CN101341257A

CN101341257A - Human papilloma virus (HPV) detection using nucleic acid probes, microbeads and fluorescent-activated cell sorter (FACS)

Info

Publication number: CN101341257A
Application number: CNA2005800402348A
Authority: CN
Inventors: K·波特; T·戈尔德
Original assignee: Genera Biosystems Ltd
Current assignee: Genera Biosystems Ltd
Priority date: 2004-12-10
Filing date: 2005-12-09
Publication date: 2009-01-07
Anticipated expiration: 2025-12-09
Also published as: ES2524050T3; CN101341257B

Abstract

The present invention relates generally to the field of diagnostic and detection assays. More particularly, the present invention provides methods, and reagents including biochips for detecting the presence of, or distinguishing between, one or more analytes in a sample.

Description

Use the cell sorter (FACS) of nucleic acid probe, microballon and fluorescence-activation to detect human papillomavirus (HPV)

Invention field

The present invention briefly relates to diagnosis and detection assay field.More specifically, the invention provides the existence of one or more analytes that are used for test sample or distinguish their method and reagent, comprise biochip.

Background technology

At the end of specification sheets, listed the descriptive entry details of the reference that provides in this application.

Any prior art in this specification sheets is not, should be considered to admit or any type of hint yet: the prior art has formed the part of common general knowledge in any country.

To in single mensuration, detecting the needs of the screening method of multiple analytes fast and reliably, be crucial not only, but also use in screening in the clinical diagnosis field, for example screen environmental toxin and the drug screening aspect is crucial.

The such field that presses for improved screening method and reagent is the infectious diseases field.For example, the conservative estimation that is applied to the diagnostic detection of sexually transmitted disease (STD) (for example, human papillomavirus (HPV)) in the world is to detect for annual about 20000000 times.

The detection of the cause of disease of many existing screening infectious diseases is consuming time, efforts, expensive, and is specific to a kind of special pathogen only often, and/or can not distinguish different pathogenic agent bacterial strains.

HPV is the main infective pathogen body of cervical cancer.But the HPV taxonomical group comprises many pathogenic agent " bacterial strain ", and only wherein some are relevant with the development of cervical cancer and other cancer.Therefore, usually the HPV bacterial strain is divided into " high-risk " bacterial strain, comprises 13 kinds of bacterial strains, they account for the about 98% of uterine cervix case, or " low dangerous " bacterial strain, and their have nothing to do with development of cervical cancer usually.

At present, detect cervical cancer by Pap smear.In this technology, by erasion or washing, from the uterine cervix collecting cell.Then, these cells are placed on the microslide, make " smear ".The pathologist reexamines slide glass, seeks unusual cell.But Pap smear is for determining that clearly cervical cancer danger is some not satisfied mensuration, because this technology has about 20% false negative rate, and this technology can not be distinguished " high-risk " and " low dangerous " taxonomical group.

According to the present invention, a kind of detection assay is provided, the analyte in its energy test sample, and/or distinguish many different analytes.And, to compare with some existing detection assay, reagent of the present invention as herein described is relative quick and cheap with method.

Summary of the invention

In this specification and the appended claims, unless context has requirement in addition, word " comprises " and variant, for example " comprise " and " containing ", should be understood to represent to comprise the whole or complete step of described integral body or step or group, but do not get rid of the whole or complete step of any other integral body or step or group.

By sequence identification number (SEQ ID NO :) indication Nucleotide and aminoacid sequence.SEQ ID NO: in number with sequence identifier＜400〉1 (SEQ ID NO:1),＜400〉2 (SEQ ID NO:2) etc. are corresponding.The summary of sequence identifier is provided in table 1.Provide sequence table at the claim postscript.

The invention provides mensuration, it can detect one or more analytes, and/or can distinguish different members in the alanysis thing.More specifically, analyte is discerned or distinguished to use based on the multiple analysis of the character of analyte and mensuration component.

Therefore, one aspect of the present invention provides the pearl set (beedset) that is used for detecting one or more analytes and/or is used to distinguish two or more members of an alanysis thing, and wherein said pearl set comprises a plurality of pearl subclass, wherein:

(a) pearl of each subclass is of uniform size;

(b) pearl and reactant coupling mutually in each subclass, described reactant can react specifically with the particular target analytes in the testing sample;

(c) reactant on each pearl indicates identical mark, and each pearl subclass has different fluorescence intensities, to set up the heterogeneous mixture based on the pearl of fluorescence intensity; With

(d) at least 2 pearl subclass are admixed together, produce a pearl set, flow cytometry wherein by distinguishing based on size, fluorescence intensity and analyte, identification subclass identity (subset identity), thereby and identification pearl link coupled reactant.

In yet another aspect, the present invention is susceptible to the method that detects and/or distinguish two or more analytes in the sample, and it comprises following step:

(a) make the sample contact to the specific pearl set of target analytes;

(b) under the condition that is enough to allow analyte in the described sample and the reactant on the pearl in the set of described pearl to react specifically, described pearl was gathered with described sample incubation for some time; With

(c) detect and/or distinguish analyte on the reactant that is attached to described pearl in the sample.

At a related aspect, reactant can indicate one or more fluorescence dyes, and it further allows to distinguish the different members in the alanysis thing.One preferred aspect, the invention provides the set of method and pearl, it can detect and/or distinguish the analyte in the biological sample, wherein said analyte is specific to infectious agent.

The biological sample that this paper considers comprises blood, serum, and saliva, ight soil, urine, tissue juice, seminal fluid, exudate, pus is breathed liquid and mucus and from the wiping sample of local ulcer, cancer and damage.

Term " pathogenic agent " refers to infect or the microorganism or the virus of the sample of living away from home.Exemplary pathogenic agent comprises virus, bacterium, fungi and eukaryotic microorganisms.Virus comprise lentivirus (AIDS virus for example, HIV-I, HIV-II, HTLV-IV), retrovirus and avian influenza virus.In a preferred embodiment, " pathogenic agent " comprises microorganism or virus, and it can infect multicellular organism, for example animal or plant.Therefore, in one embodiment, analyte can be regarded as the animal or plant pathogenic agent.But, the present invention includes the detection and/or the differentiation of the avirulence material (for example symbiote, endophyte, stomach and intestine parasite etc.) of the multicellular organism that lives away from home.Method of the present invention also is applicable to the detection of the analyte of the existence of indicating therapeutic agent or abuse material in the sample.Method of the present invention and reagent also can be used for the analyte of test sample, and described sample is not to be derived from from the isolating biological sample of animal or plant.Like this, reagent of the present invention and method also can expand to the differentiation of analyte in the detection of one or more analytes and/or the environmental sample, described sample, except the biological sample of listing above, comprise air, water and soil earth sample, comprise samples such as the outer soil of the earth, dust, production piece etc.

In a specific embodiment, the invention provides diagnostic method and the reagent of people experimenter's HPV, and can detect and distinguish different strains, so that from " low dangerous " HPV taxonomical group, distinguish " high-risk " HPV taxonomical group.Therefore, in an especially preferred embodiment, the invention provides the pearl set, it can distinguish a plurality of different HPV bacterial strains.Like this, in one aspect, analyte is specific to many HPV taxonomical groups, and method and reagent are to the detection specificity of following substances: to the specific nucleic acid of many HPV taxonomical groups or antigen or antibody.

In a more particular embodiment, can be in conjunction with the nucleic acid primer of the genomic bacterial strain specificity of HPV portion or probe-immobilized to the pearl of each pearl subclass.Then, use the primer of the conserved regions in the HPV genome that points to side joint bacterial strain specific regions, amplification HPM genome.Then, use detects or distinguishes the HPV bacterial strain to the specific pearl subclass of any HPV bacterial strain.

Therefore, another aspect of the present invention is pointed to the pearl set, and it is used to detect one or more HPV bacterial strains, and/or is used to distinguish two or more HPV bacterial strains, and wherein said pearl set comprises a plurality of pearl subclass, wherein:

(a) pearl of each subclass is of uniform size;

(b) pearl and the coupling mutually of trapping nucleic acids probe in each subclass, described trapping nucleic acids probe can be in conjunction with the specific zone of the genomic HPV bacterial strain of HPV;

(d) at least 2 pearl subclass are admixed together, produce a pearl set, wherein the flow cytometry by distinguishing based on size, fluorescence intensity and sequence is discerned the subclass identity, thus and identification HPV bacterial strain.

Another aspect of the present invention is susceptible to the method that detects and/or distinguish two or more HPV bacterial strains in the sample, and it comprises following step:

(a) pearl that makes the sample contact comprise a plurality of pearl subclass is gathered, wherein:

(i) pearl of each subclass is of uniform size;

The (ii) pearl and the coupling mutually of trapping nucleic acids probe in each subclass, described trapping nucleic acids probe can be in conjunction with the genomic HPV bacterial strain of HPV specific regions;

(iii) the reactant on each pearl indicates identical mark, and each pearl subclass has different fluorescence intensities, to set up the heterogeneous mixture based on the pearl of fluorescence intensity; With

(iv) that at least 2 pearl subclass are admixed together, produce the set of pearl, flow cytometry wherein by distinguishing based on size, fluorescence intensity and sequence, identification subclass identity, thereby and identification HPV bacterial strain;

(b) under the genomic condition of HPV that is enough to allow described probe in conjunction with amplification, described pearl set with described sample incubation for some time, is produced the replicon that comprises the specific zone of bacterial strain;

(c) detect and/or distinguish the replicon that produces in the sample, thereby differentiate or distinguish two or more HPV bacterial strains in conjunction with described pearl.

One preferred aspect, size, fluorescence intensity level, fluorescence dye type and can with the basis of the reagent of specific analyte reaction on, distinguish the pearl in the pearl set.

The method that detects about HPV of the present invention can be used to distinguish 2 to 16 kinds of HPV bacterial strains, comprises 2,3,4,5,6,7,8,9,10,11,12,13,14,15 to 16 kinds of bacterial strains.In an especially preferred embodiment, the pearl set comprises at least 16 pearl subclass, and it is at HPV

bacterial strain

6,11,16,18,31,33,35,39,45,51,52,56,58,59,66 and 68.Suitable capture probe is to list and be presented among the SEQ IDNO:5 to 20 those in Fig. 9.

Use can be distinguished any method of the different pearls in the pearl set, can determine analyte and be present between the reactant on the pearl whether combination has taken place.In an especially preferred embodiment, the method for the different pearls in the set of differentiation pearl is flow cytometries.

The present invention also is susceptible to the diagnostic kit according to reagent of the present invention and method use.More specifically, the present invention expands to biochip and expands to the minaturization of the solid components in the mensuration, measures reagent to set up micron.In one embodiment, pearl set or its part or other immobilization of reagentsization are on solid phase (biological example chip).Biochip also can be regarded " biology laboratory " as, and on it, carry out at least a portion and measure, and/or the record result.The tabulation of abbreviation used herein is provided in table 1.

Table 1-abbreviation

Abbreviation	Describe
Abbreviation	Describe	FITC	Fluorescein
HEX	The chlordene fluorescein	FITC	Fluorescein
HEX	The chlordene fluorescein	HIV	The human immunodeficiency virus
HPV	Human papillomavirus	HIV	The human immunodeficiency virus
HPV	Human papillomavirus	JOE	7 '-dimethoxy fluorescein
PCR	The polymerase chain reaction	JOE	7 '-dimethoxy fluorescein
PCR	The polymerase chain reaction	PE	Phycoerythrin
PMT	Photomultiplier	PE	Phycoerythrin
PMT	Photomultiplier	QD	Quantum dot
TAMRA	Carboxyl tetramethyl-rhodamine	QD	Quantum dot
TAMRA	Carboxyl tetramethyl-rhodamine	TET	Tetrachlorofluorescein
TMR	The tetramethyl-rhodamine	TET	Tetrachlorofluorescein
TMR	The tetramethyl-rhodamine	VRE	The faecalis of vancomycin resistance

In table 2, summed up sequence identifier used herein.

Table 2-sequence identifier

Sequence identifier	Sequence
Sequence identifier	Sequence	SEQ ID NO：1	The nucleotide sequence of GP5+ primer
SEQ ID NO：2	The nucleotide sequence of GP6+ primer	SEQ ID NO：1	The nucleotide sequence of GP5+ primer
SEQ ID NO：2	The nucleotide sequence of GP6+ primer	SEQ ID NO：3	The nucleotide sequence of LC1_F primer
SEQ ID NO：4	The nucleotide sequence of LC1_R primer	SEQ ID NO：3	The nucleotide sequence of LC1_F primer
SEQ ID NO：4	The nucleotide sequence of LC1_R primer	SEQ ID NO：5	Capture probe or HPV bacterial strain 6
SEQ ID NO：6	Capture probe or HPV bacterial strain 11	SEQ ID NO：5	Capture probe or HPV bacterial strain 6
SEQ ID NO：6	Capture probe or HPV bacterial strain 11	SEQ ID NO：7	Capture probe or HPV31
SEQ ID NO：8	Capture probe or HPV33	SEQ ID NO：7	Capture probe or HPV31
SEQ ID NO：8	Capture probe or HPV33	SEQ ID NO：9	Capture probe or HPV35
SEQ ID NO：10	Capture probe or HPV39	SEQ ID NO：9	Capture probe or HPV35
SEQ ID NO：10	Capture probe or HPV39	SEQ ID NO：11	Capture probe or HPV45

SEQ ID NO：12	Capture probe or HPV51
SEQ ID NO：12	Capture probe or HPV51	SEQ ID NO：13	Capture probe or HPV52
SEQ ID NO：14	Capture probe or HPV56	SEQ ID NO：13	Capture probe or HPV52
SEQ ID NO：14	Capture probe or HPV56	SEQ ID NO：15	Capture probe or HPV58
SEQ ID NO：16	Capture probe or HPV59	SEQ ID NO：15	Capture probe or HPV58
SEQ ID NO：16	Capture probe or HPV59	SEQ ID NO：17	Probe 68, HPV primer, synthetic
SEQ ID NO：18	Capture probe or HPV16	SEQ ID NO：17	Probe 68, HPV primer, synthetic
SEQ ID NO：18	Capture probe or HPV16	SEQ ID NO：19	Capture probe or HPV18
SEQ ID NO：20	Capture probe or HPV66	SEQ ID NO：19	Capture probe or HPV18
SEQ ID NO：20	Capture probe or HPV66	SEQ ID NO：21	MLC1_Ac, HPV primer, synthetic
SEQ ID NO：22	GP5+For_Ac, HPV primer, synthetic	SEQ ID NO：21	MLC1_Ac, HPV primer, synthetic
SEQ ID NO：22	GP5+For_Ac, HPV primer, synthetic	SEQ ID NO：23	MLC1_reg_FP, HPV primer, synthetic
SEQ ID NO：24	MLC1_reg_R, HPV primer, synthetic	SEQ ID NO：23	MLC1_reg_FP, HPV primer, synthetic
SEQ ID NO：24	MLC1_reg_R, HPV primer, synthetic	SEQ ID NO：25	GP5d+, HPV primer, synthetic
SEQ ID NO：26	GP6d+, HPV primer, synthetic	SEQ ID NO：25	GP5d+, HPV primer, synthetic

Description of drawings

Fig. 1 is a diagram of describing typical flow cytometer.

Fig. 2 is the diagram that is presented at the DNA extraction operating process of using in the HPV diagnostic method.

Fig. 3 shows the diagram be used to increase from the PCR operation of the HPV of DNA sample and people DNA.GP5+ and GP6+ refer to general HPV primer, and it is in conjunction with the conserved sequence among the HPV (Y), and the generation amplicon, and it is included in HPV bacterial strain (X _1-16) between the zone that can change.Primer LC1_F and LC1_R amplification human gene group DNA zone (Z), it is as the contrast of a kind of hybridization step in back.Primer GP6+ and LC1_R comprise fluorescent marker, and it is incorporated in the amplicon of generation.

Fig. 4 is the diagram that shows based on the size discrimination microballoon.Shown 6 point groups (cluster), its with comprise 3.0 μ m, 3.5 μ m, 4.1 μ m, 5.0 μ m, 5.6 μ m are corresponding with the microballoon of 6.8 μ m diameters.

Fig. 5 is the diagram that shows based on the microballoon of the identical size of fluorescent mark intensity, distinguishes.Can clearly distinguish 0%, 4%, 20% and 100% TMR relative intensity.

Fig. 6 is the synoptic diagram that is presented at the every kind of binding reagents that uses in the mensuration.Mensuration comprises and has 3.0 μ m, 3.5 μ m, 4.1 μ m, 5.0 μ m, the microballoon and 0%, 4% of the diameter of 5.6 μ m and 6.8 μ m, 20% and 100% fluorescent mark strength of signal.Under the situation of littler bead size (i.e. 3.0 μ m, 3.5 μ m and 4.1 μ m), use 0% and 100% TMR intensity; For 5.0 μ m microballoons, use 0%, 20% and 100% TMR intensity; And for the microballoon of maximum, 5.6 μ m and 6.8 μ m diameters use all strength of signal.

How Fig. 7 shows to use flow cytometry to distinguish the diagram of 17 kinds of binding reagents on granular size and fluorescent mark intensity based.Point group 1 to 4 is equivalent to have respectively 6.8 μ m particles of 0%, 4%, 20% and 100% mark intensity; Point group 5 to 8 is equivalent to have respectively 5.6 μ m particles of 0%, 4%, 20% and 100% mark intensity; Point group 9 to 11 is equivalent to have respectively 5.0 μ m particles of 100%, 20% and 0% mark intensity; Point group 12 and 13 is equivalent to have respectively 4.1 μ m particles of 100% and 0% mark intensity; Point group 14 and 15 is equivalent to have respectively 3.5 μ m particles of 100% and 0% mark intensity; Point group 16 and 17 is equivalent to have respectively 3.0 μ m particles of 0% and 100% mark intensity;

Fig. 8 shows that amplicon is in conjunction with the diagram of which binding reagents array.The result shows and is incorporated into viral conserved sequence Y, people's control sequence Z and virus strains specific sequence X ₁₆

Fig. 9 is to HPV

bacterial strain

6,11,16,18,31,33,35,39,45,51,52,56, and the representative of 58,59,66 and 68 specific capture probes (primer).

Figure 10 A to G provides and has been used to detect the Qplots (trade mark) whether the human sample exists HPV.

Detailed Description Of The Invention

The invention provides and measure and reagent, comprise biochip, it can detect one or more analytes and/or distinguish different members in the alanysis thing. More specifically, by based on the multiple analysis method of analyte with the character of measuring component, differentiate or distinguish analyte. Diagnosis and detection mensuration of the present invention and reagent are specially adapted to diagnose the pathogenic infection among the many cells eucaryon experimenter. In a specific embodiment, the invention provides the diagnostic assay of HPV among the people experimenter, and can distinguish the HPV taxon, " high-risk " HPV infects and " low dangerous " HPV infects in order to distinguish. And the present invention also provides diagnosis or evaluation and analyte to infect the method for the development of the relevant disease (especially, people experimenter's cervix cancer) of many cells eucaryon experimenter.

Should be appreciated that except as otherwise noted, the invention is not restricted to specific diagnosis or assay method, because this can change. It is also understood that term used herein only is used for describing the purpose of particular, is not intended to limit.

Should be pointed out that as employed at this specification unless context is otherwise noted, " " of singulative, " a kind of " and " being somebody's turn to do " comprise plural aspect. Therefore, " a kind of analyte " comprises single analyte and two or more analytes; A kind of " differentiable substrate on the physical chemistry " comprises single substrate and two or more substrates; The rest may be inferred.

Therefore, in one aspect, the invention provides the pearl set, it can detect and/or distinguish two or more analytes in the sample, described pearl set-inclusion:

(a) pearl of every subset is of uniform size;

(b) pearl in every subset and the coupling of reaction phase, described reactant can with testing sample in particular target analytes react specifically;

(c) reactant on each pearl indicates identical mark, and each pearl subset has different fluorescence intensities, to set up the heterogeneous mixture based on the pearl of fluorescence intensity; With

(d) at least 2 pearl subsets are admixed together, produce a pearl set, wherein the flow cytometry by distinguishing based on size, fluorescence intensity and analyte is identified the subset identity, thus and the reactant of coupling of identification pearl.

At a related aspect, can be further labeling reaction discriminatively, with based on the mixing of different fluorescent dyes, set up other pearl subgroup.

In yet another aspect, the invention provides for detection of and/or distinguish method or the pearl set of analyte.

One preferred aspect, the set of method of the present invention or pearl can detect and/or the differentation amongst pathogenic e analyte.

The present invention also provides the method that detects and/or distinguish one or more analytes in the sample, and it comprises following step:

(a) make the sample contact to the specific pearl set of target analytes;

(b) under the condition that is enough to allow analyte in the described sample and the reactant on the pearl in the set of described pearl to react specifically, described pearl was gathered with described sample incubation a period of time; With

As used herein, term " pathogenicity analyte " refers to infer infection, live away from home or microorganism or the virus of contaminated samples. Exemplary Analysis of pathogens thing comprises virus, bacterium, fungi and eukaryotic microorganisms. In a preferred embodiment, " analyte " comprises microorganism or the virus that infects multicellular organism (for example animal or plant). Therefore, in one embodiment, the pathogenicity analyte can be regarded the animal or plant pathogen as. But, the present invention includes the avirulence analyte that detects and distinguish the multicellular organism that lives away from home, the microorganism of animal (Lactobacillus for example for example, the ruminant bacterium), the microbe symbiotic of insect biological (for example streptomyces, Wolbachia), the biological (green alga for example of poriferous microbe symbiotic, dinoflagellates, cyanobacteria) etc.; Endophyte of plant (for example mycorhiza, rhizobium, Frankia, streptomyces) etc. And analyte can be the analyte irrelevant with multicellular organism. Such analyte comprises, bacterium, and fungi, virus, protist, nematode etc., it resides in the specific environment, comprises for example soil of " natural " environment, ocean, fresh water, ice, rock, hot water mouth and air; Health care environments comprises hospital, hospital equipment, operation equipment, health care personnel's clothes etc.; " industry " environment comprises production equipment, pharmaceutical equipment, winery, grape wine factory etc.; " laboratory " environment comprises fermentation tank, culture, experimental bench, instrument etc.

Therefore, the sample that the present invention is susceptible to comprises production piece (such as air, water and soil etc.) and biological sample (blood for example, serum, saliva, ight soil, urine, tissue fluid, seminal fluid, exudate, pus is breathed liquid, mucus and from the wiping sample of local ulcer, cancer and damage). In addition, sample can be the outer sample of the earth, for example from aerolite or another planet. About the latter, mensuration of the present invention is adapted at using on the interplanetary remote vehicle, is used for testing soil or dust or ice sample product, or is used for the core material of test planet.

In a preferred embodiment, analyte comprises infection animal experimenter's bacterium, mycoviruses and/or eucaryon parasitic animal and plant. " animal subjects " that this paper is susceptible to comprises all animals, preferred mammal, and more preferably primate comprises the low primate of waiting, more preferably the people. For convenient, " animal " also comprises for example ox of domestic animal especially, horse, and sheep, pig, goat and donkey and animal used as test comprise mouse, rat, rabbit, cavy and hamster.

The exemplary people's analyte that uses reagent of the present invention and method to detect comprises virus, and such as human papilloma virus (HPV), coronavirus comprises SARS virus, influenza virus, avian influenza virus, HIV comprises HIV-I, HIV-II or HLTV-IV, common lentivirus, hepatitis viruse etc., the pathogenicity factor of sexually transmitted disease, for example chlamydiaceae, gonorrhoea, Mycoplasma and syphilis; Food-borne pathogen is listeria for example, Salmonella, Escherichia coli (especially Escherichia coli HO 567), Shigella, Brucella, staphylococcus aureus; The Nosicomial pathogen, for example staphylococcus aureus comprises the staphylococcus aureus (MRSA) of methicillin resistance and the enterococcus (VRE) that enterococcus comprises the vancomycin resistance; The pathogen that obtains from environment is Legionella for example, Giardia, and Crytospiridium belongs to, bacillus anthracis (anthrax) etc.

In one aspect, the sample of detection analyte preferably is derived from the many cells experimenter's who infers the analyte infection or live away from home sample. Therefore, in one aspect, sample is " biological sample " preferably. The exemplary biological sample that does not limit the present invention in any way comprises tissue or cell sample, cell scraping blade for example, and biopsies etc. and humoral sample comprise blood, urine, lymph, amniotic fluid, cerebrospinal fluid etc.

In yet another aspect, method of the present invention also is applicable to detect non-" analyte " that exclusively is derived from the Eukaryotic sample of many cells. Like this, the present invention expands to one or more concrete taxons or the bacterial strain that detects and/or distinguish the analyte in the sample, and described sample is environmental sample (comprising air, the water and soil sample) for example, production piece, laboratory sample etc. For example, method of the present invention can be used for estimating soil, water or air sample or be derived from the sample of culture or prokaryotic micro-organisms group, eukaryotic microorganisms group and/or the viral load on surface.

In a particularly preferred embodiment of the present invention, test analyte is HPV or its bacterial strain, and sample preferably is derived from people experimenter's biological sample. In another preferred embodiment, biological sample comprises experimenter's one or more cells, blood or urine. Most preferably, biological sample comprises the cervical cell of collecting from the experimenter.

Gearhart etc. (www.emedicine.com/MED/topicl 037.htm, 2004) describe HPV in detail, will reproduce in its part below. HPV can cause the epithelial tumor of skin and mucous membrane. Detected above 100 kinds of HPV types, and the almost 70 kinds of genomes that checked order fully. The current categorizing system based on the genome sequence similitude is usually with relevant for 3 kinds of classification describing clinically HPV: anogenital wart and/or mucous membrane wart, non-genital skin wart, and epidermodysplasia verruciformis (EV). By the website of HPV sequence library, can obtain database and the stammbaum of HPV genome sequence.

The HPV mucosal infections is further divided into (asymptomatic) that hides, subclinical, or clinical. Clinical infringement roughly is significantly, and latent infection only can detect by Test Virus DNA. By using 5% acetic acid and under amplifying, checking, can differentiate subclinical infringement. It is potential that most of HPV infect; Significantly infection can cause wart usually clinically, rather than malignant tumour.

Typically,

HPV type

6 and 11 is labeled as low dangerous, because the infection of these types has low oncogenic potential, and usually can causes formation and the rudimentary precancerous lesion of condyloma.

HPV Class1

6 and 18 has become the high-risk type of HPV, because they are reason, especially those in anus genitals kind and/or mucous membrane kind of most of senior upper intracutaneous infringements (they can canceration).

HPV infects self can not cause the vicious transformation of the tissue of infection. Co-factor, for example smoking, ultraviolet radiation, pregnancy, folate lacks and immunosupress has participated in this process. Table 3 has been listed many kinds of diseases and relevant HPV hypotype.

Table 3-disease and relevant HPV hypotype

Non-genital skin is sick	The HPV type
Non-genital skin is sick	The HPV type	Common wart (verrucae vulgaris)	1，2，4，26，27，29，41，57，65
Sole wart (myrmecias)	1，2，4，63	Common wart (verrucae vulgaris)	1，2，4，26，27，29，41，57，65
Sole wart (myrmecias)	1，2，4，63	Flat wart (verrucae plana)	3，10，27，28，38，41，49
BucherShi wart (processing the people's of meat, poultry and fish common wart)	1，2，3，4，7，10，28	Flat wart (verrucae plana)	3，10，27，28，38，41，49
	1，2，3，4，7，10，28	Mosaic wart	2，27，57
Refer to squamous cell carcinoma	16	Mosaic wart	2，27，57
Refer to squamous cell carcinoma	16	Epidermodysplasia verruciformis (optimum)	2，3，10，12，15，19，36，46，47，50
Epidermodysplasia verruciformis (pernicious or optimum)	5，8，9，10，14，17，20，21， 22，23，24，25，37，38	Epidermodysplasia verruciformis (optimum)	2，3，10，12，15，19，36，46，47，50
Epidermodysplasia verruciformis (pernicious or optimum)	5，8，9，10，14，17，20，21， 22，23，24，25，37，38	Non-wart skin lesion	37，38
Non-genitals mucosal disease	The HPV type	Non-wart skin lesion	37，38
Non-genitals mucosal disease	The HPV type	Breathe papillomatosis
		Breathe papillomatosis
		6，11
The squamous cell carcinoma of lung		6，11	6，11，16，18
The squamous cell carcinoma of lung	Papilloma of larynx	6，11，30	6，11，16，18

Laryngocarcinoma	16，18
Laryngocarcinoma	16，18	Maxillary sinus papilloma	57
The squamous cell carcinoma of hole	16，18	Maxillary sinus papilloma	57
The squamous cell carcinoma of hole	16，18	Papilloma of conjunctiva	6，11
The conjunctiva cancer	16	Papilloma of conjunctiva	6，11
The conjunctiva cancer	16	Focal epithelial hyperplasia of mouth's (focal epithelial hyperplasia)	13，32
Carcinoma of mouth	16，18		13，32
Carcinoma of mouth	16，18	Leukokeratosis of oral mucosa	16，18
The squamous cell carcinoma of oesophagus	16，18	Leukokeratosis of oral mucosa	16，18
The squamous cell carcinoma of oesophagus	16，18	The anus genital diseases	The HPV type
Condyloma acuminatum		The anus genital diseases	The HPV type
Condyloma acuminatum



		6，11，30，42，43，44，45，51，52，54
Bowenoid papulosis		6，11，30，42，43，44，45，51，52，54	16，18，34，39，42，45
Bowenoid papulosis	Bowen disease	16，18，31，34	16，18，34，39，42，45
Huge condyloma (buschke-Lowenstein tumor)	Bowen disease	16，18，31，34	6，11
Huge condyloma (buschke-Lowenstein tumor)	Unspecified intraepithelial neoplasia forms	30，34，39，40，53，57，59，61， 62，64，66，67，68，69	6，11
Rudimentary intraepithelial neoplasia forms	Unspecified intraepithelial neoplasia forms	30，34，39，40，53，57，59，61， 62，64，66，67，68，69	6，11，43
Rudimentary intraepithelial neoplasia forms	Middle intraepithelial neoplasia forms	31，33，35，42，44，45，51，52	6，11，43
Senior intraepithelial neoplasia forms	Middle intraepithelial neoplasia forms	31，33，35，42，44，45，51，52	16，18，56，58
Senior intraepithelial neoplasia forms	Carcinoma of vulva	6，11，16，18	16，18，56，58
Carcinoma of vagina	Carcinoma of vulva	6，11，16，18	16
Carcinoma of vagina	Cervix cancer	16，18，31	16
Cancer of anus	Cervix cancer	16，18，31	16，31，32，33
Cancer of anus	Preinvasive carcinoma of penis (erythroplasia of Queyrat)	16	16，31，32，33
Carcinoma of penis	Preinvasive carcinoma of penis (erythroplasia of Queyrat)	16	16，18

Papillomavirus is the height species specificity, can not infect other species, even under laboratory condition. The people is unique known HPV host.

Papillomavirus is the viral without capsid of icosahedron symmetry, and it has 72 capsomeres around genome, and described genome contains the double-stranded cyclic DNA with about 8000 base-pairs.

Think that papillomavirus has 2 kinds of replication modes, i.e. stable copy of episome genome in basal cell, and in the cell of more differentiation the copying of out of control or growth, to produce progeny virus. Although all cells of infringement all contains viral genome, the expression of viral gene and the state of Cell Differentiation are closely related. Before the keratinocyte that infects left basalis, most of viral genes were not activated. The production of virion only occurs over just in the well differentiated keratinocyte; Therefore, virus production only occurs over just epithelial surface, and cell here finally comes off in environment.

Think that the reason of HPV infringement is the propagation of the substrate keratinocyte of infection. When basal cell is exposed to the infectious virus of the epithelium barrier that passes upset, usually infect, as in the sexual intercourse process or behind the small skin abrasion, occuring. Confirm that not yet it is cytolysis that HPV infects, yet as the result of the degraded of cast-off cells, discharge virion. And HPV virus can and not have at low temperature to survive the several months in host's the situation.

The virus multiplication is confined in the nuclear usually. As a result, the cell of infection shows the nuclear atypia of height usually. Koilocytosis (from Greek koilos, refer to empty) has been described the combination that nuclear week transparent (ring) and (rasinoid) that concentrate or shrinkage examine, and is the feature of productivity papilloma virus infection.

The HPV genome exists as the ring-type episomal DNA, and it separates with host cell nuclear in the optimum or low dangerous HPV infringement, for example common those relevant with

HPV type

6 and 11. High-

risk HPV Class1

6 and 18 genome are incorporated in the host cell DNA of malignant lesions usually. But the present invention expands to arbitrarily HPV bacterial strain, includes but not limited to

bacterial strain

6,11,16,18,31,33,35,39,45,51,52,56,58,59,66 and 68. The integration of viral genome in the host cell gene group is considered the sign of vicious transformation. Show, the HPV albumen E6 of high-risk serotype and E7 meeting deactivation host tumor suppressor protein p53 and Rb, thus the host cell that causes lacking of proper care is bred and vicious transformation.

Therefore, in yet another aspect, the invention provides the method that detects and/or distinguish one or more the specific HPV bacterial strains in the biological sample, described method comprises following step:

(i) obtain biological sample from people experimenter, it is inferred and comprises HPV;

(ii) from described sample separation nucleic acid;

(iii) use primer from described sample amplification nucleic acid, described primer produces and every kind of amplicon that the HPV bacterial strain is different;

(iv) randomly, amplification contrast nucleotide sequence;

(v) be marked at step (iii) and/or (iv) described amplicon;

(vi) make the amplicon and the pearl set hybridization that is coated with reactant of mark, wherein the nucleotide sequence that comprises with specific HPV bacterial strain of each member of pearl set has complementary nucleic acid molecule, its in conjunction with or be connected on the physical chemistry on the differentiable pearl; With

(vii) determine the amplicon the sort of reactant of bonded;

Wherein said amplicon combines with specific reactants, is indicating the existence of specific HPV bacterial strain in sample.

The present invention can detect the HPV DNA of amplification, perhaps, uses reversed transcriptive enzyme, detects corresponding RNA.Therefore, the present invention is susceptible to the pearl with RNA or DNA or its chemical analog.

Method of the present invention partly is used for detecting and/or distinguish one or more specific bacterial strains of experimenter's analyte of sample." the specific bacterial strain of experimenter's analyte " mentioned herein comprises the species of analyte or any variant of taxonomical group.The example of " bacterial strain " of analyte comprises the subspecies of analyte, has the analyte variant of different virulence level, the analyte variant of indication different prognosis when infecting or living away from home the host, the biological chemistry variant of analyte etc.

In a preferred embodiment, method of the present invention can be used for detecting and/or distinguish and more high-risk or relevant specific HPV bacterial strain (high-risk bacterial strain) and dangerous with lower cancer or those (the low dangerous bacterial strains) that low oncogenic potential is relevant of higher oncogenic potential the mankind.Therefore, term " high-risk " HPV bacterial strain comprises any HPV bacterial strain relevant with the development of cancer (comprising cervical cancer) among the people experimenter.Point out that as top the exemplary high-risk HPV bacterial strain that does not limit the present invention in any way comprises

HPV

6,11,16,18,31,33,35,39,45,51,52,56,58,59,66 and 68.The suitable capture probe on pearl that in Fig. 9, has shown these HPV bacterial strains.Term " probe " and " primer " can use in the present context interchangeably." low dangerous " HPV bacterial strain comprise with people experimenter in dangerous irrelevant or only faint relevant those of the cancer that increases.Typically, low dangerous HPV bacterial strain is that wart forms bacterial strain, comprises HPV 6 and HPV 11.

Pearl of the present invention can react with the particular target analytes in the sample specifically with reactant coupling mutually, described reactant.In one aspect, reactant of the present invention is a nucleic acid, and the analyte that reacts specifically with reactant in the sample also is a nucleic acid.

Therefore, but the primer of the specific genome sequence of conserved regions side joint bacterial strain that points to the HPV bacterial strain is used in this aspect of the present invention.The specific sequence of bacterial strain is called " variable " sequence, because compare with constant conserved sequence between bacterial strain, they change between bacterial strain.After the amplification, make the pearl subclass in the set of amplicon contact pearl, wherein each pearl of each subclass carry can with the capture nucleic acid primer or the probe of the specific amplicon hybridization of bacterial strain.Use bead size, fluorescence intensity and DNA binding specificity to double, can realize discriminating, sorting and the differentiation of HPV bacterial strain.

Therefore, another aspect of the present invention is susceptible to the pearl set, and it is used to detect one or more HPV bacterial strains and/or is used to distinguish two or more HPV bacterial strains, and wherein said pearl set comprises a plurality of pearl subclass, wherein:

(a) pearl of each subclass is of uniform size;

Another aspect of the present invention is susceptible to the method for two or more HPV bacterial strains that are used for detecting and/or distinguish sample, and it comprises following step:

(i) pearl of each subclass is of uniform size;

The (ii) pearl and the coupling mutually of trapping nucleic acids probe in each subclass, described trapping nucleic acids probe can be in conjunction with the specific zone of the genomic HPV bacterial strain of HPV;

(b) under the genomic condition of HPV that is enough to allow described primer in conjunction with amplification, described pearl set with described sample incubation for some time, is produced the replicon that comprises the specific zone of bacterial strain;

Also can use the specific amplicon of fluorescent reporter molecule labeling nucleic acid capture probe.

Use can be from experimenter's sample separation nucleic acid for any easily method of character of sample itself and analyte.As used herein, term " nucleic acid " refers to DNA and/or RNA.Typically, DNA is isolating, although in some cases, this is that those skilled in the art is conspicuous, isolation of RNA more preferably, for example, when target analytes is RNA viruses.If RNA is isolating, can cloning RNA, perhaps can use standard method, the RNA reverse transcription is become cDNA, be used for subsequently amplification and analysis.

Preferably, " nucleic acid " is DNA.Use any mode easily, can be from sample separation DNA.For example, under the situation of the virus (for example HPV) of people's cell sample, can use guanidine or functional equivalent reagent to come lysing cell.The method (Anal.Biochem.207 (1): 97-201,1992) that exemplary lysis and DNA extraction method based on guanidine is Nelson and Krawetz.Cracked solution based on guanidine also can obtain from supplier is commercial, Qiagen for example, QIAamp for example, PAXgene etc.But, cleavage method can be per sample with the character of analyte and change.For example, for the detection of analyte in the environmental sample (for example soil or deposit sample), can be more suitably based on the lysis system of granulated glass sphere, the method (Appl.Environ.Microbiol.64 (7): 2463-2412,1998) of Kuske etc. for example.Under any circumstance, those of ordinary skill in the art tests without over-drastic, can easily determine the suitable cleavage method of specific analyte and sample.

Behind the lysing cell, can be by the clear easily any mode easily (for example test kit that obtains referring to top commerce) of those skilled in the art, purify DNA.In an embodiment preferred of the present invention, use limited amount DNA binding reagents, such as but not limited to silicon-dioxide, purify DNA.By using limited amount DNA binding reagents, can never separate the consistent DNA that measures, because the amount of the DNA of Hui Shouing equals the maximum of the combinable DNA of this limited amount DNA binding reagents in each case with sample.Then, can use any mode easily, reclaim or eluted dna binding reagents bonded DNA from the DNA binding reagents.

Although DNA is preferred nucleic acid, also can use the RNA separation method of any standard, from sample separation RNA.RNA separates and typically comprises cytoclasis step and RNA separating step.The exemplary cell breaking technology that is applicable to isolation of RNA comprises Ambion TechnicalBulletin #183 described those (" www.ambion.com/techlib/tb/tb_183.html ").And, at www.ambion.com/techlib/basics/products/rnaisol_compchart .html, the many exemplary RNA separating kit that is applicable to many sample types has been described.But, should be appreciated that these specific RNA separate and the method and the test kit of purifying do not limit the present invention in any way the present invention and the conspicuous any RNA separation method compatibility of those skilled in the art.

Detect about HPV, the pearl set can comprise and resembles the as many pearl subclass of HPV bacterial strain.Therefore, mensuration can adopt 2,3,4,5, and 6,7,8,9,10,11,12,13,14,15 or 16 pearl subclass, corresponding separately HPV

bacterial strain

6,11,16,18,31,33,35,39,45,51,52,56,58,59,66 and 68.Other pearl also can be with comparing.Suitable capture probe is disclosed in Fig. 9.

(a) pearl of each subclass is of uniform size;

(b) pearl and the trapping nucleic acids probe coupling mutually that is selected from SEQ ID NO:5 to 20 in each subclass, described trapping nucleic acids probe can be in conjunction with the specific zone of the genomic HPV bacterial strain of HPV;

(i) pearl of each subclass is of uniform size;

The (ii) pearl and the trapping nucleic acids probe coupling mutually that is selected from SEQ ID NO:5 to 20 in each subclass, described trapping nucleic acids probe can be in conjunction with the specific zone of the genomic HPV bacterial strain of HPV;

Therefore, pearl set can comprise

HPV

2,3, and 4,5,6,7,8,10,11,12,13,14,15,16 pearl subclass have the nucleic acid molecule of a kind of SEQ of being selected from ID NO:5 to 20 separately.The specific sequence of these HPV bacterial strains among the SEQ ID NO:5 to 20 comprises having at least 90% consistence or can hang down the nucleic acid molecule of hybridizing with they or they complementary type under the stringency with these sequences.At least 90% comprises 90,91,92,93,94,95,96,97,98,99 and 100%.

Method of the present invention partly depends on, and uses the primer in conjunction with the conserved sequence in the different strains of experimenter's analyte, and from sample amplification nucleic acid, but this can produce amplicon, and the latter comprises the different IPs nucleotide sequence of every kind of bacterial strain of analyte.In fact, the primer of Shi Yonging can be combined in sequence conservative in experimenter's analyte bacterial strain in the present invention, and its side joint is not conservative at least in part or polymorphic zone between bacterial strain.Schematically, the analyte region of amplification has following general structure:

C-X-C’

Wherein:

C is a nucleotide sequence, and it is guarded in two or more analyte bacterial strains, and is the binding site of " forward " primer;

X is a nucleotide sequence, and it part or all comprises the variation between the different analyte bacterial strains;

C ' is a nucleotide sequence, and it is guarded in two or more analyte bacterial strains, and is the binding site of " oppositely " primer;

From primer sites (for example above-mentioned those) amplification, can allow effectively to use " general " primer set, it is combined in C and C ', with the X that increase from many analyte bacterial strains.And, should be pointed out that and use the amplicon of universal primer amplification can comprise conserved regions and variable region.

In a preferred embodiment, use the primer of amplification HPV sequence.More preferably, these primers are: GP5+, i.e. 5 ' TTTGTTACTGTGGTAGATACTAC 3 ' (SEQ ID NO:1), and GP6+, i.e. 5 ' GAAAAATAAACTGTAAATCATATTC 3 ' (SEQ ID NO:2).These primers produce amplicon from HPV, the zone (being defined as X in Fig. 3) that it comprises conserved regions (being defined as Y in Fig. 3) and changes between different HPV bacterial strains.

The present invention also is susceptible to the amplification of control sequence.In one embodiment, control sequence can comprise biological sample source experimenter's genomic zone.But the present invention never is limited to these concrete control sequence, and also is susceptible to conspicuous other control sequence of those skilled in the art.And, also can under the situation of the control sequence that do not increase, realize method of the present invention.

In a preferred embodiment, use comprises the primer LC1_F of nucleotide sequence 5 ' TACACACAGGTGTACACAGA 3 ' (SEQ ID NO:3) and comprises the primer LC1_R of sequence 5 ' ACCAAGTACTCTACGTGTTG 3 ' (SEQ ID NO:4), from people experimenter's genome amplification control sequence.

Use DNA cloning method arbitrarily, separated DNA can increase.At " DNAAmplification:Current Technologies and Applications " (Demidov and Broude Eds., Horizon Bioscience, 2004) in, described many exemplary DNA cloning methods, they can not limit the present invention.

Use any RNA method known in the art, the isolating RNA that can increase, and developed many RNA amplification techniques.Two big classes wherein are: (i) use the technology of thermal cycling, for example RT-PCR and (ii) isothermal measure, for example based on amplification (NASBA) (Compton, Nature 350:91-92,1991 of nucleotide sequence; Kievits etc., J Virol.methods35:273-286,1991) and the amplification (TMA) (Hill, J.Clin.LigandAssay 19:43-51,1996) of transcriptive intermediate.Can segment isothermal and measure, this based on: (i) whether they copy and the amplified target sequence, TMA for example, NASBA and self-sustained sequence replicating (3SR) (Guatelli etc., Proc.Natl Acad.Sci USA 87:1874-1878,1990; Chadwick etc., J.Virol.Methods 70:59-70,1998; Summary is referring to Chan and Fox, Rev.Med.Microbiol.10:185-196,1999), or (ii) whether they produce the dependent signal of target thing that can further increase, for example invader measure (Lyamichev etc., Nat.Biotechnol.17:292-296,1999; Ryan etc., Mol.Diagn.4:135-144,1999).Have multiple other amplification technique, they can not easily be included into these classifications, for example Q β replicative enzyme (Lizardi etc., Biotechnology (6:1197-1202,1988) and ramose DNA (Todd etc., J.AIDSHum.Retrovirol.10:S35-S44,1995; Pawlotsky etc., J.Virol.Methods 79:227-235,1999).But, should be appreciated that the present invention is susceptible to the conspicuous any RNA amplification method of those skilled in the art.And, should be appreciated that the present invention also is susceptible to the use reversed transcriptive enzyme or its function equivalent changes into DNA with RNA, can increase it then.

According to the present invention, the step that is marked at aforesaid method (iii) and/or the amplicon (iv).Can use any mode easily, mark amplicon of the present invention.Exemplary method comprises the method after before synthetic and synthetic.Marking method before synthetic comprises, thereby mark is used for the PCR primer that pcr amplification also is integrated into amplicon subsequently.In the method, mark typically is combined in 5 ' end of the primer that is applicable to the amplification amplicon, although also be susceptible to other position in the labeled primer, for example 3 ' mark or non-end mark.

Also can between the polynucleotide of mark and mark, use chemical linkers.Suitable connector sequence can easily be determined by those skilled in the art, may comprise for example C6 of connector, amido modified dose of C7 and C12 and comprise the connector of sulfydryl.Determine that easily primer can comprise connector and mark or independent connector, can mark be attached to above it in the stage of back.

Marking method after the amplification comprises the otch Mk system, wherein uses Klenow polysaccharase or its function equivalent, uses random primer, from the polynucleotide of amplicon complex sign.In building-up process, the Nucleotide of mark, or comprise the Nucleotide of linking group, can mix in the Klenow polysaccharase synthetic polynucleotide.

Under any circumstance, those skilled in the art can easily understand other marking method, should be appreciated that the selection of marking method will never limit or limit the present invention.

Preferably, the mark of use is " fluorescent marker " or " fluorophore ".Those skilled in the art are familiar with many different fluorescent markers, and the selection of fluorescent marker does not limit the present invention in any way.In an embodiment preferred of the present invention, fluorescent marker of the present invention comprise any can be in conjunction with polynucleotide and can use the fluorescent marker that is selected from following light source activation:

(i) argon laser: comprise blue 488nm spectral line, it be applicable to excite many in green to fluorescigenic dyestuff of red area and fluorescence dye.Also can obtain adjustable argon laser in wavelength region (458nm, 488nm, 496nm, 515nm etc.) emission.

(ii) diode laser: have the 635nm emission wavelength.Obtainable other diode laser is worked at 532nm now.Enjoyably, this wavelength optimally excites iodine third ingot (PI).PI dyeing is widely used for DNA analysis, lives/dead counting and ploidy mensuration.Also can obtain to launch the blue diode laser of about 476nm light.

(iii) HeNe gas laser: use the work of red 633nm spectral line.

(iv) HeCd laser: work at 325nm.

(v) 100W mercury arc lamp: the most effective light source that excites UV dyestuff (as Hoechst and DAPI).

In preferred embodiment of the present invention, fluorescent marker is selected from: Hydroxycoumarin, aminocoumarin, methoxy coumarin, waterfall indigo plant, fluorescent yellow, NBD, Phyccerythrin (PE), PerCP, allophycocyanin, hoechst 33342, DAPl, SYTOX Blue, hoechst 33258, chromomycin A3, Plicamycin, YOYO-1, SYTOX is green, SYTOX orange, 7-AAD, acridine orange, TOTO-1, To-PRO-1, thiazole orange, TOTO-3, TO-PRO-3, LDS751, the Alexa fluorescence dye comprises Alexa Fluro-350,-430 ,-488 ,-532 ,-546,-555 ,-556 ,-594 ,-633,-647 ,-660 ,-680 ,-700 and-750; The BoDipy dyestuff comprises BoDipy 630/650 and BoDipy 650/665; CY dyestuff, especially Cy2, Cy3, Cy3.5, Cy5, Cy5.5 and Cy7; 6-FAM (fluorescein); PE-Cy5, PE-Cy7, fluorescein dT; Chlordene fluorescein (Hex); 6-carboxyl-4 ', 5 '-two chloro-2 ', 7 '-dimethoxy fluorescein (JOE); The Oregon green dye comprises 488-X and 514; Rhodamine comprises the X-rhodamine, lissamine rhodamine B, and rhodamine is green, the red and ROX of rhodamine; TRITC, tetramethyl-rhodamine (TMR); Carboxyl tetramethyl-rhodamine (TAMRA); Tetrachlorofluorescein (TET); Red 6B, FluorX, BODIPY-FL and texas Red.In particularly preferred embodiment of the present invention, marker is Cy5, and it is especially easily for realization of the present invention.

But in alternate embodiment of the present invention, radioactive or inactive mark can be used for the mark amplicon.Radio-labeling comprises easily ³²P and ³H.Can use any mode easily, these marks are mixed amplicon and/or primer.Also can use many inactive marking methods.In Speel (Histochem.Cell Biol.112:89-113,1999), described and do not limited exemplary inactive marking method of the present invention.

As used herein term " reactant " should be understood to comprise the polynucleotide that are immobilized on the pearl.More specifically, every kind of reactant comprises polynucleotide, and the latter comprises and the amplicon complementary sequence that produces according to methods described herein, its in conjunction with or be connected on the physical chemistry on the differentiable pearl.Reactant also can comprise the control sequence complementary sequence with preamble definition, promptly from the sequence (Z) of the genome amplification of multicellular organism or between the analyte bacterial strain amplicon (Y) of conservative nucleotide sequence.

Therefore, the set of the pearl of reactant can comprise:

[B ₁-cX ₁，B ₂-cX ₂，B ₃-cX ₃...B _n-cX _n，B _y-cY，B _z-cZ]

Wherein:

B ₁... B _n, B _y, B _zIt is respectively differentiable pearl on the physical chemistry;

CX _nBe the polynucleotide that are immobilized on the pearl, wherein said polynucleotide comprise nucleotide sequence, the latter with to the specific specific nucleic acid sequence complementation of the specific bacterial strain of analyte or experimenter's analyte, and wherein n is the number that will use the specific bacterial strain of analyte that pearl set detects or experimenter's analyte;

CY is the optional member of pearl set, and is the polynucleotide that are immobilized on the pearl, and wherein said polynucleotide comprise nucleotide sequence, the latter and the sequence complementation of guarding between the bacterial strain of analyte or experimenter's analyte;

CZ is the optional member of pearl set, and is the polynucleotide that are immobilized on the pearl, and wherein said polynucleotide comprise nucleotide sequence, the latter and the control sequence complementation of increasing from the many cells experimenter.

Preferably, experimenter's analyte is HPV, and the contrast dna sequence dna is human gene group DNA's sequence.

" complementation " should be understood to, and immobilized reactant polynucleotide can be under low stringency and the amplicon hybridization that produces according to methods described herein.Preferably, immobilized polynucleotide can be in conjunction with sample and standard substance under medium stringency, and most preferably, immobilized polynucleotide can be in conjunction with sample and standard substance under high stringency.

Low severity herein comprises, at least about 0 to (comprising 1%, 2% at least about the 15%v/v methane amide, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% 11%, 12%, 13% and the 14%v/v methane amide) and at least about 1M to be used for hybridization at least about 2M salt and at least about 1M to being used for wash conditions at least about 2M salt.Usually, low severity is at about 25-30 ℃ to about 52 ℃, for example 25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48, and 49,50,51 and 52 ℃.Can change temperature, and can use higher temperature to substitute methane amide and/or produce substituting stringency.When needs, can use substituting stringency, for example medium severity, it comprises at least about 16%v/v and to comprise 16%, 17% at least about the 30%v/v methane amide, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 24%, 26%, 27%, 28%, 29% and the 30%v/v methane amide, with at least about 0.5M to be used for hybridization at least about 0.9M salt and at least about 0.5M to being used for wash conditions at least about 0.9M salt, or high severity, it comprises at least about 31%v/v to extremely being used for hybridization and extremely being used for wash conditions at least about 0.15M salt at least about 0.01M at least about 0.15M salt at least about the 50%v/v methane amide with at least about 0.01M.Usually, at T _m=69.3+0.41 (G+C) % (Marmur and Doty, J.Mol Biol.5:109,1962) washs.But, the every increase by 1% of number that base mismatch is right, the T of double-stranded DNA _mReduce by 1 ℃ (Bonner and Laskey, Eur.J.Biochem.46:83,1974).Under these hybridization conditions, methane amide is chosen wantonly.Therefore, particularly preferred severity level is defined as follows: low severity is the 6xSSC damping fluid, and 0.1%w/v SDS is at 25-42 ℃; Medium severity is the 2xSSC damping fluid, and 0.1%w/v SDS is 20 ℃ to 65 ℃ temperature; High severity is the 0.1xSSC damping fluid, and 0.1%w/v SDS is at least 65 ℃ temperature.

Pearl (the B of reactant pearl set ₁... B _n, B _y, B _z) be respectively differentiable pearl on the physical chemistry.Term " differentiable on the physical chemistry " refers to feature any physics or chemistry, and it allows a kind of pearl (B for example ₁) with another kind of pearl (B for example ₂) distinguish.Therefore, differentiable pearl allows to distinguish specific reactants on the physical chemistry.

In a preferred embodiment, pearl comprises " particulate ".Conspicuous as those skilled in the art, material nearly all homogeneous or inhomogeneous can be used as particulate.The particulate that this paper is susceptible to also can comprise and surpass a kind of material, can comprise the mixture of shell, alloy or organism and/or inorganics like this.Can be used according to the invention and represent the useful especially material of the preferred embodiments of the invention to comprise to be selected from following material: silicon-dioxide (for example: quartz or glass), rubber, titanium, tindioxide, yttrium, aluminum oxide and other bivalent metal oxide (for example ZnO), uhligite and other piezoelectricity metal oxide (BaTiO for example ₃), ZnS, sucrose, agarose and other polymerization pearl.In an especially preferred embodiment, particulate comprises silicon-dioxide.

In a preferred embodiment, term " differentiable on the physical chemistry " existence each measurable difference whether and/or in the intensity of the detectable mark of vision of referring to bead size, the detectable mark of particular visual.

The pearl that the present invention can be susceptible to is made the regular or irregular 3D shape of any routine.But, practicably synthetic usually bead or spherical particle.Such ball or spherical particle are also referred to as " pearl " in this article.Therefore, in embodiment preferred of the present invention, " particulate " of the present invention is spheric or spheroidal basically, or comprises " microballoon ".

Although pearl of the present invention can be called " microballoon ", the particulate actual size depends on many factors, and in fact particle can comprise or not comprise the tolerance of micrometer range.In a preferred embodiment, pearl comprises the diameter (or equivalent metric of non-spherical particle) of about 300nm to about 30 μ m, comprises 300nm, 350nm, 400nm, 450nm, 500nm, 550nm, 600nm, 650nm, 700nm, 750nm, 800nm, 850nm, 900nm5 950nm, 1.0 μ m, 1.1 μ m, 1.2 μ m, 1.3 μ m, 1.4 μ m, 1.5 μ m, 1.6 μ m, 1.7 μ m, 1.8 μ m, 1.9 μ m, 2.0 μ m, 2.1 μ m, 2.2 μ m, 2.3 μ m, 2.4 μ m, 2.5 μ m, 2.6 μ m, 2.7 μ m, 2.8 μ m, 2.9 μ m, 3.0 μ m, 3.1 μ m, 3.2 μ m, 3.3 μ m, 3.4 μ m, 3.5 μ m, 3.6 μ m, 3.7 μ m, 3.8 μ m, 3.9 μ m, 4.0 μ m, 4.1 μ m, 4.2 μ m, 4.3 μ m, 4.4 μ m, 4.5 μ m, 4.6 μ m, 4.7 μ m, 4.8 μ m, 4.9 μ m, 5.0 μ m, 5.1 μ m, 5.2 μ m, 5.3 μ m, 5.4 μ m, 5.5 μ m, 5.6 μ m, 5.7 μ m, 5.8 μ m, 5.9 μ m, 6.0 μ m, 6.1 μ m, 6.2 μ m, 6.3 μ m, 6.4 μ m, 6.5 μ m, 6.6 μ m, 6.7 μ m, 6.8 μ m, 6.9 μ m, 7.0 μ m, 7.1 μ m, 7.2 μ m, 7.3 μ m, 7.4 μ m, 7.5 μ m, 7.6 μ m, 7.7 μ m, 7.8 μ m, 7.9 μ m, 8.0 μ m, 8.1 μ m, 8.2 μ m, 8.3 μ m, 8.4 μ m, 8.5 μ m, 8.6 μ m, 8.7 μ m, 8.8 μ m, 8.9 μ m, 9.0 μ m, 9.1 μ m, 9.2 μ m, 9.3 μ m, 9.4 μ m, 9.5 μ m, 9.6 μ m, 9.7 μ m, 9.8 μ m, 9.9 μ m, 10 μ m, 11 μ m, 12 μ m, 13 μ m, 14 μ m, 15 μ m, 16 μ m, 17 μ m, 18 μ m, 19 μ m, 20 μ m, 21 μ m, 22 μ m, 23 μ m, 24 μ m, 25 μ m, 26 μ m, 27 μ m, 28 μ m, 29 μ m, 30 μ m.More preferably, pearl comprises 1 μ m to 10 μ m diameter (or equivalent metric of aspherical particle).

In an especially preferred embodiment, pearl is the AmpaSand (trade mark of being produced by Genera Biosystems: pearl Genera Biosystems).These pearls can commercially obtain, and are documented in www.generabiosystems.com/generabiosystems/technoloRy/Amp aSandBeads/.But, the present invention should not regarded as to be limited to and use these specific pearls.

Whether exist on the basis of one or more " the detectable marks of vision ", can distinguish pearl.Typically, specific pearl can comprise 0,1,2,3,4,5 kinds of detectable marks of vision.As used herein, term " the detectable mark of vision " refers to any molecule, atom or the ion of meeting emitting fluorescence, phosphorescence and/or white heat.The detectable mark of vision comprises those of meeting emission ultraviolet (wavelength region is extremely about 3nm of about 350nm), visible light (wavelength region is that about 350nm is to about 800nm), near infrared (NIR) (wavelength region is extremely about 1500nm of about 800nm) and/or infrared rays (IR) (wavelength region is extremely about 10 μ m of about 1500nm) easily.But owing to detect easily, in an especially preferred embodiment, the detectable mark of vision is detectable in the vision wavelength region.

In other embodiment preferred of the present invention, the detectable mark of vision comprises one or more and is selected from following mark: fluorophore, semiconductor grain, phosphorus particle, adulterated particle, or nanocrystal or quantum dot.

In a particularly preferred embodiment of the present invention, the detectable mark of vision is a fluorophore.As used herein, term " fluorophore " refers to show any molecule of photoluminescent property.For the purpose of this paper, term " fluorescence " can be defined as molecule the absorption specific wavelength light and launch the more character of long wavelength's light again.Wavelength change relates to the power loss that takes place in this process.Term " fluorophore " can comprise the detectable mark of many visions, and for example chemiluminescence is rolled into a ball and dyestuff, and quantum dot.

A kind of special detectable mark of vision easily that can be used according to the invention is the semiconductor fluorescence particle of embedding.The detectable marking particle of these visions can be very little, and it is dependent that their character and emission become size like this.The detectable marking particle of small vision like this is called semiconductor nanoparticle, quantum dot, quantum wire, quantum rod or nanocrystal or Q-particle in this area.But as used herein, term " quantum dot " or " QD " should be understood to the particle that comprises that all are such.And, the detectable mark of vision that comprises QD can comprise almost spherical or the spheroidal particle of class, or the spheric of dressing or the spheroidal particle of class.But term QD in no case should regard as and be limited to that spheric, class are spheroidal, cyclic, columned or any other form of " point ".For example, as used herein QD also can comprise other form, comprise, especially, the bar-shaped or oval particle of bar-shaped, oval or dressing.

QD is made up of the nano level crystal heart of semiconductor material; The form of biologic activity is typically around protective shell and coat are arranged.For example, QD can comprise diameter and be the semiconductor microcrystallite of about 2nm to about 30nm, and can include 50-500000 the atom of having an appointment at crystal, comprises comprising ZnS ZnSe, ZnTe, CdS, CdSe, CdTe, PbS, PbSe, PbTe, HgS, HgSe, HgTe, Si, the luminescent crystal of materials such as ZnO.

QD can launch the fluorescence of wide absorption spectrum and narrow emmission spectrum.Other the fluorophore with different absorption spectrums is different with some, and QD can absorb the light above wide spectral range, and this is fair with many light sources (for example laser, Jupiter, or LED) excitation quantum point.And the set of different Q D can be used to use only a kind of multiple use of excitaton source.But the emmission spectrum of each point is very narrow usually, is the magnitude of about 30nm, and definite color depends on particulate diameter and component.And the narrow emmission spectrum of QD allows the spectrally resolved of neighbor point.Except top advantage, QD also is fast to light relatively, even in strong excitation process, and brighter than fluorophore.

In view of foregoing, be to be understood that to the present invention includes the QD that uses different sizes.

And the present invention is susceptible to the QD that handles with methods such as thermal treatment, finishing, alloy, surface passivation or covering surfaces coatings, makes QD emission high quantum production rate, and improves the long time of photostabilization.

QD also can company be commercial obtains from Quantum Dot Corp. (QDC) etc., and the said firm produces QD, for example Qdot[trade mark] 605 streptavidin conjugates, it contains the cadmium selenide heart in the 605nm emission.Also can obtain 525,565 585 and the Qdot conjugate of 655nm emission.But, should be appreciated that the present invention never is limited to the particular composition of QD (or the detectable mark of any other vision), and any QD (commercial or other) can with compatibility of the present invention.

Also have the available fluorescence dye in many this areas, it can be used as according to fluorophore of the present invention.The a kind of of fluorescence dye or other fluorophore determines that the critical nature of its application potential is the excitation wavelength of fluorophore; It must be with available light source Wavelength matched.But, the many different fluorescence dye that those skilled in the art are afamiliar with and other fluorophore, the selection of fluorescent marker can not limit the present invention.The special fluorescence dye easily that can be used for labeled substrate comprises top about sub those that discuss of mark pcr amplification.But when selecting fluorescent marker, the emmission spectrum of the mark that the emmission spectrum of the fluorescent marker that binding reagents uses should use with amplicon is different.

Two kinds of staining techniques are usually used in fluorescence ground mark pearl and microballoon: inner dyeing and outside dyeing (surface markers).These two kinds of technology produce the pearl with peculiar property, are useful for different purposes respectively.Inner dyeing can produce highly stable particle, and it typically has narrow fluorescent emission.These pearls often demonstrate the bigger tolerance to photobleaching.Because fluorophore is in the inside of pearl, surface group can be used for part (albumen, antibody, nucleic acid etc.) is conjugated on the bead surface.In view of this reason, internally the pearl of mark typically is used for detection of analytes and immunoassay purposes.Surface markers comprises fluorophore puting together to bead surface.Because fluorophore is on bead surface, they can with their environmental interaction, as the fluorophore on the staining cell.The result is the pearl standard substance, and it can show excite and emission characteristic identical with painted cell sample under many different conditions (for example have pollutent or change pH)." environment-responsive " character of the pearl of surface markers makes them be applicable to the mimic biology product that imitate in theory.Contrast and the standard substance in the purposes of the pearl of mark through being commonly used for many use fluoroscopic examinations externally.But the present invention is susceptible to pearl and fluorescent marker combining by any way.

Term " phosphorescent pearl ", " phosphorescence pearl " and " phosphor " use in this article interchangeably.Those skilled in the art can easily understand the material that constitutes the detectable mark of phosphorescent vision.But as an example, they do not limit the present invention in any way, and suitable phosphor comprises ZnS, ZnS:Cu, europium sesquioxide and the small-particle of other phosphor of using in display unit.

The detectable mark of vision that comprises " adulterated pearl " can comprise particle, and the latter comprises one or more rare earth ions of sealing amount, Eu for example, Y, Yb, Sm etc.

As used herein, term " the detectable mark of vision " should be understood to also comprise the detectable mark of multiple vision, the mixture of the detectable mark of vision, the nanocrystal of dressing, conspicuous other the complicated mixture of alloy and those skilled in the art.The application of the detectable mark of vision that all are such should be regarded as in the scope of method as herein described and reagent.

And the detectable mark of the vision of reactant can comprise the detectable mark of vision that mixes in the immobilized polynucleotide sequence (its bonding or otherwise be combined on the pearl), rather than directly in conjunction with the mark of pearl itself.

Usually, with immobilized " label " or probe oligonucleotides mark pearl.This label carries interior amine (NH ₂), the latter modifies by the succinimido ester of puting together dyestuff again.In existing setting, the dyestuff of use is BODIPY-TMR.By mixed mark and unlabelled label, then this mixture is conjugated on the pearl, can generate the pearl grade of fluorescent marker with different levels.The ratio of Shi Yonging is 1: 5 easily ^XSeries; That is to say that unlabelled by using: the ratio of the label of mark produces different grades.In the table 4 below this has been carried out the classification illustration.

4-is unlabelled for table: the ratio of the label of mark

Grade	Unlabelled Rel amount	The Rel amount of mark
Grade	Unlabelled Rel amount	The Rel amount of mark	All	0	All
Do not have	All	0	All	0	All
Do not have	All	0	1/5	5	1
1/25	25	1	1/5	5	1
1/25	25	1	1/125	125	1

The detectable mark of vision can be used for the pearl in many concentration or intensity, thereby the basis of another kind of " distinguishing on biological chemistry " specific pearl is provided.For example, if but regard the maximum detected intensity of the detectable signal of particular visual as 100%, mark can be applied to many pearls, produces 0%, 2%, 4%, 6%, 8%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100% intensity.

In an especially preferred embodiment, the set of the pearl of reactant comprises 3.0 μ m, 3.5 μ m, 4.1 μ m, 5.0 μ m, the pearl of 5.6 μ m and 6.8 μ m, wherein said 3.0 μ m, 3.5 μ m and 4.1 μ m diameter pearls are by 0% and 100% mark, and 5.0 μ m diameter pearls are by 0%, 100% and 20% mark, and 5.6 μ m and 6.8 μ m diameter pearls are by 0%, 100%, 20% and 4% mark.

Can use any mode easily, with the immobilized polynucleotide component of reactant, for example cX _n, cY and/or cZ are attached on the pearl.

In their production process, immobilized polynucleotide can be encapsulated in the pearl, or after production, it can be attached on their surface.Be used for depending on the material of use, can easily determine as those skilled in the art in conjunction with the selection of the method for polynucleotide and pearl.In addition, can carry out other processing to pearl before in conjunction with polynucleotide, comprise silanization (with silane package by substrate), so that increase of the combination of described polynucleotide to pearl.

Usually, can with meeting covalently in conjunction with or be adsorbed onto any compound bag on the bead surface by pearl, in addition, reactant also should have the chemical group that is used in conjunction with polynucleotide, for example sulfydryl, amine or carboxyl.The silane that examples for compounds with these characteristics comprises amino-ending is amino-propyl trimethoxy silicane or amino-propyl-triethoxysilicane for example.Except silane, covalently in conjunction with glass surface with adsorb the compound of the phosphate of polynucleotide statically, poly-L-Lysine for example, also within the scope of the invention.Therefore, those skilled in the art can easily discern other compound, comprise being applicable to polynucleotide being attached to lip-deep other silane, and the present invention is not subjected to the restriction of the selection of compound.

Can use any mode easily, polynucleotide are attached on the pearl, typically, this connects by physical adsorption or chemistry realizes.In addition, can be with promoting or increase absorption or the bonded reagent of polynucleotide to bead surface, for example aminosilane further wraps by pearl.But those skilled in the art can easily determine to carry out other reagent of this function.

In one embodiment, nucleic acid molecule is by Universal Anchoring System (UAS) (trade mark: Genera Biosystems) be attached on the pearl.In brief, this system comprises use " bridge " nucleic acid molecule nucleic acid " label " sequence is connected on the substrate with target sequence." bridge " sequence partly with the sequence label complementation, and partly with target complement sequence, make that the bridge sequence can combination tag and target sequence, and make their keep linear arrangement (alignmen t) alignment, so that can use ligase enzyme to connect label and target sequence.UAS also is commercial available, and write up exists Www.generabiosystems.com/ Generabiosystems/technology/UAS/But, should by any way the present invention not regarded to be limited to as nucleic acid molecule is connected to this ad hoc approach on the substrate.

Use to allow bonded amplicon mark to navigate to any method on the differentiable reactant on the specific physical chemistry, can determine whether combination has taken place between amplicon and the reactant.In an especially preferred embodiment, use flow cytometry.

Flow cytometry may be defined as the technology of the character of measurement when cell or particle move or be mobile in liquid suspension.Can with more familiar laboratory equipment microscope analogy, to further describe this technology.Most of microscopes have following composition:

Light source

Typical microscope uses the bulb illuminated objects.In flow cytometer, light source is laser normally.Use laser to be and concentrate very much and the intensive homogeneous beam because they can provide.The monochromatic feature of light particularly important in carrying out fluorescence measurement.

Dressing table

In microscope, dressing table is movably, to allow the visual field of object by eyepiece.In flow cytometer, cell or particle are present in the liquid suspension.Liquid with air pressure stream through object lens, thereby carry cell or particle passes through the visual field.

Lens

In microscope and flow cytometer, lens are collected light from object.

Filter

Some microscopes have filter, to select the feature of most important light concerning the viewer.Especially true in fluorescent microscope.In fluorescence, dye molecule is produced more long wavelength's emission light then by the optical excitation of specific wavelength.Filter can be removed exciting light, to allow to observe or measure emission light.

Detector

In microscope, photodetector is the viewer.Flow cytometer uses the high sensitivity photodetector that is called photomultiplier (PMT).Described detector must be able to be measured the of short duration flicker from cell or particulate exciting light, and described cell or particle are so that reach the thousands of speed of per second one at a time by the object lens visual field.

Most of flow cytometers can be measured scattered light and fluorescence.

Fig. 1 has shown the main composition of a specific model of flow cytometer.A container in the bottom provides damping fluid, and described damping fluid carries cell or particle passes through instrument, and second container collected all waste liquids.The purpose of carrier fluid (so-called sheath fluid) is a sucking-off suspension, so that cell or particle are with the single-row laser beam that passes through.

Cell or particle that the laser of left front upwards flows through from test tube with the blue light beam illumination.The scattered light of forward is by collecting, and be reflected on the photodetector with the co-axial lens of laser beam (laser beam itself is by little opaque grid resistance retaining).By collecting side-scattered light and fluorescence with the rectangular lens of laser beam.Described instrument measurable is at the three fluorescence of green, orange and red spectral area.By the filter separate colors, the wavelength that described filter reflection or only see through is wanted is to suitable detector.

At last, all are from electronic signal transmission of detector computer (not shown) to record they and display result.Because all observed values all are simultaneously at each cell, therefore can determine the dependency between them.And, can use a kind of method of masurement to select the cell subclass, to study with another kind of method of masurement.For example, can check fluorescence and granular size.

In a preferred embodiment, according to the inventive method, use Flow cytometry and/or sorting pearl.Yet the present invention never is defined in previously described specific flow cytometry method or instrument.This embodiment only as an illustration the property purpose provide, and instrument or method according to the embodiment that provides are provided in the present invention.

Use flow cytometer, can determine the size of given pearl by the object scattered light.

Scattering of light is the interaction of light and object.All substances comprise pearl, all can scattered light.It mainly is made up of reflection or refractive light.The position of observing object determines obtainable information usually.In flow cytometer, light scattering detector is usually located at the opposite (with respect to cell or particle) of laser, and in a side of laser, coaxial with liquid stream/laser beam intersection point.The measurement that these detectors produce is called forward scattering of light and lateral light scattering.

Forward scattering of light meeting provides some information of relevant individual cells or particulate relative size, and lateral light scattering meeting provides some information of relevant individual cells or the relative granularity of particulate.They common one are used from the white corpuscle of distinguishing main kinds different in the unsegregated mammalian, and other is measured but also be used for many kinds, for example determines the size of particulate.

The definite flow cytometry of present inventor can be distinguished the about 3.0 μ m of diameter, about 3.5 μ m, about 4.1 μ m, about 5.0 μ m, the pearl of about 5.6 μ m and about 6.8 μ m.Also can distinguish other pearl magnitude, for example, 5.0 to 5.6 and 5.6 to 6.8.Therefore, the inventor thinks that flow cytometry can be distinguished to the pearls that reach 6 kinds of different sizes at least.

Except size detection, flow cytometer has one or more laser apparatus and detectors that are used for test sample fluorescence usually.Fluorescence is the absorption special wavelength light of molecule and launches the more characteristic of long wavelength light again.Wavelength change relates to the power loss that takes place in this process.It is to make the useful especially feature of fluorescence: filter can be used for getting rid of from photodetector or scopic exciting light.Therefore, measurement or observed light just derive from the light of fluorophore.From background or the interference that shines the scattered light on the detector is low-down.

Many fluorescence dyes that are used for flow cytometry are arranged.They are in conjunction with the various kinds of cell chemical composition, for example ionic molecule and more composition in nucleic acid, albumen, specific cytolemma, nucleus and cytosol receptor, the cell.The key feature of determining the fluorescence dye of the potentiality that it is used for flow cytometry mensuration is an excitation wavelength, and promptly it must mate with obtainable optical source wavelength.

In yet another aspect, the invention provides and be used to the method for diagnosing the experimenter to be infected by the pathogenicity bo analyte, described method comprises:

(i) from inferring the experimenter who comprises described pathogenicity bo analyte, obtain biological sample;

(ii) from described sample separation nucleic acid;

(iii) use primer from described sample amplification nucleic acid, described primer produces the distinctive amplicon of specific bacterial strain with described analyte or described analyte;

(iv) randomly, from experimenter's contrast nucleotide sequence that increases;

(v) randomly, be marked at step (iii) and/or (iv) described amplicon;

(vi) make the amplicon and the pearl set hybridization that is coated with reactant of mark, wherein the nucleotide sequence that comprises with the specific bacterial strain of analyte or analyte of each member of pearl set has complementary nucleic acid molecule, its in conjunction with or be connected on the physical chemistry on the differentiable pearl; With

(vii) determine the amplicon the sort of reactant of bonded;

Wherein said amplicon combines with specific reactants, is indicating the infection of analyte in the experimenter.

As used herein, term " experimenter " refers to any biology to the infection susceptible of another kind of analyte.Like this, " experimenter " includes but not limited to, animal, plant, fungi and bacterium (its can by phage-infect).As used herein, term " animal " preferably includes Mammals, and more preferably primate, comprise lowly waiting primate, and more preferably people.But term " animal " also comprises for example ox of domestic animal, horse, sheep, pig, goat and donkey and laboratory animal especially.The example of laboratory experiment animal comprises mouse, rat, rabbit, cavy and hamster.Rabbit and rodent, for example rat and mouse, the experimental system that can provide convenience or animal model wait primate the same as primate with low.Also be susceptible to the animal of nonmammalian, for example birds, zebra fish, Amphibians (comprising toad) and fruit bat kind drosophila melanogaster for example.

" experimenter " also can right and wrong animal, for example plant.Term " plant " comprises the plant with agronomical value particularly, for example cereal grass (wheat for example, barley, oat, rye, triticale and corn), paddy rice, fruit tree (apple for example, banana, mango and oranges and tangerines), sugarcane, garden crop plant (for example potato, Radix Dauci Sativae and onion) etc.

But, in a preferred embodiment, the invention provides the method that HPV infects among the diagnosis people experimenter, described method comprises:

(i) from inferring the people experimenter who comprises HPV, obtain biological sample;

(ii) from described sample separation nucleic acid;

(iv) randomly, amplification is from the contrast nucleotide sequence of people experimenter's genomic dna;

(v) randomly, be marked at step (iii) and/or (iv) described amplicon;

(vi) make the pearl set hybridization of the amplicon and the reactant of mark, wherein the nucleotide sequence that comprises with HPV or specific HPV bacterial strain of each member of pearl set has complementary nucleic acid molecule, its in conjunction with or be connected on the physical chemistry on the differentiable substrate; With

(vii) determine the amplicon the sort of reactant of bonded;

Wherein said amplicon is indicating the HPV among the people experimenter to infect with combining of specific reactants.

At a related aspect, the present invention also is susceptible to the method for the danger of determining people experimenter's development and one or more HPV bacterial strain diseases associated, and described method comprises:

(ii) from described sample separation nucleic acid;

(v) randomly, be marked at step (iii) and/or (iv) described amplicon;

(vii) determine the amplicon the sort of reactant of bonded;

Wherein said amplicon combines with the specific reactants that comprises polynucleotide, and the danger of the increase of disease described in the experimenter is being indicated in the related HPV infection bacterial strain complementation of described polynucleotide and specified disease.

(v) the mark of described amplicon is preferred as part.Therefore, amplicon and pearl all are labeled.

The exemplary disease relevant with one or more specific HPV bacterial strains is included in those that list in the table 3.Therefore, in this respect, the invention provides by discerning which kind of HPV strain infection experimenter specifically, the diagnosis experimenter is developed the method for danger of the increase of specified disease.In an especially preferred embodiment, this method is applicable to and determines that people experimenter develops the danger of cervical cancer.

The present invention also is susceptible to the diagnostic kit that is used for method as herein described, comprises that the HPV that diagnoses people experimenter infects and/or appraiser experimenter is developed the danger of (comprising cervical cancer) of HPV relative disease.Test kit comprises the pearl set of reactant, the nucleotide sequence complementary polynucleotide of their each self-contained and specific HPV bacterial strains, its combination or be connected on the physical chemistry on the differentiable substrate.Randomly, test kit also can comprise the primer on the conserved sequence that is attached between the different HPV bacterial strains, but the amplicon that produces comprises for every kind of nucleotide sequence that the HPV bacterial strain is different, and the polynucleotide complementation on the differentiable pearl on one or more physical chemistry of test kit is inferred and be attached to the amplicon of wherein said generation.

In a preferred embodiment, the set of the pearl of reactant comprises at least one group of pearl, has about 3.0 μ m separately, about 3.5 μ m, about 4.1 μ m, about 5.0 μ m, any diameter among about 5.6 μ m and the about 6.8 μ m.In another preferred embodiment, each size group of pearl comprises one or more microballoons subgroup, the fluorescent marker that has the varying strength scope separately.More preferably, fluorescent marker is TMR, and uses in about 0%, about 4%, about 20% and about 100% intensity.

In another preferred embodiment, test kit comprises primer GP5+ and GP6+ and optional primer LC1_F and LC1_R.

Test kit also can be the form of solid phase chip or upholder, so-called biochip.The all or part reagent that uses in the experimenter measures can mix biochip or microminiaturization is measured to nanometer.Although flow cytometry is useful especially in the output of measuring experimenter's mensuration, biochip can be used for measuring or other signal of automatization, for example relevant with Whispering-gallery-mode (whispering gallery mode) mensuration those.

Although fluorescence intensity is the preferred aspect of multiple method, the present invention also is susceptible to the discriminating of other form.A kind of such alternative method comprises that Whispering-gallery-mode (WGM) detects.In this embodiment, fluorescent marker is mixed in the subclass pearl, or mix or be attached to DNA on the bead surface.This fluorescent marker can excite WGM with laser or unfocused white light source or with filtering unfocused white light source.

WGM only allows the light of some wavelength to emit from particle.The result of this phenomenon is, is restricted from common wide emission (10-100nm the is wide) band of for example fluorophore, and occurs as a series of spikes, and they are corresponding with the still-mode collection of illustrative plates of intragranular light effectively.According to the present invention, determined that the WGM characteristic is highstrung to the variation on microsphere particle surface, and when the interaction of molecules in microsphere particle and analyte or its environment, the WGM characteristic can change.

Therefore, another aspect of the present invention is susceptible to the method for check and analysis thing, described analyte for example comes the amplicon of the HPV bacterial strain of self-contained bacterial strain specific sequence, described method comprises makes at least one microsphere particle set contact infer the sample that comprises described analyte, wherein each particle in the microsphere particle set comprise detectable mark of vision and immobilized described analyte of inferring binding partners (for example can in conjunction with, catch or immobilization from the primer or the probe of the amplicon of HPV bacterial strain), wherein each particle set has definite WGM characteristic, wherein said analyte is to the combination of described immobilized binding partners, can cause the variation of the described WGM characteristic of described at least one microsphere particle set, this is indicating the existence of described analyte.

Method of the present invention can be used to detect the regulation and control of the WGM characteristic of microsphere particle, and microsphere particle is lip-deep potentially to be detected in conjunction with the particulate bonded to being immobilized in from the molecule in the sample in wherein said regulation and control.Sensitivity based on the WGM characteristic changes, and the association reaction between check and analysis thing and its binding partners can be differentiated and separate analytes.

A feature of the present invention is to promote the measurement of many different WGM characteristics with the light source activation microsphere particle of wide region.

" the detectable mark of vision " can be any molecule, atom or the ion of emitting fluorescence, phosphorescence and/or white heat.In an embodiment preferred of the present invention, the detectable mark of vision is a fluorophore, and it can comprise the detectable mark of many visions, and for example chemiluminescence is rolled into a ball and dyestuff, and quantum dot.

In a specific embodiment; the invention provides microsphere particle; it comprises rubber (latex) or silica dioxide granule that diameter is 1 μ m to 100 μ m; and carry out mark with the detectable mark of vision; for example fluorophore or quantum dot, this particle also comprises the binding partners of inferring of test analyte.An example is the capture nucleic acid molecule, the HPV amplicon that its 2 primer amplifications that can be used in combination the genomic conserved regions of HPV of side joint bacterial strain specific regions produce.The detectable visible wavelength that is marked at of vision is can be detected, and this microsphere particle can show one or more WGM characteristics.When analyte when being immobilized in binding partners on the particle and interacting, can be able to regulate and control one or more WGM characteristics of microsphere particle with detecting.The existence of the analyte on the binding partners that is attached to it is being indicated in any such variation of WGM characteristic.

Following non-limiting example has further described the present invention:

Embodiment 1:HPV diagnosis-DNA separates and amplification

The overview that in Fig. 2, has shown the DNA extraction method of the DNA that is used for separating the HPV diagnostic method.

As shown in Figure 3, use PCR to come the DNA amplification sample.Use primer GP5+ and GP6+ to produce the amplicon that is present in any HPV bacterial strain in the DNA sample.Primer GP6+ comprises fluorescent marker, and Cy5 more specifically is to observe the combination of amplicon to binding reagents after allowing.Virus amplification that produces comprises conserved regions (Y) (it is guarded) and variable (being that bacterial strain is specific) regional X between the HPV bacterial strain in the HPV of all inspections bacterial strain _n, wherein n representative and every kind of variable region that the HPV bacterial strain is relevant.The binding partners that is immobilized on the pearl can be specifically in conjunction with the specific genome of HPV bacterial strain.

In addition, use LC1_F and LC1_R primer in contrast, also produced amplicon from people experimenter's genomic dna.In this case, primer LC1_R also carries the Cy5 mark.

Embodiment 2:HPV diagnosis-multiple detection

Make in embodiment 1 amplicon and the hybridization array of binding reagents that produce, every kind of binding reagents carries and from every kind of HPV bacterial strain c, 11,16,18,31,33,35,42,45,51,52,56,58,59,67 and 68 (X ₁To X ₁₆) the variable region complementary polynucleotide of inferring virus amplification that produce.The nucleotide sequence of the capture nucleic acid of immobilization to the pearl is seen Fig. 9.And this array comprises, and contains the binding reagents with conserved regions (Y) the complementary polynucleotide of HPV virus amplification.At last, comprise following binding reagents, it comprises with the people and contrasts amplicon sequence complementary polynucleotide.Capture nucleic acid can be DNA or RNA.If use RNA, may need reversed transcriptive enzyme to come to produce RNA from DNA cloning.

Every kind of binding reagents in the array comprises microballoon or the pearl with different sizes and different fluorescence (TMR) mark intensity.Use flow cytometry as shown in Figure 4, can will have 3.0 μ m, 3.5 μ m, 4.1 μ m, 5.0 μ m, the pearl of the diameter of 5.6 μ m and 6.8 μ m is distinguished from each other out.

For every kind of microballoon of giving sizing, fluorescent marker (TMR) is with 0%, 4%, and 20% and 100% relative intensity is mixed.Use flow cytometry as shown in Figure 5, can clearly distinguish these mark intensity.In Fig. 1, shown the machine that reads intensity.

Fig. 6 is the synoptic diagram that is presented at the every kind of binding reagents that uses in the array.As can be seen, array uses has 3.0 μ m, 3.5 μ m, and 4.1 μ m, 5.0 μ m, the microballoon of 5.6 μ m and 6.8 μ m diameters, and the fluorescent marker strength of signal is 0%, 4%, 20% and 100%.But, under the situation of littler bead size, use the still less strength of signal of magnitude.Fig. 7 has shown each how to distinguish in these binding reagents on size and fluorescent mark intensity based.

Fig. 8 has shown combining of 3 species specific binding reagents in bonded amplicon and the array.In the figure, confirmed that amplicon can be in conjunction with people DNA contrast (Z), viral conserved sequence (Y) and viral variable sequence X ₇, this is indicating the existence of HPV bacterial strain 18 in sample.

Embodiment 3: contrast multiple detection method and traditional HPV diagnosis

Following table 5 provides the overview of the Histological method that contrasts multiple HPV detection method of the present invention and existing HPV diagnosis.

The contrast of table 5HPV diagnostic method

The HPV diagnostic method	Output	Report	Contrast
The HPV diagnostic method	Output	Report	Contrast	The present invention	Each installs every day 1600	All 13 " high-risk " bacterial strains have been identified individually	Internal contrast, positive control, people gDNA contrast
Based on histological method	Every day 350	Usually differentiate " high-risk " rank	No internal contrast, " low dangerous " positive control, " high-risk " positive control	The present invention	Each installs every day 1600		Internal contrast, positive control, people gDNA contrast

The HPV that embodiment 4 detects among the human sample

Figure 10 A to G provide embodiment, wherein detected HPV in the human sample or discovery lacks HPV.

It will be readily apparent to those skilled in the art that invention as herein described can specifically describe variation and modification in addition.Should be appreciated that and the present invention includes all such variation and modifications.The present invention be also included within the institute mentioning individually or uniformly in this specification sheets or point out in steps, feature, composition and compound and any one or more described step or feature arbitrarily and all combinations.

Reference

Bonner and Laskey，Eur.J.Biochem.46：83，1974

Chadwick et al.，J.Virol.Methods 70：59-70，1998

Chan and Fox，Rev.Med.Microbiol.10：185-196，1999

Compton，Nature 350：91-92，1991

Demidov and Broude(Eds.)，″DNA Amplification：CurrentTechnologies and Applications″，Horizon Bioscience，2004

Gearhart et al.，www.emedicine.com/MED/topic1037.htm，2004

Guatelli et al.，Proc.Natl Acad.Sci.USA 87：1874-1878，1990

Hill，J.Clin.Ligand Assay 19：43-51，1996

Kievits et al.，J Virol.Methods 35：273-286，1991

Kuske et al.，Appl Environ.Microbiol.64(7)：2463-2472，1998

Lizardi et al.，Biotechnology 6：1197-1202，1988

Lyamichev et al.，Nat.Biotechnol.17：292-296，1999

Marmur and Doty，J.Mol.Biol.5：109，1962

Nelson and Krawetz，Anal.Biochem.207(1)：97-201，1992

Pawlotsky et al.，J.Virol.Methods 79：227-235，1999

Ryan et al.，Mol.Diagn.4：135-144，1999

Speel，Histochem.Cell Biol.112：89-113，1999

Todd et al.，J.AIDS Hum.Retrovirol.10：S35-S44，1995

Sequence table

<110>Genera Biosystems Pty Ltd

POETTER，Karl(US ONLY)

GOULD，Toby(US ONLY)

＜120〉use the cell sorter (FACS) of nucleic acid probe, microballon and fluorescence-activation to detect human papillomavirus (HPV)

<130>12701060/EJH

<150>AU 2004907070

<151>2004-12-10

<150>US 60/704,974

<151>2005-08-03

<160>26

<170>PatentIn version 3.1

<210>1

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence

<400>1

tttgttactg tggtagatac tac 23

<210>2

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence

<400>2

gaaaaataaa ctgtaaatca tattc 25

<210>3

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence

<400>3

tacacacagg tgtacacaga 20

<210>4

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence

<400>4

accaagtact ctacgtgttg 20

<210>5

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>5

aattaaccct cactaaaggg aggacagcta tggacatccg taactacatc ttccacatac 60

accaa 65

<210>6

<211>70

<212>DNA

＜213〉synthetic HPV primer

<400>6

aatggaatta accctcacta aagggaggac agctatggac atctgtgtct aaatctgcta 60

catacactaa 70

<210>7

<211>70

<212>DNA

＜213〉synthetic HPV primer

<400>7

aatggaatta accctcacta aagggaggac agctatggac tgtttgtgct gcaattgcaa 60

acagtgatac 70

<210>8

<211>70

<212>DNA

＜213〉synthetic HPV primer

<400>8

aatggaatta accctcacta aagggaggac agctatggac tttatgcaca caagtaacta 60

gtgacagtac 70

<210>9

<211>70

<212>DNA

＜213〉synthetic HPV primer

<400>9

aatggaatta accctcacta aagggaggac agctatggac gtctgtgtgt tctgctgtgt 60

cttctagtga 70

<210>10

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>10

aattaaccct cactaaaggg aggacagcta tggactctac ctctatagag tcttccatac 60

cttct 65

<210>11

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>11

aattaaccct cactaaaggg aggacagcta tggacacaca aaatcctgtg ccaagtacat 60

atgac 65

<210>12

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>12

aattaaccct cactaaaggg aggacagcta tggacagcac tgccactgct gcggtttccc 60

caaca 65

<210>13

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>13

aattaaccct cactaaaggg aggacagcta tggactgctg aggttaaaaa ggaaagcaca 60

tataa 65

<210>14

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>14

aattaaccct cactaaaggg aggacagcta tggacgtact gctacagaac agttaagtaa 60

atatg 65

<210>15

<211>70

<212>DNA

＜213〉synthetic HPV primer

<400>15

aatggaatta accctcacta aagggaggac agctatggac attatgcact gaagtaacta 60

aggaaggtac 70

<210>16

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>16

aattaaccct cactaaaggg aggacagcta tggactctac tacttcttct attcctaatg 60

tatac 65

<210>17

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>17

aattaaccct cactaaaggg aggacagcta tggactctac tactactgaa tcagctgtac 60

caaat 65

<210>18

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>18

aattaaccct cactaaaggg aggacagcta tggacgtcat tatgtgctgc catatctact 60

tcaga 65

<210>19

<211>65

<212>DNA

＜213〉synthetic HPV primer

<400>19

aattaaccct cactaaaggg aggacagcta tggactgctt ctacacagtc tcctgtacct 60

gggca 65

<210>20

<211>51

<212>DNA

＜213〉synthetic HPV primer

<400>20

aaagggagga cagctatgga ctattaatgc agctaaaagc acattaacta a 51

<210>21

<211>51

<212>DNA

＜213〉synthetic HPV primer

<400>21

aaagggagga cagctatgga ccaaacacag acacagagag acccacagac a 51

<210>22

<211>58

<212>DNA

＜213〉synthetic HPV primer

<400>22

aattaaccct cactaaaggg aggacagcta tggactttgt tactgtggta gatactac 58

<210>23

<211>20

<212>DNA

＜213〉synthetic HPV primer

<400>23

tacacacagg tgtacacaga 20

<210>24

<211>20

<212>DNA

＜213〉synthetic HPV primer

<400>24

accaagtact ctacgtgttg 20

<210>25

<211>23

<212>DNA

＜213〉synthetic HPV primer

<400>25

tttkttachg tkgtdgatac yac 23

<210>26

<211>25

<212>DNA

＜213〉synthetic HPV primer

<400>26

gaaahataaa ytgyaadtca taytc 25

Claims

1. pearl set, it is used to detect the HPV bacterial strain and/or is used to distinguish two or more HPV bacterial strains, and wherein said pearl set comprises a plurality of pearl subclass, wherein:

(a) pearl of each subclass is of uniform size;

2. the pearl of claim 1 set, wherein said bead size is selected from 3.0 μ m, 3.5 μ m, 4.1 μ m, 5.0 μ m, 5.6 μ m and 6.8 μ m.

3. each pearl set among the claim 1-2, wherein said pearl carries out mark with being selected from following fluorescence dye: Hydroxycoumarin, aminocoumarin, methoxy coumarin, waterfall indigo plant, fluorescent yellow, NBD, Phyccerythrin (PE), PerCP, allophycocyanin, hoechst33342, DAP1, SYTOX Blue, hoechst33258, chromomycin A3, Plicamycin, YOYO-1, SYTOX is green, SYTOX orange, 7-AAD, acridine orange, TOTO-1, To-PRO-1, thiazole orange, TOTO-3, TO-PRO-3, LDS 751, and the Alexa fluorescence dye comprises Alexa Fluro-350,-430 ,-488 ,-532,-546 ,-555 ,-556,-594 ,-633 ,-647,-660 ,-680 ,-700 and-750; The BoDipy dyestuff comprises BoDipy630/650 and BoDipy 650/665; CY dyestuff, especially Cy2, Cy3, Cy3.5, Cy5, Cy5.5 and Cy7; 6-FAM (fluorescein); PE-Cy5, PE-Cy7, fluorescein dT; Chlordene fluorescein (Hex); 6-carboxyl-4 ', 5 '-two chloro-2 ', 7 '-dimethoxy fluoresceins (JOE); The Oregon green dye comprises 488-X and 514; Rhodamine comprises the X-rhodamine, lissamine rhodamine B, and rhodamine is green, the red and ROX of rhodamine; TRITC, tetramethyl-rhodamine (TMR); Carboxyl tetramethyl-rhodamine (TAMRA); Tetrachlorofluorescein (TET); Red 6B, FluorX, BODIPY-FL and texas Red.

4. each pearl set among the claim 1-3, the trapping nucleic acids probe on the wherein said pearl is DNA.

5. the pearl of claim 1 set, it comprises 2-16 pearl subclass.

6. the pearl of claim 5 set, wherein said pearl set comprises 16 pearl subclass.

7. the pearl of claim 1 set, wherein said HPV bacterial strain is selected from bacterial strain 6,11, and 16,18,31,33,35,39,45,51,52,56,58,59,66 and 68.

8. the pearl of claim 7 set, wherein said HPV bacterial strain is selected from 6,11, and 31 and 33.

9. the pearl of claim 1 set, wherein said trapping nucleic acids probe is selected from SEQ IDNO:5 to 20.

10. prepare the method that is used to detect one or more HPV bacterial strains and/or is used to distinguish the pearl set of two or more HPV bacterial strains, this method comprises selects many pearls subclass, wherein:

(a) pearl of each subclass is of uniform size;

11. the method for claim 10, wherein said bead size are selected from 3.0 μ m, 3.5 μ m, 4.1 μ m, 5.0 μ m, 5.6 μ m and 6.8 μ m.

12. the method for claim 10 or 11, wherein said pearl carries out mark with being selected from following fluorescence dye: Hydroxycoumarin, aminocoumarin, methoxy coumarin, waterfall indigo plant, fluorescent yellow, NBD, Phyccerythrin (PE), PerCP, allophycocyanin, hoechst33342, DAP1, SYTOX Blue, hoechst33258, chromomycin A3, Plicamycin, YOYO-1, SYTOX is green, SYTOX orange, 7-AAD, acridine orange, TOTO-1, To-PRO-1, thiazole orange, TOTO-3, TO-PRO-3, LDS 751, and the Alexa fluorescence dye comprises Alexa Fluro-350,-430 ,-488 ,-532 ,-546,-555 ,-556 ,-594 ,-633,-647 ,-660 ,-680 ,-700 and-750; The BoDipy dyestuff comprises BoDipy630/650 and BoDipy 650/665; CY dyestuff, especially Cy2, Cy3, Cy3.5, Cy5, Cy5.5 and Cy7; 6-FAM (fluorescein); PE-Cy5, PE-Cy7, fluorescein dT; Chlordene fluorescein (Hex); 6-carboxyl-4 ', 5 '-two chloro-2 ', 7 '-dimethoxy fluoresceins (JOE); The Oregon green dye comprises 488-X and 514; Rhodamine comprises the X-rhodamine, lissamine rhodamine B, and rhodamine is green, the red and ROX of rhodamine; TRITC, tetramethyl-rhodamine (TMR); Carboxyl tetramethyl-rhodamine (TAMRA); Tetrachlorofluorescein (TET); Red 6B, FluorX, BODIPY-FL and texas Red.

13. the method for claim 10, wherein said trapping nucleic acids probe is DNA.

14. the method for claim 13 comprises and selects 2 to 16 pearl subclass.

15. the method for claim 14 comprises and selects 16 pearl subclass.

16. the method for claim 10, wherein said HPV bacterial strain is selected from 6,11,16,18,31,33,35,39,45,51,52,56,58,59,66 and 68.

17. the method for claim 16, wherein said HPV bacterial strain is selected from bacterial strain 6,11,31 and 33.

18. the method for claim 10, wherein said trapping nucleic acids probe is selected from SEQ IDNO:5 to 20.

19. the method that HPV infects among the diagnosis people experimenter, described method comprises:

(viii), obtain biological sample from inferring the people experimenter who comprises HPV;

(ix) from described sample separation nucleic acid;

(x) use primer from described sample amplification nucleic acid, described primer produces the distinctive amplicon of specific bacterial strain with described analyte or described analyte;

(xi) randomly, amplification is from the contrast nucleotide sequence of people experimenter's genomic dna;

(xii) randomly, be marked at step (iii) and/or (iv) described amplicon;

(xiii) amplicon of mark and the pearl set of reactant are hybridized, wherein the nucleotide sequence that comprises with HPV or specific HPV bacterial strain of each member of pearl set has complementary nucleic acid molecule, its in conjunction with or be connected on the physical chemistry on the differentiable substrate; With

(xiv) determine the amplicon the sort of reactant of bonded;

20. determine the method for the danger of people experimenter's development and one or more HPV bacterial strain diseases associated, described method comprises:

(ix) from described sample separation nucleic acid;

(xii) randomly, be marked at step (iii) and/or (iv) described amplicon;

(xiv) determine the amplicon the sort of reactant of bonded;

Wherein said amplicon combines with the specific reactants that comprises polynucleotide, and the high-risk of disease described in the experimenter is being indicated in the related HPV infection bacterial strain complementation of described polynucleotide and specified disease.

21. the method for claim 19 and 20, wherein said bead size are selected from 3.0 μ m, 3.5 μ m, 4.1 μ m, 5.0 μ m, 5.6 μ m and 6.8 μ m.

22. each method in claim 19 or 20, wherein said pearl carries out mark with being selected from following fluorescence dye: Hydroxycoumarin, aminocoumarin, methoxy coumarin, waterfall indigo plant, fluorescent yellow, NBD, Phyccerythrin (PE), PerCP, allophycocyanin, hoechst33342, DAP1, SYTOX Blue, hoechst33258, chromomycin A3, Plicamycin, YOYO-1, SYTOX is green, SYTOX orange, 7-AAD, acridine orange, TOTO-1, To-PRO-1, thiazole orange, TOTO-3, TO-PRO-3, LDS 751, and the Alexa fluorescence dye comprises Alexa Fluro-350,-430 ,-488 ,-532,-546 ,-555 ,-556,-594 ,-633 ,-647,-660 ,-680 ,-700 and-750; The BoDipy dyestuff comprises BoDipy630/650 and BoDipy 650/665; CY dyestuff, especially Cy2, Cy3, Cy3.5, Cy5, Cy5.5 and Cy7; 6-FAM (fluorescein); PE-Cy5, PE-Cy7, fluorescein dT; Chlordene fluorescein (Hex); 6-carboxyl-4 ', 5 '-two chloro-2 ', 7 ,-dimethoxy fluorescein (JOE); The Oregon green dye comprises 488-X and 514; Rhodamine comprises the X-rhodamine, lissamine rhodamine B, and rhodamine is green, the red and ROX of rhodamine; TRITC, tetramethyl-rhodamine (TMR); Carboxyl tetramethyl-rhodamine (TAMRA); Tetrachlorofluorescein (TET); Red 6B, FluorX, BODIPY-FL and texas Red.