CN101280282A - Transgenic yeast containing flounder growth hormone gene, preparation and application thereof - Google Patents

Abstract

The invention discloses recombinant yeast for the flounder growth hormone gene and the preparation method and the application thereof. The recombinant yeast is obtained through transferring the flounder growth hormone gene into saccharomyces cerevisiae, and the obtained saccharomyces cerevisiae expresses the flounder growth hormone. The fermentation technology of the saccharomyces cerevisiae is mature, the expression quantity is higher, the saccharomyces cerevisiae is secure and non-toxic, the obtained saccharomyces cerevisiae for expressing the flounder growth hormone is not required to be purified, and can be directly used as feedstuffs or feed additive for the flatfish cultivation, the growth speed of the flatfish can be quickened, and the cultivation cycle can be shortened.

Description

Transgenic yeast containing flounder growth hormone gene and its production and application

Technical field

The invention belongs to Protocols in Molecular Biology and technical field of bioengineering, specifically, is a kind of transgenic yeast containing flounder growth hormone gene and its production and application.

Background technology

Since the eighties, China began the commodity breed of lefteye flounder, because of its marketable value height, good in economic efficiency, its proportion in aquaculture was increasing.To the cultured output of China's lefteye flounder in 2006 above 82560 tons, the output value breaks through 6,000,000,000 yuan, wherein, lefteye flounder and turbot are most important kinds in the Pangasiidae aquaculture of present China, introduced Atlantic Ocean summer flounder, Paralichthys lethostigma, Senegal sole etc. in recent years again, the scale of propagating artificially of lefteye flounder enlarges day by day.But in the long breeding process of lefteye flounder,, cause its sick death easily, cause financial loss owing to the influence of reasons such as temperature, water quality.Therefore improve the speed of growth of flounder sole by modernized biotechnology means, reduce aquaculture cost and risk, become insider's Focal Point of Common Attention.

Fish growth hormone (GH) is a kind of single chain polypeptide parahormone by the Anterior pituitary cell synthesis secretion of fish.In bony fish, the growth promoting function of tethelin mainly is as metabolic controlling element, promotes that fat decomposes more as the energy, makes the amino acid of absorption be used for growth more; Improve proteinic transformation efficiency in the bait, promote proteinic synthetic; Influence to sugar metabolism shows as the consumption that can promote liver starch, strengthens the ability of utilizing to carbohydrate.Tethelin can promote growth, the growth of fish body effectively in the intravital regulatory function on multi-level of fish.

Normal fish body inner growth hormone content is very little, and every liter of fish blood only contains 20 μ g, and it is impossible extracting from the fish body.For satisfying the needs of marine fish culture industry, the utilization genetic engineering technique utilizes microbial fermentation production to become an effective way of a large amount of acquisition offal fish tethelin.Many studies confirm that, the tethelin that gene engineering method obtains has the function of compensatory endogenous growth hormone, and the intramuscular injection exogenous growth hormone can promote the fish bulk-growth; The tethelin that adds in the bait can absorb by the epithelial pinosome of fish body digestive tube hindgut, improves the speed of growth of fish body, and in the fish body transformation period generally in 6h, after 12--24h, basic detect less than.And because the tethelin of most of seawater fishs has higher homology, a kind of tethelin of sea water fish also has the effect that promotes growth to other sea water fish, so its range of application is wider.

In the prior art, have two class methods promoting fish growth hormone gene vivoexpression to application development:

The raising of first expression efficiency, according to the tethelin aminoacid sequence of intestinal bacteria preference codon and known fish, somatonorm cDNA, transformed into escherichia coli obtains a large amount of tethelin; Perhaps make up new expression vector, in intestinal bacteria, efficiently express, obtain the more foreign protein of high expression level amount.Yet colibacillary expression product often forms inclusion body, and is consuming time, loaded down with trivial details to its processing, expresses simultaneously and contains intracellular toxin in the crude extract, must carry out strict separation and purification to the purpose product and just can use.Therefore people transfer to attempt can be used as the expression system of bait again.

The genes of brewing yeast engineering bacteria not only has the advantage of prokaryotic system, and has the characteristic of typical eukaryotic system, is considered to express the suitable host of foreign protein.Its superiority shows: it is fast 1, to have a growth of similar prokaryotic organism, cultivates easily, and reproduction speed is fast, can high-density culture, be easy to the characteristics of genetic manipulation; 2, have processes such as translation post-treatment such as glycosylation, disulfide linkage formation and protein folding; 3, adopt the promotor of high expression level, efficiently express goal gene, but induction regulating controlling; 4, finish gene order-checking, have complete gene expression regulation mechanism and the processing modification and the secretion capacity of expression product; 5, yeast saccharomyces cerevisiae safety non-toxic.Have in the brewing yeast cell than other biological homologous recombination repair mechanism more efficiently in addition, the homology segment that studies show that 30-50bp just can mediate effective reorganization, this make yeast saccharomyces cerevisiae than other biology more the suitable applications homologous recombination technique carry out various DNA operation, thereby realize that the long-term stability of foreign gene in yeast saccharomyces cerevisiae express, multiple medicine-obtained expression as cellobiase, human alpha interferon, hepatitis B surface antigen etc. in yeast saccharomyces cerevisiae has been arranged.

The existing integrating vector of yeast saccharomyces cerevisiae expression vector that has developed at present and set up has additional build yeast again.The additional build expression vector that is applied to yeast saccharomyces cerevisiae mostly is intestinal bacteria-yeast saccharomyces cerevisiae shuttle expression plasmid, and this carrier can be selected in host bacterium and breed, and often uses the replication orgin and the amicillin resistance selective marker of pUC plasmid.Yeast partly generally includes the duplicate field of zymic 2 μ m plasmids, and the selection element that is used for yeast conversion mainly is the relevant gene of auxotroph.This class carrier can be independent of outside the yeast chromosomal and duplicate, often with 30 or more multiple copied have but instability when not having selective pressure.This type expression vector must have selective pressure ability stably express in cell, be unsuitable for suitability for industrialized production.The plasmid replication district that another kind of carrier does not duplicate in yeast, but utilize the homology segment with vector integration to karyomit(e), this chromosomoid stability is high, be suitable for suitability for industrialized production, but copy number is low.When expressing, foreign gene merges with the gene promoter that efficiently expresses from yeast saccharomyces cerevisiae, and the existing constitutive expression of these promotors also has inducible expression.

Because the yeast saccharomyces cerevisiae safety non-toxic once was used to strengthen halogen worm, wheel animalcule, as porgy prelarva and lefteye flounder prelarva bait in aquaculture.Therefore yeast saccharomyces cerevisiae is the excellent selection of expressing fish growth hormone, and Piyaviriyakul etc. (2002) use the yeast saccharomyces cerevisiae episomal vector that contains the PGK promotor to obtain the huge catfish tethelin of reorganization of 102.5mg/l in yeast saccharomyces cerevisiae.That Ma Jin etc. (1999) have made up expression rainbow trout tethelin is the yeast saccharomyces cerevisiae episomal vector pMArGH16 of promotor with PGK, transformed saccharomyces cerevisiae, obtained to express the Yeast engineering bacteria of rainbow trout tethelin, the expression amount of the recombinant human growth hormone that obtains accounts for 3% of cell total soluble protein.As the fodder additives tilapia of throwing something and feeding, 2% addition can significantly improve the growth of juvenile fish with this yeast, and the body weight gain rate improves 38% (2001) than control group.But still yeast saccharomyces cerevisiae is not applied on the vivoexpression of lefteye flounder tethelin particularly integrated expression at present.

Summary of the invention

The invention provides a kind of transgenic yeast containing flounder growth hormone gene and its production and application, can accelerate the speed of growth of fishes in bothid and true plaice, solve in the long breeding process of present fishes in bothid and true plaice the problem of sick death owing to the influence of reasons such as temperature, water quality.

The objective of the invention is to realize by following technical scheme:

A kind of transgenic yeast containing flounder growth hormone gene is characterized in that: described transgenic yeast changes the lefteye flounder growth hormone gene in the yeast saccharomyces cerevisiae over to and obtains.

Described transgenic yeast is expressed lefteye flounder tethelin, and by Chinese microorganism strain preservation center preservation, preserving number is this transgenic yeast: CGMCC No.2478.

Described yeast saccharomyces cerevisiae is the synthetic defective type of Saccharomyces cerevisiae tryptophane.

Described lefteye flounder growth hormone gene is lefteye flounder tethelin mature peptide cDNA, contains the nucleotide fragments of 525bp, has 100% homology with nucleotide sequence shown in No. 1 sequence of sequence table.

The lefteye flounder tethelin that described transgenic yeast is expressed is lefteye flounder tethelin mature peptide, 174 amino-acid residues of encoding, and its molecular weight is 19KDa, the aminoacid sequence shown in No. 2 sequence of its aminoacid sequence and sequence table has 100% homology.

It is by with lefteye flounder growth hormone gene carrier construction pIPGK-GH that described lefteye flounder growth hormone gene changes in the yeast saccharomyces cerevisiae, and transformed saccharomyces cerevisiae obtains transgenic yeast Saccharomyces cerevisiaeYGH.

Among the described carrier pZGH, the front end of lefteye flounder growth hormone cDNA is the promotor of the PGK (phosphoglycerokinase gene) of yeast saccharomyces cerevisiae, start the expression of lefteye flounder tethelin by the PGK promotor, the long 1490bp of PGK promotor has 100% homology with the nucleotide sequence shown in No. 3 sequence of sequence table.

Among the described carrier pZGH, the both sides of described growth hormone gene expression cassette are the URA3 gene of yeast saccharomyces cerevisiae, with the URA3 gene as with the site of the genomic dna generation homologous recombination of yeast saccharomyces cerevisiae, URA3 gene length 807bp has 100% homology with the nucleotide sequence shown in No. 4 sequence of sequence table.

A kind of preparation method of transgenic yeast containing flounder growth hormone gene is characterized in that having following steps:

[1] preparation of lefteye flounder growth hormone cDNA:

Extract the total RNA of lefteye flounder pituitary gland, design contains primer ping1 and the ping2 of restriction enzyme site BamH I and Not I, nucleotide sequence shown in No. 5 sequence of ping1 primer sequence and sequence table has 100% homology, nucleotide sequence shown in No. 6 sequence of ping2 primer sequence and sequence table has 100% homology, adopt reverse transcriptase polymerase chain reaction (RT-PCR) method, amplify tethelin mature peptide cDNA, order-checking determines that its sequence with expection is consistent;

[2] make up the yeast saccharomyces cerevisiae conversion carrier:

With lefteye flounder tethelin mature peptide cDNA, behind BamH I and Not I double digestion, be connected into escherichia coli plasmid pUC-PGK, make up conversion carrier pIPGK-GH, escherichia coli plasmid pUC-PGK is to be initial carrier with pUC18, be connected into URA3 gene upstream sequence, PGK promoter sequence, tryptophane gene order and URA3 gene downstream sequence successively and make up and form in its multiple clone site, order-checking determines that growth hormone cDNA sequence, PGK promoter sequence and URA3 sequence are all consistent with the sequence of expecting;

[3] the lefteye flounder growth hormone gene is transformed in the yeast saccharomyces cerevisiae:

Conversion carrier pIPGK-GH reclaims the linear fragment that obtains to contain the lefteye flounder growth hormone gene after Nco I enzyme is cut, this linear fragment is coated on the brewing yeast cell that transforms the tryptophane defective type then and selects on the substratum by the method transformed saccharomyces cerevisiae competent cell of LiAc mediation;

The positive colony that the tryptophane defective type is selected to grow on the substratum carries out the PCR evaluation, with the yeast saccharomyces cerevisiae that the contains growth hormone gene continuous passage on the YPD substratum that filters out, the yeast saccharomyces cerevisiae mono-clonal of selecting the growth hormone gene stable existence carries out large scale culturing;

[4] cultivation of transgenic yeast containing flounder growth hormone gene:

Transgenic yeast containing flounder growth hormone gene is in shaking or fermentation culture in the YPD liquid nutrient medium under 20-30 ℃, and the YPD culture medium prescription is as follows:

Amounts of components (g/L)

Yeast extract 10

Peptone 20

Glucose 20

Transgenic yeast containing flounder growth hormone gene is in fodder additives of culturing fishes in bothid and true plaice or the application in the feed.

The evaluation of transgenic yeast containing flounder growth hormone gene:

Extract the genomic dna of transgenic yeast containing flounder growth hormone gene, carry out enzyme with EcoR I and Bgl I respectively and cut, carry out Southern hybridization with lefteye flounder growth hormone cDNA probe then, confirm that the growth hormone gene recombination and integration is in genes of brewing yeast group DNA.

The Western hybridization that lefteye flounder tethelin is expressed in yeast saccharomyces cerevisiae detects:

Picking changeed lefteye flounder tethelin yeast saccharomyces cerevisiae list bacterium colony, under 20-30 ℃ in the YPD liquid nutrient medium shaking culture 2-5 days.Collect transgenic yeast, centrifugal behind the smudge cells, get supernatant and carry out the SDS-PAGE electrophoresis, after electrophoresis finishes, hybridize with the anti-fGH antiserum(antisera) of rabbit after polyacrylamide gel changeed film, confirm that lefteye flounder tethelin expresses in yeast saccharomyces cerevisiae.

Express the lyophilize of lefteye flounder tethelin yeast saccharomyces cerevisiae:

Express lefteye flounder tethelin yeast saccharomyces cerevisiae in refrigerated centrifuge with 4 ℃, 5000-20000g, the centrifugal collection of the condition of 1-10min, the sample of collecting is freezing to-40 ℃ with the speed of 1 ℃/min, change lyophilize in the freeze drier of prior precooling then over to, in cryodesiccated last two hours, heated sample to 23 is ℃ to reduce residual moisture content.

Compared with prior art, the invention has the advantages that: the present invention has obtained transgenic yeast containing flounder growth hormone gene, lefteye flounder tethelin is expressed in yeast saccharomyces cerevisiae, and this yeast saccharomyces cerevisiae is promoting to have significant effect aspect fishes in bothid and true plaice growth, the raising bait transformation efficiency.And yeast saccharomyces cerevisiae itself can be used as the feed of fish, and therefore the yeast saccharomyces cerevisiae of the expression tethelin that obtains does not need purifying, produces easily, and cost is lower, can be directly used in the growth promoter and the fodder additives of preparation fishes in bothid and true plaice (containing parent population and seed).

The transgenic yeast containing flounder growth hormone gene of the present invention preparation is at the URA3 of yeast saccharomyces cerevisiae gene locus, in the mode of homologous recombination the lefteye flounder growth hormone gene is incorporated on the genome of yeast saccharomyces cerevisiae, so it can be along with going down to posterity of cell stable existence.In the process that goes down to posterity in 50 generations of carrying out in the laboratory, the lefteye flounder growth hormone gene is stable existence still, does not lose phenomenon, and this is for producing in the future and safety issue of application provides guarantee.

The transgenic yeast containing flounder growth hormone gene of the present invention's preparation adopts phosphoglycerokinase gene (PGK) promotor to start the expression of tethelin.The PGK promotor is a kind of yeast saccharomyces cerevisiae composing type strong promoter, need not the continual and steady expression that inductive condition can be realized foreign protein in the expression process, and the amount that obtains the tethelin of expressing with yeast saccharomyces cerevisiae is 734ng/ml, and expression amount is 1.93 ‰.

The transgenic yeast containing flounder growth hormone gene of the present invention's preparation is promoting to have significant effect aspect lefteye flounder growth, the raising bait transformation efficiency.Show as the throw something and feed experimental result in 7 weeks of lefteye flounder of fodder additives with transgenic yeast containing flounder growth hormone gene, transgenic yeast can significantly promote the lefteye flounder growth at 0.5% and 1.0% addition, the two body weight is compared respectively according to improving 31.21% and 50.24%, and the bait transformation efficiency improves 26.15% and 32.07% than control group.Proved that transgenic yeast containing flounder growth hormone gene has tangible growth promoting function to lefteye flounder.

The transgenic yeast containing flounder growth hormone gene safety non-toxic of the present invention's preparation.With the mouse is experimental subjects, by to the per os acute toxicity of transgenic yeast containing flounder growth hormone gene, traditional teratology testing, marrow micronucleus test and teratospermia inspection, finds the per os LD of transgenic yeast containing flounder growth hormone gene ₅₀＞10g/kg; Transgenic yeast grows to pregnant mouse reproduction function and tire mouse and can not exert an influence, and the tire mouse is not had teratogenesis; Mouse Bone marrow cells micronucleus and teratospermia there is not inducing action.

The transgenic yeast containing flounder growth hormone gene of the present invention's preparation is a kind of feed of fishes in bothid and true plaice safely and effectively or fodder additives, has bigger using value in culture fishery.

Description of drawings

Fig. 1 is the structure schema of carrier pIPGK-GH;

Fig. 2 is the Southern hybridization detected result figure of transgenic yeast containing flounder growth hormone gene;

The Western hybridization detected result figure that Fig. 3 expresses in yeast saccharomyces cerevisiae for lefteye flounder tethelin.

The preservation date of transgenic yeast containing flounder growth hormone gene (Saccharomyces cerevisiae YGH):

On April 30th, 2008;

The title of depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center;

Address: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica;

Be called for short: CGMCC;

Deposit number: 2478.

Embodiment

The present invention is further detailed explanation below in conjunction with the drawings and specific embodiments.

Embodiment 1: the preparation of transgenic yeast containing flounder growth hormone gene:

[1] preparation of lefteye flounder growth hormone cDNA:

Extract the total RNA of lefteye flounder pituitary gland, design contains primer ping1 and the ping2 of restriction enzyme site BamH I and Not I, nucleotide sequence shown in No. 5 sequence of ping1 primer sequence and sequence table has 100% homology, nucleotide sequence shown in No. 6 sequence of ping2 primer sequence and sequence table has 100% homology, adopt reverse transcriptase polymerase chain reaction (RT-PCR) method, amplify the lefteye flounder growth hormone cDNA, order-checking determines that its sequence with expection is consistent.

[2] make up the yeast saccharomyces cerevisiae conversion carrier:

With lefteye flounder tethelin mature peptide cDNA, behind BamH I and Not I double digestion, be connected into escherichia coli plasmid pUC-PGK, make up conversion carrier pIPGK-GH.Escherichia coli plasmid pUC-PGK is to be initial carrier with pUC18, is connected into URA3 gene upstream sequence, PGK promoter sequence, tryptophane gene order and URA3 gene downstream sequence successively and makes up and to form in its multiple clone site.Growth hormone cDNA sequence, PGK promoter sequence and URA3 sequence are determined in order-checking, and all the sequence with expection is consistent.

[3] the lefteye flounder growth hormone gene is transformed in the yeast saccharomyces cerevisiae:

Conversion carrier pIPGK-GH reclaims the linear fragment that obtains to contain the lefteye flounder growth hormone gene after Nco I enzyme is cut, this linear fragment is by the method transformed saccharomyces cerevisiae competent cell of LiAc mediation, and the method for transformation of LiAc mediation is as follows:

(1) picking yeast mono-clonal is in 5ml YPD substratum, and 30 ℃ of shaking culture are spent the night;

(2) next day, survey OD ₆₀₀, with final OD ₆₀₀=0.4 cell density inoculation 5ml YPD nutrient solution continues to cultivate 2-4 hour;

(3) centrifugal collection yeast cell, 1.5mL/ pipe, 2500rpm, 5min.With centrifugal again collection after the sterilized water suspension;

(4) abandon water, every pipe adds 50 μ L LiAc (100mM);

(5) centrifugal collecting cell adds conversion mixed solution (adding in the following order)

20μL PEG(50％w/v)

36μL 1M?LiAc

25 μ L single-stranded vector DNA (2mg/mL)

50 μ L external source fragments (0.1-10 μ g)

Thermal agitation 1min;

(6) 30 ℃ of insulation 30min;

(7) 42 ℃ of incubation 20-25min;

(8) centrifugal collection transformant, 6000-8000rpm, 15S.Abandon the conversion mixed solution;

(9) add the 0.2-1mL sterilized water, suspend gently;

(10) per 200 μ L are coated on the tryptophane defective type selection substratum (the MinimalDextrose Plates that does not add tryptophane);

The Minimal Dextrose Plates prescription that does not add tryptophane is as follows:

Amounts of components (g/L)

YNB 6.7

Glucose 20

Leucine 0.1

Agar 15

(11) positive colony that will select to grow on the substratum carries out PCR and identifies;

The yeast saccharomyces cerevisiae that contains growth hormone gene that (12) will filter out continuous passage 3 times on the YPD substratum;

(13) the yeast saccharomyces cerevisiae mono-clonal of selecting the growth hormone gene stable existence carries out large scale culturing.

[4] cultivation of transgenic yeast containing flounder growth hormone gene:

Transgenic yeast containing flounder growth hormone gene is in vibrating or fermentation culture in the YPD liquid nutrient medium under 20-30 ℃.The YPD culture medium prescription is as follows:

Amounts of components (g/L)

Yeast extract 10

Peptone 20

Glucose 20

Embodiment 2: the evaluation of transgenic yeast containing flounder growth hormone gene:

The Southern hybridization in the genes of brewing yeast group DNA of lefteye flounder growth hormone gene recombination and integration detects:

Extract the genomic dna of transgenic yeast containing flounder growth hormone gene, carry out enzyme with EcoR I and BglI respectively and cut, the lefteye flounder growth hormone cDNA is carried out digoxigenin labeled make probe, carry out Southern hybridization then.The result as shown in Figure 2, wherein, M: λ/EcoRI+HindIII; 1: the genomic dna of unconverted yeast saccharomyces cerevisiae (enzyme is not cut); The genomic dna of the unconverted yeast saccharomyces cerevisiae that 2:EcoR I enzyme is cut; The genomic dna of the unconverted yeast saccharomyces cerevisiae that 3:Bgl I enzyme is cut; 4: the genomic dna of transformed saccharomyces cerevisiae (enzyme is not cut); The genomic dna of the transformed saccharomyces cerevisiae that 5:EcoR I enzyme is cut; The genomic dna of the transformed saccharomyces cerevisiae that 6:Bgl I enzyme is cut; 7: the Southern results of hybridization of the genomic dna of unconverted yeast saccharomyces cerevisiae (enzyme is not cut); The Southern results of hybridization of the genomic dna of the unconverted yeast saccharomyces cerevisiae that 8:EcoR I enzyme is cut; The Southern results of hybridization of the genomic dna of the unconverted yeast saccharomyces cerevisiae that 9:Bgl I enzyme is cut; 10: the Southern results of hybridization of the genomic dna of transformed saccharomyces cerevisiae (enzyme is not cut); The Southern results of hybridization of the genomic dna of the transformed saccharomyces cerevisiae that 11:EcoR I enzyme is cut; The Southern results of hybridization of the genomic dna of the transformed saccharomyces cerevisiae that 12:Bgl I enzyme is cut.The result shows: no matter the genomic dna of transgenic yeast containing flounder growth hormone gene is to cut or do not cut through enzyme through enzyme, can react with probe, demonstrates the hybridization band; And the genomic dna of unconverted yeast saccharomyces cerevisiae and probe can not react, the amixia signal.Confirm that the lefteye flounder growth hormone gene is incorporated on the genomic dna of yeast saccharomyces cerevisiae by homologous recombination.

Embodiment 3: the Detection of Stability of lefteye flounder growth hormone gene in yeast saccharomyces cerevisiae:

The yeast saccharomyces cerevisiae that will contain the lefteye flounder growth hormone gene is coated on the MinimalDextrose Plates solid medium that does not add tryptophane, after treating that bacterium colony is longer, 2 of random chooses are cloned on the Minimal Dextrose Plates solid medium that does not add tryptophane streak culture; After treating that bacterium colony is longer, 2 of random chooses are cloned on the YPD solid medium streak culture again ... so continuous biography is after 50 generations, 10 bacterium colonies of random choose carry out the PCR detection again, all there is specific band to clone out, the result shows that the lefteye flounder growth hormone gene is a stable existence, can not lose along with going down to posterity of cell in yeast saccharomyces cerevisiae.

Embodiment 4: express the lyophilize of lefteye flounder tethelin yeast saccharomyces cerevisiae:

Express lefteye flounder tethelin yeast saccharomyces cerevisiae in refrigerated centrifuge with 4 ℃, 10000g, the centrifugal collection of the condition of 10min, the sample of collecting is freezing to-40 ℃ with the speed of 1 ℃/min, change lyophilize in the freeze drier of prior precooling then over to, in cryodesiccated last two hours, heated sample to 23 is ℃ to reduce residual moisture content.

Embodiment 5: the Western hybridization that lefteye flounder tethelin is expressed in yeast saccharomyces cerevisiae detects:

Picking transgenic yeast containing flounder growth hormone gene list bacterium colony was under 20-30 ℃ in the YPD liquid nutrient medium shaking culture 2-5 days.Collect transgenic yeast, centrifugal behind the smudge cells, get supernatant and carry out the SDS-PAGE electrophoresis, after electrophoresis finishes, hybridize with the anti-fGH antiserum(antisera) of rabbit after polyacrylamide gel changeed film.The result as shown in Figure 3, wherein, M: molecular weight of albumen standard; 1,2: unconverted yeast saccharomyces cerevisiae; 3,4: transformed saccharomyces cerevisiae; 5,6: the Western results of hybridization of unconverted yeast saccharomyces cerevisiae; 7,8: the Western results of hybridization of transformed saccharomyces cerevisiae.The result shows: transgenic yeast shows the hybridization band at the 19kD place, and transgenic yeast does not have the appearance of this hybridization band.Confirm that lefteye flounder tethelin has passed through abduction delivering in yeast saccharomyces cerevisiae.

Embodiment 6: the mensuration of lefteye flounder tethelin expression amount in yeast saccharomyces cerevisiae:

Adopt euzymelinked immunosorbent assay (ELISA) (ELISA method), the pure product bag of tethelin by elisa plate, is added one anti----the anti-fGH antibody of rabbit and the two resists---goat anti-rabbit igg of horseradish peroxidase-labeled then successively, OD is measured in the colour developing back ₄₉₂, according to the concentration gradient and the OD of the pure product of tethelin ₄₉₂Concern the drawing standard curve.

The lefteye flounder tethelin product of expressing in the yeast is carried out ELISA to be detected.Collect the yeast of 0.5OD, 10mL, centrifugal collecting precipitation, and pair cell carries out cracking, is 0.381mg/ml with protein content in the albumen suspension after the cracking of Lowry-Kalokar formula calculating transgenic yeast.OD with transgenic yeast YGH ₄₉₂Value (2.93) deducts the not OD of transgenic yeast ₄₉₂Be worth (0.77), be the OD492 value (2.16) of the tethelin correspondence of in yeast saccharomyces cerevisiae, expressing, corresponding typical curve, the amount of finding the tethelin of 2.16 correspondences is 734ng/ml.

In view of the above, the amount that draws yeast saccharomyces cerevisiae YGH total protein and be the tethelin of expressing under the 0.381mg/ml concentration is 734ng/ml, and expression amount is 1.93 ‰.

Embodiment 7: the yeast saccharomyces cerevisiae of expressing lefteye flounder tethelin is grown and Biochemical and Physiological Effect to lefteye flounder:

The yeast saccharomyces cerevisiae of lefteye flounder growth hormone gene and transgenic yeast are not changeed in respectively centrifugal collection, add in the normal diet of fishes in bothid and true plaice according to 0.5% transgenic yeast (w/w) and 1% transgenic yeast (w/w) after the lyophilize, the normal diet that does not add yeast saccharomyces cerevisiae is set simultaneously organizes in contrast, and establish one group of repetition.

Buy 60 of Paralichthys olivaceus, be divided into 6 cylinders at random, 10/cylinder, culture condition is as follows: 23 ℃, ventilation in 24 hours, water 24 hours circulation was changed the water in the fish jar once in per three days fully, every day, feeding twice, and feeding is as the criterion not stay residual bait, calculates food ration during each feeding.After fish is bought back, under laboratory condition, raised and train 10 days earlier, when all fishes all begin to take food, begin experiment.Be 7 weeks whole experimental period, surveyed body weight in per 5 days, body is long and body is wide.

Through the experiment in 7 weeks, the body weight gain of 0.5% and 1.0% transgenic yeast group fish has improved 31.21% and 50.24% than commercial feed control group respectively.The comparison of its food ration of the lefteye flounder of transgenic yeast increases to some extent according to fish although throw something and feed, and there is not significant difference (P＞0.05) in statistical results show between the two.The bait transformation efficiency of two experimental group all is significantly improved (being respectively 26.15% and 32.07%) (P＜0.05) than control group, and the bait transformation efficiency of 1.0% transgenic yeast group is significantly higher than the transformation efficiency of 0.5% transgenic yeast interpolation group.

Embodiment 8: the biological safety of expressing lefteye flounder tethelin yeast saccharomyces cerevisiae detects

Select SPF level (cleaning level) Kunming mouse at experimentation on animals center, Qingdao City for use, body weight 20 ± 2g, credit number: SCXK (Shandong) 20030010.After the precuring 5 days, select healthy mice and carry out per os studies on acute toxicity, Study on Teratogenic, the research of marrow micronucleus inducing action, the research of teratospermia inducing action.

The result shows: in the week age after mouse is irritated stomach, each is organized mouse and ingests with movable normal, does not show toxicity symptom, and each group does not all have dead mouse.Show that transgenic yeast containing flounder growth hormone gene does not have toxicity, LD to mouse ₅₀Greater than 10g/kg.According to the grade scale of China to chemical dangerous product, transgenic yeast containing flounder growth hormone gene belongs to actual non-toxic substance.

In expressing of the research of lefteye flounder tethelin yeast saccharomyces cerevisiae to maternal toxicity, embryotoxicity and the teratogenecity of mouse, weigh and statistical results show in the body weight gain of a plurality of time points of pregnancy duration by each being organized female mouse, transgenic yeast containing flounder growth hormone gene is to the not influence of pregnant mouse body weight, and body weight of three pregnant mouse of transgenic yeast group and control group more all do not have significant difference (P＞0.05).Irritate the female mouse that feeds 0.5g/kg, 2.0g/kg and 10.0g/kg transgenic yeast, its reproduction function and control group do not have difference, and its bearing capacity and the viviparous productive rate of living are not affected.Irritate three groups of female mouse that feed transgenic yeast and all do not give birth to stillborn foetus.The quantity of irritating the average every nest production of the female mouse that feeds transgenic yeast tire mouse alive does not have difference with the female mouse of contrast.The female-male proportion that the female mouse of control group, 0.5g/kg, 2.0g/kg and 10.0g/kg transgenic yeast group produces the tire mouse was respectively 1: 1.0,1: 0.9,1: 1.1 and 1: 1.1, relatively there is not significant difference between group, show that transgenic yeast can not exert an influence to mouse offspring sex ratio.It is long and tail is long does not relatively have significant difference (P＞0.05) with control group tire mouse that the female mouse of three transgenic yeast groups produces body weight, the body of tire mouse, and the placental weight of four groups of tire mouse does not have difference yet.Irritate three groups of female mouse that feed 0.5g/kg, 2.0g/kg and 10.0g/kg transgenic yeast and all do not produce abnormal phenomenon, also do not give birth to the monster mouse, outward appearance and the physiological activity of four groups of mouse are acted normally.Bone to the tire mouse that lives checks that the vertebra of four groups of tire mouse, rib and breastbone all do not produce number and deformity in shape, and its skull and bones of limbs and basin bone etc. also shows normal morphology.Tire mouse internal organs deformity check result shows, the transgenic yeast containing flounder growth hormone gene of ingesting does not have detrimentally affect to tire rat tissue organ, and female mouse of irritating hello transgenic yeast produces the tire mouse and has normal oblongata, spinal cord, tongue, eye, the heart, lung, oesophagus and digestion and urogenital organ.

2.0g/kg, bone marrow cell micronucleus rate and the negative control group of 5.0g/kg and 10.0g/kg transgenic yeast group mouse more all do not have marked difference (P＞0.05), and do not show dosage-effect relation, illustrate that transgenic yeast to mouse Bone marrow cells micronucleus inducing action takes place not have.

Sperm to mouse is discovered, irritates the mouse that feeds 2.0g/kg, 5.0g/kg and 10.0g/kg transgenic yeast, and its teratospermia quantity and water control group do not have significant difference (P＞0.05), do not have tangible dosage-reaction relation yet.Show that transgenic yeast does not have inducing action to mouse sperm deformity, find no the folding teratospermia of double end, two tail and tail.

By acute toxicity test in mice, traditional teratogenicity test, marrow micronucleus and sperm malformation test, prove that transgenic yeast containing flounder growth hormone gene can not produce teratogenesis and mutagenesis to mouse, be a kind of safe transgenosis feed or fodder additives.

Certainly; above-mentioned explanation is not to be limitation of the present invention; the present invention also is not limited in above-mentioned giving an example, and variation, remodeling, interpolation or replacement that those skilled in the art are made in essential scope of the present invention also should belong to protection scope of the present invention.

Sequence table

＜110〉Chinese Marine University

＜120〉transgenic yeast containing flounder growth hormone gene and its production and application

<160>6

<170>

<210>1

<211>525

<212>DNA

＜213〉lefteye flounder growth hormone cDNA (cDNA of Growth hormone of Paralichthys

olivaceous)

<220>

<221>CDS

<222>(1)…(522)

<223>

<400>1

1 ATGCAGCCAA?TCACAGAGAA?CCAGCGCCTG?TTCTCCATCG?CTGTTGGTCG?AGTTCAGTAT

61 CTTCACCTGG?TTGCTAAGAA?ACTCTTCAGT?GACTTTGAGA?ACTCACTACA?GTTGGAGGAT

121 CAACGTCTTC?TCAACAAAAT?CGCTTCAAAA?GAATTTTGTC?ATTCAGATAA?TTTCTTGAGT

181 CCGATCGACA?AACACGAGAC?ACAAGGCAGC?TCAGTTCAGA?AGCTTTTATC?GGTCTCTTAT

241 CGATTGATTG?AGTCCTGGGA?GTTTTTCAGT?CGCTTCCTGG?TCGCAAGTTT?TGCTGTGAGG

301 ACCCAGGTTA?CATCCAAACT?GTCAGAACTG?AAGATGGGTC?TCCTGAAGCT?GATAGAGGCC

361 AATCAGGATG?GAGCAGGTGG?ATTCTCTGAG?AGTTCGGTGC?TCCAGCTCAC?GCCGTATGGA

421 AACTCTGAAC?TGTTCGCCTG?CTTTAAGAAG?GATATGCACA?AGGTGGAGAC?GTACCTGACC

481 GTGGCCAAAT?GCCGACTCTT?TCCAGAAGCT?AACTGCACCC?TGTAG

<210>2

<211>174

<212>PRT

＜213〉recombinant large-tooth flounder tethelin (recombinant Growth hormone of Paralichthys

olivaceous)

<400>2

1 MET?Gln?Pro?Ile?Thr?Glu?Asn?Gln?Arg?Leu?Phe?Ser?Ile?Ala?Val

16 Gly?Arg?Val?Gln?Tyr?Leu?His?Leu?Val?Ala?Lys?Lys?Leu?Phe?Ser

31 Asp?Phe?Glu?Asn?Ser?Leu?Gln?Leu?Glu?Asp?Gln?Arg?Leu?Leu?Asn

46 Lys?Ile?Ala?Ser?Lys?Glu?Phe?Cys?His?Ser?Asp?Asn?Phe?Leu?Ser

61 Pro?Ile?Asp?Lys?His?Glu?Thr?Gln?Gly?Ser?Ser?Val?Gln?Lys?Leu

76 Leu?Ser?Val?Ser?Tyr?Arg?Leu?Ile?Glu?Ser?Trp?Glu?Phe?Phe?Ser

91 Arg?Phe?Leu?Val?Ala?Ser?Phe?Ala?Val?Arg?Thr?Gln?Val?Thr?Ser

106 Lys?Leu?Ser?Glu?Leu?Lys?Met?Gly?Leu?Leu?Lys?Leu?Ile?Glu?Ala

121 Asn?Gln?Asp?Gly?Ala?Gly?Gly?Phe?Ser?Glu?Ser?Ser?Val?Leu?Gln

136 Leu?Thr?Pro?Tyr?Gly?Asn?Ser?Glu?Leu?Phe?Ala?Cys?Phe?Lys?Lys

151 Asp?Met?His?Lys?Val?Glu?Thr?Tyr?Leu?Thr?Val?Ala?Lys?Cys?Arg

166 Leu?Phe?Pro?Glu?Ala?Asn?Cys?Thr?Leu

<210>3

<211>1490

<212>DNA

＜213〉yeast saccharomyces cerevisiae PGK promotor (promoter of PGK of Saccharomyces cerevisiae)

<400>3

1 AAGCTTTCTA?ACTGATCTAT?CCAAAACTGA?AAATTACATT?CTTGATTAGG?TTTATCACAG

61 GCAAATGTAA?TTTGTGGTAT?TTTGCCGTTC?AAAATCTGTA?GAATTTTCTC?ATTGGTCACA

121 TTACAACCTG?AAAATACTTT?ATCTACAATC?ATACCATTCT?TATAACATGT?CCCCTTAATA

181 CTAGGATCAG?GCATGAACGC?ATCACAGACA?AAATCTTCTT?GACAAACGTC?ACAATTGATC

241 CCTCCCCATC?CGTTATCACA?ATGACAGGTG?TCATTTTGTG?CTCTTATGGG?ACGATCCTTA

301 TTACCGCTTT?CATCCGGTGA?TAGACCGCCA?CAGAGGGGCA?GAGAGCAATC?ATCACCTGCA

361 AACCCTTCTA?TACACTCACA?TCTACCAGTG?TACGAATTGC?ATTCAGAAAA?CTGTTTGCAT

421 TCAAAAATAG?GTAGCATACA?ATTAAAACAT?GGCGGGCACG?TATCATTGCC?CTTATCTTGT

481 GCAGTTAGAC?GCGAATTTTT?CGAAGAAGTA?CCTTCAAAGA?ATGGGGTCTC?ATCTTGTTTT

541 GCAAGTACCA?CTGAGCAGGA?TAATAATAGA?AATGATAATA?TACTATAGTA?GAGATAACGT

601 CGATGACTTC?CCATACTGTA?ATTGCTTTTA?GTTGTGTATT?TTTAGTGTGC?AAGTTTCTGT

661 AAATCGATTA?ATTTTTTTTT?CTTTCCTCTT?TTTATTAACC?TTAATTTTTA?TTTTAGATTC

721 CTGACTTCAA?CTCAAGACGC?ACAGATATTA?TAACATCTGC?ACAATAGGCA?TTTGCAAGAA

781 TTACTCGTGA?GTAAGGAAAG?AGTGAGGAAC?TATCGCATAC?CTGCATTTAA?AGATGCCGAT

841 TTGGGCGCGA?ATCCTTTATT?TTGGCTTCAC?CCTCATACTA?TTATCAGGGC?CAGAAAAAGG

901 AAGTGTTTCC?CTCCTTCTTG?AATTGATGTT?ACCCTCATAA?AGCACGTGGC?CTCTTATCGA

961 GAAAGAAATT?ACCGTCGCTC?GTGATTTGTT?TGCAAAAAGA?ACAAAACTGA?AAAAACCCAG

1021 ACACGCTCGA?CTTCCTGTCT?TCCTATTGAT?TGCAGCTTCC?AATTTCGTCA?CACAACAAGG

1081 TCCTAGCGAC?GGCTCACAGG?TTTTGTAACA?AGCAATCGAA?GGTTCTGGAA?TGGCGGGAAA

1141 GGGTTTAGTA?CCACATGCTA?TGATGCCCAC?TGTGATCTCC?AGAGCAAAGT?TCGTTCGATC

1201 GTACTGTTAC?TCTCTCTCTT?TCAAACAGAA?TTGTCCGAAT?CGTGTGACAA?CAACAGCCTG

1261 TTCTCACACA?CTCTTTTCTT?CTAACCAAGG?GGGTGGTTTA?GTTTAGTAGA?ACCTCGTGAA

1321 ACTTACATTT?ACATATATAT?AAACTTGCAT?AAATTGGTCA?ATGCAAGAAA?TACATATTTG

1381 GTCTTTTCTA?ATTCGTAGTT?TTTCAAGTTC?TTAGATGCTT?TCTTTTTCTC?TTTTTTACAG

1441 ATCATCAAGG?AAGTAATTAT?CTACTTTTTA?GTAATTATCT?ACTTTTTYMC

<210>4

<211>807

<212>DNA

＜213〉yeast saccharomyces cerevisiae URA3 gene (URA3 of Saccharomyces cerevisiae)

<400>4

1 TAAATCATGT?CGAAAGCTAC?ATATAAGGAA?CGTGCTGCTA?CTCATCCTAG?TCCTGTTGCT

61 CAAGCTATTT?AATATCATGC?ACGAAAAGCA?AACAAACTTG?TGTGCTTCAT?TGGATGTTCG

121 TACCACCAAG?GAATTACTGG?AGTTAGTTGA?AGCATTAGGT?CCCAAAATTT?GTTTACTAAA

181 AACACATGTG?GATATCTTGA?CTGATTTTTC?CATGGAGGGC?ACAGTTAAGC?CGCTAAAGGC

241 ATTATCCGCC?AAGTACAATT?TTTTACTCTT?CGAAGACAGA?AAATTTGCTG?ACATTGGTAA

301 TACAGTCAAA?TTGCAGTACT?CTGCGGGTGT?ATACAGAATA?GCAGAATGGG?CAGACATTAC

361 GAATGCACAC?GGTGTGGTGG?GCCCAGGTAT?TGTTAGCGGT?TTGAAGCAGG?CGGCGGAAGA

421 AGTAACAAAG?GAACCTAGAG?GCCTTTTGAT?GTTAGCAGAA?TTGTCATGCA?AGGGCTCCCT

481 AGCTACTGGA?GAATATACTA?AGGGTACTGT?TGACATTGCG?AAGAGCGACA?AAGATTTTGT

541 TATCGGCTTT?ATTGCTCAAA?GAGACATGGG?TGGAAGAGAT?GAAGGTTACG?ATTGGTTGAT

601 TATGACACCC?GGTGTGGGTT?TAGATGACAA?GGGAGACGCA?TTGGGTCAAC?AGTATAGACC

661 GTGGATGATG?TGGTCTCTAC?AGGATCTGAC?ATTATTATTG?TTGGAAGAGG?ACTATTTGCA

721 AAGGGAAGGG?ATGCTAAGGT?AGAGGGTGAA?CGTTACAGAA?AAGCAGGCTG?GGAAGCATAT

781 TTGAGAAGAT?GCGGCCAGCA?AAACTAA

<210>5

<211>30

<212>DNA

＜213〉lefteye flounder growth hormone cDNA (cDNA of Growth hormone of Paralichthys

olivaceous)

<400>5

CGGGATCCATGCAGCCAATCACAGAGAACC

<210>6

<211>34

<212>DNA

＜213〉lefteye flounder growth hormone cDNA (cDNA of Growth hormone of Paralichthys

olivaceous)

<400>6

ATAAGAATGCGGCCGCCTACAGGGTGCAGTTAGC

Claims (10)

1. transgenic yeast containing flounder growth hormone gene, it is characterized in that: described transgenic yeast changes the lefteye flounder growth hormone gene in the yeast saccharomyces cerevisiae over to and obtains.

2. transgenic yeast containing flounder growth hormone gene according to claim 1 is characterized in that: described transgenic yeast is expressed lefteye flounder tethelin, and by Chinese microorganism strain preservation center preservation, preserving number is this transgenic yeast: CGMCC No.2478.

3. transgenic yeast containing flounder growth hormone gene according to claim 1 is characterized in that: described yeast saccharomyces cerevisiae is the synthetic defective type of Saccharomyces cerevisiae tryptophane.

4. transgenic yeast containing flounder growth hormone gene according to claim 1 and 2, it is characterized in that: described lefteye flounder growth hormone gene is lefteye flounder tethelin mature peptide cDNA, the nucleotide fragments that contains 525bp has 100% homology with nucleotide sequence shown in No. 1 sequence of sequence table.

5. transgenic yeast containing flounder growth hormone gene according to claim 2, it is characterized in that: the lefteye flounder tethelin that described transgenic yeast is expressed is lefteye flounder tethelin mature peptide, 174 amino-acid residues of encoding, its molecular weight is 19KDa, and the aminoacid sequence shown in No. 2 sequence of its aminoacid sequence and sequence table has 100% homology.

6. transgenic yeast containing flounder growth hormone gene according to claim 4, it is characterized in that: it is by with lefteye flounder growth hormone gene carrier construction pIPGK-GH that described lefteye flounder growth hormone gene changes in the yeast saccharomyces cerevisiae, transformed saccharomyces cerevisiae obtains transgenic yeast Saccharomyces cerevisiae YGH.

7. transgenic yeast containing flounder growth hormone gene according to claim 6, it is characterized in that: among the described carrier pIPGK-GH, the front end of lefteye flounder growth hormone cDNA is the promotor of the PGK (phosphoglycerokinase gene) of yeast saccharomyces cerevisiae, start the expression of lefteye flounder tethelin by the PGK promotor, the long 1490bp of PGK promotor has 100% homology with the nucleotide sequence shown in No. 3 sequence of sequence table.

8. transgenic yeast containing flounder growth hormone gene according to claim 6, it is characterized in that: among the described carrier pIPGK-GH, the both sides of growth hormone gene expression cassette are the URA3 gene of yeast saccharomyces cerevisiae, with the URA3 gene as with the site of the genomic dna generation homologous recombination of yeast saccharomyces cerevisiae, URA3 gene length 807bp has 100% homology with the nucleotide sequence shown in No. 4 sequence of sequence table.

9. the preparation method of transgenic yeast containing flounder growth hormone gene according to claim 1 is characterized in that having following steps:

[1] preparation of lefteye flounder growth hormone cDNA:

Extract the total RNA of lefteye flounder pituitary gland, design contains primer ping1 and the ping2 of restriction enzyme site BamH I and Not I, nucleotide sequence shown in No. 5 sequence of ping1 primer sequence and sequence table has 100% homology, nucleotide sequence shown in No. 6 sequence of ping2 primer sequence and sequence table has 100% homology, adopt reverse transcriptase polymerase chain reaction (RT-PCR) method, amplify tethelin mature peptide cDNA, order-checking determines that its sequence with expection is consistent;

[2] make up the yeast saccharomyces cerevisiae conversion carrier:

With lefteye flounder tethelin mature peptide cDNA, behind BamH I and Not I double digestion, be connected into escherichia coli plasmid pUC-PGK, make up conversion carrier pIPGK-GH, escherichia coli plasmid pUC-PGK is to be initial carrier with pUC18, be connected into URA3 gene upstream sequence, PGK promoter sequence, tryptophane gene order and URA3 gene downstream sequence successively and make up and form in its multiple clone site, order-checking determines that growth hormone cDNA sequence, PGK promoter sequence and URA3 sequence are all consistent with the sequence of expecting;

[3] the lefteye flounder growth hormone gene is transformed in the yeast saccharomyces cerevisiae:

Conversion carrier pIPGK-GH reclaims the linear fragment that obtains to contain the lefteye flounder growth hormone gene after Nco I enzyme is cut, this linear fragment is coated on the brewing yeast cell that transforms the tryptophane defective type then and selects on the substratum by the method transformed yeast competent cell of LiAc mediation;

The positive colony that the tryptophane defective type is selected to grow on the substratum carries out the PCR evaluation, with the yeast saccharomyces cerevisiae that the contains growth hormone gene continuous passage on the YPD substratum that filters out, the yeast saccharomyces cerevisiae mono-clonal of selecting the growth hormone gene stable existence carries out large scale culturing;

[4] cultivation of transgenic yeast containing flounder growth hormone gene:

Transgenic yeast containing flounder growth hormone gene is in shaking or fermentation culture in the YPD liquid nutrient medium under 20-30 ℃, and the YPD culture medium prescription is as follows:

Amounts of components (g/L)

Yeast extract 10

Peptone 20

Glucose 20

10. transgenic yeast containing flounder growth hormone gene is in fodder additives of culturing fishes in bothid and true plaice or the application in the feed.

Images