CN101323852B

CN101323852B - Reagent box and method for genome extraction on automatic nucleic acid extraction workstation

Info

Publication number: CN101323852B
Application number: CN 200710118802
Authority: CN
Inventors: 申跃华; 聂尚海; 葛涛
Original assignee: BEIJING EASTWIN SCIENTIFIC Inc
Current assignee: BEIJING EASTWIN SCIENTIFIC Inc
Priority date: 2007-06-11
Filing date: 2007-06-11
Publication date: 2013-01-23
Anticipated expiration: 2027-06-11
Also published as: CN101323852A

Abstract

The invention discloses a reagent kit for extracting genome on an automated nucleic acid extraction workstation, and a method thereof, wherein, the reagent kit contains a lysis buffer, a guanidinium buffer, a bead and an eluent; the method comprises the steps of: disintegrating biological tissues or cells by using the lysis buffer, adsorbing DNA by using the bead in the reagent kit, removing impurity by using a cleaning solution and finally recycling the DNA by using the eluent to finish the extraction of the DNA. A regular PCR, a fluorescent quantitation PCR, Genotyping, STR and other various follow-up processing operations can be carried to the extracted DNA. The reagent kit and the method of the invention have the advantages of having wide sample applicability of the reagent, being easy to be operated, and requiring no centrifugalization processing in the whole process, thus being beneficial to the advance of the follow-up operation; the invention can cooperate with the automated nucleic acid extraction workstation to carry out effective DNA extraction and can be used in gene extraction with manual operation.

Description

A kind of test kit and method of carrying out the genome extraction at automatic nucleic acid extraction workstation

Technical field

The present invention relates to biological technical field, particularly a kind ofly can extract test kit and the method that workstation effectively carries out extracting genome DNA at automatic nucleic acid.

Background technology

Carrying out nucleic acid extraction from biological tissue or cell is a very proven technique now, its technology content is lower, mostly be repetitive operation, a class new technique and utilize workstation to carry out nucleic acid extraction, it is to utilize treated magnetic bead can effectively carry out the principle of DNA absorption in certain solution environmental, use workstation and carry out genomic DNA extraction work, be characterized in high efficiency, can carry out simultaneously the extraction work of 96 passages, and greatly improve the repeatability of the work of extracting.At present in the blood station, the industries such as agricultural and hospital inspection center have extensively adopted and have utilized the workstation method to extract genome, market capacity is larger, but only have at present two kinds of CTAB and SBS method, can cooperate automatic nucleic acid to extract the reagent that workstation carries out nucleic acid extraction, it is bad that these reagent all exist versatility, operation steps is numerous and diverse, the more high defective of price.It is wide that the reagent of mentioning among the present invention has the sample suitability, easy handling, and whole process does not need to carry out centrifugal treating, helps the advantages such as carrying out of subsequent operations.

Summary of the invention

The object of the present invention is to provide a kind of test kit and method of carrying out the genome extraction at automatic nucleic acid extraction workstation, it is wide that this reagent has the sample suitability, easy handling, whole process do not need to carry out centrifugal treating, help the advantages such as carrying out of subsequent operations.

For achieving the above object, the utility model is taked following design:

This test kit that carries out the genome extraction at automatic nucleic acid extraction workstation, it comprises following component:

(1), lysis buffer: it contains different sulphur nitrile acid guanidine (4-8%); Guanidinium hydrochloride (4-8%); TrisCl (pH6.4) 10mmol/L; TritonX-100 (0.1%-0.5%); Tween20 (0.1-0.3%); 12 gastral cavity base creatine sodium (1-3%);

(2), guanidinesalt damping fluid: it contains different sulphur nitrile acid guanidine (4-8%), Guanidinium hydrochloride (4-8%);

(3), magnetic bead;

(4), elutriant contains Tris100mmol/L (pH=8), EDTA10mmol/L (pH=8).

In this test kit, % all represents weight percent.

A kind of method of utilizing test kit claimed in claim 1 to carry out the genome extraction, it may further comprise the steps:

(1), utilize lysate that plant, animal or other biological tissue or cell are carried out cracking;

(2), utilize reagent to extract gene (group) DNA of tissue or cell;

(3), the genomic dna that extracts is carried out pcr amplification, check.

Described biological tissue or the cell that carries out cracking can be blood sample, and it comprises blood filter paper, whole blood, serum.

Test kit of the present invention can be used for manual method and extracts genome.

Description of drawings

Fig. 1 Yb8 primer extension product 1% agarose gel electrophoresis figure

Fig. 2 D13S317 primer extension product 1% agarose gel electrophoresis figure

Among Fig. 1,1, positive contrast (K562genomic DNA), 2, be the blood filter paper sample, 3, negative contrast (water), 4, be object of reference DL2000 (2000,1000,750,500,250,100).

Among Fig. 21, positive contrast (K562genomic DNA), 2, be the blood filter paper sample, 3, negative contrast (water), 4, be object of reference DL2000 (2000,1000,750,500,250,100).

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.These embodiment only are used for explanation the present invention, limit the scope of the invention and be not used in.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook. molecular cloning: laboratory manual (New York:coldspring Harbor Laboratory), Press, 1989) condition described in, or the condition of advising according to manufacturer.

Specific embodiment 1:

1) the direct WATER-WASHING METHOD experimental procedure of blood filter paper (building the storehouse):

The paramagnetic particle method experimental procedure:

Take blood filter paper as sample, implementation and operation is described:

Be that (size of 0.5cm * 0.5cm) adds respectively in the hole of sample panel, and in addition standby disposable plates and DNA collect each one of plate with sample preparation.

1) sample panel adds 90 μ L lysate A (lysate is for containing different sulphur nitrile acid guanidine (6%); Guanidinium hydrochloride (6%); TrisCl (pH6.4) 10mmol/L; TritonX-100 (0.3%); Tween20 (0.2%); 12 gastral cavity base creatine sodium (1%);

2) sample panel is put on the 68 degree well heaters and was heated 30 minutes

3) sample panel moisturizing 40 μ L, 600rpm vibration 20 seconds

4) sample panel is put on the 100 degree well heaters and was heated 10 minutes

5) sample panel moisturizing 40 μ L, 600rpm vibration 20 seconds

6) sample panel is put on the 100 degree well heaters and was heated 10 minutes

7) sample panel moisturizing 40 μ L, 600rpm vibration 20 seconds

8) sample panel is put on the 100 degree well heaters and was heated 10 minutes

9) sample panel adds 100 μ L guanidinesalt damping fluids, and 600rpm vibration 20 seconds repeats once;

10) dilution mixes magnetic bead, and every hole adds 21 μ L magnetic bead suspensions on disposable plates to add 2 times of volume guanidinesalt damping fluids (different sulphur nitrile acid guanidine 4%, Guanidinium hydrochloride 4%);

11) shift the lysate of about 130 μ L to the DNA disposable plates by sample panel;

12) disposable plates 760rpm vibration is 30 seconds, and commutation in per 10 seconds once.Left standstill 2 minutes, again vibration.Left standstill 2 minutes, for the third time vibration;

13) disposable plates is transferred on the magnet, and it is discarded to leave standstill after 30 seconds the sucking-off lysate;

14) disposable plates adds 90 μ L70% ethanol, 800rpm vibration 30 seconds, and commutation in per 10 seconds is once.

15) disposable plates is transferred on the magnet, and it is discarded to leave standstill after 20 seconds the sucking-off lysate

16) disposable plates adds 90 μ L70% ethanol, 800rpm vibration 30 seconds, and commutation in per 10 seconds is once;

17) disposable plates is transferred on the magnet, and it is discarded to leave standstill after 20 seconds the sucking-off lysate, and disposable plates left standstill 5 minutes;

18) add 75 μ L water in the disposable plates, 1200rpm vibration 30 seconds, commutation in per 10 seconds is once;

19) disposable plates is put on the 68 degree well heaters and was heated 10 minutes;

20) disposable plates 1000rpm vibration is 30 seconds, and commutation in per 10 seconds once;

21) disposable plates is put on the magnet, and transfer DNA is collected plate;

22) shift 30 μ L dna solutions by disposable plates and collect plate to DNA;

23) finish the DNA extraction experiment

Described magnetic bead is available from Jiangsu hundred dimension letter companies (being used for extracting the magnetic bead of DNA)

The DNA that extracts carries out conventional PCR, quantitative fluorescent PCR, Genotyping, the multiple post-treatment operations such as STR or any two or more treatment combination.

Carry out PCR/Real-time PCR/STR detects take 4 μ l genomic dnas as template.

PCR step after processing:

PrimersD13S317

D13S317-5：ACAGAAGTCTGGGATGTGGA

D13S317-3：GCCCAAAAAGACAGACAGAA

Genbank No.： G09017

Primers Yb8：

Genbank No.： AF015169.

Yb8-5：5’-CGA GGC GGG TGG ATC ATG AGG T-3’

Yb8-3：5’-TCT GTC GCC CAG GCC GGA CT-3’

realt ime PCR system：

10X buffer 2μl

Mg ²⁺(3mM) 1.76μl

dNTP(2.5mM/each) 2μl

primers 0.25μM/each

SYBR(final density0.01％)，add ddH ₂O to total20μl volume.

94℃，5min；

94℃，15s，59℃，15s，72℃30s，80℃，6s，30cycle；

72℃，3min；

70-95℃，0.3℃，6s，melt curve.

Experimental result is seen Fig. 1 and Fig. 2.

Sequence table

＜110〉Beijing Eastwin Scientific, Inc.

＜120〉a kind of test kit and method of carrying out the genome extraction at automatic nucleic acid extraction workstation

<130>

<160>4

<170>PatentIn version3.1

<210>1

<211>20

<212>DNA

＜213〉synthetic

<400>1

<210>2

<211>20

<212>DNA

＜213〉synthetic

<400>2

<210>3

<211>22

<212>DNA

＜213〉synthetic

<400>3

<210>4

<211>20

<212>DNA

＜213〉synthetic

<400>4

Claims

1. one kind is extracted workstation at automatic nucleic acid and carries out the test kit that genome extracts, and it is characterized in that: it comprises following component:

(1), lysis buffer: it contains different sulphur nitrile acid guanidine 4-8%; Guanidinium hydrochloride 4-8%; TrisCl pH6.410mmol/L; TritonX-100 0.1%-0.5%; Tween 20 0.1-0.3%; Sarcosyl 1-3%;

(2), guanidinesalt damping fluid: it contains different sulphur nitrile acid guanidine 4-8%, Guanidinium hydrochloride 4-8%;

(3), magnetic bead;

(4), elutriant contains Tris 100mmol/L pH=8, EDTA 10mmol/L pH=8;

% in the test kit all represents weight percent.