CN101294166A - Pig vesicula seminalis glandulae bioreactor and method for preparing recombinant protein or polypeptide with the same - Google Patents
Pig vesicula seminalis glandulae bioreactor and method for preparing recombinant protein or polypeptide with the same Download PDFInfo
- Publication number
- CN101294166A CN101294166A CNA2007101340994A CN200710134099A CN101294166A CN 101294166 A CN101294166 A CN 101294166A CN A2007101340994 A CNA2007101340994 A CN A2007101340994A CN 200710134099 A CN200710134099 A CN 200710134099A CN 101294166 A CN101294166 A CN 101294166A
- Authority
- CN
- China
- Prior art keywords
- gene
- pig
- protein
- expression vector
- refining
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a boar seminal vesicle gland bioreactor and a method for producing recombinant protein or polypeptide. A gene expression vector specifically expressed in seminal vesicle gland of boar contains regulating elements such as promoter, signal peptide and DNA sequence of polyadenylation signal. When the expression vector is integrated with boar genome by transgenic technology, the recombinant protein or polypeptide can be specifically expressed in seminal vesicle gland tissue of adult boar and secreted in semen. The method can directly obtain recombinant protein or polypeptide from semen, and has the advantages of advanced and simple method and low cost. Compared with methods using other animals, the method has remarkable superiority in maintaining cost, production period, etc.
Description
Technical field
The present invention relates to a kind of in the transgenic pig seminal vesicle synthetic recombinant protein or the polypeptide justacrine method to the boar semen, more specifically, relate to a kind of transgenic pig seminal vesicle bio-reactor and utilize this bio-reactor to produce the method for recombinant protein or polypeptide.
Background technology
The pharmaceutical protein of present many preciousnesses can utilize the DNA recombinant technology to express in bacterium, fungi and yeast, produces through large-scale the cultivation.But the biological activity of numerous protein just has behind post-treatment, such as carrying out glycosylation, hydroxylation and carboxylated.In many cases, the protokaryon bacterium lacks translates post-treatment modification ability, and yeast cell is different from people's source protein matter to expressing proteic cooked mode, and expression product has immunogenicity or non-activity.Though Zooblast culture medium can be realized these active courses of processing because of the engineering pharmaceutical system, animal cell culture system cost is too high, and output is lower, can't satisfy the clinical demand of most pharmaceutical protein.The albumen that utilizes the production of transgenic animal bio-reactor is synthetic in animal body and excretory, the interior environment of system of body has carries out posttranslational modification and machining functions to heterologous protein, the physiological activity of protein of producing is good, with people's homology height, very near natural product, and output height, cost are low.This is that other expression system is incomparable.Therefore the transgenic animal bio-reactor is the current protein drug mode of production that has development prospect.
The transgenic animal bio-reactor is meant that certain organ or tissue that can efficiently express foreign protein that utilizes the transgenosis living animal carries out the proteic technology of suitability for industrialized production active function, and these albumen generally are pharmaceutical protein or nutritive health-care albumen.The bio-reactor that is used to express comprises animal blood, urinary system, mammary gland etc., also comprises birds, beasts and eggs and insect (for example silkworm) individuality etc.Its ultimate principle is: use recombinant DNA technology, structure has the expression vector at the promotor of organizing specific expression and goal gene and other related elements, utilize gene transfer technique this expression vector to be incorporated in the genome of animal then, produce transgenic animal, this expression vector then can be at respective organization specifically expressing justacrine in corresponding body fluid.Principle in view of the above, any have great expression certain or some proteic tissue or organ all has the possibility of research and development bio-reactor.
Since first transgenic mice was born, people had just proposed to utilize transgenic animal to produce the possibility of pharmaceutical protein.Utilize the transgenic animal bio-reactor to produce recombinant protein at present and make important progress, particularly animal mammary gland bioreactor.The whole world has twenty or thirty company to be devoted to develop the animal bioreactor recombinant protein medicine at present, comprise recombinant human Antithrombin III (prevention and treatment acute and chronic thrombus thromboembolism form), recombinant tissue plasminogen activators (medicine for treating thrombus) and people C1 inhibitor (medicine of treatment vasodilation) etc., wherein the recombinant human Antithrombin III is first animal bioreactor protein drug of getting permission to go on the market.The recombinant protein of productions such as Transgenic Sheep, ox and rabbit galactophore biological reactor has been finished or has been entered the clinical III phase and tested, and also has more than 10 kind of recombinant protein medicine to be in clinical study, and other has hundreds of recombinant proteins to be in development.Also have animal blood bio-reactor, bladder bio-reactor expression systems such as (producing recombinant protein in the urine) to be in different development in addition.
Yet comparatively speaking, expression systems such as mammary gland also exist some can't improved deficiency, and are quite long to lactation timed interval for the first time as birth; Breeding cycle is long; There is long lactation interval; Some animal is difficult to collect milk, as pig, rabbit etc.; Some mammary gland external source biological activity protein of expressing can be absorbed by animal in addition, may be harmful to animal health, particularly at expression level when higher.
The transgenic chicken bio-reactor at present unvanquishable shortcoming be the fetal development of bird a lot of differences of having compared with mammals, research to it temporarily lags behind other animal, make the application of transgenic chicken still have more difficulty, cause the transgenic technology of widespread use in Mammals, be not suitable in bird, using.And for the blood bio-reactor,, add the composition more complicated of blood because the people source is often more similar with the albumen in the animal blood, separate relatively difficulty; The high density foreign protein may be healthy harmful to animal body in blood in addition, and these unfavorable factors have limited the application of blood expression system.The subject matter of urine expression system is that the foreign protein rate ratio that can express in the urine is lower.
Summary of the invention
One object of the present invention is to provide a kind of method of producing recombinant protein or polypeptide in transgenosis boar seminal vesicle, and it is big that it has output, and separation and purification is simple, does not have characteristics such as the interval of breeding.
Another object of the present invention be to provide a kind of in boar seminal vesicle tissue specifically expressing and the secretion foreign protein expression vector.
The inventor is experimental animal model with the mouse, through a large amount of basic research works, has finished the present invention finally.
The expression vector of specifically expressing in transgenic pig seminal vesicle tissue, contained 5 ' flanking region, promotor, signal peptide, polyadenylation signal and 3 ' the flanking region sequence of this expression vector can instruct foreign gene specifically expressing in boar seminal vesicle tissue, and justacrine recombinant protein or polypeptide are to seminal fluid.
Described promotor is selected from the promotor of pig refining protein gene.The promotor that is selected from pig refining protein gene is the promotor of sperm adhesin albumen man cluster gene in the pig refining.The promotor of sperm adhesin albumen man cluster gene is the promotor of pig refining protein I gene or refining protein I I gene in the pig refining.
Described in transgenic pig seminal vesicle tissue the expression vector of specifically expressing, also comprise 5 ' flanking sequence of one section pig refining protein I gene or refining protein I I gene.
Described signal peptide dna sequence dna is the signal peptide sequence of pig refining protein I gene or refining protein I I gene.
Described 3 ' flanking sequence is a 3 ' flanking sequence of pig refining protein I gene or refining protein I I gene.
Described polyadenylation signal sequence is the polyadenylation signal sequence of pig refining protein I gene or refining protein I I gene.
What a cover provided by the invention was brand-new is the bio-reactor of host animal with the transgenic pig, is made up of transgenic pig seminal vesicle tissue, and wherein said transgenic pig is made by the expression vector that the invention described above provides.
Utilize this system, can from the transgenic pig seminal fluid, obtain gene recombinant protein or polypeptide.Bio-reactor of the present invention provide a kind of under condition of living organism at particular organization's specific expression protein white matter and polypeptide, and carry out glycosylation, hydroxylation and processing method of biological activity such as carboxylated.
Method from the transgenic pig seminal vesicle is produced foreign protein or polypeptide comprises the steps: that mainly (1) is structured in the expression vector of boar seminal vesicle organizing specific expression; (2) adopt method well known to those skilled in the art, expression vector is integrated in the animal gene group, make transgenic animal as sperm vector method or embryo's microinjection; (3) behind the Farrowing, gather hemocyte or tissue DNA analysis and the definite transgenosis individuality of offspring piglet; (4) cultivating transgenosis boar and sow to sexual maturity and mating goes down to posterity; (5) gather F0 or F1 seminal fluid, analyze the content of exogenous gene expression product, select the high yield individuality as the host of bio-reactor or as the bio-reactor boar for sexual maturity transgenosis boar; (6) described foreign protein of separation and purification or polypeptide from the seminal fluid of sexual maturity transgenosis boar.
More specifically, to of the present invention further describe as follows:
The key of transgenic animal bio-reactor is the expression vector that obtains efficient specifically expressing.The present invention has successfully assembled the suitable expression vector of a cover, carry the transgenosis boar of this expression vector can be in seminal vesicle tissue high level expression foreign gene specifically, carry out corresponding biological activity and process, justacrine is to seminal fluid.In one embodiment, the promotor of expression vector of the present invention is to be derived from proteic main member's refining protein I I (the porcine seminalproteins II of boar refining, PSPII) promotor of gene, this promotor are the important regulating and controlling elements of gene efficient expression.Pig refining protein I and II are the main members of tame bunch of sperm adhesion protein (Spermadhesion), mainly express at seminal vesicle, the content of refining protein I and II accounts for more than 50% of refining total protein, points out this expression of gene controlling element to have the characteristic of efficient specifically expressing.In other embodiments of the present invention, can in boar seminal vesicle tissue, express, and the proteic gene expression regulation element of the refining that contains in seminal fluid (promotor, signal peptide and polyadenylation signal etc.) all can instruct exogenous gene expression.
Except that promotor, expression vector of the present invention has also assembled pig refining protein I I signal peptide (SP) and polyadenylic acid (poly A) is changed signal and 5 ' and 3 ' flanking region sequence, these gene expression regulation elements can make the messenger RNA(mRNA) (mRNA) of expressed exogenous gene tend towards stability, prolong its transformation period, improve its expression amount at tissue.
The said gene element is pre-assembled in can be on the plasmid vector that duplicates in the intestinal bacteria, and foreign gene inserts the promotor downstream by cloning site, contains the expression of exogenous gene carrier thereby be built into.This expression vector can carry out a large amount of preparations and the purifying of recombinant plasmid by method well known to those skilled in the art, utilizes sperm vector method well known to those skilled in the art or embryo's microinjection etc. to carry out transgenic animal production then.
After the transgenosis piglet birth, utilize polymerase chain reaction (PCR) and the analysis of Southern engram technology to determine transgenosis individuality (F0), go down to posterity (F1) and cultivate to sexual maturity.Collect the adult boar semen of F0 and F1, detect the expression level of target protein.The boar that the preferred expression level is high carries out population as bio-reactor host of the present invention and expands numerous.
The inventive method is advanced simple, and cost is low.The expression vector of specifically expressing in the boar seminal vesicle, this expression vector contains the controlling elements such as dna sequence dna of promotor, signal peptide and polyadenylation signal, when this expression vector is integrated in the pig genome by transgenic technology after, recombinant protein or polypeptide can be in transgenosis be grown up boar seminal vesicle tissue specifically expressing, justacrine is to seminal fluid.Characteristics of the present invention are that recombinant protein or the polypeptide produced can directly be gathered in the crops from seminal fluid.
Utilizing the transgenic pig seminal vesicle to produce foreign protein is a very attractive uncharted field.Compare with other animal, make pig seminal vesicle bio-reactor, utilize the pig seminal fluid to produce foreign protein and have unique advantage: the semen volume of (1) pig is bigger, once ejaculate about 200-400ml, protein content in the seminal fluid is higher, and the protein in the seminal fluid of at every turn ejaculating can reach 6-9 gram, and wherein major protein refining protein I and refining protein I I account for more than 50%, mainly by the seminal vesicle secretion, the control region of its gene is fit to do the controlling element of expression vector very much.(2) the seminal vesicle tissue of pig has expression and the proteic ability of processed complex; (3) boar early sexual maturity, 69 monthly ages were sexual maturity; The back sustainable use of growing up can be gathered 4-5 time weekly, and seminal fluid can constantly be gathered at all seasons, can utilize the time limit to reach 4-6; (4) pig semen collection and treatment technology are quite ripe, and the seminal fluid composition is also simple relatively, easily purifying protein; (5) breeding easily, litter size is many, in case successfully develop the transgenosis boar, can breed rapidly, enlarges population, and commercial cost is low after the industrialization; (6) expression product is mainly in seminal vesicle tissue and seminal fluid, and is little to the potential hazard of health.Therefore pig seminal vesicle bio-reactor has the production potential same with the bovine mammary gland bio-reactor, and has clear superiority at aspects such as carrying cost, production cycles.
Description of drawings
Fig. 1 illustrates the clone of pig refining protein I I gene 5 ' regulating and controlling sequence, recombinant plasmid called after pMD18-T-PSPII 5.(embodiment 1 is described)
Fig. 2 illustrates pig refining protein I I gene 5 ' regulating and controlling sequence subclone to the pcDNA3.0 carrier of transforming, called after pcPSPII5.(embodiment 1 is described)
Fig. 3 illustrates the clone of pig refining protein I I gene 3 ' regulating and controlling sequence, recombinant plasmid called after pMD18-T-PSPII 3.(embodiment 1 is described)
Fig. 4 illustrates the structure of the specific expression carrier that contains pig refining protein I I gene 5 ' regulating and controlling sequence, polyadenylation signal and 3 ' flanking region sequence, recombinant vectors called after pcPSPII53.(embodiment 1 is described)
Fig. 5 illustrates the pcPSPII construction of recombinant plasmid that contains pig refining protein I I gene promoter, signal peptide, polyadenylation signal and 3 ' flanking region sequence.(embodiment 1 is described)
Fig. 6 illustrates the pcPSPII-EGFP construction of recombinant plasmid that contains pig refining protein I I gene promoter, signal peptide, enhanced green fluorescence protein reporter gene, polyadenylation signal and 3 ' flanking region sequence.(embodiment 1 is described)
Fig. 7 illustrates expression member used when carrying out the transgenic mice making, contains encoding sequence, pig refining protein I I gene polyadenylation signal sequence and 3 ' the distolateral pterion of pig refining protein I I gene promoter, signal peptide sequence, enhanced green fluorescent albumen reporter gene.(embodiment 2 is described)
Fig. 8 illustrates the PCR qualification result of transgenic mice.(embodiment 3 is described)
Fig. 9 illustrates the expression of green fluorescent protein in the public mouse seminal vesicle of transgenic positive tissue.(embodiment 3 is described)
Figure 10 illustrates the expression of green fluorescent protein in the vaginal suppository that the public mouse post-coitum of transgenic positive forms.(embodiment 3 is described)
Embodiment
In order to make up the dedicated expression vector therefor that can express in the boar seminal vesicle, justacrine is to seminal fluid, and the present embodiment is selected the basic skeleton of pcDNA3.0 as vector construction, successively the range gene element is inserted improved pcDNA3.0 carrier.
1.pcDNA3.0 transformation: according to the restriction enzyme mapping analytical results, with restriction enzyme Pvu II digestion pcDNA3.0 carrier, excision neo gene and expression regulation sequence thereof wherein, digestion product separates with agarose gel electrophoresis, reclaim test kit with dna gel and reclaim the 3.2kb fragment, connect the back from body and transform DH5 α competence intestinal bacteria, transform the transformation plasmid that bacterial classification obtains not contain neo gene and expression regulation sequence thereof from the positive.
2. preparation and clone pig refining protein I I gene promoter: the pig refining protein I I gene order of having delivered according to Genbank (AJ853849), analyze the restriction endonuclease sites of PSP-II gene complete sequence with DNASTAR, and design the distolateral pterion of a pair of primer amplification PSP-II gene 5 ', length is 4087bp, the upstream is to-4087, the downstream is to ATG initiator codon place, comprising promotor.Upstream primer is 5 '-AG
TCGCGATGA GTT GAG GGG TAT TCACCA AAC-3 ' has introduced Nru I restriction enzyme site (underscore place) in primer, downstream primer is 5 '-AT
GGTACC ACGCGTCTC AGC AGC CTG GCC CTA GC-3 ' has introduced Kpn I and Mlu I restriction enzyme site (underscore place) in primer.Get 500 nanogram pig genomic templates, add above-mentioned primer, under high-fidelity DNA polymerase LA Taq (Japanese precious biotech firm) effect (setting of reaction system parameter by specification), through 95 ℃ of pre-sex change 5 minutes; 94 ℃ of sex change 40 seconds, 61 ℃ of renaturation 90 seconds, 72 ℃ were extended 6 minutes, totally 30 circulations; 72 ℃ were extended 10 minutes then, and amplifying length at last is the distolateral pterion of pig refining protein I I gene 5 ' of 4087bp, and this fragment promptly contains the promotor of refining protein I I gene.Pcr amplification product carries out electrophoresis in 0.7% sepharose, cut the target dna fragment of glue recovery purifying 4087bp length then, purifying dna fragmentation purification kit (TaKaRa Agarose Gel DNA PurificationKit Ver.2.0, the precious biotech firm of Japan), undertaken by process specifications.Be cloned into TA cloning vector pMD18-T (Japanese precious biotech firm) then according to a conventional method, screening positive clone, and positive colony carried out the enzyme evaluation of cutting and check order, obtain containing the pMD18-T-PSPII5 recombinant plasmid (Fig. 1) in the distolateral pterion of pig refining protein I I gene 5 ' of 4087bp.Then pMD18-T-PSPII5 recombinant plasmid and transformed pcDNA3 plasmid being carried out enzyme with NruI and KpnI cuts, cut glue behind the electrophoresis and reclaim purifying 4087bp and linearizing 2589bp fragment, under the effect of T4DNA ligase enzyme, connect, transformed into escherichia coli DH5 α competent cell, the white colony of growing after picking transforms is inoculated in 1ml and contains in the LB substratum of 100 μ g/ml penbritins, 37 ℃ shaking culture 10-12 hour, extract plasmid DNA according to ordinary method then, screening positive clone, carry out enzyme and cut evaluation, obtain containing the pcPSPII5 recombinant plasmid (Fig. 2) in the distolateral pterion of pig refining protein I I gene 5 ' of 4087bp.
3. preparation and clone pig refining protein I I gene 3 ' the distolateral pterion: the pig refining protein I I gene order of having delivered according to Genbank (AJ853849), analyze the restriction endonuclease sites of PSP-II gene complete sequence with DNASTAR, and design a pair of primer amplification PSP-II gene 3 ' the distolateral pterion, length is 3094bp, the upstream is to terminator codon, downstream 3094bp to the terminator codon is comprising PSP-II gene polyadenylation signal sequence.Upstream primer is 5 ' CT
GGTACCTGC TGT AAT CAT TTT GAA TAA AG 3 ' has introduced KpnI restriction enzyme site (underscore place) in primer, downstream primer is 5 ' AT
CTCGAGGTG AAC TGT TTA CCA TGA ATT GT 3 ' has introduced Xho I restriction enzyme site (underscore place) in primer.Get 500 nanogram pig genomic templates, add above-mentioned primer, under high-fidelity DNA polymerase LATaq (Japanese precious biotech firm) effect (setting of reaction system parameter by specification), through 95 ℃ of pre-sex change 5 minutes; 94 ℃ of sex change 40 seconds, 57 ℃ of renaturation 60 seconds, 72 ℃ were extended 4 minutes, totally 30 circulations; 72 ℃ were extended 10 minutes then, and amplifying length at last is pig refining protein I I gene 3 ' the distolateral pterion of 3094bp, and this fragment contains refining protein I I gene polyadenylic acid (polyA) and changes signal sequence.Pcr amplification product carries out electrophoresis in 0.7% sepharose, cut the target dna fragment of glue recovery purifying 3094bp length then, insert the pMD18-T cloning vector by the 2nd described method in the present embodiment example, and positive colony carried out the enzyme evaluation of cutting and check order, obtain containing the pMD18-T-PSPII3 recombinant plasmid (Fig. 3) in pig refining protein I I gene 3 ' the distolateral pterion of 3094bp.Then pMD18-T-PSPII3 and pcPSPII5 ' being carried out enzyme with KpnI and XhoI cuts, cut glue behind the electrophoresis and reclaim purifying 3094bp and linearizing pcPSPII5 fragment, connect by the 2nd described method in the present embodiment example, transform, screening positive clone, carry out enzyme and cut evaluation, the recombinant plasmid pcPSPII53 (Fig. 4) that obtains containing the distolateral pterion of pig refining protein I I gene 5 ' of 4087bp and contain pig refining protein I I gene 3 ' the distolateral pterion of 3094bp.
4. synthetic pig refining protein I I gene signal peptide sequence and insertion site: shown in the mRNA sequence (NM 213836) of pig refining protein I I gene, its signal peptide length is 21 amino acid, from ATG, altogether by 63 nucleotide codings.According to this sequence, from the ATG initiator codon, the dna double chain-ordering of this signal peptide of synthetic, and extended two amino acid whose codons (GCACGG) of pig refining protein I I mature peptide, make signal peptide be easy to identification.Introduce MluI restriction enzyme site (ACGCGT at 5 ' end at last, underscore part as shown below), introduce EcoRV HindIII NotI Kpn I restriction enzyme site (GATATC AAGCTT GCGGCCGC GGTACC, underscore part as shown below) at 3 ' end, be convenient to the insertion of foreign gene.Synthetic signal coding sequence and insertion site are as follows: MluI EcoR V Hind III NotI KpnI
ACGCGTATGAAGCTGGGCACTGCCATCCCCTGGGCCTTGCTGCTCAGTACAGCCACACTGGT TTCAACTGCACGG
GATATCAAGCTTGCGGCCGCGGTACC TGCGCATACTTCGACCCGTGACGGTAGGGGACCCGGAACGACGAGTCATGTCGGTGTGACCA AAGTTGACGTGCC
CTATAGTTCGAACGCCGGCGCCATGG5 ' 3 '
5. assemble pig refining protein I I gene signal peptide sequence and insert the site: the signal peptide dna double chain-ordering fragment of recombinant plasmid pcPSPII53 and synthetic is carried out enzyme with KpnI and MluI cut, cut glue behind the electrophoresis and reclaim purifying linearizing fragment, connect by the 2nd described method in the present embodiment example, transform, screening positive clone, carry out the enzyme evaluation of cutting and check order, obtain containing pig refining protein I I gene 3 ' the distolateral pterion pcPSPII recombinant plasmid (Fig. 5) of the distolateral pterion of pig refining protein I I gene 5 ', signal peptide sequence and the 3094bp of 4087bp.
6. in the pcPSPII expression vector, insert green fluorescent albumen reporter gene: pcPSPII recombinant plasmid and commercialization plasmid pEGFP-N1 are carried out enzyme with HindIII and NotI cut, cut glue behind the electrophoresis and reclaim purifying purpose fragment, connect by the 2nd described method in the present embodiment example, transform, screening positive clone, carry out enzyme and cut the evaluation with PCR, the encoding sequence insertion pcPSPII with enhanced green fluorescent albumen reporter gene obtains pcPSPII-EGFP recombinant plasmid (Fig. 6).
The pcPSPII-EGFP expression vector is cut with NruI and XhoI enzyme, cut glue behind the electrophoresis and reclaim the purpose fragment (Fig. 7) that purifying contains encoding sequence, pig refining protein I I gene polyadenylation signal sequence and 3 ' the distolateral pterion of pig refining protein I I gene promoter, signal peptide sequence, green fluorescent albumen reporter gene.This fragment of 30 micrograms with polycation PEI parcel, is injected in the testis Mus in six ages in week, injects altogether three times, be spaced apart 3 days, count, after 20 days, public mouse and normal female mouse of injecting carried out mating from last injection.Treat to identify with PCR after the hybridize mice birth screening transgenic positive mouse.And continue to cultivate the public mouse of transgenic positive and female mouse to sexual maturity (F0), and with the normal mouse mating, cultivate F1 for the public mouse of transgenic positive and female mouse.Fig. 8 has shown that F0 generation and F1 are for transgenic mice PCR qualification result.Figure A represented F0 for detected result, swimming lane 1-5 be F0 for individuality, swimming lane 6 positive contrasts, swimming lane 7 is a non-transgenic mouse negative control, wherein swimming lane 2,4 is the transgenic positive mouse.Figure B has represented F1 for detected result, and swimming lane 1-8 is the transgenic positive mouse, and swimming lane 9 is a non-transgenic mouse negative control, swimming lane 10 positive contrasts.
With the public mouse F1 of the sexual maturity transgenic positive among the embodiment 2 public mouse incision of the transgenosis abdominal cavity in generation, downcut a seminal vesicle tissue respectively, make frozen section.Get a public mouse of feminine gender simultaneously, make frozen section, in contrast, observe green fluorescence down, to green fluorescence, and in negative control public affairs mouse, do not observe green fluorescence (Fig. 9) at the seminal vesicle structure observation of the public mouse of transgenic positive in fluorescent microscope.Wherein scheming A is transgenic positive mouse seminal vesicle tissue slice, and figure B is a non-transgenic mouse seminal vesicle tissue slice.And with the public mouse of transgenic positive and normal female mouse post-coitum collection vaginal suppository, with damping fluid (Tris 10mM, EDTA 1mM) dissolving vaginal suppository, observe green fluorescence down in fluorescent microscope, in the vaginal suppository lysate that the public mouse post-coitum of transgenic positive is collected, observe green fluorescence, and in the vaginal suppository lysate that the public mouse post-coitum of negative control is collected, do not observe green fluorescence (Figure 10).Wherein scheming A is the lysate of public mouse of transgenic positive and the collected vaginal suppository of normal female mouse post-coitum, and figure B is the lysate of positive public mouse of non-transgenic and the collected vaginal suppository of normal female mouse post-coitum.
Claims (10)
1, a kind of in transgenic pig seminal vesicle tissue the expression vector of specifically expressing, it is characterized in that 5 ' contained flanking region, promotor, signal peptide, polyadenylation signal and 3 ' flanking region sequence can instruct foreign gene specifically expressing in boar seminal vesicle tissue, justacrine recombinant protein or polypeptide are to seminal fluid.
2, expression vector as claimed in claim 1 is characterized in that described promotor is selected from the promotor of pig refining protein gene.
3, expression vector as claimed in claim 2 is characterized in that described promotor is the promotor of sperm adhesin albumen man cluster gene in the pig refining.
4, expression vector as claimed in claim 3 is characterized in that described promotor is the promotor of pig refining protein I gene or refining protein I I gene.
5, expression vector as claimed in claim 1 is characterized in that also comprising 5 ' flanking sequence of one section pig refining protein I gene or refining protein I I gene.
6, expression vector as claimed in claim 1 is characterized in that described signal peptide dna sequence dna is the signal peptide sequence of pig refining protein I gene or refining protein I I gene.
7, expression vector as claimed in claim 1 is characterized in that described 3 ' flanking sequence is a 3 ' flanking sequence of pig refining protein I gene or refining protein I I gene.
8, expression vector as claimed in claim 1 is characterized in that described polyadenylation signal sequence is the polyadenylation signal sequence of pig refining protein I gene or refining protein I I gene.
9, a kind of bio-reactor is characterized in that being made up of transgenic pig seminal vesicle tissue, and wherein said transgenic pig is made by the expression vector of claim 1-8.
10, a kind of method of producing foreign protein or polypeptide from the transgenic pig seminal vesicle is characterized in that comprising the steps:
(1) will the encode foreign gene of described albumen or polypeptide is inserted in the expression vector of claim 1-8;
(2) utilize sperm vector method well known to those skilled in the art or embryo's microinjection that expression vector and target gene are integrated in the pig genome;
(3) behind the Farrowing, gather hemocyte or tissue DNA analysis and the definite transgenosis individuality of piglet;
(4) cultivate transgenosis male and female pig individuality to sexual maturity and go down to posterity;
(5) gather F0 or F1 seminal fluid, analyze the content of exogenous gene expression product, select the high yield individuality to use animal as the host animal of bio-reactor or as the bio-reactor kind for ripe transgenosis boar;
(6) described foreign protein of separation and purification or polypeptide from the seminal fluid of transgenosis boar.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101340994A CN101294166A (en) | 2007-10-29 | 2007-10-29 | Pig vesicula seminalis glandulae bioreactor and method for preparing recombinant protein or polypeptide with the same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101340994A CN101294166A (en) | 2007-10-29 | 2007-10-29 | Pig vesicula seminalis glandulae bioreactor and method for preparing recombinant protein or polypeptide with the same |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101294166A true CN101294166A (en) | 2008-10-29 |
Family
ID=40064701
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007101340994A Pending CN101294166A (en) | 2007-10-29 | 2007-10-29 | Pig vesicula seminalis glandulae bioreactor and method for preparing recombinant protein or polypeptide with the same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101294166A (en) |
-
2007
- 2007-10-29 CN CNA2007101340994A patent/CN101294166A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pursel et al. | Status of research with transgenic farm animals | |
| Powell et al. | Transgenic sheep and wool growth: possibilities and current status | |
| Ebert et al. | Transgenic farm animals: progress report | |
| CN102226202A (en) | Method for synthetizing secretion lysozyme by middle silkgland cell of silkworm | |
| US6545198B1 (en) | Transgenically produced prolactin | |
| CN101260398B (en) | Nerve growth factor gene positioning reconstruction animal and its preparation method and application | |
| AU2001259465B2 (en) | Transgenically produced decorin | |
| CN100497369C (en) | Non-glycosylated human alpha-fetoprotein, methods of production, and uses thereof | |
| WO2012068769A1 (en) | Method for site-specific integration of exogenous genes | |
| AU2001259465A1 (en) | Transgenically produced decorin | |
| CN100480390C (en) | Transgenic cow obtaining method | |
| EP0771874B1 (en) | Transgenic protein production | |
| CN106256909A (en) | Express the transgenic chicken breeding method of duck RIG-I albumen | |
| CN101294166A (en) | Pig vesicula seminalis glandulae bioreactor and method for preparing recombinant protein or polypeptide with the same | |
| CN100469876C (en) | Method for procducing great cattles through transgene cloning ferritin gene of human milk | |
| CN101412999A (en) | A kind of gene targeting locus-specific transgenic method and application thereof | |
| CN1970750B (en) | Garget-resistant milk cow embryo reconstruction method using antibacterial peptide | |
| CN1300314C (en) | Method for preparing transient expression recombination protein chicken salpingo biological reactor | |
| CN103923215B (en) | Make material and the application thereof of ACC-α gene promoter P III inactivation | |
| CN1891821B (en) | Production method of animal cell with human lysozyme gene | |
| CN101532018A (en) | Producing method of transgenic mouse containing anthropogenic proto-oncogene c-Ha-ras and application thereof | |
| JP5688849B2 (en) | Transgenic goldfish | |
| Tian et al. | Life on the bio-pharm: therapeutic proteins from transgenic organisms | |
| US20210032311A1 (en) | Non-human gene-edited mammal, protein crude extract separated from connective tissue of non-human gene-edited mammal, method for protein crude extract and uses of protein crude extract | |
| Montgomery | Transgenic Animals |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20081029 |