CN101353693A - Preparation and use of micro-array chip for HLA-B27 genotyping - Google Patents
Preparation and use of micro-array chip for HLA-B27 genotyping Download PDFInfo
- Publication number
- CN101353693A CN101353693A CNA2007100293055A CN200710029305A CN101353693A CN 101353693 A CN101353693 A CN 101353693A CN A2007100293055 A CNA2007100293055 A CN A2007100293055A CN 200710029305 A CN200710029305 A CN 200710029305A CN 101353693 A CN101353693 A CN 101353693A
- Authority
- CN
- China
- Prior art keywords
- hla
- gene
- dna
- hybridization
- chip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a gene detection kit used for clinical detection, in particular to the preparation and the usage of a micro-array chip used for HLA-B27 genotyping. A DNA micro-array chip technology is adopted, and the kit can carry out partign to human leucocyte antigen B27, with high pass, high efficiency and high specificity.
Description
Affiliated technical field
The present invention relates to a kind of gene detecting kit of clinical detection purposes, especially relate to the dna microarray chip, this test kit can high-throughput, high-level efficiency, high specific are carried out somatotype to human leucocyte antigen B27 gene.
Technical background
HLA (Human leukocyte antigen, human leucocyte antigen) is human major histocompatibility system.Histocompatibility is meant organizes or during organ transplantation the degree that donor and receptor both sides accept between Different Individual.The donor-recipient organizes the incompatible reaction that causes, be proved to be a kind of immune response, it is by cell surface allogenic antigen inductive, on behalf of individual specificity's antigen, this claim transplantation antigen or histocompatibility antigen, the antigen that wherein plays a major role claims major histocompatibility system (MHS), and HLA (human leucocyte antigen) is exactly human major histocompatibility system.The HLA gene complex is positioned at human No. 6 karyomit(e) 6p21.3 zone, has height single nucleotide polymorphism (SNPs).There are a plurality of locus in HLA, and each locus has can be divided into multiple type, hypotype and allelotrope.
The biology of HLA and medical significance comprise immunological response, organ transplantation eliminating reaction and disease association or the like.Aspect disease association, first report psoriatic (psoriasis) patient of Russel carried HLA-B13 or HLA-B17 in 1972.After this find successively that a large amount of other diseases are relevant with specific HLA, wherein, HLA-B27 antigen sees about 90% ankylosing spondylitis patient, so that make the HLA somatotype have diagnostic value, even, can confirm the clinical difference between the disease subtypes earlier.For example, psoriasis vulgaris is relevant with HLA, and pustular psoriasis is quite different; Teenager's property insulin-dependent diabetes mellitus is relevant with HLA-B8, HLA-Bw15 and HLA-B18, and late onset type diabetes there is no this being correlated with; The congenital adrenal hyperplasia disease of autosomal recessive inheritance is because 21-hydroxylase lacks.Use HLA antigen polymorphism and make colony's association analysis and family linkage analysis, find to have two hydroxylase sites (21-OHA and 21-OHB) and HLA-B, DR close linkage, according to this, available HLA makes antenatal diagnosis.In orthogenics, can extrapolate the ill relative risk rate of child to some disease according to available data.On the other hand, about HLA and long-lived relation, also form a research focus.Therefore, the HLA of particular type just becomes the genetic marker of some disease.The cognation progress of HLA-DR4 and rheumatic and rheumatoid inflammation is very fast, has been subjected to the medical circle extensive concern at present, and begins the HLA-DR4 detection is used for clinical assistant diagnosis.
It is large-scale that HLA-B27 gene type belongs to of HLA-B locus, i.e. the HLA-B*27 type.In HLA-B*27 is large-scale, can be divided into numerous hypotype of 2701-2727 and allelotype again.
Ankylosing spondylitis (Ankylosing spondylitis is called for short AS) has another name called the similar rheumatism spondylitis.Modern medicine thinks that this disease is a kind of chronic, carrying out property and inflammatory diseases, and diseased region is mainly at articulatio sacroiliaca, backbone, the other soft tissue of backbone and extremities joint.Pathology often begins from articulatio sacroiliaca, upwards spreads to the other tissue of backbone and ridge gradually, causes bony ankylosis at last.Ankylosing spondylitis is the quite high a kind of disease of a kind of invalidity rate, and late period, the ankylosing spondylitis state of an illness can not reverse, and not only makes patient lose employment and work capacity, also is a white elephant concerning family and society.But according to existing Case definition, in case be diagnosed as ankylosing spondylitis, its course of disease all enters late period.Therefore, early diagnosis has become the task of top priority.
The cause of disease of ankylosing spondylitis is not clear and definite fully as yet.But should disease and the relation of human leucocyte antigen B27 (HLA-B27) very close.Incidence can be up to more than 90% in patients with ankylosing spondylitis, and only has 3% positive in the general population.The relative risk that the positive carrier of HLA-B27 suffers from ankylosing spondylitis is 87.4: 1.Chinese HLA-B27 is positive, and ratio is about 3%, and the AS morbidity is about 0.2%, and prompting exists inherited genetic factors or the external cause beyond the HLA-B27 ill relevant with AS.Studies show that recently there are many gene hypotypes in HLA-B27, that finds at present has 27 kinds at least, and the range gene hypotype is the distribution proportion difference in various nationalities crowd.With AS ill closely related also only be several HLA-B27 gene hypotypes, most of HLA-B27 gene hypotype and AS are ill irrelevant.This discovers and has disclosed, the reason of huge spread between current HLA-B27 positive rate and AS morbidity, and AS morbidity otherness reason between various nationalities.Cipriani etc. discover that to Zulian crowd HLA-B27 gene hypotype it mainly is B2705 (68.8%) and B2702 (31.2%) that AS suffers from the patient, and normal population HLA-B27 gene hypotype mainly is B2708.Sampaio-Barros etc. discover that to Belgian AS patient HLA-B2705 mainly carries molecule, accounts for 92.5%, and B2706, B2707 and AS morbidity are irrelevant.The patients with ankylosing spondylitis in native country, Taiwan, the positive ratio of HLA-B27 is up to 95%, and wherein 2704 hypotypes have accounted for most (89%), minority is 2705 types (11%) in addition.
Nearly 10 years, it was unique possible pathogenic structure that the tetrad structure of HLA-B27 often is mistaken as, and became the basis of many researchs.HLA-B27 mediation sacroiliitis is not only by its HLA-I quasi-molecule structure, and also mostly to be dimeric structure relevant with the form of its light chain and free heavy chain.1～7 amino acid whose difference is arranged between each hypotype of HLA-B27, and the result of study of the degree that each hypotype is relevant with AS is as follows:
B*2705 is an ancient hypotype, is most commonly in white people, with AS dependency is highly arranged.B*2705 further is divided into B*27052, B*27053 and B*27054 again.
B*2704 also is a kind of common hypotype, and is particularly in the crowd of China and Japan, also relevant with AS.
The frequency of occurrences of B*2701, B*2702, B*2703, B*2704, B*2707, B*2708 and B*2710 is than B*2704 or B*2705 much less, but also relevant with AS.
B*2706 and B*2709 have been in the news and AS does not have dependency.B*2706 is common in Thailand and Indonesian healthy population.B*2709 sees the healthy population of Italian Sardinia 25%.
The early diagnosis of AS is very important, and still, present reagent for clinical diagnosis mainly leans on import, the price height, and it is also low to detect flux, heavily hinder HLA-B27 and the detection of AS disease association, has more hindered health check-up examination widely.
The present invention has well solved above problem, HLA-B27 genotype tests of the present invention, adopt the dna microarray technology of independent development autonomous production, cost and price all reduces greatly, not only can be good at being used for clinical AS auxiliary diagnosis, also can be widely used in health check-up and new person's examination of large units such as industrial and mining enterprises, army, sports institutes, when bringing economic interests for research institute, also benefit society, produce obvious social.
The HLA-B27 methods of genotyping grew up since the nineties, mainly comprised PCR-SSP (PCR-sequence specific primers method), PCR-SSOP (PCR-sequence specific oligonucleotide probes method), SBT (sequencing), FCM (streaming method) method at present.By Hesperian minority business monopoly, China is in space state to these methods at present, fully dependence on import.Simultaneously, also there are some technical problems in these methods, such as primer too much cause detect wrong, to detect flux too small or the like.
The dna microarray method is the novel gene typing that grew up in recent years, compare other classifying method, have characteristics such as high-throughput, intensification, low cost, high accuracy, be that to melt microtronics, biology, physics, chemistry, computer science be the new technology that the height of one intersects, have great fundamental research and be worth, have tangible industrialization prospect again.Owing to can be fixed in extremely a large amount of probes on the upholder simultaneously with this technology, so once can carry out check and analysis, thereby solve traditional nucleic acid blot hybridization technique complexity, deficiencies such as level of automation is low, the testing goal molecular amounts is few, small throughput to a large amount of biomolecules.And, by designing different probe arrays, using specific analytical procedure can make this technology have multiple different using value, as gene expression profile mensuration, sudden change detection, polymorphism analysis, genomic library mapping and sequencing by hybridization (Sequencing by hybridization, SBH) etc., the development for " post genome project " gene functional research in period and modern medicine science, medical diagnosis provides strong tool.
Summary of the invention
In view of the deficiency of present existing HLA-B27 methods of genotyping, the present invention is applied to 27 type gene types of HLA-B locus with the dna microarray technology, has developed a kind of novel gene type test kit.
The technical solution adopted in the present invention is: at genotypic second exon of HLA-B27, design one cover specific oligonucleotide probe (subordinate list 1), adopt Linomat device people, probe is printed on the specific region of a slide, and every slide is printed 10 microarray matrixes, so just makes the dna microarray chip, a chip can detect 10 samples, be equipped with other necessary component again,, form complete test kit as PCR primer (subordinate list 2).During actual detected, get 10 parts of human gene group DNA's solution, adopt CY3 labeled primer and asymmetric PCR method, amplify the second exon strand CY3 labeled fragment of people's gene group HLA-DRB1*04 gene.Get one of dna microarray chip, add 10 kinds of PCR product 2ul and hybridization solution 8ul respectively at 10 hybridization regions.Chip is placed in the hybridization groove of automatic hybridization washing instrument, hybridization temperature is set at 52 ℃, and hybridization time 30 minutes dries up automatically.Take out slide, put into GenePix 4100A scanner and scan, operational analysis software carries out the view data conversion process to scan image signal, and analyzes generation sample gene type result.
This test kit adopts the dna microarray technology, can improve the detection flux greatly, and every slide can prepare the dna microarray that is used to detect 10 samples, generally is existing more than 10 times of detection technique.
Table 1 sequence oligonucleotide probe
Table 2 primer sequence
The present invention makes an explanation with the following example, and purpose is just in order to explain rather than limit by any way the present invention.
Below in conjunction with description of drawings concrete enforcement of the present invention.
Description of drawings
Fig. 1 is HLA-b27 gene typing DNA micro-array hybridization region and probe microarray synoptic diagram
1 chip overall appearance
2 hybridization regions and probe microarray
Embodiment one
The design of method 1:HLA-B27 gene typing DNA micro-array PCR primer and oligonucleotide probe and synthetic
In order to adopt the 2nd exon of specific PCR amplification HLA-B27 locus,, design specificity 5 ' primer PB1 and design 3 ' primer PB2 at the 2nd exon terminal position respectively in the position, top of the 1st intron end to the 2 exons.Primer sequence sees Table 2.
At the polymorphism of HLA-B27 the 2nd exon genes sequence, design 19 kinds of typing probes, see Table 1.
The preparation of method 2:HLA-DRB1 gene typing DNA micro-array
Adopt the automatic point sample instrument of gene chip,, make dna microarray 19 kinds of typing probes and two kinds of specific regions that contrast probe points system to slide.
(1) point sample probe solution: in probe dilution to 5 * SSC, 0.05%SDS solution, final concentration is 30uM;
(2) point sample matrix: (as Fig. 1) on slide, each probe laterally repeats 3 points in hybridization region with probe points; Hybridization region is divided into 10.
Embodiment two: adopt the HLA-B27 gene type to detect sample HLA-B27 gene type with dna microarray
Get the dna sample of 10 parts of known types, adopt the PCR primer of CY3 mark, 1: 30 (molecule number ratio) asymmetric PCR method of upstream and downstream primer, the PCR loop parameter is: 94 ℃ 5 '; 94 ℃ 30 ", 58 ℃ 30 ", 72 ℃ 30 " and, 40 circulations; 72 ℃ 5 '.
Get a microarray slide, get 10 holes that 10 kinds of each 2ul of PCR product are added to chip respectively, add hybridization solution (5XSSC) 8ul in each hole again, chip is put in the groove of automatic hybridization washing instrument, sets 52 ℃ of hybridization temperatures, hybridization time 40 minutes.The washing and air-dry automatically of hybridization back.
Adopt the GnenPix4100A scanner, the scanning hybridization signal obtains the results of hybridization scintigram, and image transitions is become data.
Adopt analysis software, above data analysis is converted into the gene type of each sample, detected result conforms to fully with sample protogene type.See Table 3.
Embodiment has illustrated that product of the present invention is detecting the advantage (10 samples of one-time detection) aspect the flux and the reliability (detected result conforms to fully with former sample result) of detection accuracy aspect.
Other compares this detected result of table 3 and the original genotype of sample
Sequence table
＜110〉Zhongshan University Anda gene limited-liability company
＜120〉HLA-B27 gene type dna microarray chip agent box
<140>
<141>
<160>21
<210>1
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>1
CCG?GGA?CAT?GGC?GGT?GT
<210>2
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>2
GCG?GCT?CCT?TCC?TCG?GAC
<210>3
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>3
GCC?CAC?GGT?GAT?GAA?GC
<210>4
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>4
CGC?CCG?GGG?CTC?CGT?CCT
<210>5
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>5
TTC?TCT?ATC?CAC?GGC?GCC
<210>6
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>6
GTG?TCT?CCC?GGT?CCC?AA
<210>7
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>7
GTG?CCT?TGG?CCT?TGC?AGA
<210>8
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>8
CCG?GGA?CAC?GGA?GGT?GT
<210>9
<211>16
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>9
CTC?TCG?GTC?AGT?CTG?T
<210>10
<211>16
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>10
ACG?AAC?TGC?GTG?TCG?T
<210>11
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>11
TGG?TCT?TGA?AGA?TCT?GTG
<210>12
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>12
GCG?GAG?CGC?GGT?GCG?CAG
<210>13
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>13
TTG?GTC?TTG?GAG?ATC?TGT
<210>14
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>14
CCC?ACT?GCA?ATG?AAG?CG
<210>15
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>15
TTG?GTC?TTG?CAG?ATC?TGT
<210>16
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>16
CTG?TGT?GTT?CCG?GTC?CC
<210>17
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>17
GCC?CAC?TGC?GAT?GAA?GC
<210>18
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>18
GTA?GTA?GCG?GAG?CAG?GGT
<210>19
<211>16
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to react probe as chip hybridization.
<400>19
GAA?CTG?GGT?GTC?GTC?C
<210>20
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to be used as the pcr amplification primer.
<400>20
CGG?AGG?AGC?GAG?GGG?ACC?GC
<210>21
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, to be used as the pcr amplification primer.
<400>21
CTC?CTC?GCT?CTG?GTT?GTA?GT
Claims (4)
1, a kind of gene parting detecting reagent adopts the dna microarray chip technology, and the HLA-B27 gene is detected and somatotype, it is characterized in that said test kit is with 19 kinds of oligonucleotide probes, point is made the dna microarray chip on slide, be equipped with 2 kinds of primers and other component.
2, gene parting detecting reagent according to claim 1, its feature also are 2 kinds of primers of amplification HLA-B27 second exon that uses, and are respectively:
PB1?CGGAGGAGCGAGGGGACCGC
PB2?CTCCTCGCTCTGGTTGTAGT
3, gene parting detecting reagent according to claim 1, its feature are that also employed 19 kinds of oligonucleotide probes are respectively:
B1 CCGGGACATGGCGGTGT
B2 GCGGCTCCTTCCTCGGAC
B3 GCCCACGGTGATGAAGC
B4 CGCCCGGGGCTCCGTCCT
B5 TTCTCTATCCACGGCGCC
B6 GTGTCTCCCGGTCCCAA
B7 GTGCCTTGGCCTTGCAGA
B8 CCGGGACACGGAGGTGT
B9 CTCTCGGTCAGTCTGT
B10?ACGAACTGCGTGTCGT
B11?TGGTCTTGAAGATCTGTG
B12?GCGGAGCGCGGTGCGCAG
B13?TTGGTCTTGGAGATCTGT
B14?CCCACTGCAATGAAGCG
B15?TTGGTCTTGCAGATCTGT
B16?CTGTGTGTTCCGGTCCC
B17?GCCCACTGCGATGAAGC
B18?GTAGTAGCGGAGCAGGGT
B19?GAACTGGGTGTCGTCC
4, gene parting detecting reagent according to claim 1, its feature also are to be used for the auxiliary diagnosis and the health check-up examination of clinical atrophic diseases and ankylosing spondylitis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100293055A CN101353693B (en) | 2007-07-24 | 2007-07-24 | HLA-B27 genotyping detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100293055A CN101353693B (en) | 2007-07-24 | 2007-07-24 | HLA-B27 genotyping detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101353693A true CN101353693A (en) | 2009-01-28 |
| CN101353693B CN101353693B (en) | 2012-05-30 |
Family
ID=40306710
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100293055A Active CN101353693B (en) | 2007-07-24 | 2007-07-24 | HLA-B27 genotyping detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101353693B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101481736B (en) * | 2009-02-06 | 2011-12-28 | 中山大学 | DNA micro-array chip, detection method thereof and uses in CYP3A4, CYP3A5 and MDR1 gene polymorphism detection |
| CN101665833B (en) * | 2009-09-23 | 2011-12-28 | 博奥生物有限公司 | Method for detecting HLA-B27 gene as well as special primer and kit thereof |
| CN102443625A (en) * | 2011-09-19 | 2012-05-09 | 浙江夸克生物科技有限公司 | Method for rapidly detecting human leucocyte antigen B27 (HLA-B27) and kit thereof |
| CN105296481A (en) * | 2015-12-01 | 2016-02-03 | 济南英盛生物技术有限公司 | Gene sequencing method-based HLA-B27 genotyping method |
| CN106520989A (en) * | 2016-12-08 | 2017-03-22 | 武汉海吉力生物科技有限公司 | Detection kits for detecting HLA-B27 gene and method |
| CN108103061A (en) * | 2018-02-05 | 2018-06-01 | 古洁若 | A kind of method for detecting HLA-B27 subtype genes site and its kit and purposes |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1451760A (en) * | 2002-04-16 | 2003-10-29 | 中国人民解放军军事医学科学院放射医学研究所 | Preparation and use method of oligonucleotide chip for HLA typing |
-
2007
- 2007-07-24 CN CN2007100293055A patent/CN101353693B/en active Active
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101481736B (en) * | 2009-02-06 | 2011-12-28 | 中山大学 | DNA micro-array chip, detection method thereof and uses in CYP3A4, CYP3A5 and MDR1 gene polymorphism detection |
| CN101665833B (en) * | 2009-09-23 | 2011-12-28 | 博奥生物有限公司 | Method for detecting HLA-B27 gene as well as special primer and kit thereof |
| CN102443625A (en) * | 2011-09-19 | 2012-05-09 | 浙江夸克生物科技有限公司 | Method for rapidly detecting human leucocyte antigen B27 (HLA-B27) and kit thereof |
| CN102443625B (en) * | 2011-09-19 | 2013-03-13 | 浙江夸克生物科技有限公司 | Kit for rapidly detecting human leucocyte antigen B27 (HLA-B27) |
| CN105296481A (en) * | 2015-12-01 | 2016-02-03 | 济南英盛生物技术有限公司 | Gene sequencing method-based HLA-B27 genotyping method |
| CN106520989A (en) * | 2016-12-08 | 2017-03-22 | 武汉海吉力生物科技有限公司 | Detection kits for detecting HLA-B27 gene and method |
| CN108103061A (en) * | 2018-02-05 | 2018-06-01 | 古洁若 | A kind of method for detecting HLA-B27 subtype genes site and its kit and purposes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101353693B (en) | 2012-05-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2019101778A4 (en) | Method for constructing rice molecular marker map based on Kompetitive Allele Specific PCR and application in breeding Using the same | |
| KR102218512B1 (en) | Bambam: parallel comparative analysis of high-throughput sequencing data | |
| CN101353693B (en) | HLA-B27 genotyping detection kit | |
| CN109371143A (en) | SNP marker associated with pig growth traits | |
| CN101838702A (en) | Detection method of single nucleotide polymorphism with high throughout | |
| CN108823294B (en) | Forensic medicine composite detection kit based on Y-SNP genetic markers of 20 haplotype groups D | |
| Rocha et al. | Seventh international meeting on single nucleotide polymorphism and complex genome analysis:‘ever bigger scans and an increasingly variable genome’ | |
| CN101353692B (en) | Preparation and use of micro-array chip for HLA-B genotyping | |
| CN101177702B (en) | Mitochondrial diseases MELAS and MERRF syndrome related mtDNA mutation site detecting gene chip and detecting method | |
| CN101497925A (en) | Leber's hereditary optic neuroretinopathy related mtDNA mutant site integrated detection gene chip, as well as preparation and use thereof | |
| Zeng et al. | High transferability of homoeolog-specific markers between bread wheat and newly synthesized hexaploid wheat lines | |
| CN101353691B (en) | Preparation and use of micro-array chip for HLA-DR4 genotyping | |
| CN114317776B (en) | Molecular marker combination related to duck egg laying characteristics, obtaining method and application | |
| CN101487044B (en) | HLA-DQB1 gene typing DNA micro-array chip reagent kit | |
| CN108611425A (en) | The Genetic diversity evaluation method of sheep sources group | |
| CN101487043B (en) | HLA-C gene typing DNA micro-array chip reagent kit | |
| CN103757009A (en) | Litter size related molecular marker of swine 13# chromosome and primers thereof | |
| CN114085913A (en) | STR locus fluorescence labeling multiplex amplification kit for mouse cell strain identification and application thereof | |
| CN101353694B (en) | Preparation and use of micro-array chip for HLA-A genotyping | |
| CN110257505A (en) | A kind of non-deletion type alpha Thalassemia point mutation quick detection kit and detection method | |
| CN101314790B (en) | Reagent kit for parting detection of HLA-DRB1 gene | |
| CN101851673B (en) | Method for detecting tagged single-nucleotide polymorphic loci of six immunity-related genes of human | |
| CN102321749B (en) | Polymerase chain reaction-sequence based typing (PCR-SBT) method and kit of MHC class I chain-related gene B (MICB) | |
| CN114875161B (en) | Molecular marker related to chicken low temperature tolerance, primer combination and corresponding breeding method | |
| Han et al. | Multiplex single nucleotide extension: a robust and high throughput method for HLA-A locus typing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: GUANGZHOU DARUI ANTIBODY ENGINEERING TECHNOLOGY CO Free format text: FORMER OWNER: DAAN GENE CO., LTD., ZHONGSHAN UNIV. Effective date: 20110613 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 510665 NO. 19, XIANGSHAN ROAD, HIGH-TECH. INDUSTRIAL DEVELOPMENT ZONE, GUANGZHOU CITY, GUANGDONG PROVINCE TO: 510665 NO. 19, XIANGSHAN ROAD, SCIENCE CITY, HIGH-TECH. DEVELOPMENT ZONE, GUANGZHOU CITY, GUANGDONG PROVINCE |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20110613 Address after: 510665 No. 19 incense Hill Road, science and Technology Town, Guangzhou hi tech Development Zone, Guangdong, China Applicant after: Guangzhou Darui Antibodies Engineering Technology Co.Ltd Address before: 510665 Guangzhou high tech Industrial Development Zone, Guangdong, Xiang Shan Road, No. 19 Applicant before: Daan Gene Co., Ltd., Zhongshan Univ. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 510665 No. 19 incense Hill Road, science and Technology Town, Guangzhou hi tech Development Zone, Guangdong, China Patentee after: Guangzhou Da Rui Biotechnology Ltd. Address before: 510665 No. 19 incense Hill Road, science and Technology Town, Guangzhou hi tech Development Zone, Guangdong, China Patentee before: Guangzhou Darui Antibodies Engineering Technology Co.Ltd |
|
| CP01 | Change in the name or title of a patent holder |