greater than the ACS formation.

● in the Glu288Val A/T of α 1-AT gene (M/S) polymorphism analysis, (OR=1.5 p=0.16), meets susceptibility effect (referring to table 18) greater than resistance smoker formation for the AT of discovery ACS formation and TT genotype.

● in the K469E of ICAM1 gene A/G polymorphism analysis, (OR=0.70 p=0.09), meets protective effect (referring to table 19) to the AA genotype of discovery resistance smoker formation greater than the ACS formation.

● in-23 C/G polymorphism analysis of BAT1 gene, (OR=0.71 p=0.09), meets protective effect (referring to table 20) to the GG genotype of discovery resistance smoker formation greater than the ACS formation.

● in the Glu298Asp of nitricoxide synthase 3 genes (G/T) polymorphism analysis, (OR=0.72 p=0.09), meets protective effect (referring to table 21) to the GG genotype of discovery resistance smoker formation greater than the ACS formation.

● in the Arg213Gly of SOD3 gene C/G polymorphism analysis, (OR=0.23 p=0.13), meets protective effect (referring to table 22) greater than the ACS formation for the CG of discovery resistance smoker formation and GG genotype.

● in-668 Del/G (4G/5G) polymorphism analysis of PAI-1 gene, (OR=0.72 p=0.19), meets protective effect (referring to table 23) to the 5G5G genotype of discovery resistance smoker formation greater than the ACS formation.

● in the 459C/T of MIP1A gene polymorphism analysis, (OR=1.31 p=0.18), meets susceptibility effect (referring to table 24) greater than resistance smoker formation for the CT of discovery ACS formation and TT genotype.(OR=1.33 p=0.09), meets susceptibility effect (table 24) to the T allelotrope of discovery ACS formation greater than resistance smoking formation.

● in-181 A/G polymorphism analysis of MMP7 gene, (OR=0.70 p=0.19), meets protective effect (referring to table 25) to the GG genotype of discovery resistance smoker formation greater than the ACS formation.

● in the Asn125Ser of cathepsin G's gene A/G polymorphism analysis, (OR=0.58 p=0.12), meets the two each tool protective effect (referring to table 26) greater than the ACS formation for the AG of discovery resistance smoker formation and GG genotype.On the contrary, find AA genotype and susceptibility effect consistent (table 26).

● in the I249V of CX3CR1 gene C/T polymorphism analysis, (OR=1.5 p=0.15), meets susceptibility effect (table 27) to the TT genotype of discovery ACS formation greater than resistance smoker formation.

● in the Gly881Arg of NOD2 gene G/C polymorphism analysis, (OR=2.1 p=0.15), meets susceptibility effect (referring to table 28) greater than resistance smoker formation for the CC of discovery ACS formation and CG genotype.

● in 372 T/C polymorphism analysis of TIMP1 gene, (OR=0.27 p=0.00005), meets protective effect (referring to table 29) to the TT genotype of discovery resistance smoker formation greater than the ACS formation.Significantly (OR=0.61 p=0.0004), meets protective effect (table 29) to the T allelotrope of discovery resistance smoker formation greater than the ACS formation.On the contrary, (OR=1.4 p=0.06), meets susceptibility effect (referring to table 29) to the CC allelotrope of discovery ACS formation greater than resistance smoking formation.

People accept, and the ACS procatarxis is that idiogenetics is formed and the result of other factor joint effects, and wherein other factors comprise that it is throughout one's life to the exposure of the various air pollutant that contain tobacco smoke.Equally, people accept, and ACS comprises several vascular disease.This paper Notes of Key Data several gene pairss ACS plays a role.The transgenation that many actings in conjunction promote blood vessel injury or protection blood vessel to avoid damaging may participate in the rising to ACS resistivity or susceptibility.

Go out 20 susceptible gene types and 20 protective gene types from the Analysis and Identification of individual polymorphism, and analyze the frequency of these genotype in smoker's formation of forming by resistance smoker and the smoker who suffers from ACS.In a kind of predefined algorithm, wherein exist a kind of susceptible gene type must be divided into+1, exist a kind of protective gene type must be divided into-1, thereby generate the ACS SNP mark of every object.The ACS SNP mark that generates with reference to 11 SNP group is linear relevant with the frequency that ACS takes place.For example, the probability that ACS takes place is from having+58% the dropping to and have-4 or 5% (referring to table 31 and Fig. 1) of lower SNP fractional smoker of 2 SNP fractional smokers.In the analysis of 15 SNP that are made up of SNP S1-S5 and P1-P10 shown in another table 30 group, the probability that ACS takes place is from having 2 or 84% the reducing to and have-6 or 0% (referring to table 32 and Fig. 2) of lower SNP fractional smoker of higher SNP fractional smoker.

And, have the logarithm advantage of ACS and the SNP mark of ACS and be linear dependence---be that the SNP mark is high more, have the possibility big more (referring to Fig. 3) of acute coronary syndrome.Initial analysis according to C statistical value (be equivalent to and optimize test susceptibility and the following area of specific receiver operating curve), the C statistical value is as follows: SNP mark=0.65, SNP mark/age=0.74, SNP mark/BMI/ sex=0.78, SNP/ mark/BMI/ sex/age=0.93.

Therefore, the SNP mark independent association of ACS can be used inclusive NAND genetic risk factor to unite separately and make the risk that is used for assessing the risk of ACS and has the acute coronary incident in having ACS.

These discoveries show that the method for the invention was the ACS of measurable individuality before symptom occurs.

Therefore these find also to provide chance for therapeutic intervention discussed in this article and/or treatment plan.In brief, this class intervention or scheme can comprise providing to object carries out the power that mode of life changes, or comprises and be used to make abnormal gene expression or the normal methods of treatment of gene product functional rehabilitation.For example, as shown here ,-675 5G5G genotype of the promotor of PAI-1 gene reduce related with the risk that ACS takes place.It is reported that 5G allelotrope descends relevant in conjunction with increasing with genetic transcription with repressor.For having the genotypic individuality of-675 4G4G, suitable therapy can be to use the combination that can improve the repressor level and/or strengthen repressor, thereby promotes its downstream effect to transcribing.Another therapy can comprise gene therapy, for example introduces the gene of the coding repressor of at least one additional copies, and this repressor is attached to the avidity with the genotypic PAI-1 gene of-675 4G4G and raises.In another example shown in this article ,-82 A/GGG genotype of the promotor of coding MMP12 gene are associated with the ACS susceptibility.The inhibitor of known many matrix metalloproteinases, for example US 6,600, the inhibitor that 057 (integral body is incorporated this paper into) discussed, for example form the tissue inhibitor of metalloproteinase that comprises TIMP1, TIMP2, TIMP3 and TIMP4 (TIMP) of the mixture of non-activity with MMP, the conditioning agent of proteolytic enzyme more widely that stops MMP to play a role, activate the conditioning agent of MMP (comprising that film is in conjunction with MMP (the MT-MMP)) genetic expression of MMP secretion zymogen forms, for example 4, the compound of 5-dihydroxyanthraquinone-2-carboxylic acid (AQCA) and derivative thereof.Have-the genotypic object of 82A/G GG for known, suitable therapy can be to use the medicament of the genetic expression that can reduce coding MMP12, or use and to reduce the active medicament of MMP12, for example express or active medicament, or use and to reduce expression or the active medicament of one or more films in conjunction with MMP or other MMP12 activator by using one or more TIMP that to raise.For example, suitable therapy can be to use the MMP1 inhibitor to this class object, for example 4, and 5-dihydroxyanthraquinone-2-carboxylic acid (AQCA), anthraquinonyl-mercaptoethylamine, anthraquinonyl-L-Ala hydroxamic acid or their derivative.Equally, the 372T/C CC genotype of coding TIMP1 gene is relevant with the ACS susceptibility.Have a genotypic object of 372T/C CC for known, suitable therapy can be to use the medicament that can regulate and preferably increase the genetic expression of coding TIMP1.

In another example, with respect to the protective gene type, a certain susceptible gene type raises with genetic expression and is associated.For known object with susceptible gene type, suitable therapy is by for example using antisense or RNAi method to use the medicament that can reduce described genetic expression.Another suitable therapy can be to use the inhibitor of described gene product to this class object.In a further example, being present in the reduction that susceptible gene type and the combination of repressor in the gene promoter increase with genetic transcription is associated.Suitable therapy is to use can reduce the repressor level and/or prevent repressor bonded medicament, thereby alleviates its downward modulation effect to transcribing.Another therapy can comprise gene therapy, for example introduces the gene (gene copy that for example has the protective gene type) to the reduction of repressor binding affinity of at least one each additional copies.

The method and the medicament that are suitable for being applied in this class therapy are known in the art, and discuss in this article.

The evaluation of susceptibility described herein and protectiveness polymorphism also provides the screening candidate compound to assess the chance of its effect in preventing and/or treating.This class screening method relates to the candidate compound of the ability of the genotype of identifying a series of abilities with the genotype that reverses or offset the susceptibility polymorphism or phenotype effect or simulation or copy protection sexual polymorphism or phenotype effect.

In addition, the present invention also provides and has been used for the possible reactive method of evaluation object to existing prevention or methods of treatment.When existing treatment process related to physiologically active concentration with excessive or insufficient expressing gene product and returns to for age of object and sex in the normal scope, these class methods were particularly suitable for.In these cases, described method comprises whether exist, raise or down-regulation of gene expression if detecting the susceptibility polymorphism when it exists, make this excessive or insufficient state be the result, and the object that wherein has described polymorphism may be the respondent who handles.

Embodiment 2

Present embodiment has been described this paper has been identified that the SNP related with the risk that ACS takes place is substituted by the SNP that is in linkage disequilibrium with it, shows that this class SNP can obtain similar SNP mark.At this, when the SNP in being in LD is replaced by the concrete SNP that this paper put down in writing, can use substituting SNP to obtain the SNP mark.For this point is described, TLR4 Asp299Gly A/G SNP is replaced from the TLR4 Thr399Ile C/T SNP in the 11SNP group.It is reported that these two SNP are in linkage disequilibrium (it is reported the G allelotrope T allelotrope almost total and the Thr399Ile polymorphism of Asp299Gly polymorphism be divided into from).Table 33 hereinafter clearly illustrated this be divided into from, wherein there are 99% consistence (having got rid of genotyping " failure ") in Asp299Gly polymorphism genotype and Thr399Ile polymorphism genotype.

Consistence between table 33.TLR4 299 and 399 polymorphisms.

TLR4 299 genotype	TLR4 399 genotype	Consistence (%)	Summation
TLR4 299 genotype	TLR4 399 genotype	Consistence (%)	Summation	AA 534	CC 524 TC 6 failures 4	524/530 (99％)	534
AG 69	TC 68 TT 1	68/69 (99％)	69	AA 534	CC 524 TC 6 failures 4	524/530 (99％)	534
AG 69	TC 68 TT 1	68/69 (99％)	69	GG 2	TT 2	2/2	2

(100％)
(100％)		Failure 3	CC 3	3
	608	Failure 3	CC 3	3

Table 34 has shown that when TLR4 Asp299Gly SNP is substituted by the TLR4 Thr399IleSNP of 11 SNP group ACS organizes and the SNP score distribution of control group.During derivation SNP mark, this means that mark with AG/GG genotype (protectiveness=+ 1) replaces with the mark of CT/TT genotype (protectiveness=+ 1) and calculates the latter's mark.But table 34 top shadow grid is represented and table 31 shown in comparative group between difference.Fig. 4 drawing illustrates the similar mark with Fig. 1 in the graphic representation mode.

Table 34. is according to the distribution-alternate 11SNP group of SNP mark ACS object

Therefore, replace the mark that has clinical meaning with derivation with this paper SNP that SNP that SNP fractional SNP is in LD can be in LD with it that is used to derive.

Table 35 has hereinafter provided the representative example that the polymorphism of indicating with table 30 is in linkage disequilibrium.Use public database can locate the example of this class polymorphism, for example Www.hapmap.orgOn database.The polymorphism of indicating illustrates with bracket.The rs number that provides as those of skill in the art will recognize that is the unique identifier of each polymorphism.

These results show that the SNP that is put down in writing with this paper is in the SNP of the LD SNP of table 35 (for example from) and can be used in the SNP mark with similar clinical application.

Table 35. and the SNP that is in linkage disequilibrium with the related SNP of susceptibility or protectiveness phenotype.

CMA1

rs7150627	rs2007323	rs11844710	rs7151943	rs7148705
rs7150627	rs2007323	rs11844710	rs7151943	rs7148705	rs1885107	rs9806075	rs4982956	rs1956920	rs7146705
rs12434912	rs1956921	rs2208447	rs927281	rs1800875(-1903 A/G)	rs1885107	rs9806075	rs4982956	rs1956920	rs7146705
rs12434912	rs1956921	rs2208447	rs927281	rs1800875(-1903 A/G)	rs7400965	rs761988	rs1800876	rs6573850	rs1956916
rs3759635	rs8007723	rs1956917	rs1956922	rs927278	rs7400965	rs761988	rs1800876	rs6573850	rs1956916
rs3759635	rs8007723	rs1956917	rs1956922	rs927278	rs1956918	rs1956923	rs2007316	rs1956919

TGFB1

rs1529717	rs13447341	rs1046909	rs2241712
rs1529717	rs13447341	rs1046909	rs2241712	rs2241714	rs1982072	rs2317130	rs4803457
rs1800469(-509 C/T)	rs1982073	rs1800471		rs2241714	rs1982072	rs2317130	rs4803457

MMP12

rs17368890	rs11225444	rs608194	rs12793969	rs1277718
rs17368890	rs11225444	rs608194	rs12793969	rs1277718	rs4323842	rs17099726	rs7931510	rs12786343	rs7934568
rs17099720	rs4420231	rs7934710	rs3814766	rs4393288	rs4323842	rs17099726	rs7931510	rs12786343	rs7934568
rs17099720	rs4420231	rs7934710	rs3814766	rs4393288	rs621170	rs2276109(-82 A/G)	rs11225443	rs11225445	rs10895367
rs17368659	rs636648	rs495914	rs7126998	rs17368814	rs621170	rs2276109(-82 A/G)	rs11225443	rs11225445	rs10895367
rs17368659	rs636648	rs495914	rs7126998	rs17368814	rs610341	rs1799750(MMP1-1607 G/GG)	rs501371	rs610338

FGF2

rs13434728	rs308395	rs12509901	rs308405	rs13434738
rs13434728	rs308395	rs12509901	rs308405	rs13434738	rs308396	rs177814	rs308404	rs308447	rs308397
rs308412	rs10470916	rs13435470	rs308398	rs1563704	rs308396	rs177814	rs308404	rs308447	rs308397
rs308412	rs10470916	rs13435470	rs308398	rs1563704	rs308403	rs10003693	rs308399	rs10049563	rs308402
rs11940812	rs308400	rs308411	rs308401	rs13137174	rs308403	rs10003693	rs308399	rs10049563	rs308402
rs11940812	rs308400	rs308411	rs308401	rs13137174	rs1449683(Ser52Ser)	rs308410	rs10028307	rs2922979	rs416124
rs7668232	rs3804144	rs374880	rs13349352	rs2922980	rs1449683(Ser52Ser)	rs308410	rs10028307	rs2922979	rs416124
rs7668232	rs3804144	rs374880	rs13349352	rs2922980	rs308409	rs11940156	rs12650248	rs4574429	rs308391
rs1992980	rs308408	rs12507250	rs2922981	rs367344	rs308409	rs11940156	rs12650248	rs4574429	rs308391
rs1992980	rs308408	rs12507250	rs2922981	rs367344	rs308392	rs1984971	rs367331	rs11098673	rs366192
rs308407	rs6828763	rs411027	rs968346	rs6829351	rs308392	rs1984971	rs367331	rs11098673	rs366192
rs308407	rs6828763	rs411027	rs968346	rs6829351	rs421184	rs4254785	rs308393	rs2926173	rs728694
rs6830094	rs11934448	rs13119363	rs308394	rs4146526	rs421184	rs4254785	rs308393	rs2926173	rs728694
rs6830094	rs11934448	rs13119363	rs308394	rs4146526	rs308406

IL4RA

rs3024672	rs1805012	rs3024696	rs2234899	rs3024673
rs3024672	rs1805012	rs3024696	rs2234899	rs3024673	rs2234923	rs3024674	rs2234900	rs3024675	rs1805013
rs3024676	rs1805015	rs2234897	rs1801275(Q576R)	rs6413500	rs2234923	rs3024674	rs2234900	rs3024675	rs1805013
rs3024676	rs1805015	rs2234897	rs1801275(Q576R)	rs6413500	rs3024677	rs1805011	rs3024678	rs2234898	rs1805016

LTA

rs2857708	rs3093540	rs4645834	rs4947326	rs2516312
rs2857708	rs3093540	rs4645834	rs4947326	rs2516312	rs3093547	rs4947327	rs2844482	rs3093545	rs2844486
rs2071590	rs4248157	rs2857601	rs1800683	rs9282875	rs3093547	rs4947327	rs2844482	rs3093545	rs2844486
rs2071590	rs4248157	rs2857601	rs1800683	rs9282875	rs2844485	rs2239704	rs1799964	rs3131637	rs3093546
rs4647198	rs7449641	rs909253	rs9282876	rs12174951	rs2844485	rs2239704	rs1799964	rs3131637	rs3093546
rs4647198	rs7449641	rs909253	rs9282876	rs12174951	rs4986978	rs2507961	rs3135048	rs746868	rs1800630
rs2844484	rs4647193	rs2844483	rs4647194	rs9267499	rs4986978	rs2507961	rs3135048	rs746868	rs1800630
rs2844484	rs4647193	rs2844483	rs4647194	rs9267499	rs2857713	rs2857706	rs3093542	rs2009658	rs3093543
rs3093539	rs2071589	rs736160	rs1041981(Thr26Asn)	rs915654	rs2857713	rs2857706	rs3093542	rs2009658	rs3093543
rs3093539	rs2071589	rs736160	rs1041981(Thr26Asn)	rs915654	rs4647195	rs4647191	rs4647196	rs4647192	rs3093544

HSP70

rs547828	rs11557921	rs2075800	rs1061581
rs547828	rs11557921	rs2075800	rs1061581	rs2227956(T2437C)	rs506770	rs1008438	rs541340
rs1043618	rs508603	rs11557923	rs508633	rs2227956(T2437C)	rs506770	rs1008438	rs541340
rs1043618	rs508603	rs11557923	rs508633	rs1043620	rs562047	rs12190359	rs11557924

TLR4

rs2149356	rs5030714	rs5030727	rs4986790(Asp299Gly)	rs5030728
rs2149356	rs5030714	rs5030727	rs4986790(Asp299Gly)	rs5030728	rs2770145	rs5030729	rs2770144	rs100001066	rs5031050

rs5030710	rs11536884	rs5030711	rs4986791(Thr399Ile)	rs5030712
rs5030710	rs11536884	rs5030711	rs4986791(Thr399Ile)	rs5030712	rs16906079	rs5030713

IFNG

rs2069705	rs2069713	rs2069719	rs2069724	rs2069731
rs2069705	rs2069713	rs2069719	rs2069724	rs2069731	rs1861494	rs9282708	rs2069725	rs2069706	rs2234685
rs2069720	rs4394909	rs2069707	rs1861493	rs1042274	rs1861494	rs9282708	rs2069725	rs2069706	rs2234685
rs2069720	rs4394909	rs2069707	rs1861493	rs1042274	rs2069726	rs3814242	rs2069714	rs2069721	rs2069727
rs2069709	rs2069715	rs2069734	rs2069710	rs2069716	rs2069726	rs3814242	rs2069714	rs2069721	rs2069727
rs2069709	rs2069715	rs2069734	rs2069710	rs2069716	rs2069722	rs2069711	rs2069717	rs2234687	rs2069712
rs2069718	rs7957366	rs2430561(874 A/T)	rs3087272	rs2069723	rs2069722	rs2069711	rs2069717	rs2234687	rs2069712

NFKBIL1

rs2071592(-63 T/A)	rs2844492	rs12181589	rs3869143	rs2857710
rs2071592(-63 T/A)	rs2844492	rs12181589	rs3869143	rs2857710	rs2516386	rs2523500	rs11756780	rs4081553	rs3131641
rs2516385	rs2523499	rs2857606	rs4947324	rs2844490	rs2516386	rs2523500	rs11756780	rs4081553	rs3131641
rs2516385	rs2523499	rs2857606	rs4947324	rs2844490	rs11962114	rs9267491	rs2516395	rs4947325	rs2844489
rs2239708	rs2516383	rs9267493	rs2516479	rs2857709	rs11962114	rs9267491	rs2516395	rs4947325	rs2844489
rs2239708	rs2516383	rs9267493	rs2516479	rs2857709	rs2071591	rs7749930	rs12526552	rs13215091	rs2844488
rs9380262	rs6916921	rs12200955	rs2516392	rs2844487	rs2071591	rs7749930	rs12526552	rs13215091	rs2844488
rs9380262	rs6916921	rs12200955	rs2516392	rs2844487	rs3219183	rs9378162	rs3130061	rs2516391	rs2857602
rs9267489	rs7754479	rs13220163	rs2857603	rs2857708	rs3219183	rs9378162	rs3130061	rs2516391	rs2857602
rs9267489	rs7754479	rs13220163	rs2857603	rs2857708	rs3219182	rs11752951	rs13220165	rs2516390	rs4947326
rs3219181	rs11752976	rs2857605	rs9501149	rs4947327	rs3219182	rs11752951	rs13220165	rs2516390	rs4947326
rs3219181	rs11752976	rs2857605	rs9501149	rs4947327	rs3219180	rs2255798	rs2857604	rs9267494	rs2844486
rs2857607	rs9267492	rs3093949	rs6903106	rs2857601	rs3219180	rs2255798	rs2857604	rs9267494	rs2844486
rs2857607	rs9267492	rs3093949	rs6903106	rs2857601	rs9267490	rs3094594	rs2239707	rs928815	rs2844485
rs9394075	rs2516397	rs3219179	rs7762619	rs3131637	rs9267490	rs3094594	rs2239707	rs928815	rs2844485
rs9394075	rs2516397	rs3219179	rs7762619	rs3131637	rs2516384	rs2516396	rs2230365	rs12663590	rs7449641
rs13190709	rs2255899	rs3130062	rs7746486	rs12174951	rs2516384	rs2516396	rs2230365	rs12663590	rs7449641
rs13190709	rs2255899	rs3130062	rs7746486	rs12174951	rs2523501	rs9394076	rs13192469	rs3135043	rs3135048
rs7738380	rs12661769	rs9469024	rs3135042	rs2844484	rs2523501	rs9394076	rs13192469	rs3135043	rs3135048
rs7738380	rs12661769	rs9469024	rs3135042	rs2844484	rs11751074	rs6929796	rs4288225	rs2523514

PDGFRA

rs7682912	rs17084062	rs890203	rs2412555	rs4484359
rs7682912	rs17084062	rs890203	rs2412555	rs4484359	rs17084065	rs4864861	rs11941325	rs12649484	rs2114039
rs4864504	rs11942406	rs7683707	rs13140747	rs4608869	rs17084065	rs4864861	rs11941325	rs12649484	rs2114039
rs4864504	rs11942406	rs7683707	rs13140747	rs4608869	rs11944066	rs12506783	rs13114391	rs4368668	rs4422471
rs17084050(-1630I/D)	rs17084067	rs4635872	rs10029499	rs17084051	rs11944066	rs12506783	rs13114391	rs4368668	rs4422471
rs17084050(-1630I/D)	rs17084067	rs4635872	rs10029499	rs17084051	rs6850748	rs4637467	rs7673597	rs1800809	rs4864862
rs7677751	rs7673625	rs6554162	rs4864505	rs7673984	rs6850748	rs4637467	rs7673597	rs1800809	rs4864862
rs7677751	rs7673625	rs6554162	rs4864505	rs7673984	rs1800810	rs4864863	rs4352534	rs1800813	rs4864844
rs4394060	rs1135534	rs7678144	rs4508953	rs1800812	rs1800810	rs4864863	rs4352534	rs1800813	rs4864844
rs4394060	rs1135534	rs7678144	rs4508953	rs1800812	rs6554163	rs4864857	rs7690503	rs6836215	rs4864858
rs7673027	rs6554164	rs4864859	rs7668190	rs11727127	rs6554163	rs4864857	rs7690503	rs6836215	rs4864858
rs7673027	rs6554164	rs4864859	rs7668190	rs11727127	rs4864860	rs7689569	rs11937644	rs7698425	rs12644271
rs13435164	rs7681399	rs7673853	rs6554165	rs6839108	rs4864860	rs7689569	rs11937644	rs7698425	rs12644271
rs13435164	rs7681399	rs7673853	rs6554165	rs6839108	rs7679903	rs6842432

IL4

rs2243250(-589C/T)	rs2243261	rs2243280	rs10066662	rs4986963
rs2243250(-589C/T)	rs2243261	rs2243280	rs10066662	rs4986963	rs2227282	rs2243281	rs6885996	rs17772853	rs2243263
rs6879348	rs13181331	rs2070874	rs2243264	rs2243282	rs2227282	rs2243281	rs6885996	rs17772853	rs2243263
rs6879348	rs13181331	rs2070874	rs2243264	rs2243282	rs13161530	rs2243251	rs2243265	rs2243283	rs4426908
rs4986964	rs2243266	rs2243284	rs7731792	rs2243252	rs13161530	rs2243251	rs2243265	rs2243283	rs4426908
rs4986964	rs2243266	rs2243284	rs7731792	rs2243252	rs2243267	rs2243285	rs11749544	rs2079102	rs2243268

rs7703922	rs6897429	rs734244	rs9282745	rs12521281
rs7703922	rs6897429	rs734244	rs9282745	rs12521281	rs2406539	rs2243253	rs9282746	rs2243286	rs11747814
rs4996002	rs2243270	rs2243287	rs10043403	rs9327636	rs2406539	rs2243253	rs9282746	rs2243286	rs11747814
rs4996002	rs2243270	rs2243287	rs10043403	rs9327636	rs2243308	rs2243309	rs11242122	rs9327637	rs2243271
rs2243288	rs11242123	rs2243254	rs2243272	rs2243289	rs2243308	rs2243309	rs11242122	rs9327637	rs2243271
rs2243288	rs11242123	rs2243254	rs2243272	rs2243289	rs11242124	rs2243255	rs2243273	rs2243290	rs11242125
rs2243257	rs2243274	rs2243291	rs6879672	rs2243258	rs11242124	rs2243255	rs2243273	rs2243290	rs11242125
rs2243257	rs2243274	rs2243291	rs6879672	rs2243258	rs2243275	rs2243292	rs1859139	rs2243259	rs2243276
rs7379604	rs1859138	rs2227284	rs2243277	rs7379607	rs2243275	rs2243292	rs1859139	rs2243259	rs2243276
rs7379604	rs1859138	rs2227284	rs2243277	rs7379607	rs10068370	rs2243260	rs2243279	rs10066660	rs11949166

MMP1

rs498186	rs509332	rs570662	rs575727	rs473509
rs498186	rs509332	rs570662	rs575727	rs473509	rs534191	rs7125865	rs7102189	rs2075847	rs1155764
rs2000609	rs573764	rs470146	rs7107224	rs2839969	rs534191	rs7125865	rs7102189	rs2075847	rs1155764
rs2000609	rs573764	rs470146	rs7107224	rs2839969	rs574939	rs1799750(-16071G/2G)	rs685265	rs12283571	rs542603
rs470211	rs12279710	rs519806	rs12280880	rs533621	rs574939	rs1799750(-16071G/2G)	rs685265	rs12283571	rs542603
rs470211	rs12279710	rs519806	rs12280880	rs533621	rs2408490	rs12285331	rs526215	rs470206	rs470307
rs12286876	rs504875	rs2105581	rs484915	rs634607	rs2408490	rs12285331	rs526215	rs470206	rs470307
rs12286876	rs504875	rs2105581	rs484915	rs634607	rs12283759	rs11225427	rs552306

PDGFA

rs1800815 C-26IN3T

No rs His69His

rs1800814(C+12IN5T)

GCLM

rs3170633	rs2234730	rs12094906	rs2273407	rs10489605
rs3170633	rs2234730	rs12094906	rs2273407	rs10489605	rs6703130	rs7515991	rs2273406	rs12094966	rs11165031
rs12057371	rs12401915	rs7549683	rs6667121	rs12068345	rs6703130	rs7515991	rs2273406	rs12094966	rs11165031
rs12057371	rs12401915	rs7549683	rs6667121	rs12068345	rs743119	rs7513671	rs1803636	rs11165033	rs736762
rs1087480g	rs11165032	rs7527855	no rs number(-588C/T)	rs7552401	rs743119	rs7513671	rs1803636	rs11165033	rs736762
rs1087480g	rs11165032	rs7527855	no rs number(-588C/T)	rs7552401	rs12062047	rs3827715	rs6700112	rs11589165	rs17376966
rs12040570	rs11587480	rs2234729	rs12090038	rs12062214	rs12062047	rs3827715	rs6700112	rs11589165	rs17376966
rs12040570	rs11587480	rs2234729	rs12090038	rs12062214	rs6680315	rs4598495	rs12062216	rs6541405	rs12090230
rs12760946	rs12730517	rs6692306	rs12089163	rs7541690	rs6680315	rs4598495	rs12062216	rs6541405	rs12090230
rs12760946	rs12730517	rs6692306	rs12089163	rs7541690	rs6702045	rs12140446	rs718873	rs6702064	rs7522297
rs718874	rs2391323	rs7517826	rs718875	rs2064764	rs6702045	rs12140446	rs718873	rs6702064	rs7522297
rs718874	rs2391323	rs7517826	rs718875	rs2064764	rs7515191	rs12741834	rs12143416	rs1803635	rs12410324
rs12064127	rs12068168	rs2301022	rs769211	rs7515813	rs7515191	rs12741834	rs12143416	rs1803635	rs12410324
rs12064127	rs12068168	rs2301022	rs769211	rs7515813	rs3789453

OR13G1

rs1151640Ile132Val

The SNP that does not have other genotypings

IL10

rs3024498	rs3024508	rs1518110	rs3024489	rs3024510
rs3024498	rs3024508	rs1518110	rs3024489	rs3024510	rs1878672	rs3021094	rs3024488	rs3024497	rs3024493
rs3024491	rs1800872	rs3024496	rs3024507	rs3021093	rs1878672	rs3021094	rs3024488	rs3024497	rs3024493
rs3024491	rs1800872	rs3024496	rs3024507	rs3021093	rs1800895	rs5743628	rs3024492	rs3790622	rs1800871
rs3024495	rs2352792	rs3024490	rs1800894	rs5743627	rs1800895	rs5743628	rs3024492	rs3790622	rs1800871
rs3024495	rs2352792	rs3024490	rs1800894	rs5743627	rs1554286	rs2222202	rs1800896(IL10-1082A/G)	rs3024509	rs5743626
rs3021098	rs3024494	rs1518111	rs3001099	rs9282740	rs1554286	rs2222202	rs1800896(IL10-1082A/G)	rs3024509	rs5743626
rs3021098	rs3024494	rs1518111	rs3001099	rs9282740	rs3024506	rs5743625

AAT；SERPINA1

rs17824597	rs1243166	rs11846959	rs20546	rs17090693
rs17824597	rs1243166	rs11846959	rs20546	rs17090693	rs1051052	rs17090719	rs11558261	rs1243168	rs1243165
rs2070709	rs709932	rs1884549	rs7142803	rs2753938	rs1051052	rs17090719	rs11558261	rs1243168	rs1243165

rs17751614	rs7144409	rs1243162	rs1243167	rs1243164
rs17751614	rs7144409	rs1243162	rs1243167	rs1243164	rs2749547	rs1884548	rs2073333	rs2753937	rs1885065
rs1243163	rs2854258	rs1884547	rs1802960	Rs17580 (S-allele)	rs2749547	rs1884548	rs2073333	rs2753937	rs1885065
rs1243163	rs2854258	rs1884547	rs1802960	Rs17580 (S-allele)	rs1884546	rs1303	rs1049800	rs9944117	rs13170
rs2230075	rs875989	rs12233	rs8350	rs877084	rs1884546	rs1303	rs1049800	rs9944117	rs13170
rs2230075	rs875989	rs12233	rs8350	rs877084	rs12077	rs6647	rs877083	rs1050520	rs11558264
rs877082	rs1050469	rs7141735	rs877081	rs1802961	rs12077	rs6647	rs877083	rs1050520	rs11558264
rs877082	rs1050469	rs7141735	rs877081	rs1802961	rs7145047	rs11568814	rs1802959	rs2239652	rs9944155
rs2753939	rs7145770	rs11832	rs2749521	rs2239651	rs7145047	rs11568814	rs1802959	rs2239652	rs9944155
rs2753939	rs7145770	rs11832	rs2749521	rs2239651	rs11628917	rs1802962	rs11558263

ICAM1

rs1799969	rs5030383	rs2735439	rs2569705	rs5493
rs1799969	rs5030383	rs2735439	rs2569705	rs5493	rs281436	rs2569697	rs10402760	rs5030381	rs923366
rs2075742	rs2569706	rs5494	rs281437	rs2569698	rs281436	rs2569697	rs10402760	rs5030381	rs923366
rs2075742	rs2569706	rs5494	rs281437	rs2569698	rs2569707	rs3093033	rs3093030	rs11669397	rs2735441
rs5495	rs5030384	rs901886	rs2436545	rs1801714	rs2569707	rs3093033	rs3093030	rs11669397	rs2735441
rs5495	rs5030384	rs901886	rs2436545	rs1801714	rs5030385	rs885742	rs2436546	rs13306429	rs3810159
rs2569699	rs2916060	rs2071441	rs281438	rs1056538	rs5030385	rs885742	rs2436546	rs13306429	rs3810159
rs2569699	rs2916060	rs2071441	rs281438	rs1056538	rs2916059	rs5496	rs3093029	rs11549918	rs2916058
rs5497	rs2735442	rs2569700	rs2569708	rs13306430	rs2916059	rs5496	rs3093029	rs11549918	rs2916058
rs5497	rs2735442	rs2569700	rs2569708	rs13306430	rs2569693	rs2228615	rs12972990	rs5498(K469E)	rs281439
rs2569701	rs735747	rs5030400	rs281440	rs2569702	rs2569693	rs2228615	rs12972990	rs5498(K469E)	rs281439
rs2569701	rs735747	rs5030400	rs281440	rs2569702	rs885743	rs2071440	rs2569694	rs2735440	rs5499
rs11575073	rs2569703	rs3093032	rs2569695	rs10418913	rs885743	rs2071440	rs2569694	rs2735440	rs5499
rs11575073	rs2569703	rs3093032	rs2569695	rs10418913	rs1057981	rs2075741	rs1056536	rs5500	rs11575074
rs2569704	rs5501	rs2569696	rs11673661		rs1057981	rs2075741	rs1056536	rs5500	rs11575074

BAT1

rs10456058	rs3219190	rs3130057	rs2523507	rs2516485
rs10456058	rs3219190	rs3130057	rs2523507	rs2516485	rs1048885	rs1266079	rs2239525	rs2734572	rs11264
rs2844504	rs2239526	rs3093984	rs9267480	rs9267483	rs1048885	rs1266079	rs2239525	rs2734572	rs11264
rs2844504	rs2239526	rs3093984	rs9267480	rs9267483	rs16899756	rs3130051	rs3093978	rs13211189	rs2239527(-23G/C)
rs2734580	rs11543322	rs2734583	rs2523506	rs3130052	rs16899756	rs3130051	rs3093978	rs13211189	rs2239527(-23G/C)
rs2734580	rs11543322	rs2734583	rs2523506	rs3130052	rs2516478	rs2516338	rs2523505	rs3130053	rs3130056
rs9267484	rs2239528	rs2734579	rs2734585	rs9380261	rs2516478	rs2516338	rs2523505	rs3130053	rs3130056
rs9267484	rs2239528	rs2734579	rs2734585	rs9380261	rs16899760	rs2734578	rs2516477	rs9267485	rs2523504
rs2734577	rs3853601	rs3130058	rs2844509	rs3130633	rs16899760	rs2734578	rs2516477	rs9267485	rs2523504
rs2734577	rs3853601	rs3130058	rs2844509	rs3130633	rs3093977	rs2516394	rs3130630	rs2907768	rs2734584
rs3093975	rs3130629	rs2516484	rs9267481	rs3093974	rs3093977	rs2516394	rs3130630	rs2907768	rs2734584
rs3093975	rs3130629	rs2516484	rs9267481	rs3093974	rs12662306	rs9267478	rs11796	rs1129640	rs9267487
rs2734588	rs3093948	rs933208	rs2251824	rs2516483	rs12662306	rs9267478	rs11796	rs1129640	rs9267487
rs2734588	rs3093948	rs933208	rs2251824	rs2516483	rs1055385	rs2071596	rs12215563	rs2516482	rs1055384
rs2516393	rs2071594	rs2516481	rs1055388	rs2523512	rs1055385	rs2071596	rs12215563	rs2516482	rs1055384
rs2516393	rs2071594	rs2516481	rs1055388	rs2523512	rs2071593	rs3130054	rs3131629	rs2523511	rs2239705
rs9394074	rs6915692	rs3219187	rs2523503	rs2516480	rs2071593	rs3130054	rs3131629	rs2523511	rs2239705
rs9394074	rs6915692	rs3219187	rs2523503	rs2516480	rs3131628	rs2071595	rs2523502	rs2259435	rs6915573
rs2239709	rs3093983	rs3093976	rs2516473	rs2286712	rs3131628	rs2071595	rs2523502	rs2259435	rs6915573
rs2239709	rs3093983	rs3093976	rs2516473	rs2286712	rs7753431	rs9501148	rs13206927	rs2516475	rs2523510
rs2734587	rs2516474	rs2269476	rs3093982	rs2471826	rs7753431	rs9501148	rs13206927	rs2516475	rs2523510
rs2734587	rs2516474	rs2269476	rs3093982	rs2471826	rs12665489	rs2734586	rs2734582	rs11757236	rs3130055
rs929138	rs12665501	rs3093981	rs2075581	rs12178599	rs12665489	rs2734586	rs2734582	rs11757236	rs3130055
rs929138	rs12665501	rs3093981	rs2075581	rs12178599	rs3093980	rs2734581	rs2079170	rs2075582	rs2075580
rs2523508	rs3093979	rs9267482	rs7738430	rs3115537	rs3093980	rs2734581	rs2079170	rs2075582	rs2075580
rs2523508	rs3093979	rs9267482	rs7738430	rs3115537	rs10456396	rs3130059

rs2373962	rs2566519	rs2853797	rs2373961	rs3918157
rs2373962	rs2566519	rs2853797	rs2373961	rs3918157	rs13311166	rs6951150	rs3918158	rs13310774	rs13238512
rs3918159	rs2853798	rs10247107	rs2566516	rs11974098	rs13311166	rs6951150	rs3918158	rs13310774	rs13238512
rs3918159	rs2853798	rs10247107	rs2566516	rs11974098	rs10276930	rs3918225	rs3918166	rs10277237	rs3918160
rs3730001	rs12703107	rs1800779	rs3918167	rs6946340	rs10276930	rs3918225	rs3918166	rs10277237	rs3918160
rs3730001	rs12703107	rs1800779	rs3918167	rs6946340	rs2243311	rs3918168	rs6946091	rs3918161	rs3918169
rs6946415	rs10952298	rs3918170	rs10952296	rs2070744	rs2243311	rs3918168	rs6946091	rs3918161	rs3918169
rs6946415	rs10952298	rs3918170	rs10952296	rs2070744	rs3793342	rs13309715	rs3918226	rs3793341	rs10952297
rs3918162	rs1549758	rs7784943	rs3918163	rs1007311	rs3793342	rs13309715	rs3918226	rs3793341	rs10952297
rs3918162	rs1549758	rs7784943	rs3918163	rs1007311	rs11771443	rs3918164	rs9282803	rs2243310	rs3918165
rs9282804	rs1800783	rs1800781	rs1799983(Asp298Glu)	rs3918155	rs11771443	rs3918164	rs9282803	rs2243310	rs3918165
rs9282804	rs1800783	rs1800781	rs1799983(Asp298Glu)	rs3918155	rs13310854	rs3918156	rs13310763

SOD3

rs1799895；Arg213Gly

Be positioned at the recombination hotspot district

PAI-1

rs6972498	rs7788533	rs2227707	rs12536798	rs6975620
rs6972498	rs7788533	rs2227707	rs12536798	rs6975620	rs2227631	rs6959121	rs6956010	rs1799768(-675/-668 4G/5G)	rs17135252
rs12534508	rs4729662	rs4729664	rs11770439	rs2527316	rs2227631	rs6959121	rs6956010	rs1799768(-675/-668 4G/5G)	rs17135252
rs12534508	rs4729662	rs4729664	rs11770439	rs2527316	rs4727479	rs2854235	rs4729663	rs10228765	rs6950982
rs2854225	rs6465787	rs2854226			rs4727479	rs2854235	rs4729663	rs10228765	rs6950982

MIP1A

rs8075808	rs1719126	rs4995343	rs17616714	rs5023530
rs8075808	rs1719126	rs4995343	rs17616714	rs5023530	rs4995344	rs7214787	rs5023529	rs4995345	rs9903603
rs5023528	rs4995346	rs1634486	rs5023527	rs9972917	rs4995344	rs7214787	rs5023529	rs4995345	rs9903603
rs5023528	rs4995346	rs1634486	rs5023527	rs9972917	rs7213813	rs1396785	rs1634497	rs8075709	rs2522124
rs7406518	rs1634488	rs2522125	rs1634498	rs1634489	rs7213813	rs1396785	rs1634497	rs8075709	rs2522124
rs7406518	rs1634488	rs2522125	rs1634498	rs1634489	rs764871	rs8076279	rs3859285	rs764872	rs1634499
rs3859286	rs2376461	rs17679109	rs3859287	rs2011959	rs764871	rs8076279	rs3859285	rs764872	rs1634499
rs3859286	rs2376461	rs17679109	rs3859287	rs2011959	rs9972960	rs1634490	rs1719127	rs1634500	rs17616756
rs3169944	rs1634501	rs5022560	rs1049203	rs17617023	rs9972960	rs1634490	rs1719127	rs1634500	rs17616756
rs3169944	rs1634501	rs5022560	rs1049203	rs17617023	rs2136430	rs8951	rs1634502	rs4319819	rs1049200
rs17617047	rs6505505	rs16971943	rs8068313	rs1620728	rs2136430	rs8951	rs1634502	rs4319819	rs1049200
rs17617047	rs6505505	rs16971943	rs8068313	rs1620728	rs1049199	rs12602397	rs4302099	rs3210166	rs1634503
rs4319820	rs1063340	rs2687498	rs1634491	rs1049195	rs1049199	rs12602397	rs4302099	rs3210166	rs1634503
rs4319820	rs1063340	rs2687498	rs1634491	rs1049195	rs16971970	rs4506953	rs1049191	rs12452083	rs1634492
rs16971944	rs5011009	rs1634493	rs8070375	rs4636955	rs16971970	rs4506953	rs1049191	rs12452083	rs1634492
rs16971944	rs5011009	rs1634493	rs8070375	rs4636955	rs4309452	rs1049188	rs1626203	rs5015795	rs16971946
rs9900984	rs1851503	rs5029406	rs12937093	rs1719209	rs4309452	rs1049188	rs1626203	rs5015795	rs16971946
rs9900984	rs1851503	rs5029406	rs12937093	rs1719209	rs5029407	rs12937627	rs16971936	rs1049131	rs1719135
rs16971937	rs1049121	rs1719136	rs1634494	rs1049114	rs5029407	rs12937627	rs16971936	rs1049131	rs1719135
rs16971937	rs1049121	rs1719136	rs1634494	rs1049114	rs1634504	rs9893539	rs5029408	rs1634505	rs12601899
rs5029409	rs11658357	rs9916016	rs5029410	rs1634506	rs1634504	rs9893539	rs5029408	rs1634505	rs12601899
rs5029409	rs11658357	rs9916016	rs5029410	rs1634506	rs1719123	rs1719130	rs16971972	rs16971938	rs6505506
rs9913910	rs1879917	rs6505507	rs1634507	rs1719124	rs1719123	rs1719130	rs16971972	rs16971938	rs6505506
rs9913910	rs1879917	rs6505507	rs1634507	rs1719124	rs1719131	rs17679271	rs7406217	rs1130371	rs8072326
rs7406596	rs16971957	rs2072091	rs7406597	rs1851501	rs1719131	rs17679271	rs7406217	rs1130371	rs8072326
rs7406596	rs16971957	rs2072091	rs7406597	rs1851501	rs1634508	rs7502900	rs1719133	rs7220510	rs7222527
rs1634495	rs1719134(+459C/T)	rs2188973	rs16971960	rs2188974	rs1634508	rs7502900	rs1719133	rs7220510	rs7222527
rs1634495	rs1719134(+459C/T)	rs2188973	rs16971960	rs2188974	rs4995339	rs7222850	rs4995340	rs7222217	rs4995341
rs1719125	rs4995342				rs4995339	rs7222850	rs4995340	rs7222217	rs4995341

MMP7

rs14983	rs11225305	rs12289943	rs2847530	rs12419959
rs14983	rs11225305	rs12289943	rs2847530	rs12419959	rs12788028	rs7926218	rs12419977	rs10895308	rs2187364

rs11225306	rs2408391	rs2156528	rs11225307	rs11820758
rs11225306	rs2408391	rs2156528	rs11225307	rs11820758	rs17098292	rs10502001	rs880197	rs17352054	rs12289049
rs1943778	rs11225303	rs10750646	rs11827824	rs12288254	rs17098292	rs10502001	rs880197	rs17352054	rs12289049
rs1943778	rs11225303	rs10750646	rs11827824	rs12288254	rs10502002	rs1943779	rs7933135	rs11225308	rs7926470
rs12575975	rs11225304	rs11225309	rs17098295	rs17098317	rs10502002	rs1943779	rs7933135	rs11225308	rs7926470
rs12575975	rs11225304	rs11225309	rs17098295	rs17098317	rs6590970	rs10895306	rs1996352	rs10895307	rs12418158
rs2408390	rs2701982	rs17881472	rs12419636	rs17880821(-181A/G)	rs6590970	rs10895306	rs1996352	rs10895307	rs12418158
rs2408390	rs2701982	rs17881472	rs12419636	rs17880821(-181A/G)	rs17098306	rs4543946	rs12285347	rs17098318

Cathepsin G

rs9671740	rs34792401	rs12588201	rs10148261	rs6573865	rs8007970
rs9671740	rs34792401	rs12588201	rs10148261	rs6573865	rs8007970	rs11848310	rs35614744	rs35345293	rs4537944	rs2332397	rs8012655
rs12889110	rs10311660	rs4981537	rs36079901	rs2332398	rs1956907	rs11848310	rs35614744	rs35345293	rs4537944	rs2332397	rs8012655
rs12889110	rs10311660	rs4981537	rs36079901	rs2332398	rs1956907	rs12587099	rs12147842	rs4981538	rs9989246	rs3891906	rs1956906
rs12879629	rs9671474	rs4981539	rs9989184	rs3891905	rs35316440	rs12587099	rs12147842	rs4981538	rs9989246	rs3891906	rs1956906
rs12879629	rs9671474	rs4981539	rs9989184	rs3891905	rs35316440	rs35776728	rs1756602	rs4981540	rs34712519	rs11851298	rs28778409
rs35270658	rs11157885	rs34432073	rs12100969	rs3861508	rs8008954	rs35776728	rs1756602	rs4981540	rs34712519	rs11851298	rs28778409
rs35270658	rs11157885	rs34432073	rs12100969	rs3861508	rs8008954	rs34377408	rs10143176	rs35884608	rs10144984	rs7142675	rs2093256
rs34310125	rs12436232	rs4981541	rs10145731	rs11301449	rs11158781	rs34377408	rs10143176	rs35884608	rs10144984	rs7142675	rs2093256
rs34310125	rs12436232	rs4981541	rs10145731	rs11301449	rs11158781	rs35426278	rs5007574	rs9646161	rs28806511	rs28441642	rs7157694
rs2216900	rs28878775	rs4982959	rs10145286	rs2011607	rs8005739	rs35426278	rs5007574	rs9646161	rs28806511	rs28441642	rs7157694
rs2216900	rs28878775	rs4982959	rs10145286	rs2011607	rs8005739	rs12435455	rs35112976	rs11158761	rs28803584	rs11158778	rs7143951
rs10138356	rs34065379	rs4632067	rs9652365	rs11845858	rs7144090	rs12435455	rs35112976	rs11158761	rs28803584	rs11158778	rs7143951
rs10138356	rs34065379	rs4632067	rs9652365	rs11845858	rs7144090	rs4644778	rs12433770	rs34318040	rs12888328	rs2224426	rs7144096
rs11850630	rs11159232	rs8010555	rs12887710	rs4982968	rs7144104	rs4644778	rs12433770	rs34318040	rs12888328	rs2224426	rs7144096
rs11850630	rs11159232	rs8010555	rs12887710	rs4982968	rs7144104	rs34841597	rs12882370	rs10148816	rs8006887	rs35704637	rs34651242
rs12879894	rs36126615	rs10133351	rs8007599	rs1951132	rs10136912	rs34841597	rs12882370	rs10148816	rs8006887	rs35704637	rs34651242
rs12879894	rs36126615	rs10133351	rs8007599	rs1951132	rs10136912	rs4375584	rs9672023	rs12890682	rs9652294	rs1951131	rs9323523
rs800849	rs9944068	rs4553550	rs7155992	rs1951130	rs28722668	rs4375584	rs9672023	rs12890682	rs9652294	rs1951131	rs9323523
rs800849	rs9944068	rs4553550	rs7155992	rs1951130	rs28722668	rs34042254	rs9944069	rs4537943	rs12888151	rs1951129	rs35959655
rs34545435	rs1956918	rs12433996	rs34436261	rs3079309	rs34997518	rs34042254	rs9944069	rs4537943	rs12888151	rs1951129	rs35959655
rs34545435	rs1956918	rs12433996	rs34436261	rs3079309	rs34997518	rs12885502	rs1956917	rs34092671	rs36100678	rs34634241	rs17257069
rs12885756	rs1956916	rs8005125	rs35239717	rs11849152	rs6573871	rs12885502	rs1956917	rs34092671	rs36100678	rs34634241	rs17257069
rs12885756	rs1956916	rs8005125	rs35239717	rs11849152	rs6573871	rs12885748	rs761988	rs35584604	rs12587746	rs1956911	rs17105013
rs12885747	rs927281	rs1956915	rs34035545	rs12888496	rs28479407	rs12885748	rs761988	rs35584604	rs12587746	rs1956911	rs17105013
rs12885747	rs927281	rs1956915	rs34035545	rs12888496	rs28479407	rs12885233	rs12434912	rs10873216	rs4420452	rs1956910	rs12100907
rs34449575	rs28656464	rs34656084	rs721134	rs1956909	rs11158791	rs12885233	rs12434912	rs10873216	rs4420452	rs1956910	rs12100907
rs34449575	rs28656464	rs34656084	rs721134	rs1956909	rs11158791	rs34780137	rs35275136	rs34416904	rs10130107	rs12588702	rs1956912
rs12886566	rs4982956	rs28496049	rs3901388	rs2332399	rs1956908	rs34780137	rs35275136	rs34416904	rs10130107	rs12588702	rs1956912
rs12886566	rs4982956	rs28496049	rs3901388	rs2332399	rs1956908	rs11850400	rs7148705	rs12589666	rs35220969	rs1951128	rs1304909
rs12882368	rs2007323	rs7151899	rs3861506	rs2332400	rs8021299	rs11850400	rs7148705	rs12589666	rs35220969	rs1951128	rs1304909
rs12882368	rs2007323	rs7151899	rs3861506	rs2332400	rs8021299	rs12882089	rs2007316	rs7149913	rs3861507	rs28768164	rs7155452
rs12896244	rs927278	rs7149925	rs3905107	rs10144882	rs2332401	rs12882089	rs2007316	rs7149913	rs3861507	rs28768164	rs7155452
rs12896244	rs927278	rs7149925	rs3905107	rs10144882	rs2332401	rs35106724	rs8007723	rs7156977	rs1956914	rs1951127	rs8007285
rs35193389	rs6573850	rs4982960	rs1956913	rs8022028	rs11849224	rs35106724	rs8007723	rs7156977	rs1956914	rs1951127	rs8007285
rs35193389	rs6573850	rs4982960	rs1956913	rs8022028	rs11849224	rs12432795	rs34858090	rs7141080	rs987630	rs10131084	rs6573874
rs12432796	rs3079301	rs33993912	rs987629	rs10139948	rs12587351	rs12432795	rs34858090	rs7141080	rs987630	rs10131084	rs6573874
rs12432796	rs3079301	rs33993912	rs987629	rs10139948	rs12587351	rs34281648	rs35839512	rs4982961	rs987628	rs10139332	rs12587425
rs800850	rs34614283	rs12878586	rs11158770	rs1951125	rs4982969	rs34281648	rs35839512	rs4982961	rs987628	rs10139332	rs12587425
rs800850	rs34614283	rs12878586	rs11158770	rs1951125	rs4982969	rs34013113	rs4982957	rs8004636	rs932617	rs33995132	rs12587539
rs11851718	rs2208447	rs10130100	rs932616	rs1951124	rs10601342	rs34013113	rs4982957	rs8004636	rs932617	rs33995132	rs12587539
rs11851718	rs2208447	rs10130100	rs932616	rs1951124	rs10601342	rs12433789	rs7146705	rs11849539	rs1885106	rs8007117	rs35533698
rs13379195	rs9806075	rs35778376	rs8008866	rs8006658	rs10601343	rs12433789	rs7146705	rs11849539	rs1885106	rs8007117	rs35533698
rs13379195	rs9806075	rs35778376	rs8008866	rs8006658	rs10601343	rs13379433	rs34657109	rs8008632	rs4982964	rs34042582	rs4592564
rs4287482	rs7151943	rs11520369	rs4982965	rs34002761	rs8019787	rs13379433	rs34657109	rs8008632	rs4982964	rs34042582	rs4592564
rs4287482	rs7151943	rs11520369	rs4982965	rs34002761	rs8019787	rs34264349	rs7150627	rs34079088	rs4982966	rs8007445	rs1885597

rs4417480	rs4981536	rs4982962	rs10134629	rs34071722	Asn 125Ser
rs4417480	rs4981536	rs4982962	rs10134629	rs34071722	Asn 125Ser	rs2792215	rs4982958	rs4981542	rs8003038	rs12890487	rs17105289
rs10313155	rs11351813	rs4982963	rs8017569	rs12890488	rs34281853	rs2792215	rs4982958	rs4981542	rs8003038	rs12890487	rs17105289
rs10313155	rs11351813	rs4982963	rs8017569	rs12890488	rs34281853	rs34640640	rs10712328	rs36074365	rs10137473	rs12890064	rs2070697

CX3CR1

rs4234139	rs11707528	rs17038647	rs2669850	rs4676621	rs34570795
rs4234139	rs11707528	rs17038647	rs2669850	rs4676621	rs34570795	rs11129819	rs17793056	rs4676622	rs34841495	rs11129820	rs2669851
rs12491311	rs6599018	rs9826296	rs2853714	rs34980214	rs11709600	rs11129819	rs17793056	rs4676622	rs34841495	rs11129820	rs2669851
rs12491311	rs6599018	rs9826296	rs2853714	rs34980214	rs11709600	rs17038663	rs36040453	rs35840437	rs34991361	rs7636125	rs34864276
rs35425914	rs9847920	rs11710546	rs13088991	rs13078589	rs17038640	rs17038663	rs36040453	rs35840437	rs34991361	rs7636125	rs34864276
rs35425914	rs9847920	rs11710546	rs13088991	rs13078589	rs17038640	rs17038674	rs13099085	rs9869871	rs1050592	rs34681148	rs10695501
rs3732378	rs35007101	rs35540291	rs3732379(I249V)	rs6790767	rs4016736	rs17038674	rs13099085	rs9869871	rs1050592	rs34681148	rs10695501
rs3732378	rs35007101	rs35540291	rs3732379(I249V)	rs6790767	rs4016736	rs4986872	rs9882352	rs11711922	rs17038679	rs938206	rs4676623
rs3732380	rs938207	rs34481570	rs7645269	rs11706384	rs4676487	rs4986872	rs9882352	rs11711922	rs17038679	rs938206	rs4676623
rs3732380	rs938207	rs34481570	rs7645269	rs11706384	rs4676487	rs4271863	rs11711391	rs35291973	rs35502141	rs7649301	rs1877563
rs34743375	rs17038638	rs11713282	rs12634272	rs13315491	rs17038645	rs4271863	rs11711391	rs35291973	rs35502141	rs7649301	rs1877563
rs34743375	rs17038638	rs11713282	rs12634272	rs13315491	rs17038645	rs34139145

NOD2

rs6596	rs34430742	rs1078327	rs8061960	rs12929234	rs17314544
rs6596	rs34430742	rs1078327	rs8061960	rs12929234	rs17314544	rs35435054	rs4785224	rs5743274	rs34192073	rs34552113	rs17223195
rs35581802	rs5743261	rs35422070	rs2066847	rs35899583	rs13337656	rs35435054	rs4785224	rs5743274	rs34192073	rs34552113	rs17223195
rs35581802	rs5743261	rs35422070	rs2066847	rs35899583	rs13337656	rs8054275	rs5743262	rs1861759	rs5743293	rs12324931	rs13338860
rs13339019	rs5743263	rs5743275	rs5743294	rs3135501	rs12599914	rs8054275	rs5743262	rs1861759	rs5743293	rs12324931	rs13338860
rs13339019	rs5743263	rs5743275	rs5743294	rs3135501	rs12599914	rs35973532	rs8046608	rs5743276	rs34829738	rs3135502	rs35234675
rs1131716	rs35378728	rs2066844	rs2357791	rs3135503	rs16948819	rs35973532	rs8046608	rs5743276	rs34829738	rs3135502	rs35234675
rs1131716	rs35378728	rs2066844	rs2357791	rs3135503	rs16948819	rs17846633	rs5743264	rs5743277	rs7359452	rs34683241	rs7200370
rs34428900	rs5743265	rs35285618	rs7203344	rs11861521	rs4785226	rs17846633	rs5743264	rs5743277	rs7359452	rs34683241	rs7200370
rs34428900	rs5743265	rs35285618	rs7203344	rs11861521	rs4785226	rs2302723	rs5743266	rs5743278	rs5743295	rs4785450	rs11646600
rs7195707	rs2076752	rs6413461	rs5743296	rs11862710	rs17223257	rs2302723	rs5743266	rs5743278	rs5743295	rs4785450	rs11646600
rs7195707	rs2076752	rs6413461	rs5743296	rs11862710	rs17223257	rs9888893	rs5743267	rs3813758	rs35980453	rs11862720	rs11865799
rs7191692	rs8061316	rs5743279	rs3135499	rs1990752	rs35072258	rs9888893	rs5743267	rs3813758	rs35980453	rs11862720	rs11865799
rs7191692	rs8061316	rs5743279	rs3135499	rs1990752	rs35072258	rs10600956	rs8061636	rs5743280	rs5743297	rs11864090	rs11866167
rs35509283	rs34456998	rs5743281	rs5743298	rs34464167	rs10451132	rs10600956	rs8061636	rs5743280	rs5743297	rs11864090	rs11866167
rs35509283	rs34456998	rs5743281	rs5743298	rs34464167	rs10451132	rs12448380	rs16948754	rs5743282	rs5743299	rs34620046	rs3064638
rs12445637	rs34627107	rs4785225	rs3135500	rs8062105	rs2066852	rs12448380	rs16948754	rs5743282	rs5743299	rs34620046	rs3064638
rs12445637	rs34627107	rs4785225	rs3135500	rs8062105	rs2066852	rs7202124	rs35085911	rs16948773	rs5743300	rs34321598	rs2302759
rs2270369	rs34281847	rs9931711	rs8056611	rs16948792	rs7194167	rs7202124	rs35085911	rs16948773	rs5743300	rs34321598	rs2302759
rs2270369	rs34281847	rs9931711	rs8056611	rs16948792	rs7194167	rs2270368	rs7206340	rs17313265	rs35111385	rs34741614	rs34233862
rs35929558	rs36034720	rs34912053	rs2357792	rs11859047	rs12444259	rs2270368	rs7206340	rs17313265	rs35111385	rs34741614	rs34233862
rs35929558	rs36034720	rs34912053	rs2357792	rs11859047	rs12444259	rs34828195	rs35701609	rs35263569	rs12600253	rs11863594	rs28705891
rs2287195	rs2076753	rs10680678	rs12598306	rs11864698	rs28654666	rs34828195	rs35701609	rs35263569	rs12600253	rs11863594	rs28705891
rs2287195	rs2076753	rs10680678	rs12598306	rs11864698	rs28654666	rs2066848	rs34936594	rs35322998	rs7205423	rs1477176	rs11382774
rs36094725	rs35095295	rs11646168	rs718226	rs35967774	rs34593836	rs2066848	rs34936594	rs35322998	rs7205423	rs1477176	rs11382774
rs36094725	rs35095295	rs11646168	rs718226	rs35967774	rs34593836	rs11336436	rs34684955	rs35431588	rs34963149	rs2066851	rs2160683
rs10709169	rs2067085	rs9925315	rs11646242	rs1592639	rs3743781	rs11336436	rs34684955	rs35431588	rs34963149	rs2066851	rs2160683
rs10709169	rs2067085	rs9925315	rs11646242	rs1592639	rs3743781	rs4785223	rs16948755	rs5743284	rs35151581	rs9925070	rs9646285
rs9926569	rs34939799	rs5743285	rs7498888	rs11863544	rs16948829	rs4785223	rs16948755	rs5743284	rs35151581	rs9925070	rs9646285
rs9926569	rs34939799	rs5743285	rs7498888	rs11863544	rs16948829	rs9939349	rs2111235	rs751271	rs5816718	rs3064635	rs34088926
rs28651300	rs35617724	rs748855	rs11323644	rs12933741	rs16948836	rs9939349	rs2111235	rs751271	rs5816718	rs3064635	rs34088926
rs28651300	rs35617724	rs748855	rs11323644	rs12933741	rs16948836	rs8062727	rs2111234	rs1861758	rs8060765	rs12933742	rs17314948
rs8044354	rs7190413	rs13332952	rs16948789	rs11863916	rs34262697	rs8062727	rs2111234	rs1861758	rs8060765	rs12933742	rs17314948
rs8044354	rs7190413	rs13332952	rs16948789	rs11863916	rs34262697	rs8043770	rs7206582	rs7198979	rs17313747	rs5816721	rs7184210
rs10459815	rs8045009	rs1861757	rs5816719	rs11859674	rs34917190	rs8043770	rs7206582	rs7198979	rs17313747	rs5816721	rs7184210
rs10459815	rs8045009	rs1861757	rs5816719	rs11859674	rs34917190	rs9302752	rs6500328	rs7203691	rs35360138	rs1420873	rs34015619
rs13331872	rs7500036	rs5743286	rs5816720	rs8053457	rs34678551	rs9302752	rs6500328	rs7203691	rs35360138	rs1420873	rs34015619

rs1420685	rs8057341	rs5743287	rs34562455	rs6500329	rs35812259
rs1420685	rs8057341	rs5743287	rs34562455	rs6500329	rs35812259	rs5816713	rs35863026	rs11319364	rs3064634	rs7500289	rs6500333
rs33925268	rs12918060	rs34103974	rs751919	rs12924216	rs17223592	rs5816713	rs35863026	rs11319364	rs3064634	rs7500289	rs6500333
rs33925268	rs12918060	rs34103974	rs751919	rs12924216	rs17223592	rs4027240	rs7204911	rs10521209	rs3743782	rs1548989	rs11866769
rs35554928	rs7500826	rs2066845 Gly881 Arg G/C)	rs11353661	rs16948808	rs1861762	rs4027240	rs7204911	rs10521209	rs3743782	rs1548989	rs11866769
rs35554928	rs7500826	rs2066845 Gly881 Arg G/C)	rs11353661	rs16948808	rs1861762	rs2004804	rs4785449	rs5743288	rs7199842	rs4283227	rs7187386
rs12448915	rs12922299	rs5743289	rs1362698	rs1420872	rs8051573	rs2004804	rs4785449	rs5743288	rs7199842	rs4283227	rs7187386
rs12448915	rs12922299	rs5743289	rs1362698	rs1420872	rs8051573	rs5816714	rs11649521	rs8063130	rs2216313	rs4785451	rs35224296
rs5816715	rs13339578	rs2076756	rs11364818	rs6500331	rs3922267	rs5816714	rs11649521	rs8063130	rs2216313	rs4785451	rs35224296
rs5816715	rs13339578	rs2076756	rs11364818	rs6500331	rs3922267	rs34609432	rs17221417	rs12920425	rs10655305	rs11644525	rs3087557
rs11297087	rs13331327	rs12920040	rs35620436	rs35189427	rs1054987	rs34609432	rs17221417	rs12920425	rs10655305	rs11644525	rs3087557
rs11297087	rs13331327	rs12920040	rs35620436	rs35189427	rs1054987	rs34919724	rs11642482	rs12920558	rs11451496	rs16948810	rs9635531
rs34746653	rs11642646	rs11326665	rs1548990	rs16948811	rs11374168	rs34919724	rs11642482	rs12920558	rs11451496	rs16948810	rs9635531
rs34746653	rs11642646	rs11326665	rs1548990	rs16948811	rs11374168	rs34550909	rs17312836	rs11292073	rs7195766	rs16948813	rs33995398
rs5816716	rs5743268	rs11423748	rs9940175	rs6500332	rs4785452	rs34550909	rs17312836	rs11292073	rs7195766	rs16948813	rs33995398
rs5816716	rs5743268	rs11423748	rs9940175	rs6500332	rs4785452	rs34235838	rs5743269	rs12919099	rs8060598	rs17222902	rs4785453
rs3064632	rs5743270	rs12920721	rs7198188	rs1420871	rs4785227	rs34235838	rs5743269	rs12919099	rs8060598	rs17222902	rs4785453
rs3064632	rs5743270	rs12920721	rs7198188	rs1420871	rs4785227	rs1981760	rs12925051	rs2076755	rs7187352	rs2302760	rs4785454
rs8063362	rs12929565	rs5743290	rs34564491	rs7192397	rs4785455	rs1981760	rs12925051	rs2076755	rs7187352	rs2302760	rs4785454
rs8063362	rs12929565	rs5743290	rs34564491	rs7192397	rs4785455	rs9933594	rs13380733	rs5743291	rs12599808	rs17314341	rs3064640
rs1362632	rs13380741	rs11642651	rs11271535	rs12597446	rs13332720	rs9933594	rs13380733	rs5743291	rs12599808	rs17314341	rs3064640
rs1362632	rs13380741	rs11642651	rs11271535	rs12597446	rs13332720	rs12926429	rs11647841	rs1861756	rs7200535	rs3785141	rs16948850
rs35831008	rs34409335	rs749910	rs13336419	rs13333006	rs6500334	rs12926429	rs11647841	rs1861756	rs7200535	rs3785141	rs16948850
rs35831008	rs34409335	rs749910	rs13336419	rs13333006	rs6500334	rs4785448	rs34133110	rs34333043	rs3785142	rs3785140	rs5816722
rs11647143	rs10451131	rs2066846	rs7342808	rs9938976	rs3064642	rs4785448	rs34133110	rs34333043	rs3785142	rs3785140	rs5816722
rs11647143	rs10451131	rs2066846	rs7342808	rs9938976	rs3064642	rs34981889	rs2066842	rs5816717	rs7342715	rs8061821	rs6500335
rs7194886	rs35090774	rs4990643	rs28454013	rs8062540	rs16948851	rs34981889	rs2066842	rs5816717	rs7342715	rs8061821	rs6500335
rs7194886	rs35090774	rs4990643	rs28454013	rs8062540	rs16948851	rs34231814	rs5743271	rs1077861	rs7197362	rs16948817	rs3135504
rs11645448	rs7498256	rs34810706	rs12934597	rs8047910	rs7189846	rs34231814	rs5743271	rs1077861	rs7197362	rs16948817	rs3135504
rs11645448	rs7498256	rs34810706	rs12934597	rs8047910	rs7189846	rs35832802	rs5743272	rs5743292	rs12930153	rs4027241	rs7205760
rs5743259	rs5743273	rs9921146	rs12934724	rs34145774	rs8049077	rs35832802	rs5743272	rs5743292	rs12930153	rs4027241	rs7205760
rs5743259	rs5743273	rs9921146	rs12934724	rs34145774	rs8049077	rs5743260	rs2076754	rs11645386	rs12934730	rs35896215	rs1861761
rs2066850	rs2066843	rs7187857	rs12929222	rs2111435	rs12925755	rs5743260	rs2076754	rs11645386	rs12934730	rs35896215	rs1861761

TIMP1

rs2858769	rs13440654	rs2097423	rs35754459	rs34026683	rs5952438
rs2858769	rs13440654	rs2097423	rs35754459	rs34026683	rs5952438	rs35510014	rs17147652	rs5906436	rs2854412	rs1984392	rs7064051
rs34644595	rs3211164	rs4824621	rs34987183	rs35777532	rs12010140	rs35510014	rs17147652	rs5906436	rs2854412	rs1984392	rs7064051
rs34644595	rs3211164	rs4824621	rs34987183	rs35777532	rs12010140	rs10701204	rs35895268	rs4824622	rs34465989	rs28764016	rs12559303
rs35338820	rs28764017	rs34324592	rs1050151	rs1043428	rs5953061	rs10701204	rs35895268	rs4824622	rs34465989	rs28764016	rs12559303
rs35338820	rs28764017	rs34324592	rs1050151	rs1043428	rs5953061	rs34865437	rs5953060	rs5953062	rs35946819	rs4898(372T/C)	rs13441207
rs34663452	rs35209437	rs5953063	rs1050175	rs6609533	rs5906437	rs34865437	rs5953060	rs5953062	rs35946819	rs4898(372T/C)	rs13441207
rs34663452	rs35209437	rs5953063	rs1050175	rs6609533	rs5906437	rs10066	rs34220495	rs3921110	rs35136843	rs1803571	rs34949562
rs2855135	rs11551797	rs6520281	rs2854414	rs17850165	rs34910886	rs10066	rs34220495	rs3921110	rs35136843	rs1803571	rs34949562
rs2855135	rs11551797	rs6520281	rs2854414	rs17850165	rs34910886	rs2855136	rs1062849	rs5953065	rs2854415	rs2070584	rs9887335
rs2854416	rs6609534	rs34207832	rs2854417	rs34478552	rs35891328	rs2855136	rs1062849	rs5953065	rs2854415	rs2070584	rs9887335
rs2854416	rs6609534	rs34207832	rs2854417	rs34478552	rs35891328	rs723556	rs5906434	rs12007301	rs12394306	rs6520278	rs6609539
rs35093912	rs6520279	rs5953066	rs5953059	rs7886171	rs6608733	rs723556	rs5906434	rs12007301	rs12394306	rs6520278	rs6609539
rs35093912	rs6520279	rs5953066	rs5953059	rs7886171	rs6608733	rs34576985	rs12556415	rs4824424	rs6609532	rs5905614	rs4824623
rs4282692	rs5905615	rs6608734	rs13440825	rs5906435		rs34576985	rs12556415	rs4824424	rs6609532	rs5905614	rs4824623

Industrial application

The present invention relates to be used for the method that the risk of ACS takes place evaluation object.Described method comprises analyzing and raises with the risk that ACS takes place shown in this paper or reduce related polymorphism, or analysis derives from the result of this alanysis.The present invention also provides to use shown in this paper and has been used for the risk of evaluation object with the polymorphism that risk raises or reduction is associated of generation ACS, and the nucleotide probe and primer, test kit and the microarray that are suitable for described assessment.The present invention also provides treatment to have the method for the object of polymorphism described herein.The present invention also provides the method that is used to screen the compound that can regulate the genetic expression that is associated with polymorphism described herein.

***

This paper with reference to or all patents, publication, scientific paper and other documents mentioned and the material level that all shows one of ordinary skill in the art of the present invention, each described reference and material are incorporated in this method by reference, and its incorporated extent is identical with the degree that the independent integral body of its method is by reference incorporated into or the listed integral body of this paper is incorporated into.But the present patent application people keeps the right that will physically incorporate this specification sheets into from any and all material and the information of any described patent, publication, scientific paper, website, electronics acquired information and other materials of quoting or document.

Concrete grammar as herein described has been represented numerous embodiments or preferred implementation, and only as exemplary application, is not used in to limit the scope of the invention.Those skilled in the art can expect other purposes, aspect, embodiment and embodiment after thinking deeply this specification sheets, and they include in the spirit of the present invention that is limited by the claim scope.Can carry out various replacements and change to the present invention disclosed herein and do not depart from scope and spirit of the present invention, this is conspicuous for those skilled in the art.Illustrative ground can suitably lack under any factor or the restriction in the present invention that this paper is described to be implemented, and this point is not open especially as necessary item in this article.Therefore, for example, under the various situations of this paper, in embodiments of the present invention or embodiment, " comprise ", " substantially by ... form " and " by ... form " in any term can be by any the substituting in other two terms in this specification sheets, and so show that additional embodiment of the present invention, the present invention have different scopes and various substituting embodiment of the present invention.Equally, term " comprises ", " comprising ", " containing " etc. should wide in range understandings and the restriction that do not have.The described method of the exemplary description of this paper can different steps in order be implemented, and they might not be confined to the order of steps shown in this paper or in claims.Use as this paper and appended claims, unless context clearlys show other implications, " a kind of (a) " of singulative, " a kind of (an) " and " being somebody's turn to do " comprise plural reference.Therefore for example mentioning " a kind of host cell " comprises multiple this class host cell (for example culture or colony), or the like.This patent all cannot be interpreted as being confined to this paper concrete disclosed specific embodiment of institute or embodiment or method in any case.This patent all may not be interpreted as being subjected to the restriction of any statement that any auditor of patent and trademark office or any other official or employee make in any case, unless this statement is concrete and adopt in the present patent application people's written reply undoubtedly, and indefinite conditioned disjunction reserve.

Term that has used and expression are used as exemplary term and non-limiting term; Equivalent or these terms and the Equivalent of expressing part not getting rid of these terms when using these terms and expression and express shown and the characteristics of description, but will be appreciated that the various changes in the scope of the invention of asking for protection are fine.Therefore, be understood that, although the present invention has obtained concrete disclosing by preferred implementation and optional feature, those skilled in the art can take the change and the variation of described notion disclosed herein, and described change and variation are considered to be in the scope of the present invention.

Sequence table

＜110〉Synergenz Bioscience Ltd.

＜120〉be used to assess the method and composition of cardiovascular function and obstacle

<130>550282

<150>NZ 543520

<151>2005-11-10

<150>NZ 543985

<151>2005-12-06

<150>NZ 549951

<151>2005-09-15

<160>124

<170>PatentIn version 3.2

<210>1

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>1

acgttggatg aaggctctga agacctgttc 30

<210>2

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>2

acgttggatg atccggatta tcgggaagag 30

<210>3

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>3

acgttggatg cttggtgatg atatcgtggg 30

<210>4

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>4

acgttggatg tcttcttcct gcctgatgag 30

<210>5

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>5

acgttggatg aaacggtcgc ttcgacgtg 29

<210>6

<211>28

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>6

acgttggatg gggcagaagg aagagttc 28

<210>7

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>7

acgttggatg tacaggtgtc tgcctcctga 30

<210>8

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>8

acgttggatg aagagggtct gtcaacatgg 30

<210>9

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>9

acgttggatg atagccatga ccatgctgag 30

<210>10

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>10

acgttggatg ggccatttgt ttccctcttc 30

<210>11

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>11

acgttggatg ttgagataga tcaagggatg 30

<210>12

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>12

acgttggatg gtccgggttc tgtgaatatg 30

<210>13

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>13

acgttggatg agcatactta gactactacc 30

<210>14

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>14

acgttggatg cacactcacc agggaaaatg 30

<210>15

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>15

acgttggatg attccatgga ggctggatag 30

<210>16

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>16

acgttggatg gacaacacta ctaaggcttc 30

<210>17

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>17

acgttggatg actcacagag cacattcacg 30

<210>18

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>18

acgttggatg tgtcactcga gatcttgagg 30

<210>19

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>19

acgttggatg aggcggcgtc cgcggagaca 30

<210>20

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>20

acgttggatg ctcggccgct cttctgtcc 29

<210>21

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>21

acgttggatg ttacctaaac agggagagcg 30

<210>22

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>22

acgttggatg aagcctgcaa ccggaagtg 29

<210>23

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>23

acgttggatg ctcaggcggc cttgcactc 29

<210>24

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>24

acgttggatg aggcgcggga gcactcaga 29

<210>25

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>25

acgttggatg gctccacagc atcaagattc 30

<210>26

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>26

acgttggatg ttccatttcc tcaccctcag 30

<210>27

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>27

acgttggatg ggttcaagaa gtcatacccc 30

<210>28

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>28

acgttggatg agctctgtcc cttggatgtc 30

<210>29

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>29

acgttggatg cgacctgtcc ttctcaaaac 30

<210>30

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>30

acgttggatg gaataacagg cagactctcc 30

<210>31

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>31

acgttggatg gaaatgtcct ccagcatggg 30

<210>32

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>32

acgttggatg accctgctcc accgcatgta 30

<210>33

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>33

acgttggatg tgatcttgtt caccttgccg 30

<210>34

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>34

acgttggatg cgaggtgacg tttgacattg 30

<210>35

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>35

acgttggatg cttcagtata tcttggattg 30

<210>36

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>36

acgttggatg gttatgccac ttagatgagg 30

<210>37

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>37

acgttggatg ggagtcaatt tatgcagcag 30

<210>38

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>38

acgttggatg catcgttatt ggcaggaagc 30

<210>39

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>39

acgttggatg agcccaagaa gtttgaactc 30

<210>40

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>40

acgttggatg aggttgctgt tctcaaagtg 30

<210>41

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>41

acgttggatg gaggtcaggt ggatgtttac 30

<210>42

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>42

acgttggatg accccaagat gcatcttgcc 30

<210>43

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>43

acgttggatg ggcaactagc ctaaaaaccc 30

<210>44

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>44

acgttggatg cagagtgcgg aataaaaggc 30

<210>45

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>45

acgttggatg tgaggtagac accgcctcc 29

<210>46

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>46

acgttggatg aagagacgtg taggaagccc 30

<210>47

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>47

acgttggatg cagacattca caattgatt 29

<210>48

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>48

acgttggatg gatagttcca aacatgtgcg 30

<210>49

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>49

acgttggatg taacgcccct cacagttcac 30

<210>50

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>50

acgttggatg actccaggct ggaggaaatg 30

<210>51

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>51

acgttggatg cacagagaga gtctggacac 30

<210>52

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>52

acgttggatg tcttggtctt tccctcatcc 30

<210>53

<211>17

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>53

tcacgatgcc gacgaag 17

<210>54

<211>18

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>54

tcacgatgcc gacgaaga 18

<210>55

<211>19

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>55

ggcgtgggtg agttcattt 19

<210>56

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>56

ggcgtgggtg agttcattta 20

<210>57

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>57

gtgctgcagg ccccagatga 20

<210>58

<211>21

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>58

gtgctgcagg ccccagatga g 21

<210>59

<211>22

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>59

cggcctcctg acccttccat cc 22

<210>60

<211>23

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>60

cggcctcctg acccttccat ccc 23

<210>61

<211>22

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>61

ccacacatat ggtggttcat aa 22

<210>62

<211>23

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>62

ccacacatat ggtggttcat aac 23

<210>63

<211>23

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>63

tagatcaagg gatgatatca act 23

<210>64

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>64

tagatcaagg gatgatatca acta 24

<210>65

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>65

catacttaga ctactacctc gatg 24

<210>66

<211>25

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>66

catacttaga ctactacctc gatga 25

<210>67

<211>28

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>67

ctttcctctt acctatccct acttcccc 28

<210>68

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>68

ctttcctctt acctatccct acttccccc 29

<210>69

<211>16

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>69

acattcacgg tcacct 16

<210>70

<211>17

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>70

acattcacgg tcacctc 17

<210>71

<211>16

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>71

cgcggagaca cccatc 16

<210>72

<211>17

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>72

cgcggagaca cccatcc 17

<210>73

<211>17

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>73

cgacgaagga gggaaat 17

<210>74

<211>18

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>74

cgacgaagga gggaaatc 18

<210>75

<211>19

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>75

tcctcgctct cgcgccgcc 19

<210>76

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>76

tcctcgctct cgcgccgccc 20

<210>77

<211>19

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>77

ccaagactta agttttgct 19

<210>78

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>78

ccaagactta agttttgctc 20

<210>79

<211>19

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>79

ggaccccaac ccaagagaa 19

<210>80

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>80

ggaccccaac ccaagagaa 20

<210>81

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>81

gaaacttggg agaacattgt 20

<210>82

<211>21

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>82

gaaacttggg agaacattgt c 21

<210>83

<211>23

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>83

ttcttccccc accagtggct atc 23

<210>84

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>84

ttcttccccc accagtggct atca 24

<210>85

<211>23

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>85

acaacttgcc ggtgctcttg tcc 23

<210>86

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>86

acaacttgcc ggtgctcttg tcca 24

<210>87

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>87

gattgatttg agataagtca tatc 24

<210>88

<211>25

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>88

gattgatttg agataagtca tatcc 25

<210>89

<211>25

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>89

cagaaaaaaa aatcctttga aagac 25

<210>90

<211>26

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>90

cagaaaaaaa aatcctttga aagaca 26

<210>91

<211>26

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>91

ggtgcagatc taaatacttt aggctg 26

<210>92

<211>27

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>92

ggtgcagatc taaatacttt aggctga 27

<210>93

<211>17

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>93

gagcagcagg tttgagg 17

<210>94

<211>18

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>94

gagcagcagg tttgaggg 18

<210>95

<211>19

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>95

taaaaacccg gttctcaac 19

<210>96

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>96

taaaaacccg gttctcaaca 20

<210>97

<211>21

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>97

ctccgcctgg tgaggtctcc c 21

<210>98

<211>22

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>98

ctccgcctgg tgaggtctcc ca 22

<210>99

<211>23

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>99

ttcttacaac acaaaatcaa atc 23

<210>100

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>100

ttcttacaac acaaaatcaa atca 24

<210>101

<211>16

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>101

acttccgtcc tccacc 16

<210>102

<211>17

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>102

acttccgtcc tccacca 17

<210>103

<211>17

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>103

agtctggaca cgtgggg 17

<210>104

<211>18

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>104

agtctggaca cgtgggga 18

<210>105

<211>29

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>105

acgttggatg gtctgttgac tcttttggc 29

<210>106

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>106

acgttggatg tggtgatcac ccaaggcttc 30

<210>107

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>107

acgttggatg catagagctt aagcgtctcc 30

<210>108

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>108

acgttggatg tgatccttct ggtggtcatc 30

<210>109

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>109

acgttggatg tcagtccctc ctgggctcta 30

<210>110

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>110

acgttggatg agaagagtca gacggaatcg 30

<210>111

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>111

acgttggatg gactcttgca catcactacc 30

<210>112

<211>30

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>112

acgttggatg agtgtaggtc ttggtgaagc 30

<210>113

<211>19

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>113

tggccttttc agattctgg 19

<210>114

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>114

tggccttttc agattctggc 20

<210>115

<211>23

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>115

aagcgtctcc aggaaaatca taa 23

<210>116

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>116

aagcgtctcc aggaaaatca taac 24

<210>117

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>117

tgggatctag gcagagccac tggg 24

<210>118

<211>25

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>118

tgggatctag gcagagccac tgggc 25

<210>119

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>119

cccatcacta cctgcagttt 20

<210>120

<211>21

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>120

cccatcacta cctgcagttt c 21

<210>121

<211>20

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>121

tggccttttc agattctggg 20

<210>122

<211>24

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>122

aagcgtctcc aggaaaatca taat 24

<210>123

<211>25

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>123

tgggatctag gcagagccac tgggt 25

<210>124

<211>21

<212>DNA

<213>Artificial

<220>

<223>Synthetic

<400>124

cccatcacta cctgcagttt t 21

Claims

1. the method for the risk of ACS takes place in a determination object, and it comprises whether analysis exists one or more to be selected from following group polymorphism from the sample of described object:

The gene of coding chyme enzyme 1 (CMA1)-1903A/G;

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

The 874A/T of the gene of the plain γ of coded interference (IFNG);

The gene of coding interleukin-4 (IL-4)-589C/T;

The gene of coding interleukin 10 (IL-10)-1084A/G (1082);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

Asn 125 SerA/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

Or be in one or more polymorphisms of linkage disequilibrium with any or multiple described polymorphism;

Wherein whether the existence of one or more described polymorphisms is the indication that the risk of ACS takes place object.

2. the method for claim 1, wherein one or more existence that are selected from following group polymorphism are that the indication that the risk of ACS reduces takes place:

Ser52Ser (223 C/T) the CC genotype of the gene of coding FGF2;

The Q576R A/G AA genotype of the gene of coding IL4RA;

The Hom T2437C CC or the CT genotype of the gene of coding HSP70;

874 A/T TT genotype of the gene of coding IFNG;

The gene of coding IL-4-589C/T CT or TT genotype;

-1084 A/G GG genotype of the gene of coding IL-10;

The Arg213Gly C/G CG or the GG genotype of the gene of coding SOD3;

The Asn 125 Ser AG or the GG genotype of the gene of coding cathepsin G; Or

372 T/C TT genotype of the gene of coding TIMP1.

3. the method for claim 1, wherein one or more existence that are selected from following group polymorphism are that the indication that the risk of ACS raises takes place:

-1903 A/G GG genotype of the gene of coding CMA1;

-82 A/G GG genotype of the gene of coding MMP12;

The gene of coding MIP1A+459 C/T Intron 1CT or TT genotype;

The Asn 125 Ser AA genotype of the gene of coding cathepsin G;

The I249V TT genotype of the gene of coding CX3CR1;

The Gly 881 Arg G/C CC or the CG genotype of the gene of coding NOD2; Or

372 T/C CC genotype of the gene of coding TIMP1.

4. the method for claim 1, wherein said method comprise whether analyze described sample exists one or more to be selected from other polymorphisms of following group:

The gene of coding transforminggrowthfactor-(TGFB1)-509C/T;

The Thr26Asn A/C of the gene of coding lymphotoxin α (LTA);

The Asp299Gly A/G of the gene of coding Toll sample acceptor 4 (TLR4);

The Thr399Ile C/T of the gene of coding TLR4;

The gene of the inhibitor-like 1 (NFKBIL1) of the nf of coding B cell κ light chain polypeptide genetic enhancer-63T/A;

-1607 1G/2G (Del/G) of the gene of coding matrix metalloproteinase 1 (MMP1);

12 IN 5C/T of the gene of coding Thr6 PDGF BB α (PDGFA);

The Glu288Val A/T (M/S) of the gene of coding alpha1-antitrypsin (α 1-AT);

The K469E A/G of the gene of coding intercellular adhesion molecule 1 (ICAM1);

The gene of the coding related transcript 1 of HLA-B (BAT1)-23C/G;

The Glu298Asp G/T of the gene of coding nitricoxide synthase 3 (NOS3);

The gene of coding Type 1 plasminogen activator inhibitor 1 (PAI-1)-6684G/5G;

The gene of coding matrix metalloproteinase 7 (MMP7)-181A/G; Or

Be in one or more polymorphisms of linkage disequilibrium with one or more described polymorphisms.

5. method as claimed in claim 4, wherein one or more existence that are selected from following group polymorphism are that the indication that the risk of ACS reduces takes place:

Ser52Ser (223 C/T) the CC genotype of the gene of coding FGF2;

The Q576R A/G AA genotype of the gene of coding IL4RA;

The Thr26Asn A/C CC genotype of the gene of coding LTA;

The Hom T2437C CC or the CT genotype of the gene of coding HSP70;

The Asp299Gly A/G AG or the GG genotype of the gene of coding TLR4;

The Thr399Ile C/T CT or the TT genotype of the gene of coding TLR4;

The 874A/T TT genotype of the gene of coding IFNG;

The gene of coding NFKBIL1-63T/A AA genotype;

The gene of coding PDGFRA-1630Ins/Del (AACTT/Del) Ins/Del or Del/Del genotype;

-589 C/T CT or the TT genotype of the gene of coding IL-4;

-588 C/T CC genotype of the gene of coding GCLM;

-1084 A/G GG genotype of the gene of coding IL-10;

The K469E A/G AA genotype of the gene of coding ICAM1;

-23 C/G GG genotype of the gene of coding BAT1;

The Glu298Asp G/T GG genotype of the gene of coding NOS3;

The Arg213Gly C/G CG or the GG genotype of the gene of coding SOD3;

-668 4G/5G 5G5G genotype of the gene of coding PAI-1;

-181 A/G GG genotype of the gene of coding MMP7;

The Asn 125 Ser AG or the GG genotype of the gene of coding cathepsin G; Or

372 T/C TT genotype of the gene of coding TIMP1.

6. as claim 4 or 5 described methods, wherein one or more existence that are selected from following group polymorphism are that the indication that the risk of ACS raises takes place:

-1903 A/G GG genotype of the gene of coding CMA1;

-509 C/T CC genotype of the gene of coding TGFB1;

-82 A/G GG genotype of the gene of coding MMP12;

Ser52Ser (223 C/T) CT or TT genotype in the coding FGF2 gene;

The Q576R A/G GG genotype of the gene of coding IL4RA;

The Hom T2437C TT genotype of the gene of coding HSP70;

Asp299GlyA/GAA genotype in the coding TLR4 gene;

The Thr399Ile C/T CC genotype of the gene of coding TLR4;

The gene of coding PDGFRA-1630Ins/Del (AACTT/Del) Ins Ins (AACTTAACTT) genotype;

-589 C/T CC genotype of the gene of coding IL4;

-1607 1G/2G (Del/G) Del Del (1G 1G) genotype of the gene of coding MMP1;

12 IN5 C/T TT genotype of the gene of coding PDGFA;

-588 C/T CT or the TT genotype of the gene of coding GCLM;

The Ile132Val A/G AA genotype of the gene of coding OR13G1;

The gene of coding MIP1A+459 C/T Intron 1CT or TT genotype;

The Asn 125 Ser AA genotype of the gene of coding cathepsin G;

The I249V TT genotype of the gene of coding CX3CR1;

The Gly 881 Arg G/C CC or the CG genotype of the gene of coding NOD2; Or

The 372T/C CC genotype of the gene of coding TIMP1.

7. the method for ACS risk takes place in an evaluation object, and described method comprises the following steps:

(i) whether the existence of at least a protectiveness polymorphism that mensuration is relevant with the risk reduction that ACS takes place to be, and

(ii) do not exist under at least a protection polymorphism situation, whether the existence of at least a susceptibility polymorphism that mensuration is relevant with the risk rising that ACS takes place;

Wherein the existence of one or more described protectiveness polymorphisms is that the indication that the risk of ACS reduces takes place, and not having at least a protectiveness polymorphism and having at least a susceptibility polymorphism then is the indication that the risk rising of ACS takes place.

8. method as claimed in claim 7, wherein said at least a protectiveness polymorphism is selected from:

Ser52Ser (223C/T) the CC genotype of the gene of coding FGF2;

The Q576R A/G AA genotype of the gene of coding IL4RA;

The Thr26Asn A/C CC genotype of the gene of coding LTA;

The Hom T2437C CC or the CT genotype of the gene of coding HSP70;

The Asp299Gly A/G AG or the GG genotype of the gene of coding TLR4;

The Thr399Ile C/T CT or the TT genotype of the gene of coding TLR4;

874 A/T TT genotype of the gene of coding IFNG;

The gene of coding NFKBIL1-the 63T/AAA genotype;

The gene of coding PDGFRA-1630Ins/Del (AACTT/Del) Ins/Del or Del/Del genotype;

-589 C/T CT or the TT genotype of the gene of coding IL-4;

-588 C/T CC genotype of the gene of coding GCLM;

-1084 A/G GG genotype of the gene of coding IL-10;

The K469E A/G AA genotype of the gene of coding ICAM1;

-23 C/G GG genotype of the gene of coding BAT1;

The G1u298Asp G/T GG genotype of the gene of coding NOS3;

The Arg213Gly C/G CG or the GG genotype of the gene of coding SOD3;

-668 4G/5G 5G5G genotype of the gene of coding PAI-1;

-181 A/G GG genotype of the gene of coding MMP7;

Asn 125 SerAG or the GG genotype of the gene of coding cathepsin G; Or

372 T/C TT genotype of the gene of coding TIMP1.

9. as claim 7 or 8 described methods, wherein said at least a susceptibility polymorphism is to be selected from following group genotype;

-1903 A/G GG genotype of the gene of coding CMA1;

-509 C/T CC genotype of the gene of coding TGFB1;

-82 A/G GG genotype of the gene of coding MMP12;

Ser52Ser (223 C/T) CT or the TT genotype of the gene of coding FGF2;

The Q576R A/G GG genotype of the gene of coding IL4RA;

The Hom T2437C TT genotype of the gene of coding HSP70;

The Asp299Gly A/G AA genotype of the gene of coding TLR4;

The Thr399Ile C/T CC genotype of the gene of coding TLR4;

-589 C/T CC genotype of the gene of coding IL4;

-1607 1G/2G (Del/G) Del Del (1G 1G) genotype of the gene of coding MMP1;

The 12IN5 C/T TT genotype of the gene of coding PDGFA;

-588 C/T CT or the TT genotype of the gene of coding GCLM;

The Ile132Val A/G AA genotype of the gene of coding OR13G1;

The gene of coding MIP1A+459C/T Intron 1CT or TT genotype;

The Asn 125 Ser AA genotype of the gene of coding cathepsin G;

The I249V TT genotype of the gene of coding CX3CR1;

The Gly 881Arg G/C CC or the CG genotype of the gene of coding NOD2; Or

The 372T/C CC genotype of the gene of coding TIMP1.

10. as each described method of claim 7 to 9, wherein no matter whether have one or more susceptibility polymorphisms, the existence of two or more protectiveness polymorphisms is that the indication that the risk of ACS reduces takes place.

11. as each described method of claim 7 to 9, wherein when the protectiveness polymorphism did not exist, the existence of one or more susceptibility polymorphisms was that the indication that the risk of ACS raises takes place.

12. as each described method of claim 7 to 9, wherein the existence of two or more susceptibility polymorphisms is that the indication that the risk of ACS raises takes place.

13. the method for the risk of ACS takes place a determination object, it comprises whether analysis exists two or more to be selected from following group polymorphism from the sample of described object:

The gene of coding chyme enzyme 1 (CMA1)-1903A/G;

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

The 874A/T of the gene of the plain γ of coded interference (IFNG);

The gene of coding interleukin-4 (IL-4)-589C/T;

The gene of coding interleukin 10 (IL-10)-1084A/G (1082);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

The Asn 125 Ser A/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

The gene of coding transforminggrowthfactor-(TGFB1)-509C/T;

The Thr26Asn A/C of the gene of coding lymphotoxin α (LTA);

The Asp299Gly A/G of the gene of coding Toll sample acceptor 4 (TLR4);

The Thr399Ile C/T of the gene of coding TLR4;

-1607 1G/2G (Del/G) of the gene of coding matrix metalloproteinase 1 (MMP1);

12 IN 5C/T of the gene of coding Thr6 PDGF BB α (PDGFA);

The Glu288Val A/T (M/S) of the gene of coding alpha1-antitrypsin (α 1-AT);

The K469E A/G of the gene of coding intercellular adhesion molecule 1 (ICAM1);

The gene of the coding related transcript 1 of HLA-B (BAT1)-23C/G;

The Glu298Asp G/T of the gene of coding nitricoxide synthase 3 (NOS3);

The gene of coding matrix metalloproteinase 7 (MMP7)-181A/G;

Or be in one or more polymorphisms of linkage disequilibrium with any or multiple described polymorphism.

14. as each described method of claim 1 to 13, wherein said method comprises analyzes one or more epidemiology risks and assumptions.

15. the method for the risk of ACS takes place determination object, described method comprises the following steps:

(i) acquisition is from results of one or more heredity tests of the sample of described object; And (ii) analyze described result, judge whether to exist one or more to be selected from following group polymorphism:

The gene of coding chyme enzyme 1 (CMA1)-1903A/G;

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

The 874A/T of the gene of the plain γ of coded interference (IFNG);

The gene of coding interleukin-4 (IL-4)-589C/T;

The gene of coding interleukin 10 (IL-10)-1084A/G (1082);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

The Asn 125 Ser A/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

16. method as claimed in claim 15 shows that wherein the result whether one or more polymorphisms that are selected from following group exist is the indication that the risk reduction of ACS takes place object:

Ser52Ser (223C/T) the CC genotype of the gene of coding FGF2;

The Q576RA/GAA genotype of the gene of coding IL4RA;

The Hom T2437C CC or the CT genotype of the gene of coding HSP70;

The 874A/T TT genotype of the gene of coding IFNG;

-589 C/T CT or the TT genotype of the gene of coding IL-4;

-1084 A/G GG genotype of the gene of coding IL-10;

The Arg213Gly C/G CG or the GG genotype of the gene of coding SOD3;

The Asn 125 Ser AG or the GG genotype of the gene of coding cathepsin G; Or

372 T/C TT genotype of the gene of coding TIMP1.

17. method as claimed in claim 15 shows that wherein the result whether one or more polymorphisms that are selected from following group exist is the indication that the risk rising of ACS takes place object:

-1903 A/G GG genotype of the gene of coding CMA1;

-82 A/G GG genotype of the gene of coding MMP12;

The gene of coding MIP1A+459 C/T Intron 1CT or TT genotype;

The Asn 125 Ser AA genotype of the gene of coding cathepsin G;

The I249V TT genotype of the gene of coding CX3CR1;

The Gly 881 Arg G/C CC or the CG genotype of the gene of coding NOD2; Or

372 T/C CC genotype of the gene of coding TIMP1.

18. be used for one or more nucleotide probes and/or primer as claim 1 to 17 method as described in each, wherein said one or more nucleotide probes and/or primer are crossed over or be can be used in the polymorphic regions of crossing over described gene, and there is described polymorphism to be analyzed in wherein said gene.

19. one or more nucleotide probes as claimed in claim 18 and/or primer, it comprises among the SEQ.ID.NO.1 to SEQ.ID.NO.124 arbitrary sequence.

20. a nucleic acid microarray, it comprises the base material of presenting nucleotide sequence, and wherein said nucleotide sequence can be hybridized with nucleotide sequence or its complementary sequence that coding is selected from one or more polymorphisms of defined group of claim 1.

21. the purposes of at least a polymorphism in the risk of evaluation object generation ACS, wherein said at least a polymorphism is selected from following group:

The gene of coding chyme enzyme 1 (CMA1)-1903A/G;

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

The Q576RA/G of the gene of coding interleukin-4 acceptor α (IL4RA);

HOM T2437C in coding heat shock protein 70 (HSP70) gene;

The 874A/T of the gene of the plain γ of coded interference (IFNG);

The gene of coding interleukin-4 (IL-4)-589C/T;

The gene of coding interleukin 10 (IL-10)-1084A/G (1082);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

The Asn 125 Ser A/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

22. purposes as claimed in claim 21, wherein said purposes can be used at least a other polymorphisms that are selected from following group:

The gene of coding transforminggrowthfactor-(TGFB1)-509C/T;

The Thr26Asn A/C of the gene of coding lymphotoxin α (LTA);

The Asp299Gly A/G of the gene of coding Toll sample acceptor 4 (TLR4);

The Thr399Ile C/T of the gene of coding TLR4;

-1607 1G/2G (Del/G) of the gene of coding matrix metalloproteinase 1 (MMP1);

The 12IN 5C/T of the gene of coding Thr6 PDGF BB α (PDGFA);

The Glu288Val A/T (M/S) of the gene of coding alpha1-antitrypsin (α 1-AT);

The K469E A/G of the gene of coding intercellular adhesion molecule 1 (ICAM1);

The gene of the coding related transcript 1 of HLA-B (BAT1)-23C/G;

The Glu298Asp G/T of the gene of coding nitricoxide synthase 3 (NOS3);

The gene of coding matrix metalloproteinase 7 (MMP7)-181A/G;

23. a method for the treatment of the object that risk that ACS takes place raises, it comprises from genotype or phenocopy and is selected from the described object existence and/or functional effect as the protectiveness polymorphism of defined group of claim 8.

24. method for the treatment of the risk rising object that ACS takes place, described object has the detected susceptibility polymorphism that is selected from defined group of claim 9, the expression of described polymorphism or rise or down-regulated gene, make the physiologically active concentration of expressed genes product not in the age and the normal range for the sex of described object, described method comprises that the physiologically active concentration with described gene expression product returns to normal range for described object age and sex with interior step.

25. the method for ACS risk takes place a determination object, it comprises that analyzing two or more is selected from following group genotype:

The gene of coding chyme enzyme 1 (CMA1)-1903A/G;

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

The Q576R A/G of the gene of coding interleukin-4 acceptor α (IL4RA);

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

The 874A/T of the gene of the plain γ of coded interference (IFNG);

The gene of coding interleukin-4 (IL-4)-589C/T;

The gene of coding interleukin 10 (IL-10)-1084A/G (1082);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

The Asn 125SerA/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881Arg G/C of the gene of coding Caspase (NOD2); Or

The gene of coding transforminggrowthfactor-(TGFB1)-509C/T;

The Thr26Asn A/C of the gene of coding lymphotoxin α (LTA);

The Asp299Gly A/G of the gene of coding Toll sample acceptor 4 (TLR4);

The Thr399Ile C/T of the gene of coding TLR4;

The gene of coding matrix metalloproteinase 1 (MMP1)-16071G/2G (Del/G);

The 12IN 5C/T of the gene of coding Thr6 PDGF BB α (PDGFA);

Ile132Val A/G in coding olfactory receptor analogue OR13G1 (OR13G1) gene;

The Glu288Val A/T (M/S) of the gene of coding alpha1-antitrypsin (α 1-AT);

The K469E A/G of the gene of coding intercellular adhesion molecule 1 (ICAM1);

The gene of the coding related transcript 1 of HLA-B (BAT1)-23C/G;

The Glu298Asp G/T of the gene of coding nitricoxide synthase 3 (NOS3);

The gene of coding matrix metalloproteinase 7 (MMP7)-181A/G; Or

Be in one or more polymorphisms of linkage disequilibrium with any or multiple described polymorphism.

26. one kind is used for as the antibody microarray in the method as described in claim 1 to 17 each or the claim 25; described microarray comprises presents the base material that can be attached to the antibody on the gene expression product; when wherein this gene and claim 2 or the defined susceptibility of claim 3 or protectiveness polymorphism are associated, its up-regulated or downward modulation.

27. one kind is used to screen, and regulatory gene is expressed and/or the method for active compound; wherein said gene is when being selected from defined susceptibility of claim 2 or claim 3 or protectiveness polymorphism and being associated; its expression is raised or is reduced, and described method comprises the following steps:

28. method as claimed in claim 27, wherein said cell is for confirming to exist people's vascular cell of described polymorphism through prescreen.

29. method as claimed in claim 27, wherein said cell is for confirming to exist people's blood vessel epithelial cell of described polymorphism through prescreen.

30. as each described method of claim 27 to 29, wherein said cell comprises and the relevant susceptibility polymorphism of described genetic expression rise that described screening is used to select to reduce the candidate compound of described genetic expression.

31. as each described method of claim 27 to 29, wherein said cell comprises the susceptibility polymorphism relevant with described down regulation of gene expression, described screening is used to select to raise the candidate compound of described genetic expression.

32. as each described method of claim 27 to 29, wherein said cell comprises and the relevant protectiveness polymorphism of described genetic expression rise that described screening is used to select further to raise the candidate compound of described genetic expression.

33. as each described method of claim 27 to 29, wherein said cell comprises the protectiveness polymorphism relevant with described down regulation of gene expression, described screening is used to select further reduce the candidate compound of described genetic expression.

34. one kind is used to screen, and regulatory gene is expressed and/or the method for active compound; wherein said gene is when being selected from defined susceptibility of claim 2 or claim 3 or protectiveness polymorphism and being associated; its up-regulated or downward modulation, described method comprises the following steps:

With candidate compound with contain the cells contacting of gene, its expression was upward or downward when described gene was associated with susceptibility or protectiveness polymorphism, did not cut but neither raise also in expression of gene described in the described cell; And

35. method as claimed in claim 34, wherein said cell is for confirming to exist people's vascular cell of described gene and described gene baseline expression level through prescreen.

36. method as claimed in claim 34, wherein said cell is for confirming to exist people's blood vessel epithelial cell of described gene and described gene baseline expression level through prescreen.

37. as each described method of claim 34 to 36, its down-regulated expression when wherein said gene is related with the susceptibility polymorphism, and described screening is used for being chosen in the candidate compound that described cell raises described genetic expression.

38. as each described method of claim 34 to 36, its up-regulated when wherein said gene is related with the susceptibility polymorphism, and described screening is used for being chosen in the candidate compound of the described genetic expression of described cell downward modulation.

39. as each described method of claim 34 to 36, its up-regulated when wherein said gene is related with the protectiveness polymorphism, and described screening is used for being chosen in the candidate compound that described cell raises described genetic expression.

40. as each described method of claim 34 to 36, its down-regulated expression when wherein said gene is related with the protectiveness polymorphism, and described screening is used for being chosen in the candidate compound of the described genetic expression of described cell downward modulation.

41. possible reactive method that object that ASC or diagnosis suffer from ASC is handled prevention or treatment is tended in an assessment, described processing comprises that the physiologically active concentration with gene expression product returned in the age and the normal range for the sex of described object, described method comprises whether detect the susceptibility polymorphism that is selected from defined group of claim 3 in the described object exists, when described susceptibility polymorphism exists or rise or reduce described expression of gene, make the physiologically active concentration of described expressing gene product exceed beyond the described normal range, the existence that wherein detects described polymorphism represents that described object may respond described processing.

42. one kind is used for the test kit that the risk of ACS takes place evaluation object, described test kit comprises whether analysis exists one or more to be selected from the device of following group polymorphism from the sample of described object:

The gene of coding chyme enzyme 1 (CMA1)-1903A/G;

The gene of coding matrix metalloproteinase 12 (MMP12)-82A/G;

Q576R A/G in coding interleukin-4 acceptor α (IL4RA) gene;

The HOM T2437C of the gene of coding heat shock protein 70 (HSP70);

The 874A/T of the gene of the plain γ of coded interference (IFNG);

The gene of coding interleukin-4 (IL-4)-589C/T;

-1084 A/G (1082) of the gene of coding interleukin 10 (IL-10);

The Arg213Gly C/G of the gene of encoding superoxide dismutase 3 (SOD3);

The Asn 125 Ser A/G of the gene of coding cathepsin G;

The I249V C/T of the gene of coding chemokine (CX3C motif) acceptor 1 (CX3CR1);

The Gly 881 Arg G/C of the gene of coding Caspase (NOD2); Or

43. method for the treatment of the object of the risk rising that ACS takes place, determined the GG genotype of existence-82A/G polymorphism in the gene promoter of coding MMP12 for described object, described method comprises using to described object can regulate the active medicament of MMP12 in the described subject.

44. method as claimed in claim 43, wherein said medicament are can improve one or more tissue inhibitor of metalloproteinase (TIMP) to express or active medicament.

45. method as claimed in claim 44, wherein said tissue inhibitor of metalloproteinase is selected from TIMP1, TIMP2, TIMP3 or TIMP4.

46. method as claimed in claim 43, wherein said medicament are can reduce one or more films to express or active medicament in conjunction with MMP.

47. method as claimed in claim 46, wherein said medicament are the MMP inhibitor.

48. method as claimed in claim 47, wherein said MMP inhibitor is selected from 4,5-dihydroxyanthraquinone-2-carboxylic acid (AQCA), anthraquinonyl-mercaptoethylamine, anthraquinonyl-L-Ala hydroxamic acid or their derivative.

49. method for the treatment of the object of the risk rising that ACS takes place, determined in the gene promoter of coding TIMP1, to exist the CC genotype at 372T/C polymorphism place, described method to comprise to use for described object and can regulate the active medicament of TIMP1 in the described subject to described object.

50. being a kind of TIMP1 that can increase, method as claimed in claim 49, wherein said medicament express or active medicament.