CN101323852A

CN101323852A - Reagent box and method for genome extraction on automatic nucleic acid extraction workstation

Info

Publication number: CN101323852A
Application number: CNA2007101188022A
Authority: CN
Inventors: 申跃华; 聂尚海; 葛涛
Original assignee: BEIJING EASTWIN SCIENTIFIC Inc
Current assignee: BEIJING EASTWIN SCIENTIFIC Inc
Priority date: 2007-06-11
Filing date: 2007-06-11
Publication date: 2008-12-17
Anticipated expiration: 2027-06-11
Also published as: CN101323852B

Abstract

The invention discloses a reagent kit for extracting genome on an automated nucleic acid extraction workstation, and a method thereof, wherein, the reagent kit contains a lysis buffer, a guanidinium buffer, a bead and an eluent; the method comprises the steps of: disintegrating biological tissues or cells by using the lysis buffer, adsorbing DNA by using the bead in the reagent kit, removing impurity by using a cleaning solution and finally recycling the DNA by using the eluent to finish the extraction of the DNA. A regular PCR, a fluorescent quantitation PCR, Genotyping, STR and other various follow-up processing operations can be carried to the extracted DNA. The reagent kit and the method of the invention have the advantages of having wide sample applicability of the reagent, being easy to be operated, and requiring no centrifugalization processing in the whole process, thus being beneficial to the advance of the follow-up operation; the invention can cooperate with the automated nucleic acid extraction workstation to carry out effective DNA extraction and can be used in gene extraction with manual operation.

Description

A kind of extraction at automatic nucleic acid carried out test kit and the method that genome extracts on the workstation

Technical field

The present invention relates to biological technical field, particularly a kind ofly can extract test kit and the method that workstation effectively carries out extracting genome DNA at automatic nucleic acid.

Background technology

Carrying out nucleic acid extraction from biological tissue or cell is a very proven technique now, its technology content is lower, mostly be repetitive operation, and utilize workstation to carry out nucleic acid extraction is a class new technique, it is to utilize treated magnetic bead can effectively carry out the principle of DNA absorption in certain solution environmental, use workstation and carry out genomic DNA extraction work, be characterized in high efficiency, can carry out the extraction work of 96 passages simultaneously, and improve the repeatability of the work of extracting greatly.At present in the blood station, industries such as agricultural and hospital inspection center have extensively adopted and have utilized the workstation method to extract genome, market capacity is bigger, but have only two kinds of CTAB and SBS method at present, can cooperate automatic nucleic acid to extract the reagent that workstation carries out nucleic acid extraction, it is bad that these reagent all exist versatility, operation steps is numerous and diverse, the more high defective of price.It is wide that the reagent of mentioning among the present invention has the sample suitability, easy handling, and whole process does not need to carry out centrifugal treating, helps the advantages such as carrying out of subsequent operations.

Summary of the invention

The object of the present invention is to provide a kind of the extraction to carry out test kit and the method that genome extracts on the workstation at automatic nucleic acid, it is wide that this reagent has the sample suitability, easy handling, whole process do not need to carry out centrifugal treating, help the advantages such as carrying out of subsequent operations.

For achieving the above object, the utility model is taked following design:

This extraction at automatic nucleic acid carried out the test kit that genome extracts on the workstation, it comprises following component:

(1), lysis buffer: it contains different sulphur nitrile acid guanidine (4-8%); Guanidinium hydrochloride (4-8%); TrisCl (pH6.4) 10mmol/L; TritonX-100 (0.1%-0.5%); Tween 20 (0.1-0.3%); 12 gastral cavity base creatine sodium (1-3%);

(2), guanidinesalt damping fluid: it contains different sulphur nitrile acid guanidine (4-8%), Guanidinium hydrochloride (4-8%);

(3), magnetic bead;

(4), elutriant contains Tris 100mmol/L (pH=8), EDTA10mmol/L (pH=8).

In this test kit, % all represents weight percent.

A kind of described test kit of claim 1 that utilizes carries out the method that genome extracts, and it may further comprise the steps:

(1), utilize lysate that plant, animal or other biological tissue or cell are carried out cracking;

(2), utilize reagent to extract gene (group) DNA of tissue or cell;

(3), the genomic dna that is extracted is carried out pcr amplification, check.

Describedly carry out cracked biological tissue or cell can be blood sample, it comprises blood filter paper, whole blood, serum.

Test kit of the present invention can be used for manual method and extracts genome.

Description of drawings

Fig. 1 Yb8 primer extension product 1% agarose gel electrophoresis figure

Fig. 2 D13S317 primer extension product 1% agarose gel electrophoresis figure

Among Fig. 1,1, positive contrast (K562 genomic DNA), 2, be the blood filter paper sample, 3, negative contrast (water), 4, be object of reference DL2000 (2000,1000,750,500,250,100).

Among Fig. 21, positive contrast (K562 genomic DNA), 2, be the blood filter paper sample, 3, negative contrast (water), 4, be object of reference DL2000 (2000,1000,750,500,250,100).

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.These embodiment only are used to illustrate the present invention, limit the scope of the invention and be not used in.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook. molecular cloning: laboratory manual (New York:coldspring Harbor Laboratory), Press, 1989) condition described in, or the condition of advising according to manufacturer.

Specific embodiment 1:

1) the direct WATER-WASHING METHOD experimental procedure of blood filter paper (building the storehouse):

The paramagnetic particle method experimental procedure:

With blood filter paper is sample, and implementation and operation is described:

Be that (size of 0.5cm * 0.5cm) adds respectively in the hole of sample panel, and is equipped with disposable plates and DNA in addition and collects each one of plate with sample preparation.

1) sample panel adds 90 μ L lysate A (lysate is for containing different sulphur nitrile acid guanidine (6%); Guanidinium hydrochloride (6%); TrisCl (pH6.4) 10mmol/L; TritonX-100 (0.3%); Tween 20 (0.2%); 12 gastral cavity base creatine sodium (1%);

2) sample panel is put on the 68 degree well heaters and was heated 30 minutes

3) sample panel moisturizing 40 μ L, 600rpm vibration 20 seconds

4) sample panel is put on the 100 degree well heaters and was heated 10 minutes

5) sample panel moisturizing 40 μ L, 600rpm vibration 20 seconds

6) sample panel is put on the 100 degree well heaters and was heated 10 minutes

7) sample panel moisturizing 40 μ L, 600rpm vibration 20 seconds

8) sample panel is put on the 100 degree well heaters and was heated 10 minutes

9) sample panel adds 100 μ L guanidinesalt damping fluids, and 600rpm vibration 20 seconds repeats once;

10) add 2 times of volume guanidinesalt damping fluids (different sulphur nitrile acid guanidine 4%, Guanidinium hydrochloride 4%) diluted mixture magnetic bead, and every hole adds 21 μ L magnetic bead suspensions on disposable plates;

11) shift the lysate of about 130 μ L to the DNA disposable plates by sample panel;

12) disposable plates 760rpm vibration is 30 seconds, and commutation in per 10 seconds once.Left standstill 2 minutes, once more vibration.Left standstill 2 minutes, for the third time vibration;

13) disposable plates is transferred on the magnet, and it is discarded to leave standstill after 30 seconds the sucking-off lysate;

14) disposable plates adds 90 μ L, 70% ethanol, 800rpm vibration 30 seconds, and commutation in per 10 seconds is once.

15) disposable plates is transferred on the magnet, and it is discarded to leave standstill after 20 seconds the sucking-off lysate

16) disposable plates adds 90 μ L, 70% ethanol, 800rpm vibration 30 seconds, and commutation in per 10 seconds is once;

17) disposable plates is transferred on the magnet, and it is discarded to leave standstill after 20 seconds the sucking-off lysate, and disposable plates left standstill 5 minutes;

18) add 75 μ L water in the disposable plates, 1200rpm vibration 30 seconds, commutation in per 10 seconds is once;

19) disposable plates is put on the 68 degree well heaters and was heated 10 minutes;

20) disposable plates 1000rpm vibration is 30 seconds, and commutation in per 10 seconds once;

21) disposable plates is put on the magnet, and transfer DNA is collected plate;

22) shift 30 μ L dna solutions by disposable plates and collect plate to DNA;

23) finish the DNA extraction experiment

Described magnetic bead is available from Jiangsu hundred dimension letter companies (being used to extract the magnetic bead of DNA)

The DNA that is extracted carries out conventional PCR, quantitative fluorescent PCR, Genotyping, multiple post-treatment operations such as STR or any two or more treatment combination.

With 4 μ l genomic dnas is that template is carried out PCR/Real-time PCR/STR detection.

Handle back PCR step:

Primers D13S317

D13S317-5：?ACAGAAGTCTGGGATGTGGA

D13S317-3：GCCCAAAAAGACAGACAGAA

Genbank?No.： G09017

Primers?Yb8：

Genbank?No.： AF015169.

Yb8-5：5’-CGA?GGC?GGG?TGG?ATC?ATG?AGG?T-3’

Yb8-3：5’-TCT?GTC?GCC?CAG?GCC?GGA?CT-3’

realtime?PCR?system：

10X?buffer 2μl

Mg ²⁺(3mM) 1.76μl

dNTP(2.5mM/each) 2μl

primers 0.25μM/each

SYBR(final?density0.01％)，add?ddH ₂O?to?total?20μl?volume.

94℃，5min；

94℃，15s，59℃，15s，72℃30s，80℃，6s，30cycle；

72℃，3min；

70-95℃，0.3℃，6s，melt?curve.

Experimental result is seen Fig. 1 and Fig. 2.

Sequence table

＜110〉Beijing Eastwin Scientific, Inc.

＜120〉a kind of extraction at automatic nucleic acid carried out test kit and the method that genome extracts on the workstation

<130>

<160>4

<170>PatentIn?version?3.1

<210>1

<211>20

<212>DNA

＜213〉synthetic

<400>1

acagaagtct?gggatgtgga 20

<210>2

<211>20

<212>DNA

＜213〉synthetic

<400>2

gcccaaaaag?acagacagaa 20

<210>3

<211>22

<212>DNA

＜213〉synthetic

<400>3

cgaggcgggt?ggatcatgag?gt 22

<210>4

<211>20

<212>DNA

＜213〉synthetic

<400>4

tctgtcgccc?aggccggact 20

Claims

1, a kind of extraction at automatic nucleic acid carried out the test kit that genome extracts on the workstation, and it is characterized in that: it comprises following component:

(3), magnetic bead;

(4), elutriant contains Tris 100mmol/L (pH=8), EDTA10mmol/L (pH=8).

2, a kind of described test kit of claim 1 that utilizes carries out the method that genome extracts, and it is characterized in that: it may further comprise the steps:

(2), utilize reagent to extract gene (group) DNA of tissue or cell;

(3), the genomic dna that is extracted is carried out pcr amplification, check.

3, according to claim 2ly carry out the method that genome extracts, it is characterized in that: will handle biological tissue or cell with lysate and add magnetic bead and adsorb, and add washings then, and reclaim DNA with elutriant at last, and finish the extraction of DNA.

4, method of carrying out the genome extraction according to claim 2, this method comprises the steps:

(1) utilizing denaturing soln is that lysis buffer is handled biological sample;

(2) adding nucleic acid extraction damping fluid and lysate carry out cracking in the sample after step (1) is handled, and add magnetic bead then and carry out DNA absorption;

(3) in the sample of above-mentioned steps (2), add washing lotion and handle, remove impurity;

(4) repeat above-mentioned steps (3) twice, add elutriant and handle, and obtain the upper strata aqueous phase solution, contain DNA in this solution, it is used for follow-up PCR operation.

5, according to claim 2ly carry out the method that genome extracts, it is characterized in that: describedly carry out cracked biological tissue or cell is a blood sample, it comprises blood filter paper, whole blood, serum.

6, according to utilizing the described test kit of claim 1 to extract genome with manual method.