CN101262889B - Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine - Google Patents

Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine Download PDF

Info

Publication number
CN101262889B
CN101262889B CN2006800333268A CN200680033326A CN101262889B CN 101262889 B CN101262889 B CN 101262889B CN 2006800333268 A CN2006800333268 A CN 2006800333268A CN 200680033326 A CN200680033326 A CN 200680033326A CN 101262889 B CN101262889 B CN 101262889B
Authority
CN
China
Prior art keywords
group
active substance
hydroxyalkyl starch
reaction
amino
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2006800333268A
Other languages
Chinese (zh)
Other versions
CN101262889A (en
Inventor
N·赞德
H·诺尔勒
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
FREZENEWSKABUE GERMANY Co Ltd
Original Assignee
FREZENEWSKABUE GERMANY Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by FREZENEWSKABUE GERMANY Co Ltd filed Critical FREZENEWSKABUE GERMANY Co Ltd
Publication of CN101262889A publication Critical patent/CN101262889A/en
Application granted granted Critical
Publication of CN101262889B publication Critical patent/CN101262889B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
    • C08B31/00—Preparation of derivatives of starch
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/61—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule the organic macromolecular compound being a polysaccharide or a derivative thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes

Abstract

The present invention relates to a method for preparing conjugates of an active substance and hydroxy alkyl starch and to conjugates of an active substance and hydroxyalkyl starch, preferably hydroxy ethyl starch, wherein the conjugates are prepared by covalently linking the hydroxyalkyl starch and the active substance by a chemical residue having a structure according to formula (I) (I') (I'') wherein R1, R2, R2', R3, R3'and R4 are independently selected from the group consisting of hydrogen, an optionally suitably substituted, linear, cyclic and/or branched alkyl, aryl, heteroaryl, aralkyl,and heteroaralkyl group, preferably hydrogen.

Description

Hydroxyalkyl starch is connected the conjugate for preparing with active substance through Thiazolidine by chemistry
The present invention relates to a kind of method for preparing the conjugate of active substance and hydroxyalkyl starch, and relate to the conjugate of active substance and hydroxyalkyl starch, preferred hetastarch, wherein conjugate prepares via the chemical residue covalency keyed jointing with following formula (I), formula (I ') or formula (I ") structure by hydroxyalkyl starch and active substance:
Figure DEST_PATH_G200680033326801D00011
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4Be independently selected from straight chain, ring-type and/or branched alkyl, aryl, heteroaryl, aralkyl and the heteroarylalkyl of hydrogen, randomly suitable replacement, preferred hydrogen.
WO03/031581 A2 disclose a kind of with polymer derivant with have the method for the polypeptide coupling of cysteine or histidine residues at the N-end, wherein said method comprises provides a kind of polypeptide that has cysteine or histidine residues at the N-end, a kind of polymer of thioesters-end-blocking is provided, this polymer comprises the main polymer chain of a kind of water solublity and non-peptide, preferred polyethylene glycol polymer is with this polymer derivant and polypeptide reaction.With regard to polymer; adopt the copolymer of poly-(aklylene glycol), ethylene glycol and propylene glycol, poly-(oxygen ethylization polyhydric alcohol), poly-(enol), PVP, poly-(alpha-hydroxy acid), poly-(vinyl alcohol), polyphosphazene, poly-oxazoline, gather (N-acryloyl group morphine), polyacrylate, polyacrylamide, polysaccharide, with and copolymer, ter-polymers and its mixture.All clear and definite disclosed polymer all are polyethylene glycol polymers.
Although couling process and the application of the PEG molecule of simple function have obtained progress, the common shortcoming of PEG chemical medicine thing be also PEG not fully aware of as the metabolic pathway of non-natural polymers.
In addition, being used for forming the common approach of the arborescence of peptide with oxime, hydrazone and Thiazolidine keyed jointing can be from J.Am Chem Soc.1995, and 117,3893-3899 is known.Wherein disclosed as the unprotected peptide of building block system unit and aldehyde and be connected with selectivity between the weak acid.
WO 99/07719 A1 discloses prodrug and conjugate and the application process thereof that contains thiol and selenium hydroxyl (seleonol) chemical compound.Except several other chemical compounds, disclosed the prodrug by the reaction preparation of Cys ethyl ester and a kind of monosaccharide-D-ribose, described prodrug comprises the Thiazolidine ring.General formula about this monosaccharide has disclosed (CHOH) nCH 2OH, n=1-5.Form in the relevant content with the Thiazolidine ring even do not disclose disaccharide, said nothing of the high molecular polymerization chemical compound, such as starch, hydroxyalkyl starch particularly.
Thus, target of the present invention provides a kind of active substance by the formation of covalency keyed jointing and the novel conjugate of polymer, does not wherein use poly alkylene glycol, particularly Polyethylene Glycol as polymer.
Thereby another target of the present invention provides the method for these conjugates of preparation.
These solution of problem schemes are methods of a kind of conjugate for the preparation of active substance and hydroxyalkyl starch, and wherein active substance and hydroxyalkyl starch are via the chemical residue covalency keyed jointing that has with following formula (I), formula (I ') or formula (II ') structure:
Figure S2006800333268D00031
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4Be independently selected from straight chain, ring-type and/or branched alkyl, aryl, heteroaryl, aralkyl and the heteroarylalkyl of hydrogen, randomly suitable replacement, preferred hydrogen,
Described method comprises:
(A) make aldehyde radical, ketone group or hemiacetal group that hydroxyalkyl starch or its comprise the derivant of aldehyde radical, ketone group or hemiacetal group and active substance or its comprise the α of the derivant of following α-SH-β amino group-SH-β amino group
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I) structure and the conjugate of described hydroxyalkyl starch; Perhaps comprise the α of the derivant of following α-SH-β amino group-SH-β amino group with active substance or its
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I ') structure and the conjugate of described hydroxyalkyl starch; Perhaps comprise the α of the derivant of following α-SH-β amino group-SH-β amino group with active substance or its
Figure S2006800333268D00041
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I ") structure and the conjugate of described hydroxyalkyl starch;
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4As above definition;
Perhaps
(B) make active substance or its comprise aldehyde radical, ketone group or the hemiacetal group and the α that comprises the hydroxyalkyl starch derivative of following α-SH-β amino group-SH-β amino group of the derivant of aldehyde radical, ketone group or hemiacetal group
Figure S2006800333268D00042
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I) structure and the conjugate of described hydroxyalkyl starch; Perhaps with the α of the hydroxyalkyl starch derivative that comprises following α-SH-β amino group-SH-β amino group
Figure S2006800333268D00043
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I ') structure and the conjugate of described hydroxyalkyl starch; Perhaps with the α of the hydroxyalkyl starch derivative that comprises following α-SH-β amino group-SH-β amino group
Figure S2006800333268D00044
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I ") structure and the conjugate of described hydroxyalkyl starch;
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4As above definition.
Thereby used term in the literary composition of the present invention " α-SH-β amino group " refers to following ethylidene, and wherein SH group and a carbon atom bonding of optional protection are chosen uncle or secondary amino group and the adjacent carbon atom bonding protected wantonly.The key of the not shown residue of an end is the key that connects hydroxyalkyl starch or active substance in the above structural formula.
Used term " alkyl " preferably has 1-20, more preferably 1-10, the alkyl of 1-4 carbon atom particularly preferably in the literary composition of the present invention, unless different definition is hereinafter arranged.
Used term " aryl " preferably has 6-20, more preferably 6-14, the aryl of 6 carbon atoms particularly preferably in the literary composition of the present invention, unless different definition is hereinafter arranged.
In the literary composition of the present invention used term " heteroaryl " preferably have 6-20, more preferably 6-14, particularly preferably 6 carbon atoms and wherein at least one, preferred 1-3, the heteroaryl that substituted by hetero atom such as S, N and/or O of 1 carbon atom particularly preferably, unless different definition is hereinafter arranged.
The preferred aryl of the remainder bonding by alkyl group and chemical compound of used term " aralkyl " in the literary composition of the present invention is unless hereinafter there is different definition.
The preferred alkyl of the remainder bonding by aromatic yl group and chemical compound of used term " alkaryl " in the literary composition of the present invention is unless hereinafter there is different definition.
The preferred heteroaryl of the remainder bonding by alkyl group and chemical compound of used term " heteroarylalkyl " in the literary composition of the present invention is unless hereinafter there is different definition.
Used term in the literary composition of the present invention " randomly suitable replace " preferably refers to exist 1-10, more preferably individual, 1 substituent group particularly preferably of 1-4, unless different definition is hereinafter arranged.
Used term " active substance " relates in the literary composition of the present invention a kind ofly can affect any physiology of organism or the material of biochemical property, and organism includes but not limited to virus, antibacterial, fungus, plant, animal and human.Especially, used term " active substance " relates to for diagnosis, cures, alleviates, treats and prevent the material of human or animal's disease in the literary composition of the present invention, perhaps is used for strengthening human or animal's health or the material of spiritual comfort.The example of active substance includes but not limited to peptide, protein, enzyme, small-molecule drug, dyestuff, lipid, nucleoside, oligonucleotide, polynucleotide, nucleic acid, cell, virus, liposome, microgranule and micelle.
The example of protein includes but not limited to erythropoietin (EPO), such as recombinant human epo (rhEPO); Colony stimulating factor (CSF) is such as G-CSF, such as recombinant human g-csf (rhG-CSF); Alpha-interferon (IFN α), beta-interferon (IFN β) or gamma interferon (IFN γ) are such as recombined human IFN α or IFN β (rhIFN α or rhIFN β); Interleukin, IL-1 to IL-8 for example is such as IL-2 or IL-3, such as recombinant human il-2 or IL-3 (rhIL-2 or rhIL-3); Serum albumin such as coagulation factor II-XIII are such as Factor IX; Alpha1-antitrypsin (A1AT); Activated protein c (APC); The plasminogen activator is such as tissue type plasminogen activator (tPA), such as human tissue plasmin activator (hTPA); AT III such as recombined human AT III (rhAT III); Myoglobin; Albumin is such as bovine serum albumin (BSA); Somatomedin is such as epidermal growth factor (EGF), PDGF (PDGF), fibroblast somatomedin (FGF), brain derived somatomedin (BDGF), nerve growth factor (NGF), B-cell growth factor (BCGF), brain derived neurotrophic growth factor (BDNF), ciliary neurotrophic factor (CNTF), transforming growth factor such as TGF α or TGF β; BMP (bone form formative albumen); Growth hormone is such as the human growth hormone; Tumor necrosis factor such as TNF α or TNF β; Amicine (peptide); Auxin (somatotropine); Somatomedin (somatomedines); Hemoglobin; Hormone or prohormone are such as insulin, promoting sexual gland hormone, melanocyte-stimulating hormone (α-MSH), triptorelin, hypothalamic hormone such as vasopressin (ADH) and oxytocin and releasing hormone and release inhibting hormone, parathyroid hormone, thyroxin such as thyroxine, thyrotropin, thyroliberin, prolactin antagonist, calcitonin, glucagon, glucagon-like peptide (GLP-1, GLP-2 etc.), Exenatide (exendine) is such as Exendin-4 (exendin-4), Leptin, vassopressin, gastrin, secretin, integrin matter, the glycoprotein hormone is (such as LH, FSH etc.), melanoside stimulates hormone, lipoprotein and apolipoprotein such as apo-B, apo-E, apo-L a, immunoglobulin such as IgG, IgE, IgM, IgA, IgD and fragment thereof, hirudin, institutional approach inhibitor, vegetable protein such as agglutinin or ricin, Venenum apis, snake venom, antitoxin, E antigen, α-proteinase inhibitor, artemisiifolia allergen, melanocyte, low one of polylysine (oligolysine) albumen, RGD albumen or these albumen optional corresponding receptor; Perhaps any functional derivatives or fragment in these albumen or the receptor.In the particularly preferred specific embodiment, active substance is the EPO of EPO, particularly following oxidation.
The example of enzyme includes but not limited to carbohydrate specific enzyme, proteolytic enzyme, oxidase, oxidoreductase, transferring enzyme, hydrolytic enzyme, lyase, isomerase, kinases and ligase.Concrete indefiniteness example is asparaginase, arginase, the arginine deaminase, the adenosine deaminase, transglutaminase, transglutaminase-asparaginase, phenylalanine, E.C. 4.1.99.1, tryrosinase, superoxide dismutase (SOD), endotoxin enzyme (endotoxinase), catalase, peroxidase, kallidinogenase, trypsin, Chymotrypsin, elastoser, thermolysin, lipase, uricase, adenosine deaminase, purine nucleoside phosphorylase, Bilirubin oxidase, glucoseoxidase, glucosidase (glucodase), glycolate oxidase, tilactase, glucocerebrosidase, glucuronidase, hyaluronidase, tissue factor, streptokinase, urokinase, the MAP-kinases, the DNA enzyme, the RNA enzyme, lactoferrin, and functional derivatives or fragment.
According to a kind of alternative scheme of the present invention, active substance is small-molecule drug, peptide and/or protein.
Wherein, can clearly mention following protein: erythropoietin (EPO), such as recombinant human epo (rhEPO); Colony stimulating factor (CSF) is such as G-CSF, such as recombinant human g-csf (rhG-CSF); Alpha-interferon (IFN α), beta-interferon (IFN β) or gamma interferon (IFN γ) are such as recombined human IFN α or IFN β (rhIFN α or rhIFN β); Serum albumin such as coagulation factor II-XIII are such as Factor IX, Factor IX, factors IX; Alpha1-antitrypsin (A1AT); Activator protein matter C (APC); The plasminogen activator is such as tissue plasminogen activator (tPA), such as human tissue plasmin activator (hTPA); AT III such as recombined human AT III (rhAT III).
The example of peptide comprises: ACTH, adrenomedullin, starchiness sample beta-protein, angiotensin I, Angiotensin II, the atrium natriuresis is drained peptide (ANP), antibody fragment, Kallidin I, large brain natriuretic peptide β-type (BNP), calcitonin, corticotropin releasing factor (CRF), endorphins, Endothelin, enkephalin, gastrin, the related peptide of gastrin, gastrin suppresses polypeptide (GIP), gastrin releasing peptide (GRP), glucagon, glucagon-like sample peptide, somatotropin releasing factor (GRF), hepatocyte growth factor, insulin, gonadotropin-releasing hormone (LH-RH, GnRH), neurokinin, oxytocin, the accessory parathyroid gland hormone, the somatropin inhibin, Substance P, throtropin releasing hormone (TRH), the active intestinal peptide (VIP) of vasoactive and vasopressin.
Active substance is preferably from antibiotic, antidepressants, antidiabetic drug, antidiuretic, anticholinergic, anti-arrhythmia medicine, Bendectin, cough medicine, antuepileptic, antihistaminic, antifungal agent, anti-sympathetic tone medicine (antisympathotonics), antithrombotic, androgen, androgen antagonist, estrogen, estrogen antagonist, anti-osteoporotic, antitumor agent, vasodilation, other hypotensive agent, antipyretic, analgesic, antiinflammatory, beta-Blocking agent, cytostatics, immunosuppressant and vitamin.
Other nonrestrictive example of some of active substance is: albuterol, fosamax, amikacin (amikazin), ampicillin, the amoxicillin, amphotericin B, atenolol, azathioprine, cefaclor, cephalo azanol benzyl, ceftizoxime, ceftazidime, rocephin, cilastatin, cimetidine, ciprofloxacin, clonidine, polymyxin E, tetracosactide, cycloserine, daunorubicin, doxorubicin, Desmopressin, dihydroergotamine, dobutamine, dopamine, ephedrine, epinephrine, episilon amino caproic acid, ergometrine, esmolol, famotidine, flecainide, folic acid, flucytosine, furosemide, ganciclovir, gentamycin, glucagon, hydralazine (hydrazaline), imipenum, isoproterenol, ketamine, liothyronine, LHRH, mepartricin (merpatricin), metaradrine, methyldopa, metoclopramide, metoprolol, mexiletine, mitomycin, neomycin (neomicin), netilmicin, nimodipine, nystatin, octreotide, oxytocin, pamldronate, pentylenetetrazol, phentolamine, phenylephrine, procainamide, procaine, Propranolol, ritodrine, sotalol, teicoplanin, terbutaline, vitamin B1, Tiludronate, tolazoline, trimethoprim, trometamol, tylosin, vancomycin, vasopressin and vinblastine.
According to a kind of replacement scheme, also can attempt rifamycin, tetracycline, bleomycin A5 (spectomycine), streptomycin or erythromycin as active substance.
The example of oligonucleotide is aptamer, DNA, RNA, PNA or derivatives thereof.
In the literary composition of the present invention, term " hydroxyalkyl starch " (HAS) refers to the starch derivatives that replaced by at least one hydroxyalkyl group.Preferred hydroxyalkyl starch of the present invention has the structure of formula (II)
Figure S2006800333268D00091
Wherein R ', R " and R
Figure 2006800333268_8
Be hydrogen, straight or branched hydroxyalkyl independently, or group
-[(CR 1R 2) mO] n[CR 3R 4] o-OH
Wherein, R 1, R 2, R 3And R 4Be independently selected from hydrogen and alkyl, preferred hydrogen and methyl, m is 2-4, wherein m group CR 1R 2In residue R 1And R 2Can be identical or different; N is 0-20, preferred 0-4; O is 0-20, preferred 2-4, and wherein when n=0, o is not 0, and o group CR wherein 3R 4In residue R 3And R 4Can be identical or different,
Residue HAS wherein " consist of the HAS molecule in conjunction with the terminal glucose fragment, i.e. a kind of HAS molecule of formula (II) expression, its end carbon hydrate fragment is clearly illustrated, the remainder of this starch molecule is HAS ".
In formula (II), the reducing end under neutral of starch molecule illustrates with oxidised form not, and the terminal sugar unit of HAS illustrates with the form of hemiacetal group, depends on for example solvent, the form of this hemiacetal group may with the form balance of aldehyde.Used abbreviation HAS in the literary composition of the present invention " refer to the HAS molecule at the terminal sugar unit that does not comprise HAS molecule reducing end under neutral.
Used term hydroxyalkyl is not limited to this compounds among the present invention: wherein terminal carbohydrate fragment is included as for simplicity and the hydroxyalkyl R ', the R that show in formula (II) " and/or R , also refer to this compounds: wherein terminal carbohydrate fragment and/or starch molecule remainder HAS " in be present at least one hydroxyalkyl group of optional position by hydroxyalkyl group R ', R " or R
Figure 2006800333268_10
Replace.
The hydroxyalkyl starch that comprises two or more different hydroxyalkyl groups also is fine.
This be included at least one hydroxyalkyl group among the HAS can comprise one or more, two or more hydroxyls particularly.According to a kind of preferred specific embodiment, this at least one hydroxyalkyl group that is included among the HAS comprises a hydroxyl.
" hydroxyalkyl starch " comprises that also alkyl group coverlet wherein replaces or polysubstituted derivant.Herein, preferred alkyl is replaced by halogen, especially fluorine, is perhaps replaced by aryl.In addition, the hydroxyl of hydroxyalkyl can esterified or etherificate.
In addition, except alkyl, can also adopt replacement or the unsubstituted alkylidene of straight or branched.
Hydroxyalkyl starch is the ether derivant of starch.Except described ether derivant, other starch derivatives also can be with in the present invention.For example, comprise the derivant of hydroxyl of esterification also available.These derivants can be for example to have the unsubstituted monobasic of 2-12 carbon atom or derivant or its substitutive derivative of dicarboxylic acids.Unsubstituted monocarboxylic derivant with 2-6 carbon atom is particularly useful, particularly acetogenin.Herein, preferred acetyl starch, bytyry starch and propiono starch.
In addition, the derivant that does not replace dicarboxylic acids that preferably has 2-6 carbon atom.
In the situation of dicarboxylic acid derivatives, advantageously second of dicarboxylic acids carboxyl is also esterified.In addition, the mono alkyl ester derivant of dicarboxylic acids also suits in literary composition of the present invention.
For the monobasic or the dicarboxylic acids that replace, substituent group is preferably identical with the above-mentioned described substituent group of alkyl residue to replacement.
The technology of starch esterification is known in the art (such as referring to people such as Klemm D., " holocellulose chemistry " (Comprehensive Cellulose Chemistry), the 2nd volume, 1998, Whiley-VCH, Weinheim, New York, the 4.4th chapter particularly, cellulosic esterification (Esterification of Cellulose) (ISBN 3-527-29489-9)).
A preferred embodiment of the invention adopts the hydroxyalkyl starch according to above-mentioned formula (II).Be included in HAS " in other sugared ring structure can be identical or different with the sugar ring of clearly statement, but they lack reducing end under neutral.
About residue R ', the R in the formula (II) " and R
Figure 2006800333268_11
, do not have particular restriction.According to a kind of preferred specific embodiment, R ', R " and R
Figure 2006800333268_12
Be hydrogen or hydroxyalkyl, hydroxyl aralkyl or the hydroxyl alkaryl with 2-10 carbon atom independently in each alkyl residue.Preferred hydrogen and the hydroxyalkyl with 2-10 carbon atom hydrogen.More preferably, hydroxyalkyl has 2-6 carbon atom, more preferably 2-4 carbon atom, very preferably 2-3 carbon atom.In a kind of preferred specific embodiment, hydroxyalkyl starch is hetastarch, wherein R ', R " and R
Figure 2006800333268_13
Be hydrogen or group (CH independently 2CH 2O) n-H, wherein n is integer, preferred 0,1,2,3,4,5 or 6.
Thereby " hydroxyalkyl starch " preferably comprise hetastarch, hydroxypropyl starch and hydroxyl butyl starch, wherein particularly preferably hetastarch and hydroxypropyl starch, most preferably hetastarch.
Alkyl, aralkyl and/or alkaryl can be for straight or brancheds, and can be replaced by suitable.
Thereby, the invention still further relates to above-mentioned method and conjugate, wherein R ', R " and R
Figure 2006800333268_14
Be hydrogen or the straight or branched hydroxyalkyl with 2-6 carbon atom independently.
Thus, R,, R " and R
Figure 2006800333268_15
Be preferably H; The hydroxyl hexyl; The hydroxyl amyl group; The hydroxyl butyl; Hydroxypropyl is such as 2-hydroxypropyl, 3-hydroxypropyl, 2-hydroxyl isopropyl; Ethoxy is such as the 2-ethoxy; Particularly preferably hydrogen and 2-hydroxyethyl groups.
Thereby, the invention still further relates to above-mentioned method and conjugate, wherein R ', R " and R
Figure 2006800333268_16
Be hydrogen or 2-ethoxy independently; Particularly preferably residue R ', R " and R
Figure 2006800333268_17
In at least one is the specific embodiment of 2-hydroxyethyl groups.
For all embodiments of the present invention, hetastarch (HES) is most preferred.
Thereby, the invention still further relates to above-mentioned method and conjugate, wherein polymer is that hetastarch and polymer derivant are the hetastarch derivant.
Hetastarch (HES) is the derivant of naturally occurring amylopectin, in vivo by α-amylasehydrolysis.HES is the substituted derivant of carbohydrate polymer amylopectin, and described amylopectin exists concentration up to 95 % by weight in corn starch.HES shows favourable biological property and can be used as the blood volume substituting agent, and can be used for clinically Hemodilution Therapy (people such as Sommermeyer, 1987, Krankenhauspharmazie, 8 (8), 271-278; With the people such as Weidler, 1991, Arzneim.-Forschung/Drug Res., 41,494-498).
Amylopectin is comprised of a plurality of glucose moieties, wherein has α-Isosorbide-5-Nitrae-glycosidic bond and find to have α-1 at its branch part, the 6-glycosidic bond in main chain.The physicochemical property of this molecule mainly is to be determined by the type of glycosidic bond.Because this α-Isosorbide-5-Nitrae jaggy-glycosidic bond has produced every circle and has had the approximately helical structure of 6 glucose-monomers.Can be by replacing physicochemical property and the biochemical property that changes described polymer.Can realize by alkaline hydroxyethylation the introducing of ethoxy.By adjusting reaction condition, can develop the differential responses of the corresponding ethoxyl etherification of each oh group in the unsubstituted glucose monomer.Because this fact, those skilled in the art can affect substitute mode at limited extent.
HES mainly characterizes by molecular weight distribution and substitution value.Two kinds of possible modes are arranged when describing substitution value:
1. substitution value can relatively be described as substituted glucose monomer with respect to the ratio of all glucose moieties.
2. substitution value can be described by molar substitution, wherein describes the ethoxy number in each glucose moiety.
In literary composition of the present invention, the substitution value that is expressed as DS relate to above-mentioned molar substitution (also can be referring to people such as Sommermeyer cited above, 1987, Krankenhauspharmazie, 8 (8), 271-278; Particularly the 273rd page).
HES solution exists with polydisperse composition forms, and wherein each molecule is variant each other aspect the number of the degree of polymerization, branch sites and pattern and substitute mode.Therefore, HES is the mixture with chemical compound of different molecular weight.So, come specific HES solution is measured with mean molecule quantity by means of statistical method.In this article, Mn calculates with the arithmetic mean of instantaneous value that depends on molecular number.Alternately, Mw (or MW)-weight average molecular weight, the unit of HES quality is depended in representative.
Preferably, the used hydroxyalkyl starch of the present invention has the mean molecule quantity (weight average) of 1-300kD.Hetastarch can further present the preferred molar substitution of 0.1-3, preferred 0.1-2, more preferably 0.1-0.9 or 0.4-2, preferred 0.4-1.3, and the C of hydroxyethyl groups 2: C 6Replace than preferably in the 2-20 scope.
Used term " mean molecule quantity " refers to according to people such as Sommermeyer in the literary composition of the present invention, 1987, Krankenhauspharmazie, 8 (8), 271-278; With the people such as Weidler, 1991, Arzneim.-ForschungIDrug Res., the weight that the LALLS-described in 41, the 494-498 (low angle laser light scattering (low angle laser light scattering))-GPC method is measured.In addition, for 10kD and less molecular weight, also calibrate with the standard specimen of the qualitative mistake of LALLS-GPC with before a kind of.
According to a preferred embodiment of the invention a, the mean molecule quantity of used hetastarch is 1-300kD, more preferably 2-200kD, further preferred 10-150 or 4-130kD, more preferably 10-100kD.
Has approximately 1-300kD, the example of the HES of preferred 10-100kD mean molecule quantity is the HES with 0.1-3 molar substitution, preferred 0.4-1.3, for example 0.4,0.5,0.6,0.7,0.8,0.9,1.0,1.1,1.2 or 1.3, preferred 0.7-1.3, for example 0.7,0.8,0.9,1.0,1.1,1.2 or 1.3.
Having approximately, the example of the HES of 130kD mean molecule quantity is the Voluven from Fresenius
Figure 2006800333268_18
Voluven
Figure 2006800333268_19
A kind of artificial colloid, be used for for example treating and when preventing hypovolemia disease the used volume for the treatment of indication substitute.Voluven
Figure 2006800333268_20
The mean molecule quantity that is characterized as be 130,000+/-20,000D; Molar substitution is 0.4 and C 2: C 6Ratio be approximately 9: 1.
The invention still further relates to above-mentioned method and conjugate, wherein hydroxyalkyl starch is the hetastarch with 10-150kD, preferred 10-100kD mean molecule quantity.
The preferable range of mean molecule quantity is, for example, 10-150kD or 10-130kD or 30-130kD or 50-130kD or 70-130kD or 100-130kD or 10-100kD or 4-100kD or 10-100kD or 12-100kD or 18-100kD or 50-100kD or 4-70kD or 10-70kD or 12-70kD or 18-70kD or 50-70kD or 4-50kD or 10-50kD or 12-50kD or 18-50kD or 4-18kD or 10-18kD or 12-18kD or 4-12kD or 10-12kD or 4-10kD.
The particularly preferred specific embodiment according to the present invention, the mean molecule quantity of used hetastarch is being higher than 4kD and is being lower than in the scope of 150kD, for example: about 10kD, perhaps in the scope of 9-10kD or 10-11kD or 9-11kD; Perhaps about 12kD, or in the scope of 11-12kD or 12-13kD or 11-13kD; Perhaps about 15kD, or in the scope of 14-15 or 15-16kD; Perhaps about 18kD, or in the scope of 17-18kD or 18-19kD or 17-19kD; Perhaps about 50kD, or in the scope of 49-50kD or 50-51kD or 49-51kD; Perhaps about 56kD, or in the scope of 55-56kD or 56-57kD.
The another kind of particularly preferred specific embodiment according to the present invention, the mean molecule quantity of used hetastarch is within being higher than 60kD and the scope up to 130kD, for example: about 70kD, or in the scope of 65-75kD; Perhaps about 80kD, or in the scope of 75-85kD; Perhaps about 90kD, or in the scope of 85-95kD; Perhaps about 100kD, or in the scope of 95-105kD; Perhaps about 110kD, or in the scope of 105-115kD; Perhaps about 120kD, or in the scope of 115-125kD; Perhaps about 130kD, or in the scope of 125-135kD.
With regard to the upper limit of molar substitution (DS), value to as high as 3.0 all is fine, such as 0.9,1.0,1.1,1.2,1.3,1.4,1.5,1.6,1.7,1.8,1.9 or 2.0, preferred value below 2.0, the more preferably value below 1.5, preferred value below 1.3 further, for example 0.7,0.8,0.9,1.0,1.1,1.2 or 1.3.
Thereby the preferable range of molar substitution is 0.1-2 or 0.1-1.5 or 0.1-1.3 or 0.1-1.0 or 0.1-0.9 or 0.1-0.8.The more preferably scope of molar substitution is 0.2-2 or 0.2-1.5 or 0.2-1.0 or 0.2-0.9 or 0.2-0.8.The more preferably scope of molar substitution is 0.3-2 or 0.3-1.5 or 0.3-1.0 or 0.3-0.9 or 0.3-0.8.The further preferable range of molar substitution is 0.4-2 or 0.4-1.5 or 0.4-1.0 or 0.4-0.9 or 0.4-0.8.
With regard to molar substitution (DS), DS preferably at least 0.1, and more preferably at least 0.2, more preferably at least 0.4 and more preferably at least 0.7.The preferable range of DS is 0.1-3, preferred 0.1-2, more preferably 0.1-1.3, more preferably 0.1-0.9, more preferably 0.1-0.8, more preferably 0.2-0.8, more preferably 0.3-0.8, very preferred 0.4-0.8, preferred 0.1-0.7 also, more preferably 0.2-0.7, more preferably 0.3-0.7 and more preferably 0.4-0.7.Particularly preferred DS value is, for example, 0.1,0.2,0.3,0.4,0.5,0.6,0.7,0.8,0.9,1.0,1.2 or 1.3, more preferably 0.2,0.3,0.4,0.5,0.6,0.7 or 0.8, further preferred 0.3,0.4,0.5,0.6,0.7 or 0.8, further preferred 0.4,0.5,0.6,0.7 or 0.8, and for example particularly preferably 0.4 or 0.5 and 0.7 or 0.8.
In the literary composition of the present invention, the set-point of molar substitution can be exact value such as 1.3 or can be understood as in the 1.25-1.34 scope; Perhaps 1.0 can be exact values or can be understood as in the 0.95-1.04 scope; Perhaps 0.9 can be exact value or can be understood as in the 0.85-0.94 scope; Perhaps 0.8 can be exact value or can be understood as in the 0.75-0.84 scope.Thereby for example, set-point 0.1 can be exact value 0.1 or in the 0.05-0.14 scope; Set-point 0.4 can be exact value 0.4 or in the 0.35-0.44 scope; Perhaps set-point 0.7 can be exact value 0.7 or in the 0.65-0.74 scope.
Hydroxyalkyl starch, preferred hetastarch, particularly preferred being combined as of molecular weight and its molar substitution DS, for example, 10kD and 0.4 or 10kD and 0.7 or 12kD and 0.4 or 12kD and 0.7 or 15kD and 0.4 or 15kD and 0.7 or 18kD and 0.4 or 18kD and 0.7 or 50kD and 0.4 or 50kD and 0.7 or 56kD and 0.4 or 56kD and 0.7 or 70kD and 0.4 or 70kD and 0.7 or 100kD and 0.4 or 100kD and 0.7 or 130kD and 0.4 or 130kD and 0.7.
With regard to C 2: C 6Replace ratio, described replacement is than preferably in the 2-20 scope, more preferably in the 2-15 scope, more preferably in the 3-12 scope.
According to another embodiment of the present invention, can also adopt to have different mean molecule quantities and/or different molar substitution and/or different C 2: C 6The mixture that replaces the hetastarch of ratio.Therefore, can adopt and have different mean molecule quantities and different molar substitutions and different C 2: C 6Replace ratio or have different mean molecule quantities and different molar substitutions and identical or roughly the same C 2: C 6Replace ratio or have different mean molecule quantities and identical or roughly the same molar substitution and different C 2: C 6Replace ratio or have identical or roughly the same mean molecule quantity and different molar substitutions and different C 2: C 6Replace ratio or have different mean molecule quantities and identical or roughly the same molar substitution and identical or roughly the same C 2: C 6Replace ratio or have identical or roughly the same mean molecule quantity and different molar substitutions and identical or roughly the same C 2: C 6Replace ratio or have identical or roughly the same mean molecule quantity and identical or roughly the same molar substitution and different C 2: C 6Replace ratio or have roughly the same mean molecule quantity and roughly the same molar substitution and roughly the same C 2: C 6The mixture that replaces the hetastarch of ratio.
In different conjugates according to the present invention and/or distinct methods, can adopt different hydroxyalkyl starchs, preferred different hetastarch and/or different hydroxyalkyl starch mixture, preferred different hetastarch mixture.
In a kind of preferred specific embodiment, the hydroxyalkyl starch or derivatives thereof comprises 1-100, preferred 1-15, particularly preferably 1 aldehyde radical, ketone group and/or hemiacetal group; Perhaps wherein the hydroxyalkyl starch or derivatives thereof comprises 1-100, preferred 1-15, particularly preferably 1 α-SH-β amino group.
In the preferred specific embodiment of another kind, active substance comprises 1-15, preferred 1-8, particularly preferably 1 aldehyde radical, ketone group and/or hemiacetal group; Perhaps wherein active substance comprises 1-15, preferred 1-8, particularly preferably 1 α-SH-β amino group.
This comprises the hydroxyalkyl starch of at least one aldehyde radical, ketone group, hemiacetal group or α-SH-β amino, and preferred hetastarch can be provided by any suitable method.
In a kind of preferred specific embodiment, the hydroxyalkyl starch derivative that comprises described aldehyde radical, ketone group, hemiacetal group or described α-SH-β amino is obtained by following methods, and the method comprises:
(a) (1) introduces hydroxyalkyl starch by the open loop oxidation reaction with at least one aldehyde radical, perhaps
(a) (2) make hydroxyalkyl starch and at least a dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 1And Q, the M of functional group 1With the hydroxyalkyl starch reaction, and the Q of another functional group is
(i) aldehyde radical, ketone group, hemiacetal group or α-SH-β is amino; Or
(ii) chemical modification generates the functional group of aldehyde radical, ketone group, hemiacetal group or α-SH-β amino.
According to (a) (1), preferably adopt periodate to make hydroxyalkyl starch experience open loop oxidation reaction, generate the hydroxyalkyl starch derivative with at least one aldehyde radical.
Open loop oxidation reaction according to (a) (1) can be carried out in aqueous medium.This open loop oxidation reaction is carried out under 0-37 ℃ temperature, preferred 0-5 ℃.
In a kind of preferred embodiment of (a) (2), the M of functional group 1Be selected from carboxyl, reactive carboxyl, carboxylic acid anhydrides, carboxylic acid halides, isocyanates, isothiocyanate, chloro-formate and epoxide group, the Q of functional group is that aldehyde radical, ketone group, hemiacetal group or α-SH-β is amino, or chemical modification generates the functional group of aldehyde radical, ketone group, hemiacetal group or α-SH-β amino.
According to a kind of specific embodiment of the present invention, can comprise according to the method for (a) (2) making hydroxyalkyl starch through the reducing end under neutral of the optional oxidation of hydroxyalkyl starch and at least aly comprising at least two M of functional group 1Chemical compound reaction with Q.
Used term hydroxyalkyl starch in the literary composition of the present invention-preferred hetastarch-" through the reducing end under neutral of optional oxidation " reaction can refer to that hydroxyalkyl starch is mainly through the process of the reducing end under neutral reaction of its optional oxidation.
Term " main reducing end under neutral through its optional oxidation " relates to and statistically is higher than 50%, preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, further preferably at least 95% as 95%, 96%, 97%, 98% or 99% is used for the hydroxyalkyl starch molecule of given reaction through the process of the reducing end under neutral reaction of at least one optional oxidation of each hydroxyalkyl starch molecule, and wherein given hydroxyalkyl starch molecule through at least one reducing end under neutral reaction is can be in identical given reaction contained and be not that at least one other the suitable functional group of reducing end under neutral reacts by described hydroxyalkyl starch molecule.If one or more hydroxyalkyl starch molecules react by at least one reproducibility functional group and contained by this (these) hydroxyalkyl starch molecule and be not that at least one other the suitable functional group of reducing end under neutral reacts simultaneously, then all of these hydroxyalkyl starch molecules participate in the functional group of reaction-described functional group comprise reducing end under neutral-in, statistically preferably surpass 50%, preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, further preferably at least 95% as 95%, 96%, 97%, 98% or 99% be reducing end under neutral.
Used term " reducing end under neutral " relates to the latter end aldehyde radical of the hydroxyalkyl starch molecule that can exist with aldehyde radical and/or corresponding hemiacetal group form in the literary composition of the present invention.In the oxidized situation of this reducing end under neutral, this aldehyde radical or hemiacetal group are the form of carboxyl and/or corresponding lactone.
According to a kind of specific embodiment of the present invention, can comprise thus hydroxyalkyl starch in its reducing end under neutral oxidation according to the method for (a) (2), production (IIIa) and/or (IIIb) shown in hydroxyalkyl starch:
Figure S2006800333268D00181
Wherein, R ', R " and R
Figure 2006800333268_21
As formula II is defined; And will in hydroxyalkyl starch and at least a suitable chemical compound reaction of its reducing end under neutral oxidation, generate the hydroxyalkyl starch of aldehyde, ketone, hemiacetal or α-SH-β aminofunctional.
Hydroxyalkyl starch-preferred hetastarch-oxidation can carry out according to the whole bag of tricks or its combined method that generation has said structure (IIIa) and/or a chemical compound (IIIb).Although this oxidation can be carried out according to all appropriate methodologies that generate the oxidized reducing end under neutral of hydroxyalkyl starch, but preferably according to for example carrying out with alkaline iodine solution described in DE 196 28 705 A1, its corresponding contents (embodiment A, the 9th hurdle, 6-24 is capable) be hereby incorporated by.
In the preferred specific embodiment of another kind, the hemiacetal group of hydroxyalkyl starch is the not oxidised form of aldehyde radical of the reducing end under neutral of hydroxyalkyl starch.
According to (a) (2), preferably make hydroxyalkyl starch, its reducing end under neutral is chosen oxidation wantonly, and comprises the M of functional group 1With the bifunctional at least chemical compound reaction of the Q of functional group, M 1Preferably react at the reducing end under neutral of its optional oxidation with hydroxyalkyl starch, Q is that aldehyde radical, ketone group, hemiacetal group or α-SH-β is amino, or chemical modification generates the functional group of one of these groups.
About the M of functional group that reacts with hydroxyalkyl starch in the bifunctional at least chemical compound 1, what will mention especially is to have structure R *The group of-NH-, wherein R *Be hydrogen or alkyl, cycloalkyl, aryl, aralkyl, cycloalkyl aryl, alkaryl or cycloalkaryl residue, wherein cycloalkyl, aryl, aralkyl, cycloalkyl aryl, alkaryl or cycloalkaryl residue can directly be connected with the NH base, perhaps according to the another kind of specific embodiment, can be connected with the NH base by oxo bridge.Alkyl, cycloalkyl, aryl, aralkyl, cycloalkyl aryl, alkaryl or cycloalkaryl residue can suitably be replaced.About preferred substituent group, can mention halogen such as F, Cl or Br.Particularly preferred residue R *Be hydrogen, alkyl and alkoxyl, very preferred hydrogen and unsubstituted alkyl and alkoxyl.
In alkyl and the alkoxy base, preferably has the group of 1,2,3,4,5 or 6 C atom.More preferably methyl, ethyl, propyl group, isopropyl, methoxyl group, ethyoxyl, propoxyl group and butoxy.Especially preferable methyl, ethyl, methoxyl group, ethyoxyl, particularly preferably methyl or methoxy.
According to the another kind of specific embodiment of the present invention, the M of functional group 1Has structure R *-NH-R *-, R wherein *Preferably comprise construction unit-NH-and/or construction unit-(C=G)-and/or construction unit-SO 2-, wherein G is O or S.The R of functional group *Object lesson be:
Figure S2006800333268D00191
With
Figure S2006800333268D00192
Wherein, if G occurs twice, then it is O or S independently.
Therefore, the invention still further relates to above-mentioned method and conjugate, wherein the M of functional group 1Be selected from lower group:
Figure S2006800333268D00201
Wherein G is O or S, and if there is twice, then it is O or S independently, and R ' is methyl.
The particularly preferred specific embodiment according to the present invention, the M of functional group 1Be amino-NH 2
Be that aldehyde radical, ketone group, hemiacetal group or α-SH-β are amino for Q, or chemical modification generates the situation of the functional group of one of these groups, except other, mentions following functional group:
The two keys of-C-C-or C-C-triple bond or aromatics C-C-key;
-sulfydryl or hydroxyl
-alkyl sulfonic acid hydrazine, aryl sulfonic acid hydrazine;
-1,2-glycol;
-1,2-amino-sulfur alcohol;
-triazo-compound;
-1,2-amino alcohol;
-amino-NH 2Or comprise the aminoderivative of construction unit-NH-, amino such as aminoalkyl, aminoaryl, amino aralkyl or alkaryl;
-hydroxyl amino-O-NH 2-, or comprise the hydroxylamino derivant of construction unit-O-NH-, as hydroxyalkyl is amino, hydroxyaryl is amino, hydroxyl aryl alkyl amino or hydroxyl alkaryl are amino;
-alkoxy amino, aryloxy group are amino, aralkoxy is amino or aryloxy alkyl is amino, and every kind comprises construction unit-NH-O-;
-have a residue of carbonyl ,-Q-C (=G)-M, wherein G is O or S, M is for for example:
---OH or-SH;
--alkoxyl, aryloxy group, aralkoxy or aryloxy alkyl;
--alkylthio group, arylthio, aromatic alkylthio or alkane arylthio;
--alkyl-carbonyl oxygen base, aryl carbonyl oxygen base, aromatic alkyl carbonyl oxygen base, alkaryl ketonic oxygen base;
--active ester, for example have the azanol of imide structure such as the ester of N-hydroxy-succinamide, or have construction unit O-N and wherein N be the ester of azanol of the part of heteroaryl compound, wherein G=O and Q do not exist, as have the aryloxy compound of substituted aromatic yl residue such as pentafluorophenyl group, p-nitrophenyl or trichlorophenyl;
Wherein Q does not exist, and perhaps is NH or hetero atom such as S or O;
--NH-NH 2Or-NH-NH-;
- -NO 2；
-itrile group;
-carbonyl such as aldehyde radical or ketone group;
-carboxyl;
--N=C=O or-N=C=S base;
-vinyl halide group is such as iodoethylene base or bromo vinyl or trifluoromethanesulfonic acid ester group;
- -C≡C-H；
--(C=NH 2CI)-the O alkyl
-group-(C=O)-CH 2-Hal, wherein Hal is Cl, Br or I;
- -CH＝CH-SO 2-；
-comprise-the disulphide group of S-S-structure;
-group
Figure S2006800333268D00211
Group
Figure S2006800333268D00212
In the preferred embodiment of the inventive method, the M of functional group 1With OH-base (the perhaps optional oxidation of hydroxyalkyl starch or the unoxidized reducing end under neutral) reaction on the hydroxyalkyl starch.The M of functional group in this specific embodiment 1Preferred carboxyl or reactive carboxyl, the Q of functional group is aldehyde radical, ketone group or hemiacetal group; Especially, comprise M 1Be selected from formoxyl benzoic acid, 4-formoxyl benzoic acid pentafluorophenyl group ester, 4-formoxyl benzoic acid N-hydroxy-succinamide ester, 4-(4-formoxyl-3 with the difunctional compound of Q; 5-dimethoxy phenoxy group) butanoic acid and 4-formoxyl benzoyl oxide perhaps are selected from the biocompatible compound of alpha-keto carboxylic acid, neuraminic acid or derivatives thereof and pyridoxal 5-phosphate.
About alpha-keto carboxylic acid, preferably derived from those alpha-keto carboxylic acids that also can from human body, find under aminoacid and the most situation, preferably be selected from keto-valine, keto-leucine, ketone isoleucine and ketone alanine derived from amino acid whose alpha-keto carboxylic acid.In the preferred embodiment of the inventive method, the carboxyl of alpha-keto carboxylic acid and the base of the OH-on the hydroxyalkyl starch (the perhaps optional oxidation of hydroxyalkyl starch or unoxidized reducing end under neutral) reaction are perhaps with the group Q reaction that is the hydroxyalkyl starch of amino.Then the residue of alpha-keto carboxylic acid forms Thiazolidine without the ketone groups reaction.
Thereby, the present invention relates to according to (i) or (a) (2) method (ii) of (a) (2), wherein hydroxyalkyl starch and alpha-keto carboxylic acid reaction.
About neuraminic acid or sialic acid or derivatives thereof, they are preferably biocompatible, the sugar that exists in the human body in particular, and it is that N-and/or O-are acetylizad.In the preferred specific embodiment, neuraminic acid or sialic acid are N-acetylneuraminic acid.These chemical compounds are owing to its pyranose structure shows as realizing as the desired rigidity of the function of interval base.On the other hand, can aldehyde radical be introduced these chemical compounds by selective oxidation.Sialic acid for example is present in the human body as the terminal monosaccharide in the glycosylated protein polysaccharide chain.
In the preferred specific embodiment, sialic acid can optionally be oxidized to aldehyde radical.
The method of selective oxidation sialic acid or neuraminic acid is known in this field, for example derives from L.W.Jaques, B.F.Riesco, W.Weltner, Carbohydrate Research, 83 (1980), 21-32 and T.Masuda, S.Shibuya, M.Arai, S.Yoshida, T.Tomozawa, A.Ohno, M.Yamashita, T.Honda, Bioorganic ﹠amp; MedicinalChemistry Letters, 13 (2003), 669-673.Preferably before reacting with hydroxyalkyl starch, carry out sialic oxidation.
Then can make the sialic acid of optional oxidation by its carboxylic acid group and hydroxyalkyl starch reaction.In the preferred specific embodiment of the inventive method, the reducing end under neutral reaction optional oxidation of the sialic carboxyl of oxidation and the base of the OH on the hydroxyalkyl starch or hydroxyalkyl starch or unoxidized; Perhaps with the group Q reaction that is the hydroxyalkyl starch of amino.The sialic residue carbonyl of oxidation can react the formation Thiazolidine subsequently.
Thereby, the present invention relates to according to (i) or (a) (2) method (ii) of (a) (2), the wherein sialic acid of hydroxyalkyl starch and oxidation reaction.
About pyridoxal 5-phosphate (PyP), it is the difunctional compound of high-biocompatibility, is also referred to as vitamin B6.PyP is a kind of coenzyme, participates in transamination, decarboxylation, racemization and the effect of several amino acids modified side chain.All PyP require enzyme by forming the effect of Schiff alkali between aminoacid and the coenzyme.
In the preferred specific embodiment of the inventive method, the reducing end under neutral reaction optional oxidation of the phosphate group of PyP and the base of the OH on the hydroxyalkyl starch or hydroxyalkyl starch or unoxidized forms bound phosphate groups; Perhaps form phosphamide with the group Q reaction that is the hydroxyalkyl starch of amino.The residue carbonyl of PyP can react the formation Thiazolidine subsequently.
In the situation of PyP, the functional group of hydroxyalkyl starch is as mentioned above preferably by using diamino compounds to introduce hydroxyalkyl starch.
Thereby, the present invention relates to according to (i) or (a) (2) method (ii) of (a) (2), wherein hydroxyalkyl starch and pyridoxal 5-phosphate reaction.
In the preferred implementation (i) of (a) (2), the M of functional group 1Be selected from carboxyl, reactive carboxyl, carboxylic acid anhydrides, carboxylic acid halides, isocyanates, isothiocyanate, chloro-formate and epoxide group, the Q of functional group is aldehyde radical, ketone group, hemiacetal group, wherein the M of functional group 1With the OH radical reaction on the hydroxyalkyl starch.
In the preferred implementation (i) of (a) (2), the M of functional group 1Be selected from amino and α-SH-β amino and the Q of functional group are α-SH-β amino, especially, the M of functional group wherein 1Reducing end under neutral reaction with the optional oxidation of hydroxyalkyl starch.
In the preferred implementation (i) of (a) (2), the hydroxyalkyl starch that comprises described α-SH-β amino is obtained by following methods, and the method comprises to be made hydroxyalkyl starch at the reducing end under neutral of its optional oxidation and comprise the M of functional group 1And the Q of functional group is the change of α-SH-β amino
The compound reaction especially wherein, comprises M 1And the chemical compound of α-SH-β amino is 1,3-diaminourea-2-sulfydryl propane, or 2,3-diaminourea-2-sulfydryl propane.
In the preferred implementation (ii) of (a) (2), this dual functional at least chemical compound is included as the M of carboxyl or reactive carboxyl 1And be the Q of protected α-SH-β amino, especially, wherein this dual functional at least chemical compound is selected from D-, L-PG 1-Cys (PG 2)-OH or its racemic mixture and their active ester, wherein PG 1Can be amino any suitable protecting group, preferably from tertbutyloxycarbonyl (Boc) or 9-fluorenylmethyloxycarbonyl (Fmoc), PG 2Can be any suitable protecting group of mercaptan, preferably from trityl (Trt), to methoxyl group trityl (Mmt), S-tert-butyl group sulfenyl (S-t-Bu) and acetylamino methyl (Acm).
According to (a) (2) (ii), the Q of functional group is such group: it is by further modification generation aldehyde radical, ketone group, hemiacetal group or α-SH-β are amino.According to this specific embodiment, by the hydroxyalkyl starch derivative and the dual functional at least chemical compound reaction of another kind that obtain in the hydroxyalkyl starch of the optional oxidation of its reducing end under neutral and dual functional at least chemical compound reaction, the latter comprises the functional group that the Q of functional group with this hydroxyalkyl starch reacts.
In the preferred situation (ii) of (a) (2), M 1With Q all be amino-NH 2, M 1With Q can be spaced apart by any suitable interval base.Wherein, said interval base can be optional straight chain, side chain and/or the cyclic hydrocarbon residue that replaces.Usually, this hydrocarbon residue has 1-40, preferred 1-20, more preferably 2-10, more preferably 2-6,2-4 carbon atom particularly preferably.If there is hetero atom, this separation group comprises 1-20, preferred 1-8,1-4 hetero atom particularly preferably usually.This hydrocarbon residue can comprise alkyl chain or the aryl of optional branching or have the cycloalkyl of 5-7 carbon atom for example or be aralkyl, alkaryl, and wherein moieties can be straight chain and/or cyclic alkyl group.According to the preferred specific embodiment, this hydrocarbon residue is 1-20, preferred 2-10, more preferably 2-6, the alkyl chain of 2-4 carbon atom particularly preferably.
In a kind of specific embodiment of the present invention according to (a) (2) method (ii), preferably this comprises M 1With the dual functional at least chemical compound of Q be the diaminourea alkane with optional replacement of 1-20 carbon atom, be preferably selected from following chemical compound: 1, the 2-diaminoethanes, 1, the 3-diaminopropanes, 1, the 4-diaminobutane, 1,5-1,5-DAP, 1，6-diaminohexane, 1,7-diaminourea heptane, 1, the 8-diamino-octane, 1,9-diaminourea nonane, 1,10-diamino decane, 1,11-diaminourea hendecane, 1,12-diaminourea dodecane, 1,13-diaminourea tridecane, 1, the 14-diaminourea tetradecane, 1,15-diaminourea pentadecane, 1,16-diaminourea hexadecane, 1,17-diaminourea heptadecane, 1,18-diaminourea octadecane, 1,19-diaminourea nonadecane, 1,20-diaminourea eicosane; Or have a chemical compound of following formula:
H 2N-[(CR 1’R 2’) pO] q[CR 3’R 4’] r-NH 2
R wherein 1 ', R 2 ', R 3 'And R 4 'Be independently selected from hydrogen and alkyl, preferred hydrogen and methyl, p is 2-4, wherein p group CR 1 'R 2 'In residue R 1 'And R 2 'Can be identical or different, q is 0-20, preferred 0-10; R is 0-20, preferred 2-4, and wherein when q=0, r is not 0, and r group CR wherein 3 'R 4 'In residue R 3 'And R 4 'Can be identical or different.
The preferred embodiments of the disclosure also relates to a kind of above-mentioned method, wherein hydroxyalkyl starch be selected from the reaction of following difunctional compound: 1, the 2-diaminoethanes, 1, the 3-diaminopropanes, 1, the 4-diaminobutane, 1,5-1,5-DAP, 1，6-diaminohexane, 1,7-diaminourea heptane, 1, the 8-diamino-octane, 1,9-diaminourea nonane, 1,10-diamino decane, 1,11-diaminourea hendecane, 1,12-diaminourea dodecane, 1,13-diaminourea tridecane, 1, the 14-diaminourea tetradecane, 1,15-diaminourea pentadecane, 1,16-diaminourea hexadecane, 1,17-diaminourea heptadecane, 1,18-diaminourea octadecane, 1,19-diaminourea nonadecane, 1,20-diaminourea eicosane; Or have a chemical compound of following formula:
H 2N-[(CR 1’R 2’) pO] q[CR 3’R 4’] r-NH 2
R wherein 1 ', R 2 ', R 3 'And R 4 'Be independently selected from hydrogen and alkyl, preferred hydrogen and methyl, p is 2-4, wherein p group CR 1 'R 2 'In residue R 1 'And R 2 'Can be identical or different, q is 0-20, preferred 0-4; R is 0-20, preferred 2-4, and wherein when q=0, r is not 0, and r group CR wherein 3 'R 4 'In residue R 3 'And R 4 'Can be identical or different; Particularly with 1, the reaction of 4-diaminobutane, generate the hydroxyalkyl starch derivative of aminofunctional, the hydroxyalkyl starch derivative of this aminofunctional further with the reaction of dual functional at least chemical compound, it is at least one functional group in aldehyde radical, ketone group, hemiacetal group or the α-SH-β amino with the functional group of the amino reaction of the hydroxyalkyl starch of aminofunctional and one that this dual functional at least chemical compound comprises one.This another kind of difunctional compound is preferably from formoxyl benzoic acid, 4-formoxyl benzoic acid pentafluorophenyl group ester, 4-formoxyl benzoic acid N-hydroxy-succinamide ester, 4-(4-formoxyl-3; 5-dimethoxy phenoxy group) butanoic acid and 4-formoxyl benzoyl oxide perhaps are selected from the biocompatible compound of alpha-keto carboxylic acid, neuraminic acid or derivatives thereof and pyridoxal 5-phosphate.
In the another kind of specific embodiment (ii) of (a) (2), the hydroxyalkyl starch that comprises described α-SH-β amino obtains by the following method, and the method comprises hydroxyalkyl starch in the randomly oxidation of its reducing end under neutral; Make the M of functional group of this oxidation or unoxidized reducing end under neutral and a kind of chemical compound 1Reaction, this chemical compound is except M 1Also comprise the Q of functional group outward, generate the first hydroxyalkyl starch derivative; And the V of the functional group reaction that makes the Q of functional group and a kind of chemical compound of this first hydroxyalkyl starch derivative; this chemical compound also comprises the α that randomly protected-SH-β amino group except V, generate the hydroxyalkyl starch derivative of the α of randomly protection-SH-β aminofunctional.The M of functional group 1With Q preferably as mentioned above.
In the preferred specific embodiment, the chemical compound of the α that comprises V and randomly protect-SH-β amino is the cysteine or derivatives thereof, and V is carboxyl and reactive carboxyl, preferred reactive ester or carboxylic acid anhydrides.
Preferably, (a) (2) (ii) in, not the hydroxyalkyl starch of oxidised form with amino M 1React by reductive amination with the difunctional compound of amino Q.Especially, this difunctional compound can be selected from primary amine, ammonia, 1，2-diaminoethane, 1, the 3-diaminopropanes, 1, the 4-diaminobutane, 1,5-1,5-DAP, 1，6-diaminohexane, 1,7-diaminourea heptane, 1, the 8-diamino-octane, 1,9-diaminourea nonane, 1,10-diamino decane, 1,11-diaminourea hendecane, 1,12-diaminourea dodecane, 1,13-diaminourea tridecane, 1, the 14-diaminourea tetradecane, 1,15-diaminourea pentadecane, 1,16-diaminourea hexadecane, 1,17-diaminourea heptadecane, 1,18-diaminourea octadecane, 1,19-diaminourea nonadecane, 1,20-diaminourea eicosane; Or have a chemical compound of following formula:
H 2N-[(CR 1’R 2’) pO] q[CR 3’R 4’] r-NH 2
R wherein 1 ', R 2 ', R 3 'And R 4 'Be independently selected from hydrogen and alkyl, preferred hydrogen and methyl, p is 2-4, wherein p group CR 1 'R 2 'In residue R 1 'And R 2 'Can be identical or different, q is 0-20, preferred 0-4; R is 0-20, preferred 2-4, and wherein when q=0, r is not 0, and r group CR wherein 3 'R 4 'In residue R 3 'And R 4 'Can be identical or different; 1,4-Diaminobutane particularly.
Preferably, (a) (2) (ii) in, the hydroxyalkyl starch of its reducing end under neutral oxidation with amino M 1React by the lactone ring-opening reaction with the difunctional compound of amino Q.Especially, this difunctional compound is selected from 1，2-diaminoethane, 1, the 3-diaminopropanes, 1, the 4-diaminobutane, 1,5-1,5-DAP, 1，6-diaminohexane, 1,7-diaminourea heptane, 1, the 8-diamino-octane, 1,9-diaminourea nonane, 1,10-diamino decane, 1,11-diaminourea hendecane, 1,12-diaminourea dodecane, 1,13-diaminourea tridecane, 1, the 14-diaminourea tetradecane, 1,15-diaminourea pentadecane, 1,16-diaminourea hexadecane, 1,17-diaminourea heptadecane, 1,18-diaminourea octadecane, 1,19-diaminourea nonadecane, 1,20-diaminourea eicosane; Or have a chemical compound of following formula:
H 2N-[(CR 1’R 2’) pO] q[CR 3’R 4’] r-NH 2
R wherein 1 ', R 2 ', R 3 'And R 4 'Be independently selected from hydrogen and alkyl, preferred hydrogen and methyl, p is 2-4, wherein p group CR 1 'R 2 'In residue R 1 'And R 2 'Can be identical or different, q is 0-20, preferred 0-4; R is 0-20, preferred 2-4, and wherein when q=0, r is not 0, and r group CR wherein 3 'R 4 'In residue R 3 'And R 4 'Can be identical or different; 1,4-Diaminobutane particularly.
Preferably, (a) (2) (ii) in, hydroxyalkyl starch at first with the difunctional compound reaction with amino Q, this chemical compound is as mentioned above preparation preferably; Then with the hydroxyalkyl starch of gained aminofunctional further with the difunctional compound reaction of the carboxyl with activation and aldehyde radical, ketone group or hemiacetal group.
In the particularly preferred specific embodiment, (a) (2) the inventive method in (ii) comprises: the hydroxyalkyl starch that makes preferential oxidation with have amino M 1Chemical compound reaction, particularly Diaminoalkyl chemical compound, especially 1,4-Diaminobutane with amino Q; Then make hydroxyalkyl starch and the reaction of a kind of chemical compound of aminofunctional, this chemical compound is selected from cysteine and the 4-formoxyl benzoic acid of optional protection.
The active substance that comprises at least one aldehyde radical, ketone group, hemiacetal group or α-SH-β amino can be provided by any suitable method.
In the preferred specific embodiment, this comprises the active substance of described aldehyde radical, ketone group, hemiacetal group or described α-SH-β amino, and preferably protein, peptide, synthetic peptide or the oligonucleotide of optional modification are obtained by following methods, and the method comprises:
(b) (1) is during its preparation or chemical modification, with the amino active substance of introducing of at least one aldehyde radical, ketone group, hemiacetal group or at least one α-SH-β, perhaps
(b) (2) make active substance and dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 2And Q, the M of functional group 2With the active substance reaction, and the Q of another functional group is
(i) aldehyde radical, ketone group, hemiacetal group or α-SH-β is amino; Or
(ii) chemical modification generates the functional group of aldehyde radical, ketone group, hemiacetal group or α-SH-β amino.
Preferably in (b) (1), active substance for prepare-preferably adopt by organic synthesis synthetic resin production-protein or peptide, this synthetic method allows generation aldehyde radical functionalized, that ketone group is functionalized, hemiacetal group is functionalized or α-SH-β aminofunctional protein or peptide; Perhaps wherein in (b) (1), protein or the peptide of active substance for adopting expression vector to produce, described carrier can generate protein or peptide that aldehyde radical is functionalized, that ketone group is functionalized, hemiacetal group is functionalized or α-SH-β aminofunctional; Perhaps wherein in (b) (1), active substance is protein or peptide, and the main chain of this protein and peptide is replaced by aldehyde radical, ketone group, hemiacetal group or α-SH-β is amino; Perhaps wherein in (b) (1), active substance is protein or peptide, the main chain keyed jointing of wherein said aldehyde radical, ketone group, hemiacetal group or described α-SH-β directly amino and this protein or peptide or be the part of the side chain of this main chain.
In the preferred embodiment of (b) (1), this active substance obtains by the modification of active substance, particularly protein or peptide by oxidation to introduce aldehyde radical.
In the preferred specific embodiment, this active substance is protein or peptide, and aldehyde radical, ketone group or hemiacetal group are included in the carbohydrate part saccharide fragment of polypeptide; Especially, wherein saccharide fragment carbohydrate partly is selected from hydroxy aldehyde, hydroxy-ketone and chemical modification thing thereof.This saccharide fragment carbohydrate part can be the derivant of naturally occurring saccharide fragment carbohydrate part and be selected from glucose, galactose, mannose and sialic acid, can be by randomly chemical oxidation or oxydasis, the galactose of the oxidation of preferred carbohydrate side chain or the sialic acid residues of oxidation, the more preferably terminal galactose of carbohydrate side chain or sialic acid residues, the oxidation of end carbon hydrate is preferably carried out through enzymatic pathway or through chemistry route, and chemical oxidation preferably adopts periodate to carry out.
In the preferred specific embodiment, carbohydrate partly be naturally occurring press hydrate partly derivant and be terminal galactose, it is through oxydasis or through chemical oxidation, wherein this terminal galactose residues randomly obtains after the sialic acid cracking endways.
In the preferred specific embodiment, α-SH-β amino be included in active substance-preferred protein or peptide-cysteine residues in, this cysteine residues is preferably the N-terminal cysteine residue of active substance.
In the preferred specific embodiment, active substance is modified protein or the peptide with N-terminal cysteine residue, and described cysteine residues is not the component part of disulphide bridges; Especially wherein, modified protein or peptide with N-terminal cysteine residue are the anomaly of naturally occurring protein or peptide, obtain by following: add cysteine residues on the-terminal amino acid to (1), (2) replace-terminal amino acid with cysteine, perhaps (3) cancellation-terminal amino acid is until obtain terminal cysteine.
Mentioned cysteine can be introduced in the peptide between synthesis stage.Peptide is synthetic to be known (W.Chang, P.D.White in the prior art; Fmoc solid phase peptidesynthesis, a practical approach; Oxford University Press, Oxford, 2000, ISBN 0199637245).
The polypeptide of restructuring can obtain with the Protocols in Molecular Biology of standard, for example at Molecular Cloning:A Laboratory Manual, and the third edition, the people such as Sambrook edit, the technology described in the CSHL Press 2001.Briefly, polypeptide can be expressed by recombinant expression carrier, and described recombinant expression carrier comprises the nucleic acid of the required polypeptide of encoding, with this nucleic acid be operably connected at least a can be so that on the adjusting sequence that required polypeptide is expressed.For example, can isolate the nucleotide sequence of the required polypeptide of coding and it is cloned in the expression vector, then this expression vector be transferred to the suitable host cell of expressing for described polypeptide.Such carrier can be plasmid, phasmid or cosmid.For example, can be in suitable mode with cloned nucleic acid molecule (referring to above Molecular Cloning) in protokaryon or carrier for expression of eukaryon.Such expression vector comprise at least one promoter and can comprise for the signal that begins to translate and-in the situation of prokaryotic expression carrier-can also comprise for the signal that finishes translation, and in the situation of carrier for expression of eukaryon, preferably comprise for the expression signal that finishes to transcribe and be used for polyadenylation.At the example of the prokaryotic expression carrier of expression in escherichia coli for for example such as US 4,952, the promoter of being identified take t7 rna polymerase described in 496 is the expression vector on basis; The example of the carrier for expression of eukaryon of in saccharomyces cerevisiae, expressing such as for carrier G426/Met25 or P526/Gall (people such as Mumberg, (1994) NucI.Acids Res., 22,5767-5768); Expression vector example in insecticide is expressed for example is baculovirus vector, such as among EP-B1-0127839 or the EP-B1-0549721 or by the described carrier of the people such as Ciccarone (" in escherichia coli, produce recombinant baculovirus DNA (" Generation of recombinantBaculovirus DNA in E.coli using baculovirus shuttle vector ") (1997) Volume 13 with the baculovirus shuttle vector; U.Reischt; ed. (Totowa, NJ:Humana Press Inc.)); And the expression vector example in mammalian cell expression for example is carrier Rc/CMW and Rc/ASW and SW40-carrier, these carriers are known and can commerce buy, the perhaps EBNA-system described in the embodiment 4, the pCytTs (people such as Boorsma based on Syndebis (Sindbis) replicon, (2002) Biotechnol.Bioeng.79 (6): 602-609), sindbis alphavirus expression system (Schlesinger (1993) TrendsBiotechnoI.11 (1): 18-22) or gland virus expression system (people such as He, (1998) Proc.NatI.Acad.Sci.USA 95:2509-2514).Prepare the molecular biology method of these expression vectors and be used for host cell is carried out transfection and method that such transfected cell is cultivated and be conventionally known to one of skill in the art by the described host cell preparation that is converted and the condition that obtains polypeptide of the present invention.
Polypeptide with required N-terminal cysteine residue can be by the as mentioned above polypeptide generation of expression and purification, by interested polypeptide being cloned into the terminal homing sequence of N-back, removing the terminal homing sequence of this N-and obtain having the polypeptide of required N-terminal cysteine residue.
It for example can be by to expressing and the polypeptide of purification carries out the Proteolytic enzyme cracking and carries out as mentioned above.In this class situation, clone, express a kind of fused polypeptide and it is carried out purification, wherein cysteine residues is close to a kind of high selectivity protease cracking position, for example the Cys residue is close to factor Xa cracking position: Ile (Glu/Asp) Gly Arg| (Cys/His), perhaps His or Cys residue are close to enterokinase cracking position: Asp Asp Asp Asp Lys| (Cys/His), wherein | and expression is by the position of protease cracking.
It can also by for example during expressing polypeptide being carried out cracking, for example be undertaken by the signal peptidase cracking in the ER transposition stage.In this type of situation, clone and express a kind of fused polypeptide, wherein Cys residue next-door neighbour points to the signal peptide of secretory pathway with this recombinant polypeptide (its summary can be referring to people such as Rapoport, Annu Rev Biochem.1996; 65:271-303).
Thereby handle the coded sequence of recombinant polypeptide so that can be created in (Sambrook, the same) that molecular biology method that desired location has the coded sequence of required Cys residue polypeptide is known in the art.
To the preferred specific embodiment of (b) (2) as above description to (a) (2), as long as active substance contains and above-mentioned M 1The functional group of radical reaction, the particularly preferred M of functional group 2With Q as above to the M of functional group 1Description with Q.
In the particularly preferred specific embodiment, active substance is selected from protein and peptide and obtains according to above (b) (1), preferably as mentioned above.
In the particularly preferred specific embodiment according to (A), the hydroxyalkyl starch that comprises aldehyde radical (ii) obtains by (a) (2), preferably obtains by following: make the hydroxyalkyl starch of preferential oxidation and have amino M 1With the chemical compound reaction of amino Q, this chemical compound is in particular the Diaminoalkyl chemical compound, especially is 1,4-Diaminobutane; Then make the hydroxyalkyl starch and the difunctional compound reaction that comprises aldehyde radical of aminofunctional, this chemical compound is in particular 4-formoxyl benzoic acid; Then make the α of the optional protection of the aldehyde radical of this hydroxyalkyl starch and active substance-amino reaction of SH-β; active substance (i) obtains by (b) (2); preferably introduce this active substance, particularly protein or peptide by the cysteine that will choose protection wantonly.
In the particularly preferred specific embodiment according to (B), the active substance that comprises aldehyde radical obtains by (b) (1), preferably following obtaining: by chemical modification, preferably by aldehyde radical is introduced in protein or peptide oxidation; Then the aldehyde radical that makes this active substance and the hydroxyalkyl starch reaction that comprises α-SH-β amino, described hydroxyalkyl starch derives from (a) (2) (ii), preferably the hydroxyalkyl starch by making preferential oxidation with have amino M 1With the chemical compound reaction of amino Q, this chemical compound is in particular two aminoalkyl chemical compounds, especially is 1,4-Diaminobutane; Then make the hydroxyalkyl starch of aminofunctional and comprise the difunctional compound of α-SH-β amino, particularly cysteine reaction.
According to the reaction of (A) and active substance of the present invention (B) and hydroxyalkyl starch can be in the mixture of any suitable solvent or at least two kinds of solvents, under suitable pH and suitable reaction temperature, carry out.
In the preferred specific embodiment, reaction (A) or (B) at temperature 0-40 ℃, preferred 0-25 ℃, particularly preferably 20-25 ℃, in the presence of solvent, pH 3.5-10, preferred 4-8, particularly preferably carry out under the 4.8-8.0, preferred 0.1-24h of response time, be in particular approximately 21h.
Solvent is preferably from water, aqueous buffer solution, DMF (dimethyl formamide), DMSO (dimethyl sulfoxide), DMA (dimethyl acetylamide) and composition thereof.
The molecular proportion of hydroxyalkyl starch and active substance is approximately 1: 1 to 200: 1, preferred 10: 1 to 100: 1, is in particular 40: 1 to 70: 1.
In addition, the present invention relates to the active substance that can be obtained by said method and the conjugate of hydroxyalkyl starch.
In the another kind of specific embodiment, the present invention relates to the conjugate of active substance and hydroxyalkyl starch, wherein active substance and hydroxyalkyl starch are by having the chemical residue covalency keyed jointing of structure shown in formula (I), (I ') or (I "):
Figure S2006800333268D00321
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4Be independently selected from straight chain, ring-type and/or branched alkyl, aryl, heteroaryl, aralkyl and the heteroarylalkyl of hydrogen, randomly suitable replacement, preferred hydrogen,
Described conjugate has the structure shown in formula (IV), (IV ') or (IV "):
Figure S2006800333268D00331
Wherein HAS ' is the residue of hydroxyalkyl starch or derivatives thereof, with aldehyde radical, ketone group or hemiacetal group keyed jointing; Wherein AS ' is the residue of active substance or derivatives thereof, with the amino keyed jointing of α-SH-β;
Perhaps have the structure shown in formula (V), (V ') or (V "):
Figure S2006800333268D00341
Wherein HAS ' is the residue of hydroxyalkyl starch or derivatives thereof, with the amino keyed jointing of α-SH-β; Wherein AS ' is the residue of active substance or derivatives thereof, with aldehyde radical, ketone group or hemiacetal group keyed jointing.
In the preferred specific embodiment, this conjugate is selected from:
Figure S2006800333268D00351
R wherein 5As above to R 1To R 4Definition,
Figure S2006800333268D00361
R wherein 5As above to R 1To R 4Definition,
Figure S2006800333268D00362
Figure S2006800333268D00371
With
Figure S2006800333268D00372
Among formula IV ' a, IV ' b, V ' b or the V ' c, n is integer, and preferred n is 0-20, and in formula Va, Vb, V ' d or V ' e, n is integer, and preferred n is 1-20.In the preferred specific embodiment of formula IV ' b and V ' c, n is 2-4, is in particular 2.
In the preferred specific embodiment, conjugate is
Figure S2006800333268D00373
Wherein R ', R " and/or R
Figure 2006800333268_22
As the definition to formula II, and wherein at least one glucose unit of HES, R ', R " and/or R
Figure 2006800333268_23
One of at least be independently selected from following:
Figure S2006800333268D00374
Figure S2006800333268D00381
With
Figure S2006800333268D00382
Wherein n is integer, preferably 1-20 and/or wherein R ', R " and/or R One of at least be-(CH 2CH 2O) m-R #, wherein m is integer, preferred 1-3, R #Be selected from formula (VIa), (VIb), (VIc) and (VId).
In the another kind of specific embodiment, the present invention relates to the hydroxyalkyl starch derivative of α-SH-β aminofunctional, be selected from:
Figure S2006800333268D00383
R wherein 5As above to R 1To R 4Definition,
And
Figure S2006800333268D00384
Wherein n is integer, preferred 0-20,
Perhaps be selected from:
Figure DEST_PATH_G200680033326801D00071
Wherein R ', R " and/or R ' " as the definition to formula II, and wherein at least one glucose unit of HES, R ', R " and/or R ' " be independently selected from one of at least following:
Figure DEST_PATH_G200680033326801D00072
With
Wherein n is integer, preferred 1-20 and/or wherein R ', R " and/or R ' " one of at least be-(CH 2CH 2O) m-R ##, wherein m is integer, preferred 1-3, R ##Be selected from formula (VI ' a), (VI ' b) and (VI ' c).
Be used in particular for the abbreviation HES among formula (VI) and (VI ') " and HES ' refer to the residue of HES molecule; this residue is with bonding HES shown in (VI) and (VI ') " and the bglii fragment of HES ', consist of the HES molecule, the part of the conjugate that this molecule defines among constitutional formula (VI) and (VI ') again conversely.
In the another kind of specific embodiment, the present invention relates to above-mentioned conjugate, be used in the Therapeutic Method of human body or animal body or as therapeutic agent.
Conjugate purity according to the present invention can be at least 50%, more preferably at least 70%, more preferably at least 90%, is in particular at least 95% or at least 99%.In the particularly preferred specific embodiment, namely there is not other by-product in this conjugate purity 100%.
Therefore, according on the other hand, the invention still further relates to a kind of compositions that can comprise conjugate of the present invention, wherein the content of conjugate for 50wt-% at least, more preferably at least 70wt-%, more preferably at least 90wt-%, be in particular at least 95wt-% or at least 99wt-%.In the particularly preferred specific embodiment, said composition can be comprised of this conjugate, and namely the content of this conjugate is 100wt-%.
Thereby, the invention still further relates to a kind of pharmaceutical composition, the conjugate that comprises above-mentioned conjugate or can be obtained by said method.
And, the invention still further relates to a kind of pharmaceutical composition, the conjugate that comprises above-mentioned conjugate or can be obtained by said method, described pharmaceutical composition also comprises at least a pharmaceutically acceptable diluent, adjuvant or carrier.
Summary of drawings
Fig. 1 represents by the analysis of sds gel electrophoresis to protein-HES conjugate crude product, and this conjugate forms and obtains through Thiazolidine from the EPO of H-Cys (H)-HES10/0.4 and oxidation.
Swimming lane X:Roti
Figure 2006800333268_28
The molecular weight marker of-Mark STANDARD (Carl Roth GmbH+Co.KG, Karlsruhe, D) from the top to the bottom: 200kDa, 119kDa, 66kDa, 43kDa, 29kDa, 20kDa, 14.3kDa
The coupling of the EPO of swimming lane A:H-Cys (H)-HES 10/004 and oxidation
Fig. 2 represents that this conjugate is from H-Cys-peptide-NH by the analysis of sds gel electrophoresis to protein-HES conjugate crude product 2Form and obtain through Thiazolidine with aldehyde radical HES.
Swimming lane X:Roti
Figure 2006800333268_29
The molecular weight marker of-Mark STANDARD (Carl Roth GmbH+Co.KG, Karlsruhe, D) from the top to the bottom: 200kDa, 119kDa, 66kDa, 43kDa, 29kDa, 20kDa, 14.3kDa
Swimming lane A: the coupling of aldehyde radical HES 10/0.7 under pH 4.6
Swimming lane B: the coupling of aldehyde radical HES 50/0.7 under pH 4.6
Swimming lane C: reaction contrast: peptide is pH 4.6 times
Swimming lane D: the coupling of aldehyde radical HES 10/0.7 under pH 8.0
Swimming lane E: the coupling of aldehyde radical HES 50/0.7 under pH 8.0
Swimming lane F: reaction contrast: peptide is pH 8.0 times
Fig. 3 represents by the analysis of agargel electrophoresis to DNA-HES conjugate crude product, and this conjugate forms and obtains through Thiazolidine from the DNA of H-Cys (H)-HES 50/0.7 and aldehyde modification, described in following experimental section 8.4-8.5.
The molecular weight marker of swimming lane X:pUC19/Msp I labelling (Carl Roth GmbH+Co.KG, Karlsruhe, D) from the top to the bottom: 501/489bp, 404bp, 331bp, 242bp, 190bp, 147bp, 111/110bp, 67bp.
Swimming lane A, the coupling of DNA under pH4.6 of top row: H-Cys (H)-HES 50/0.7 and FBA modification is described in experiment part 8.5;
Swimming lane B, top row: reaction contrast; The coupling of DNA under pH 4.6 of Oxo-HES 50/0.7 and FBA modification is described in experiment part 8.5;
Swimming lane C, the coupling of DNA under pH8.0 of top row: H-Cys (H)-HES 50/0.7 and FBA modification is described in experiment part 8.5;
Swimming lane D, top row: reaction contrast; The coupling of modification DNA under pH 8.0 of Oxo-HES 50/0.7 and FBA is described in experiment part 8.5;
Swimming lane E: top row: reaction contrast; The DNA of FBA modification is in water, without the HES derivant;
Swimming lane A, the coupling of DNA under pH 4.6 of end row: H-Cys (H)-HES 50/0.7 and formyl indole modification is described in experiment part 8.5;
Swimming lane B, end row: reaction contrast; The coupling of DNA under pH 4.6 of Oxo-HES 50/0.7 and formyl indole modification is described in experiment part 8.5;
Swimming lane C, the coupling of DNA under pH 8.0 of end row: H-Cys (H)-HES 50/0.7 and formyl indole modification is described in experiment part 8.5;
Swimming lane D, end row: reaction contrast; Oxo-HES 50/0.7 and the coupling of formyl indole modification DNA under pH 8.0 are described in experiment part 8.5;
Swimming lane E: end row: reaction contrast; The DNA of formyl indole modification is in water, without the HES derivant.
Fig. 4-6 expression detects by HPLC reverse-phase chromatography UV under 290nm, analysis to daunorubicin-HES conjugate crude product, this conjugate forms and obtains through Thiazolidine from H-Cys (H)-HES 50/0.7 and daunorubicin, described in following experimental section 9..
Fig. 4: the HPLC of conjugate crude product analyzes;
Fig. 5: the HPLC of daunorubicin analyzes;
The HPLC of Fig. 6: H-Cys (H)-HES 50/0.7 analyzes;
Fig. 7-9 expression detects by HPLC reverse-phase chromatography UV under 220nm, to tylosin--the analysis of HES conjugate crude product, this conjugate forms and obtains through Thiazolidine from H-Cys (H)-HES 50/0.7 and tylosin, described in following experimental section 9.
Fig. 7: the HPLC of conjugate crude product analyzes
Fig. 8: the HPLC of tylosin analyzes
The HPLC of Fig. 9: H-Cys (H)-HES 50/0.7 analyzes
Figure 10 represents by the analysis of sds gel electrophoresis to peptide-HES conjugate crude product, described in following experimental section 10..
Swimming lane X:
Figure DEST_PATH_G200680033326801D00081
The molecular weight marker of-Mark STANDARD (Carl Roth GmbH+Co.KG, Karlsruhe, D) from the top to the bottom: 200kDa, 119kDa, 66kDa, 43kDa, 29kDa, 20kDa, 14.3kDa
Swimming lane A:HES 10/0.7 and peptide coupling under 21 ℃ in DMF
Swimming lane B:HES 10/0.7 and peptide coupling under 37 ℃ in DMF
Swimming lane C: reaction contrast: peptide is in DMF under 50 ℃
The coupling under 50 ℃, pH4.6 of swimming lane D:HES 10/0.7 and peptide
Swimming lane E:HES 10/0.7 and peptide coupling under 50 ℃ in DMF
The coupling under 1% trinitrotoluene, 50 ℃, pH 4.6 of swimming lane F:HES 10/0.7 and peptide
The coupling in DMF, under 1% trinitrotoluene, 50 ℃ of swimming lane G:HES 10/0.7 and peptide
Embodiment
1.H-Cys (S-t-Bu)-HES 10/0.4 synthetic
1.1 the HES synthesizing amino HES 10/0.4 from oxidation
With Oxo-HES 10/0.4 (4g, MW=10.9kDa, DS=0.4, SupramolParenteral Colloids GmbH, Rosbach-Rodheim, D) heat whole night for 80 ℃ times in a vacuum, be dissolved into (25mL, Fluka, Sigma-Aldrich Chemie GmbH in the anhydrous dimethyl sulphoxide under the argon, Tautkirchen, D) and add 1,4-Diaminobutane (4.0mL, Fluka, Sigma-Aldrich Chemie GmbH, Tautkirchen, D).45 ℃ lower stirs and adds to this reactant mixture in the 2-propanol (125mL, Carl RothGmbH+Co.KG, Karlsruhe, D) behind the 24h and at-20 ℃ of lower heat insulating culture 1h.Precipitated product is collected 4 ℃ of lower centrifugal filtrations, collected with 2-propanol (100mL) washing and centrifugal filtration.This crude product is dissolved in the water (20mL, Milli-Q), with Milli-Q water dialysis 43h (SnakeSkin Dialysis tubing, 3.5kDa MWCO, Perbio SciencesDeutschland GmbH, Bonn, D), then lyophilization.The yield of separated product is 65%.
1.2 from the synthetic Fmoc-Cys (stBu) of amino HES-HES 10/0.4
With Fmoc-Cys (S-tBu)-OH (150mg, Fluka, Sigma-Aldrich ChemieGmbH, Tautkirchen, D) and 1-hydroxyl-1H-benzotriazole (61.4mg, Aldrich, Sigma-Aldrich Chemie GmbH, Tautkirchen, D) be dissolved in N, dinethylformamide (3.5mL, the synthetic level of peptide, Biosolve, Valkenswaard, NL) in and add N, N '-DIC (54.3 μ L, Fluka, Sigma-Aldrich Chemie GmbH, Taufkirchen, D).Behind 21 ℃ of lower heat insulating culture 30min, add the amino HES 10/0.4 (0.35g) of gained in 1.1, after the stirred overnight, add this reactant mixture to ice-cold acetone (Carl Roth GmbH+Co.KG, Karlsruhe under the room temperature, D) with ethanol (DAB, Sonnenberg, Braunschweig, D) 1: 1 mixture (35mL, v/v) in ,-20 ℃ of lower heat insulating culture 1h.Precipitated product is collected, is dissolved in the water (20mL, Milli-Q) and adds dichloromethane (20mL, Carl Roth GmbH+Co.KG, Karlsruhe, D) 4 ℃ of lower centrifugalize.Should mix mix homogeneously and centrifugalize.The upper strata aqueous fluid was dialysed 41 hours and lyophilization with Milli-Q water (SnakeSkin dialysis tubing, 3.5kDa MWCO, PerbioSciences Deutschland GmbH, Bonn, D).The yield of separated product is 78%.
1.3 from Fmoc-Cys (stBu)-HES 10/0.4 synthetic H-Cys (stBu)-HES 10/0.4
Gained Fmoc-Cys (S-tBu) HES 10/0.4 (0.35g) in 1.2 is dissolved in the piperidine solution (4mL, 20%in DMF, v/v, Fluka, Sigma-Aldrich Chemie GmbH, Taufkirchen, D).After stirring 15min under the room temperature, this reactant mixture is added among 1: 1 mixture (35mL, the v/v) of ice-cold acetone and ethanol and at-20 ℃ of lower heat insulating culture 1h.Precipitated product is collected 4 ℃ of lower centrifugalize, with t-butyl methyl ether (25mL, Acros Organics, Geel, B) washing and at-20 ℃ of lower heat insulating culture 1h.Precipitated product is collected and drying in nitrogen current 4 ℃ of lower centrifugalize.The yield of separated product is 68%.
2. aldehyde radical HES's 10/0.7 is synthetic
2.1 the HES synthesizing amino HES 10/0.7 from oxidation
With Oxo-HES 10/0.7 (6.02g, MW=14.7kDa, DS=0.76, SupramolParenteral Colloids GmbH, Rosbach-Rodheim, D) heat 16.5h 80 ℃ times in a vacuum, be dissolved into (25mL, Fluka, Sigma-Aldrich Chemie GmbH in the anhydrous dimethyl sulphoxide under the argon, Tautkirchen, D) and add 1,4-Diaminobutane (5.1mL, Fluka, Sigma-Aldrich Chemie GmbH, Tautkirchen, D).40 ℃ lower stirs behind the 17h among 1: 1 mixture (150mL, the v/v) that this reactant mixture is added to ice-cold acetone and ethanol.Precipitated product is collected 4 ℃ of lower centrifugal filtrations, collected with the washing of 1: 1 mixture (40mL, v/v) and the centrifugal filtration of ice-cold acetone and ethanol.This crude product is dissolved in the water (80mL), with Milli-Q water dialysis 42h (SnakeSkin Dialysis tubing, 3.5kDa MWCO, Perbio Sciences DeutschlandGmbH, Bonn, D), then lyophilization.The yield of separated product is 67%.
2.2 from the synthetic aldehyde radical HES 10/0.7 of amino HES
With 4-formoxyl benzoic acid (75mg; Lancaster Synthesis; Frankfurt/Main, D) and 1-hydroxyl-1H-benzotriazole (115mg, Aldrich; Sigma-Aldrich ChemieGmbH; Tautkirchen, D) be dissolved in DMF (DMF; 5mL; the synthetic level of peptide, Biosolve, Valkenswaard; NL) in and add N; N '-DIC (102 μ L, Fluka, Sigma-Aldrich Chemie GmbH; Taufkirchen, D).At room temperature behind the heat insulating culture 30min, add amino HES 10/0.7 (0.5g, MW=14.7kDa, DS=0.76).After the vibration whole night, this reactant mixture is added in the 2-propanol (30mL, Carl Roth GmbH+Co.KG, Karlsruhe, D) and at-20 ℃ of lower heat insulating culture 1h under the room temperature.Precipitated product is collected 4 ℃ of lower centrifugal filtrations, collected with 2-propanol (30mL) washing and centrifugal filtration.This crude product is dissolved in the water (10mL, Milli-Q), with Milli-Q water dialysis 44h (SnakeSkin Dialysis tubing, 3.5kDa MWCO, PerbioSciences Deutschland GmbH, Bonn, D), then lyophilization.The yield of separated product is 86%.
3. aldehyde radical HES's 50/0.7 is synthetic
3.1 the HES synthesizing amino HES 50/0.7 from oxidation
With Oxo-HES 50/0.7 (6.09g, MW=56.7kDa, DS=0.76, SupramolParenteral Colloids GmbH, Rosbach-Rodheim, D) heat 16.5h 80 ℃ times in a vacuum, be dissolved into (32mL, Fluka, Sigma-Aldrich Chemie GmbH in the anhydrous dimethyl sulphoxide under the argon, Tautkirchen, D) and add 1,4-Diaminobutane (1.2mL, Fluka, Sigma-Aldrich Chemie GmbH, Tautkirchen, D).40 ℃ lower stirs behind the 17h among 1: 1 mixture (150mL, the v/v) that this reactant mixture is added to ice-cold acetone and ethanol.Precipitated product is collected 4 ℃ of lower centrifugal filtrations, collected with the washing of 1: 1 mixture (40mL, v/v) and the centrifugal filtration of ice-cold acetone and ethanol.This crude product is dissolved in the water (80mL), with Milli-Q water dialysis 42h (SnakeSkin Dialysis tubing, 3.5kDa MWCO, Perbio Sciences DeutschlandGmbH, Bonn, D), then lyophilization.The yield of separated product is 82%.
3.2 from the synthetic aldehyde radical HES 50/0.7 of amino HES
With 4-formoxyl benzoic acid (124mg; Lancaster Synthesis; Frankfurt/Main, D) and 1-hydroxyl-1H-benzotriazole (174mg, Aldrich; Sigma-Aldrich ChemieGmbH; Tautkirchen, D) be dissolved in DMF (DMF; 38mL; the synthetic level of peptide, Biosolve, Valkenswaard; NL) in and add N; N '-DIC (155 μ L, Fluka, Sigma-Aldrich Chemie GmbH; Taufkirchen, D).At room temperature behind the heat insulating culture 30min, add amino HES 50/0.7 (3.80g, MW=56.7kDa, DS=0.76).After the vibration whole night, this reactant mixture is added in the 2-propanol (160mL, Carl Roth GmbH+Co.KG, Karlsruhe, D) and at-20 ℃ of lower heat insulating culture 1h under the room temperature.Precipitated product is collected 4 ℃ of lower centrifugal filtrations, be dissolved among the DMF (20mL), precipitate as mentioned above and the centrifugal filtration collection with the 2-propanol.This crude product is dissolved in the water, with Milli-Q water dialysis 24h (SnakeSkin Dialysis tubing, 3.5kDa MWCO, Perbio Sciences Deutschland GmbH, Bonn, D), then lyophilization.Product is dissolved in the water (20mL), and with 1: 1 mixture (150mL, v/v) precipitation of ice-cold acetone and ethanol ,-20 ℃ of lower heat insulating culture 1h and centrifugal filtration are collected.This crude product is dissolved in the water (29mL), with Milli-Q water dialysis 24h (SnakeSkin Dialysis tubing, 10kDa MWCO, Perbio Sciences Deutschland GmbH, Bonn, D), then lyophilization.The yield of separated product is 77%.
4. the EPO from H-Cys (H)-HES 10/0.4 and oxidation forms Thiazolidine
4.1H-Cys (StBu)-deprotection of HES 10/0.4
The H-Cys (StBu) that obtains among the embodiment 1-HES 10/0.4 (10mg) is dissolved in (pH 4.6 for 1mL, 0.1M in the sodium-acetate buffer, 10mM EDTA) and add hydrochloric acid three-(2-carboxyethyl)-phosphine (2.8mg, TCEP, Acros Organics, Geel, B).Excessive TCEP is removed at room temperature heat insulating culture 30min and the diafiltration of this reactant mixture:
(pH 8.1 for sodium phosphate, 0.1M with buffer with reactant mixture, 1mM EDTA) is diluted to 0.5mL, at Vivaspin 500 concentrators (Viva Science, 5kDa MWCO, Hannover, Germany) in 13000xg, 20 ℃ of lower centrifugalize 10min.With buffer residual solution is diluted to 0.5mL and centrifugalize 35min as mentioned above, repeats this washing step three times.With H-Cys (H)-HES 10/0.4 solution dilution to 150 μ L, final calculating concentration is 66.6 μ g/mL with identical reaction buffer.
4.2 the coupling with the EPO of oxidation
EPO for the preparation oxidation, to remaining on the 0 ℃ of altogether 2.0mg/mLEPO solution of 20mL (EPO of restructuring preparation, have human EPO aminoacid sequence and with commercially available Epoietin α: Erypo, ORTHO BIOTECH, Jansen-Cilag or Epoietin β: NeoRecormon, Roche has similar or identical in fact characteristic, referring to EP 0 148605, EP 0 205 564, EP 0 411 678) add the ice-cold solution of 2.2mL 10mM sodium metaperiodate, obtain the sodium metaperiodate of ultimate density 1mM.With this mixture 0 ℃ of lower dark heat insulating culture 1 hour in ice bath, add 40 μ L glycerol cessation reactions, be incubated again 5 minutes.Buffer solution mixture becomes pH 5.5 sodium-acetate buffers.
Add the H-Cys (H) of gained in 4.1-HES 10/0.4 solution (5 μ L) in the EPO (14.9 μ L, 1.34mg/mL, the sodium-acetate buffer of pH 5.5) of gained oxidation.Behind the heat insulating culture 21h, analyze this reactant mixture by sds gel electrophoresis under the room temperature.Adopt XCell Sure Lock Mini Cell (Invitrogen GmbH, Karlsruhe, D) and Consort E143 power supply (CONSORTnv, Tumhout, B) to carry out sds gel electrophoresis.Bis/Tris gel with 10% and the continuous buffer of MOPS (all from Invitrogen GmbH, Karlsruhe, D) under reducing condition use according to shop instruction together.
5. from H-Cys (H)-peptide-NH 2Form Thiazolidine with aldehyde radical HES
To at peptide solution (the 2 μ Ls of its N-end with free cysteine residues, 15 μ g, 3147g/mol, 7.5mg/mL in DMF, H-CLPSLEGNMQQPSEFHCMMNWSSHIAAC-NH2, obtain by standard Fmoc solid phase synthesis and HPLC purification) the aldehyde radical HES solution (referring to table 1) of the middle 20 μ L of interpolation in reaction buffer (referring to table 1, degassed 15min in the ultra sonic bath), with heat insulating culture under this mixture room temperature whole night.Adopt Xcell Sure Lock Mini Cell (Invitrogen GmbH, Karlsruhe, D) and ConsortE143 power supply (CONSORTnv, Tumhout, B) to carry out the sds gel electrophoresis analysis.Bis/Tris gel with 10% and the continuous buffer of MOPS (all from Invitrogen GmbH, Karlsruhe, D) under reducing condition use according to shop instruction together.
Table 1: reaction condition
Aldehyde radical HES The concentration of aldehyde radical HES Reaction buffer
2. the aldehyde radical HES 10/0.7 that obtains in 119mg/mL Sodium acetate, 0.1M, pH 4.6,10mM EDTA
3. the aldehyde radical HES 50/0.7 that obtains in 595mg/mL Sodium acetate, 0.1M, pH 4.6,10mM EDTA
2. the aldehyde radical HES 10/0.7 that obtains in 119mg/mL Sodium phosphate, 0.1M, pH 8.0,1mM EDTA
3. the aldehyde radical HES 50/0.7 that obtains in 595mg/mL Sodium phosphate, 0.1M, pH 8.0,1mM EDTA
6. result
Experimental result can be as seen from the figure.
As can from above embodiment, finding out, taked two kinds of different strategies, in a kind of situation (referring to 4.), carbonyl is introduced the polysaccharide of EPO by periodate oxidation, and with the HES coupling that contains α-SH-β amino.This HES 10/0.4 derivant is synthetic by two steps from the HES in the reduction end oxidation.The HES of this oxidation changes into amino HES (referring to 1.1.) through known steps, subsequently with protected cysteine (Fmoc-Cys (StBu)-OH) acidylate (referring to 1.2.), and deprotection (referring to 1.3.).Another route (referring to 5.) adopt known amino HES (referring to 2.1. and 3.1.) and 4-formoxyl benzoic acid and at its N-end with the peptide of unprotected cysteine by acidylate synthetic aldehyde radical HES 10/0.7 and aldehyde radical HES 50/0.7 (referring to 2.2. and 3.2.).Two kinds of strategies have all realized almost completely transforming (referring to Fig. 1 and 2).Aldehyde radical HES and Cys-peptide be coupled at pH 4.6 and pH carries out for 8.0 times well equally (referring to Fig. 2, swimming lane A and D or swimming lane B and E).The reaction of this peptide and HES 10/0.7 or HES 50/0.7 failure under these reaction conditions.Under improved reaction condition, can hope to succeed.
The method according to this invention is the advantage of protein: the anomaly with N-terminal cysteine residue can obtain by expressing, and other modification of yet being convenient to the protein of chemo-selective coupling will can not obtain by this route.Thus, expectation can carry out the hetastarch of N-terminal residue by protein and hydroxyalkyl starch-particularly-selective reaction.Another advantage of the method according to this invention is the chemo-selective of aldehyde radical, ketone group or hemiacetal group and the amino reaction of α-SH-β.Thereby, expectation not with the functional group reactions of the side chain of for example protein or peptide.
7.H-Cys (H)-HES 50/0.7 synthetic
7.1 the HES synthesizing amino HES 50/0.7 from oxidation
With Oxo-HES 50/0.7 (10.1g, MW=44.2kDa, DS=0.7, Lot 502, Supramol Parenteral Colloids GmbH, Rosbach-Rodheim, D) heat 72h 80 ℃ times in a vacuum, be dissolved into (52mL, Fluka in the anhydrous dimethyl sulphoxide under the argon, Sigma-Aldrich Chemie GmbH, Tautkirchen, D) and add 1,4-diaminobutane (2.3mL, Fluka, Sigma-Aldrich Chemie GmbH, Tautkirchen, D).45 ℃ lower stirs behind the 19.5h among 1: 1 mixture (400mL, the v/v) that this reactant mixture is added drop-wise to acetone (Carl Roth GmbH+Co.KG, Karlsruhe, D) and ethanol (DAB, Sonnenberg, Braunschweig, D).Precipitated product centrifugal filtration is collected.This crude product is dissolved in the water (100mL, Milli-Q), with 20mM acetic acid dialysis 24h and water dialysis 3.5h (SnakeSkin Dialysis tubing, 10kDa MWCO, Perbio SciencesDeutschland GmbH, Bonn, D).The yield of separated product is 84% after the lyophilization.
7.2 from amino HES 50/0.7 synthetic Fmoc-Cys (StBu)-HES 50/0.7
With Fmoc-Cys (S-tBu)-OH (293.1mg, Fluka, Sigma-Aldrich ChemieGmbH, Tautkirchen, D) and 1-hydroxyl-1H-benzotriazole (155.9mg, Aldrich, Sigma-Aldrich Chemie GmbH, Tautkirchen, D) be dissolved in N, dinethylformamide (30mL, the synthetic level of peptide, Biosolve, Valkenswaard, NL) in and add N, N '-DIC (138 μ L, Fluka, Sigma-Aldrich Chemie GmbH, Taufkirchen, D).Behind 21 ℃ of lower heat insulating culture 30min, add the amino HES 50/0.7 (3.00g) of gained in 7.1.Under the room temperature after the stirred overnight, this reactant mixture is added among 1: 1 mixture (230mL, the v/v) of acetone (Carl Roth GmbH+Co.KG, Karlsruhe, D) and ethanol (DAB, Sonnenberg, Braunschweig, D).The precipitated product centrifugalize is collected, is dissolved among the DMF (30mL) and also again precipitates as mentioned above.After the centrifugalize, crude product is dissolved in the water (30mL, Milli-Q), with the dialysis of Milli-Q water (SnakeSkin Dialysis tubing, 10kDa MWCO, PerbioSciences Deutschland GmbH, Bonn, D) and lyophilization in 28 hours.The yield of separated product is 98%.
7.3 from Fmoc-Cys (StBu)-HES 50/0.7 synthetic H-Cys (StBu)-HES 50/0.7
Be dissolved in gained Fmoc-Cys (S-tBu) HES 50/0.7 (2.62g) in 7.2 among the DMF (20mL) and add piperidines (5mL, Fluka, Sigma-Aldrich Chemie GmbH, Taufkirchen, D).After stirring 15min under the room temperature, this reactant mixture is added among 1: 1 mixture (190mL, the v/v) of acetone and ethanol.The precipitated product centrifugalize is collected, be dissolved among the DMF (25mL) and also again precipitate as mentioned above.After the centrifugalize, crude product is dissolved in the water (25mL, Milli-Q), with the dialysis of Milli-Q water (SnakeSkin Dialysis tubing, 10kDa MWCO, Perbio Sciences DeutschlandGmbH, Bonn, D) and lyophilization in 45 hours.The yield of separated product is 83%.
7.4 from H-Cys (StBu)-HES 50/0.7 synthetic H-Cys (H)-HES 50/0.7
Gained H-Cys (S-tBu) HES 50/0.7 (0.50g) in 7.3 is dissolved in 50mM hydrochloric acid three-(2-carboxyethyl)-phosphine solution (Acros Organics, Geel, B is in the sodium-acetate buffer of 0.1M pH 5.0 for 5mL, TCEP).After stirring 1h under the room temperature, with this reactant mixture moisture EDTA dialysis 22 hours and 1 hour (SnakeSkin Dialysis tubing of water (Milli-Q) dialysis with 5mM, 10kDa MWCO, Perbio Sciences DeutschlandGmbH, Bonn, D is in Milli-Q water) and lyophilization.The yield of separated product is 97%.
8. with the coupling of DNA
8.1 the hybridization of the DNA that formyl indole is modified
The DNA that 5 '-formyl indole is modified (according to people such as A.Okamoto, modify, and namely the 3-formyl indole is modified by the formyl indole that Tetrahedron Lett.2002,43,4581-4583 introduce; 200 μ L, atdbio, Southampton, UK, lot A0795, M=9361g/mol, c=37.8 μ M in the water, sequence: XTACTCACCCTGCGAATTCAACTGCTGCCTC) with complementary strand (199 μ L, the atdbio of unmodified, Southampton, UK, lot A0794, M=9376g/mol, c=38.2 μ M in the water, sequence: the concentration that GAGGCAGCATTGAATTCGCAGGGTGAGTA) provides based on manufacturer is hybridized by 1: 1 mol ratio.Be incorporated in 95 ℃ of lower heat insulating culture 5min with solution is mixed, obtain the double-stranded DNA of ultimate density 0.356mg/mL.With 157 μ L (55.9 μ g) lyophilized overnight, be dissolved in water (27.9, Milli-Q) in, obtain the final calculating concentration of 2mg/mL.This concentration detects without experiment for calculating gained.
8.25 the hybridization of '-amino-C6-modifying DNA
With 5 '-amino-C6-modifying DNA (59.1nmol, biomers.net GmbH, Ulm, D, lot 00033426_1 DNA, M=9218g/mol, 59.1nmol, sequence: TACTCACCCTGCGAATTCAACTGCTGCCTC) be dissolved in (100 μ l in the water; Milli-Q).With its (38.78 μ L, 595 μ M) concentration that provides based on manufacturer is by complementary strand (the 600 μ L of 1: 1 mol ratio and unmodified, atdbio, Southampton, UK, lot A0794, M=9376g/mol, c=38.2 μ M in the water, sequence: GAGGCAGCATTGAATTCGCAGGGTGAGTA) hybridization.Be incorporated in 95 ℃ of lower heat insulating culture 5min with solution is mixed, obtain the double-stranded DNA of final calculating concentration 0.667mg/mL.This concentration detects without experiment for calculating gained.
8.3 from 5 '-DNA that amino-C6-modifies forms the DNA that FBA-modifies
With 4-formoxyl benzoic acid succinimide ester (50 μ L; 4mg/mL in DMF; Novabiochem; Merck KGaA; Darmstadt; D) add to the two strands 5 that described in 8.2, obtains '-DNA (500 μ L, 0.667mg/mL in water) that amino-C6-modifies in, with this clear solution at 21 ℃ of lower heat insulating culture 5h.With this reactant mixture in Vivaspin 500 concentrators (Viva Science, 5kDa MWCO, Hannover, Germany) at 13000 * g, 21 ℃ of lower centrifugalize 15min.Residual solution water (Milli-Q) is diluted to 0.5mL, and such as above-mentioned centrifugalize 12min, repeats this washing step three times.Dna solution is diluted with water to 167 μ L, obtains the final calculating concentration of 2mg/mL.This concentration detects without experiment for calculating gained.
8.4 form Thiazolidine from the DNA of H-Cys (H)-HES50/0.7 and formyl indole modification
HES50/0.7 derivative solution (4 μ L, 147.5mg/mL is referring to table 1) in reaction buffer (referring to following table 2) is added in the aqueous solution of the formyl indole modifying DNA that described in 8.1, obtains (1.4 μ L, 2mg/mL).Behind 21 ℃ of lower heat insulating culture 14h, analyze this reactant mixture by agarose gel electrophoresis.Adopt Agagel Standard system and Minicell Power Pack P20 power supply (all from Biometra GmbH, G
Figure 2006800333268_31
Ttingen, D).2% agarose NEEO Ultra-Qualit T (Carl Roth GmbH+Co.KG, Karlsruhe, D) uses 1h with the continuous buffer of 0.5 * TBE under 55V.Adopt Gel Doc 2000 gel documentation systems and software Quality One V4.0.3 (all from BIO-RAD laboratory, Miinchen, D).Experimental result can be referring to Fig. 2.
Table 2: reaction condition
HES 50/0.7 derivant Reaction buffer
7.4 in the H-Cys (H)-HES 50/0.7 that obtains Sodium acetate, 0.1M, pH 4.6,10mM EDTA
Oxo-HES50/0.7，(Supramol Parenteral Colloids GmbH，Rosbach-Rodheim，D) Sodium acetate, 0.1M, pH 4.6,10mM EDTA
7.4 in the H-Cys (H)-HES 50/0.7 that obtains Sodium phosphate, 0.1M,
[0365]
pH 8.0，5mM EDTA
Oxo-HES50/0.7，(Supramol Parenteral Colloids GmbH，Rosbach-Rodheim，D) Sodium phosphate, 0.1M, pH 8.0,5mM EDTA
8.5 form Thiazolidine from the DNA of H-Cys (H)-HES50/0.7 and FBA modification
HES 50/0.7 derivative solution in reaction buffer (referring to following table 3) (4 μ L, 147.5mg/mL is referring to following table 3) is added in the aqueous solution of the FBA modifying DNA that described in 8.3, obtains (1.5 μ L, 2mg/mL).Behind 21 ℃ of lower heat insulating culture 14h, described in 8.4, analyze this reactant mixture by agarose gel electrophoresis.Experimental result can be referring to Fig. 3.
Table 3: reaction condition
HES 50/0.7 derivant Reaction buffer
7.4 in the H-Cys (H)-HES 50/0.7 that obtains Sodium acetate, 0.1M, pH 4.6,10mM EDTA
Oxo-HES50/0.7，(Supramol Parenteral Colloids GmbH，Rosbach-Rodheim， D) Sodium acetate, 0.1M, pH 4.6,10mM EDTA
7.4 in the H-Cys (H)-HES 50/0.7 that obtains Sodium phosphate, 0.1M, pH 8.0,5mM EDTA
Oxo-HES50/0.7，(Supramol Parenteral Colloids GmbH，Rosbach-Rodheim， D) Sodium phosphate, 0.1M, pH 8.0,5mM EDTA
9. with organic molecule coupling (herein: antibiotic (daunorubicin) and cytostatic agent (tylosin))
Be coupled to organic molecule by forming Thiazolidine
The H-Cys (H) that will obtain described in 7.4-HES 50/0.7 (11.0mg) is dissolved into the micromolecular DMF of machine (referring to following table 4) solution (44 μ L, has concentration [A] mg/mL, 13.4 equivalent, referring to following table 4) in, 21 ℃ of lower heat insulating culture are analyzed 40 these reactant mixtures of μ L whole night and by HPLC.Experimental result can be referring to Fig. 4-9.
Adopt daunorubicin (Fluka, Sigma-Aldrich, Taufkirchen, D) and tylosin tartrate (all from BioChemika grade, Fluka, Sigma-Aldrich, Taufkirchen, D) as organic molecule.
Analyze for carrying out HPLC, use ReproSil-PUR Basic C18 post 150 * 4.6mmi.d. (Order # RI5.B9.S1546, Dr.Maisch GmbH, Ammerbuch, D) and AktaBasic chromatographic analysis system (pump P900 Ser.# 01118816, UV-detector UV900 Ser.# 01120613, pH/ conductivity-detector pH/C900 Ser.# 01120665, fraction catcher Frac900 Ser.# 01120011 and software Unicorn 5.0 Ser.# 01119821, all from Amersham Biosciences, Freiburg, D).
Analyze the employing following methods for all:
-buffer A: the water (Rotisolv LC-MS Garde, CarlRoth GmbH+Co.KG, Karlsruhe, D) with 0.1TFA
-buffer B: 15% water and 85% with 0.1TFA has the mixture (being Rotisolv LC-MS level, Carl Roth GmbH+Co.KG, Karlsruhe, D) of the acetonitrile of 0.1%TFA.
-gradient: 0% buffer B, 2 column volumes (CV); Buffer B 15 CV of linear gradient 0-50%, buffer B 7 CV of linear gradient 50-100%, 100% buffer B, 7 CV, 0% buffer B, 5 CV.
The UV-at-220 and 290nm places detects.
-flow velocity: 2mL/min.
Table 4: reaction condition
Organic molecule Concentration [A]/(mg/mL)
Daunorubicin 43.0
Tylosin 80.7
10. the HES from H-Cys-peptide and unmodified forms Thiazolidine
Will be at peptide solution (the 1 μ L of its N-end with free cysteine residues, 20 μ g, 2528g/mol, 20mg/mL in DMF, sequence H-Cys-Asn-Thr-Arg-Lys-Arg-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gl y-Arg-Ala-Phe-Val-Thr-Ile-Gly-Lys-OH, SC623, NeoMPS S.A., Strasbourg, F) add 9 μ L HES 10/0.7 (408mg/mL in [reaction buffer] (referring to following table 5), MW=9.2kDa to, DS=0.7, Lot 437, Supramol Parenteral Colloids GmbH, Rosbach-Rodheim, D) in the solution, Triton-X100 solution (1 μ L, in water 10%) is added in the selected reactant (referring to following table 5), with this mixture in [B] ℃ lower heat insulating culture whole night.For by the sds gel electrophoresis analysis, adopt XCell Sure Lock Mini Cell (Invitrogen GmbH, Karlsruhe, D) and Consort E 143 power supplys (CONSORTnv, Turnhout, B).Bis/Tris gel with 12% and the continuous buffer of MOPS (all from Invitrogen GmbH, Karlsruhe, D) under reducing condition use according to manufacturers instruction together.Experimental result can be referring to Figure 10.
Table 5: reaction condition
Swimming lane [reaction buffer] [B]/℃ Triton-X100
A DMF 21 -
B DMF 37 -
C DMF 50 -
D 0.1M NaOAc，pH 4.6，10mM EDTA 50 -
E DMF 50 -
F 0.1M NaOAc，pH 4.6，10mM EDTA 50 1μL
G DMF 50 1μL
11. the experimental result according to above 8-10 item
11.1 by forming Thiazolidine and DNA coupling (above the 8th)
DNA (referring to above the 8.th) realization of modifying with two kinds of different aldehyde by the coupling that forms Thiazolidine and DNA.Required DNA-aldehyde or commercially available is as in the DNA situation of modifying at formyl indole (referring to above the 8.1st), perhaps from commercially available 5 '-amino-DNA and 4-formoxyl benzoic acid succinimide ester (referring to above the 8.3rd) preparation.Contain α-SH-β amino HES (H-Cys (H)-HES50/0.7) from H-Cys (StBu) HES 50/0.7 by preparing (referring to above the 7.4th) with TCEP reduction and by precipitation and dialysis purification.The preparation of the preparation of H-Cys (StBu)-HES 50/0.7 and H-Cys (StBu) HES 10/0.4 similar (referring to above the 4.1st).The coupling of the DNA that modifies with two kinds of aldehyde the results are shown among Fig. 3.The appearance of the new band of higher molecular weight shows successful coupling.The bandwidth of its increase is because the molecular weight distribution of the HES part of conjugate.Be coupled at the lower realization of pH 4.6 (swimming lane A) or pH 8.0 (swimming lane C).Parent material OxoHES50/0.7 with H-Cys (H)-HES 50/0.7 does not observe coupling (swimming lane B and D).
11.2 the coupling (above the 9th) with organic molecule
For cytostatic agent (daunorubicin is referring to following Fig. 4) and antibiotic (tylosin is referring to following Fig. 7), Thiazolidine is realized and the coupling of organic molecule by forming.The HES parent material (identical with concentration in the coupling reaction) that contains α-SH-β amino occurs as the broadband, about retention time 10min (referring to following Fig. 6,9).The peak width of its increase is because the molecular weight distribution of HES.The HPLC of organic micromolecule compound analyzes (identical with concentration in the coupling reaction) and is shown in Fig. 5 and 8.The appearance of the new broad peak of retention time between HES parent material and organic micromolecule compound shows successful coupling (Fig. 4 and 7).The formation of broad peak has reflected the molecular weight distribution of the HES part of conjugate again.
11.3 the coupling (above the 10th) with unmodified HES
For peptide (referring to the above 10th) solution of N-end with free cysteine residues, this solution is for take DMF as solvent and temperature range solution (Figure 10 between 21 ℃-50 ℃, swimming lane A, B) or the solution (Figure 10 in the aqueous buffer solution under the pH 4.6,50 ℃, swimming lane D), Thiazolidine is realized and the coupling of unmodified HES by forming.In the presence of detergent Triton X-100, also can observe coupling (Figure 10, swimming lane F and G) under 50 ℃.The appearance of the new band in higher molecular weight place has shown successful coupling.The bandwidth of its increase is because the molecular weight distribution of the HES part of conjugate.
Thus, this can show the coupling of the HES of unmodified and Cys-peptide even all be general possible under various different conditions, as specified in above the 6th.

Claims (66)

1. method for the preparation of the conjugate of active substance and hydroxyalkyl starch, wherein active substance and hydroxyalkyl starch are via the chemical residue covalency keyed jointing that has with following formula (I), formula (I ') or formula (I ") structure:
Figure FSB00000918307700011
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4Be independently selected from straight chain, ring-type and/or branched alkyl, aryl, heteroaryl, aralkyl and the heteroarylalkyl of hydrogen, randomly suitable replacement, described alkyl has 1-20 carbon atom, described aryl has 6-20 carbon atom and described heteroaryl has 6-20 carbon atom
Described method comprises:
(A) make aldehyde radical, ketone group or hemiacetal group that hydroxyalkyl starch or its comprise the derivant of aldehyde radical, ketone group or hemiacetal group and active substance or its comprise the α of the derivant of following α-SH-β amino group-SH-β amino group
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I) structure and the conjugate of described hydroxyalkyl starch; Perhaps comprise the α of the derivant of following α-SH-β amino group-SH-β amino group with active substance or its
Figure FSB00000918307700022
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I ') structure and the conjugate of described hydroxyalkyl starch; Perhaps comprise the α of the derivant of following α-SH-β amino group-SH-β amino group with active substance or its
Figure FSB00000918307700023
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I ") structure and the conjugate of described hydroxyalkyl starch;
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4As above definition,
The hydroxyalkyl starch derivative that wherein comprises described aldehyde radical, ketone group or hemiacetal group is obtained by following methods, and the method comprises:
(a) (2) make hydroxyalkyl starch and at least a dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 1And Q, the M of functional group 1With the hydroxyalkyl starch reaction, and the Q of another functional group is
(i) aldehyde radical, ketone group or hemiacetal group; Or
(ii) chemical modification generates the functional group of aldehyde radical, ketone group or hemiacetal group, and the active substance or derivatives thereof that wherein comprises described α-SH-β amino group obtains by following methods, and the method comprises:
(b) (1) introduces this active substance with at least one α-SH-β amino group, perhaps during its preparation or by chemical modification
(b) (2) make this active substance and dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 2And Q, the M of functional group 2With the active substance reaction, and the Q of another functional group is
(i) α-SH-β amino group; Or
(ii) chemical modification generates the functional group of α-SH-β amino group; Perhaps
(B) make active substance or its comprise aldehyde radical, ketone group or the hemiacetal group and the α that comprises the hydroxyalkyl starch derivative of following α-SH-β amino group-SH-β amino group of the derivant of aldehyde radical, ketone group or hemiacetal group
Figure FSB00000918307700031
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I) structure and the conjugate of described hydroxyalkyl starch; Perhaps with the α of the hydroxyalkyl starch derivative that comprises following α-SH-β amino group-SH-β amino group
Figure FSB00000918307700032
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I ') structure and the conjugate of described hydroxyalkyl starch; Perhaps with the α of the hydroxyalkyl starch derivative that comprises following α-SH-β amino group-SH-β amino group
Figure FSB00000918307700033
Reaction prepares thus via the described active substance of the chemical residue covalency keyed jointing with formula (I ") structure and the conjugate of described hydroxyalkyl starch;
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4As above definition,
And
Wherein said active substance is selected from protein, peptide, small-molecule drug, glycoprotein and oligonucleotide.
2. the process of claim 1 wherein that hydroxyalkyl starch has the structure with following formula (II):
Wherein R ', R " and R " ' be hydrogen, straight or branched hydroxyalkyl independently, or group
——[(CR 1R 2) mO] n[CR 3R 4] o-OH
Wherein, R 1, R 2, R 3And R 4Be independently selected from hydrogen and alkyl,
M is 2-4, wherein m group CR 1R 2In residue R 1And R 2Can be identical or different;
N is 0-20;
O is 0-20, and wherein when n=0, o is not 0, and o group CR wherein 3R 4In residue R 3And R 4Can be identical or different.
3. the method for claim 2, wherein R ', R " and R " ' be hydrogen or 2-ethoxy independently.
4. the process of claim 1 wherein that hydroxyalkyl starch is hetastarch.
5. the method for claim 4, wherein the molecular weight of hetastarch is 1-300kD.
6. claim 4 or 5 method, wherein the molar substitution of hetastarch is 0.1-3.
7. claim 4 or 5 method, wherein the ethoxy C of hetastarch 2: C 6Replace than in the 2-20 scope.
8. the process of claim 1 wherein that active substance is selected from protein, peptide and the PNA that comprises α-SH-β amino group.
9. the method for claim 8, wherein active substance comprises the cysteine group.
10. the method for claim 9, wherein active substance comprises N-terminal cysteine group.
11. the process of claim 1 wherein that protein is selected from EPO, G-CSF, IFN α, IFN β, AT III, IL-2, IL-3, Myoglobin, SOD, BSA, rhEPO, rhG-CSF, rhIFN α, rhIFN β, rhAT III, rhIL-2, rhIL-3, AlAT, factor VII, Factor IX, factors IX, tPa and APC.
12. the process of claim 1 wherein that active substance is selected from protein, glycoprotein or the peptide that comprises aldehyde radical, ketone group or hemiacetal group.
13. the process of claim 1 wherein that active substance is selected from the glycoprotein that contains aldehyde radical at the polysaccharide side chain, perhaps comprises the synthetic peptide of aldehyde radical, ketone group or hemiacetal group.
14. the method for claim 1 or 2, wherein the hydroxyalkyl starch or derivatives thereof comprises 1-100 aldehyde radical, ketone group and/or hemiacetal group; Perhaps wherein the hydroxyalkyl starch or derivatives thereof comprises 1-100 α-SH-β amino group.
15. the method for claim 1 or 2, wherein active substance comprises 1-15 aldehyde radical, ketone group and/or hemiacetal group; Perhaps wherein active substance comprises 1-15 α-SH-β amino group.
16. the method for claim 1 or 2, wherein according to (A), the hemiacetal group of hydroxyalkyl starch is the hemiacetal group of the reducing end under neutral of the hydroxyalkyl starch of oxidised form not.
17. the process of claim 1 wherein
(A) hydroxyalkyl starch derivative that comprises described aldehyde radical, ketone group or hemiacetal group in is obtained by following methods, and the method comprises:
(a) (2) make hydroxyalkyl starch and at least a dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 1And Q, the M of functional group 1With the hydroxyalkyl starch reaction, and the Q of another functional group is
(i) aldehyde radical, ketone group or hemiacetal group; Or
(ii) chemical modification generates the functional group of aldehyde radical, ketone group or hemiacetal group,
Wherein
(B) hydroxyalkyl starch derivative that comprises described α-SH-β amino group in is obtained by following methods, and the method comprises:
(a) (2) make hydroxyalkyl starch and at least a dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 1And Q, the M of functional group 1With the hydroxyalkyl starch reaction, and the Q of another functional group is
(i) α-SH-β amino group; Or
(ii) chemical modification generates the functional group of α-SH-β amino group.
18. the method for claim 17, wherein in (a) (2), the M of functional group 1Oxidation or the reaction of unoxidized reducing end under neutral with OH-base on the hydroxyalkyl starch or hydroxyalkyl starch.
19. the method for claim 17, wherein at (A) (a) in (2), the M of functional group 1Be carboxyl or reactive carboxyl, the Q of functional group is aldehyde radical, ketone group or hemiacetal group.
20. the method for claim 19 wherein comprises M 1Be selected from formoxyl benzoic acid, 4-formoxyl benzoic acid pentafluorophenyl group ester, 4-formoxyl benzoic acid N-hydroxy-succinamide ester, 4-(4-formoxyl-3 with the difunctional compound of Q; 5-dimethoxy phenoxy group) butanoic acid perhaps is selected from the biocompatible compound of alpha-keto carboxylic acid, neuraminic acid or derivatives thereof and pyridoxal 5-phosphate.
21. the method for claim 17, wherein (A) (a) (2) (ii) in, this dual functional at least chemical compound comprises amino M 1With amino Q.
22. the method for claim 21, wherein dual functional at least chemical compound be have 1-20 carbon atom optional replacement the diaminourea alkane or have the chemical compound of following formula:
H 2N-[(CR 1′R 2′) pO] q[CR 3′R 4′] r-NH 2
R wherein 1', R 2', R 3' and R 4' be independently selected from hydrogen and alkyl,
P is 2-4, wherein p group CR 1' R 2' in residue R 1' and R 2' can be identical or different,
Q is 0-20;
R is 0-20, and wherein when q=0, r is not 0, and r group CR wherein 3' R 4' in residue R 3' and R 4' can be identical or different.
23. the method for claim 22, wherein said dual functional at least chemical compound is selected from following chemical compound: 1，2-diaminoethane, 1, the 3-diaminopropanes, 1, the 4-diaminobutane, 1,5-1,5-DAP, 1，6-diaminohexane, 1,7-diaminourea heptane, 1, the 8-diamino-octane, 1,9-diaminourea nonane, 1,10-diamino decane, 1,11-diaminourea hendecane, 1,12-diaminourea dodecane, 1,13-diaminourea tridecane, 1, the 14-diaminourea tetradecane, 1,15-diaminourea pentadecane, 1,16-diaminourea hexadecane, 1,17-diaminourea heptadecane, 1,18-diaminourea octadecane, 1,19-diaminourea nonadecane and 1,20-diaminourea eicosane.
24. the method for claim 21 also comprises making hydroxyalkyl starch and comprising two amino M 1The hydroxyalkyl starch derivative that generates with the dual functional at least chemical compound reaction of Q is in its amino Q place and the another kind of difunctional compound reaction that comprises aldehyde radical, ketone group and hemiacetal group, and generation has the hydroxyalkyl starch derivative of aldehyde radical, ketone group or hemiacetal group.
25. the method for claim 24; wherein should be selected from formoxyl benzoic acid, 4-formoxyl benzoic acid pentafluorophenyl group ester, 4-formoxyl benzoic acid N-hydroxy-succinamide ester, 4-(4-formoxyl-3,5-dimethoxy phenoxy group) butanoic acid and 4-formoxyl benzoyl oxide by the another kind difunctional compound.
26. the method for claim 21, wherein hydroxyalkyl starch is by reducing end under neutral and the M of functional group of its optional oxidation 1Reaction.
27. the method for claim 26 wherein statistically is higher than 50% and is used for the hydroxyalkyl starch molecule of given reaction through the reducing end under neutral reaction of at least one optional oxidation of each hydroxyalkyl starch molecule.
28. the method for claim 17, wherein (A) (a) (2) (i) in, the M of functional group 1Be selected from carboxyl, reactive carboxyl, carboxylic acid anhydrides, carboxylic acid halides, isocyanates, isothiocyanate, chloro-formate and epoxide group, the Q of functional group is aldehyde radical, ketone group or hemiacetal group.
29. the method for claim 28, the wherein M of functional group 1With the OH radical reaction on the hydroxyalkyl starch.
30. the method for claim 17, wherein (B) (a) (2) (i) in, the M of functional group iBe selected from amino and α-SH-β amino group, the Q of functional group is α-SH-β amino group.
31. the method for claim 30, the wherein M of functional group 1Reducing end under neutral reaction with the optional oxidation of hydroxyalkyl starch.
32. the method for claim 31 wherein statistically surpasses 50% and is used for the hydroxyalkyl starch molecule of given reaction through the reducing end under neutral reaction of at least one optional oxidation of every hydroxyalkyl starch molecule.
33. the method for claim 17, wherein (B) (a) (2) (i) in, the hydroxyalkyl starch that comprises described α-SH-β amino group obtains by the following method, and the method comprises: make hydroxyalkyl starch at the reducing end under neutral of its optional oxidation and comprise the M of functional group 1And as the chemical compound reaction of the α of the Q of functional group-SH-β amino group.
34. the method for claim 33 wherein comprises M 1And the chemical compound of α-SH-β amino group is 1,3-diaminourea-2-sulfydryl propane or 2,3-diaminostilbene-sulfydryl propane.
35. the method for claim 17, wherein (B) (a) (2) (ii) in, described dual functional at least chemical compound is included as the M of carboxyl or reactive carboxyl 1And be the Q of protected α-SH-β amino group.
36. the method for claim 17, wherein said dual functional at least chemical compound is selected from D-, L-PG 1-Cys (PG 2)-OH or its racemic mixture and their active ester, wherein PG 1Can be amino any suitable protecting group, PG 2It can be any suitable protecting group of mercapto.
37. the method for claim 17, wherein (B) (a) (2) (ii) in, the hydroxyalkyl starch that comprises described α-SH-β amino group obtains by the following method, and the method comprises hydroxyalkyl starch in the randomly oxidation of its reducing end under neutral; Make the M of functional group of this oxidation or unoxidized reducing end under neutral and a kind of chemical compound 1Reaction, this chemical compound is except M 1Also comprise the Q of functional group outward, generate the first hydroxyalkyl starch derivative; And the V of the functional group reaction that makes the Q of functional group and a kind of chemical compound of this first hydroxyalkyl starch derivative; this chemical compound also comprises the α that randomly protected-SH-β amino group except V, generate the hydroxyalkyl starch derivative of the α of randomly protection-SH-β aminofunctional.
38. the method for claim 37 wherein comprises M 1With the chemical compound of Q be diamino compounds or carbon diimidazole or N, N '-two succinimidyl carbonate.
39. the method for claim 38, wherein dual functional at least chemical compound be have 1-20 carbon atom optional replacement the diaminourea alkane or have the chemical compound of following formula:
H 2N-[(CR 1′R 2′) pO] q[CR 3′R 4′] r-NH 2
R wherein 1', R 2', R 3' and R 4' be independently selected from hydrogen and alkyl,
P is 2-4, wherein p group CR 1' R 2' in residue R 1' and R 2' can be identical or different,
Q is 0-20;
R is 0-20, and wherein when q=0, r is not 0, and r group CR wherein 3' R 4' in residue R 3' and R 4' can be identical or different.
40. the method for claim 39, wherein said dual functional at least chemical compound is selected from following chemical compound: 1，2-diaminoethane, 1, the 3-diaminopropanes, 1, the 4-diaminobutane, 1,5-1,5-DAP, 1，6-diaminohexane, 1,7-diaminourea heptane, 1, the 8-diamino-octane, 1,9-diaminourea nonane, 1,10-diamino decane, 1,11-diaminourea hendecane, 1,12-diaminourea dodecane, 1,13-diaminourea tridecane, 1, the 14-diaminourea tetradecane, 1,15-diaminourea pentadecane, 1,16-diaminourea hexadecane, 1,17-diaminourea heptadecane, 1,18-diaminourea octadecane, 1,19-diaminourea nonadecane and 1,20-diaminourea eicosane.
41. the method for claim 37, the chemical compound of the α of the wherein said V of comprising and randomly protection-SH-β amino group is the cysteine or derivatives thereof, and V is carboxyl or reactive carboxyl.
42. the method for claim 41, wherein V is reactive ester or carboxylic acid anhydrides, and perhaps the chemical compound of the described V of comprising is 1,3-diaminourea-2-sulfydryl propane or 2,3-diaminostilbene-sulfydryl propane.
43. the process of claim 1 wherein
The active substance that comprises described α-SH-β amino group in (A) is obtained by following methods, and the method comprises:
(b) (1) introduces this active substance with at least one α-SH-β amino group, perhaps during its preparation or by chemical modification
(b) (2) make this active substance and dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 2And Q, the M of functional group 2With the active substance reaction, and the Q of another functional group is
(i) α-SH-β amino group; Or
(ii) chemical modification generates the functional group of α-SH-β amino group,
Wherein
The active substance that comprises described aldehyde radical, ketone group or hemiacetal group in (B) is obtained by following methods, and the method comprises:
(b) (1) introduces this active substance with at least one aldehyde radical, ketone group or hemiacetal group, perhaps during its preparation or chemical modification
(b) (2) make this active substance and dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 2And Q, the M of functional group 2With the active substance reaction, and the Q of another functional group is
(i) aldehyde radical, ketone group or hemiacetal group; Or
(ii) chemical modification generates the functional group of aldehyde radical, ketone group or hemiacetal group.
44. the method for claim 43, wherein said active substance is selected from protein, peptide, synthetic peptide and oligonucleotide.
45. the method for claim 43, wherein at (A) (b) in (1), active substance is protein or the peptide by the organic synthesis preparation, and this synthetic method allows to generate protein or the peptide of α-SH-β aminofunctional; Perhaps wherein at (A) (b) in (1), protein or the peptide of active substance for adopting expression vector to produce, this carrier causes generating protein or the peptide of α-SH-β aminofunctional; Perhaps wherein at (A) (b) in (1), active substance is protein or peptide, and the main chain of this protein and peptide is replaced by α-SH-β amino group; Perhaps wherein at (A) (b) in (1), active substance is protein or peptide, and wherein said α-SH-β amino group directly and the main chain keyed jointing of this protein or peptide or be the part of the side chain of this main chain.
46. the method for claim 43, wherein at (B) (b) in (1), active substance is protein or the peptide by the organic synthesis preparation, and this synthetic method allows to generate protein or the peptide that aldehyde radical is functionalized, that ketone group is functionalized or hemiacetal group is functionalized; Perhaps wherein at (B) (b) in (1), protein or the peptide of active substance for adopting expression vector to produce, this carrier causes generating protein or the peptide that aldehyde radical is functionalized, that ketone group is functionalized or hemiacetal group is functionalized; Perhaps wherein at (B) (b) in (1), active substance is protein or peptide, and the main chain of this protein and peptide is replaced by aldehyde radical, ketone group or hemiacetal group; Perhaps wherein at (B) (b) in (1), active substance is protein or peptide, and wherein said aldehyde radical, ketone group or hemiacetal group are directly and the main chain keyed jointing of this protein or peptide or be the part of the side chain of this main chain.
47. the method for claim 43, wherein at (B) (b) in (1), active substance is protein or peptide, and described aldehyde radical, ketone group or hemiacetal group are included in the carbohydrate part of polypeptide.
48. the method for claim 47, wherein said carbohydrate partly are selected from hydroxy aldehyde, hydroxy-ketone and chemical modification thing thereof.
49. the method for claim 47, wherein carbohydrate partly is the derivant of naturally occurring carbohydrate part and is selected from glucose, galactose, mannose and sialic acid, can be by randomly chemical oxidation or enzymology oxidation.
50. the method for claim 47, wherein carbohydrate partly is the derivant of naturally occurring carbohydrate part and is terminal galactose, it is through oxydasis or through chemical oxidation, and wherein this terminal galactose residues randomly obtains after the sialic acid cracking endways.
51. the process of claim 1 wherein (A) (b) (2) (i) in, described α-SH-β amino group is included in the cysteine residues of active substance.
52. the method for claim 51, wherein said α-SH-β amino group is included in the cysteine residues of protein or peptide.
53. the method for claim 51, wherein this cysteine residues is the N-terminal cysteine residue of active substance.
54. the process of claim 1 wherein that active substance is modified protein or the peptide with N-terminal cysteine residue, described cysteine residues is not the component part of disulphide bridges.
55. the method for claim 54, the modified protein or the peptide that wherein have N-terminal cysteine residue are the anomaly of naturally occurring protein or peptide, obtain by following: add cysteine residues on the-terminal amino acid to (1), (2) replace-terminal amino acid with cysteine, perhaps (3) cancellation-terminal amino acid is until obtain terminal cysteine.
56. the process of claim 1 wherein reaction (A) or (B) at temperature 0-40 ℃, solvent exists lower, carries out response time 0.1-24h under the pH 3.5-10.
57. the method for claim 56, wherein solvent is selected from water, aqueous buffer solution, DMF, DMSO, DMA and composition thereof.
58. the method for claim 56, wherein the molecular proportion of hydroxyalkyl starch and active substance is approximately 1: 1 to 200: 1.
59. the active substance that can be obtained by each method of claim 1-58 and the conjugate of hydroxyalkyl starch.
60. the conjugate of an active substance and hydroxyalkyl starch, wherein active substance and hydroxyalkyl starch are by having the chemical residue covalency keyed jointing of structure shown in formula (I), (I ') or (I "):
R wherein 1, R 2, R 2 ', R 3, R 3 'And R 4Straight chain, ring-type and/or the branched alkyl, aryl, heteroaryl, aralkyl and the heteroarylalkyl that be independently selected from hydrogen, randomly suitably replace, described alkyl has 1-20 carbon atom, described aryl has 6-20 carbon atom and described heteroaryl has 6-20 carbon atom
Described conjugate has the structure shown in formula (IV), (IV ') or (IV "):
Figure FSB00000918307700131
Wherein HAS ' is the residue of hydroxyalkyl starch or derivatives thereof and aldehyde radical, ketone group or hemiacetal group keyed jointing; Wherein AS ' is the residue of active substance or derivatives thereof and α-SH-β amino group keyed jointing;
Perhaps have the structure shown in formula (V), (V ') or (V "):
Wherein HAS ' is that residue and the AS ' of hydroxyalkyl starch or derivatives thereof and α-SH-β amino group keyed jointing are the residues of active substance or derivatives thereof and aldehyde radical, ketone group or hemiacetal group keyed jointing,
The hydroxyalkyl starch derivative that wherein comprises aldehyde radical, ketone group or hemiacetal group is obtained by following methods, and the method comprises:
(a) (2) make hydroxyalkyl starch and at least a dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 1And Q, the M of functional group 1With the hydroxyalkyl starch reaction, and the Q of another functional group is
(i) aldehyde radical, ketone group or hemiacetal group; Or
(ii) chemical modification generates the functional group of aldehyde radical, ketone group or hemiacetal group,
And the active substance or derivatives thereof that wherein comprises described α-SH-β amino group is obtained by following methods, and the method comprises:
(b) (1) introduces this active substance with at least one α-SH-β amino group, perhaps during its preparation or by chemical modification
(b) (2) make this active substance and dual functional at least chemical compound reaction, and described chemical compound comprises two M of functional group 2And Q, the M of functional group 2With the active substance reaction, and the Q of another functional group is
(i) α-SH-β amino group; Or
(ii) chemical modification generates the functional group of α-SH-β amino group,
With
Wherein said active substance is selected from protein, peptide, small-molecule drug, glycoprotein and oligonucleotide.
61. the conjugate of claim 60, wherein conjugate is selected from:
R wherein 5As above to R 1To R 4Definition,
Figure FSB00000918307700161
R wherein 5As above to R 1To R 4Definition,
Figure FSB00000918307700162
Figure FSB00000918307700171
Among formula IV ' a, IV ' b, V ' b or the V ' c, n is 0-20, and in formula Va, Vb, V ' d or V ' e, n is 1-20.
62. the conjugate of claim 60, wherein conjugate is
Figure FSB00000918307700172
Wherein R ', R " and/or R " ' as the definition to formula II, and wherein at least one glucose unit of HES, R ', R " and/or R " ' at least one be independently selected from following:
Figure FSB00000918307700181
Wherein n is 1-20 and/or wherein R ', R " and/or R " ' at least one be-(CH 2CH 2O) m-R #, wherein m is integer, R #Be selected from formula (VIa), (VIb), (VIc) and (VId).
63. each conjugate of claim 60-62 is for the preparation of the purposes in the medicine of human body or animal body treatment.
64. a pharmaceutical composition, it comprises each conjugate of claim 60-62.
65. the pharmaceutical composition of claim 64, it also comprises at least a pharmaceutically acceptable diluent, adjuvant or carrier.
66. a compositions, its comprise claim 60-62 each active substance and the conjugate of hydroxyalkyl starch.
CN2006800333268A 2005-09-12 2006-09-12 Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine Expired - Fee Related CN101262889B (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP05019768A EP1762250A1 (en) 2005-09-12 2005-09-12 Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine
EP05019768.0 2005-09-12
PCT/EP2006/008858 WO2007031266A2 (en) 2005-09-12 2006-09-12 Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN2011104153604A Division CN102492047A (en) 2005-09-12 2006-09-12 Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine

Publications (2)

Publication Number Publication Date
CN101262889A CN101262889A (en) 2008-09-10
CN101262889B true CN101262889B (en) 2013-02-06

Family

ID=35426984

Family Applications (2)

Application Number Title Priority Date Filing Date
CN2006800333268A Expired - Fee Related CN101262889B (en) 2005-09-12 2006-09-12 Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine
CN2011104153604A Pending CN102492047A (en) 2005-09-12 2006-09-12 Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN2011104153604A Pending CN102492047A (en) 2005-09-12 2006-09-12 Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine

Country Status (15)

Country Link
US (1) US20080207562A1 (en)
EP (2) EP1762250A1 (en)
JP (1) JP5242398B2 (en)
KR (1) KR20080065602A (en)
CN (2) CN101262889B (en)
AT (1) ATE543515T1 (en)
AU (1) AU2006291527B2 (en)
BR (1) BRPI0615732A2 (en)
CA (1) CA2619036A1 (en)
EA (1) EA013910B1 (en)
ES (1) ES2382303T3 (en)
HK (1) HK1119395A1 (en)
IL (1) IL189466A0 (en)
WO (1) WO2007031266A2 (en)
ZA (1) ZA200802252B (en)

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10209821A1 (en) * 2002-03-06 2003-09-25 Biotechnologie Ges Mittelhesse Coupling of proteins to a modified polysaccharide
DE10209822A1 (en) * 2002-03-06 2003-09-25 Biotechnologie Ges Mittelhesse Coupling of low molecular weight substances to a modified polysaccharide
PL217085B1 (en) * 2002-09-11 2014-06-30 Fresenius Kabi Gmbh Hasylated polypeptides, especially hasylated erythropoietin
WO2005014655A2 (en) 2003-08-08 2005-02-17 Fresenius Kabi Deutschland Gmbh Conjugates of hydroxyalkyl starch and a protein
BRPI0413450A (en) * 2003-08-08 2006-10-17 Fresenius Kabi De Gmbh hydroxyalkyl starch and g-csf conjugates
CA2558738C (en) 2004-03-11 2013-02-05 Fresenius Kabi Deutschland Gmbh Conjugates of hydroxyalkyl starch and a protein, prepared by reductive amination
CN102302787A (en) * 2004-03-11 2012-01-04 费森尤斯卡比德国有限公司 Conjugates of hydroxyalkyl starch and a protein
EP1861124A2 (en) * 2005-03-11 2007-12-05 Fresenius Kabi Deutschland GmbH Production of bioactive glycoproteins from inactive starting materials by conjugation with hydroxyalkylstarch
EP2197919B1 (en) 2007-08-27 2014-04-09 ratiopharm GmbH Liquid formulation of g-csf conjugate
ES2607403T3 (en) 2008-07-25 2017-03-31 Shionogi & Co., Ltd. Chemical compounds as synthetic intermediates
SG171308A1 (en) 2008-12-11 2011-07-28 Shionogi & Co Synthesis of carbamoylpyridone hiv integrase inhibitors and intermediates
SG171731A1 (en) * 2008-12-11 2011-07-28 Glaxosmithkline Llc Processes and intermediates for carbamoylpyridone hiv integrase inhibitors
TWI518084B (en) 2009-03-26 2016-01-21 鹽野義製藥股份有限公司 Process for pyrone and pyridone derivatives
TWI582097B (en) 2010-03-23 2017-05-11 Ｖｉｉｖ醫療保健公司 Process for preparing carbamoylpyridone derivatives and intermediates
JP2014521594A (en) 2011-05-25 2014-08-28 アミリン・ファーマシューティカルズ，リミテッド・ライアビリティ・カンパニー Long duration dual hormone conjugate
EP2537866A1 (en) 2011-06-21 2012-12-26 Serumwerk Bernburg AG Hydroxyethyl starch derivatives, method for manufacturing the same and therapeutical uses thereof
US20210228530A1 (en) * 2018-06-20 2021-07-29 Santolecan Pharmaceuticals Llc Taxane-lipid-polysaccharide dual conjugates, preparation methods thereof and uses thereof
CN113214620B (en) * 2021-05-25 2022-06-21 湖北工业大学 Preparation method and application of epoxy group organic modified montmorillonite
CN115385973B (en) * 2022-07-13 2023-06-06 康龙化成(宁波)科技发展有限公司 Application of oligonucleotide-tetrahydrothiazole compounds in synthesis of gene coding compound library
CN116448996B (en) * 2023-03-22 2023-11-21 卡秋(江苏)生物科技有限公司 Preparation method of polymerase-antibody complex with bead structure

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1398328A1 (en) * 2002-09-11 2004-03-17 Fresenius Kabi Deutschland GmbH Hydroxyalkyl starch derivatives
EP1003760B1 (en) * 1997-08-07 2004-07-28 The University Of Utah Prodrugs and conjugates of selenium containing compounds and use thereof
CN1596129A (en) * 2001-06-21 2005-03-16 费森尤斯卡比德国有限公司 Water-soluble antibiotic comprising an amino sugar, in the form of a polysaccharide conjugate

Family Cites Families (93)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US581476A (en) * 1897-04-27 Shaft for stamp-mills
US3191291A (en) * 1959-01-21 1965-06-29 Continental Can Co Art of producing very thin steel and like sheets in wide strips
CH397115A (en) * 1960-10-04 1965-08-15 Hoechst Ag Process for the preparation of water-insoluble dyes
US4179337A (en) * 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4125492A (en) * 1974-05-31 1978-11-14 Pedro Cuatrecasas Affinity chromatography of vibrio cholerae enterotoxin-ganglioside polysaccharide and the biological effects of ganglioside-containing soluble polymers
US4001401A (en) * 1975-02-02 1977-01-04 Alza Corporation Blood substitute and blood plasma expander comprising polyhemoglobin
US4001200A (en) * 1975-02-27 1977-01-04 Alza Corporation Novel polymerized, cross-linked, stromal-free hemoglobin
US4053590A (en) * 1975-02-27 1977-10-11 Alza Corporation Compositions of matter comprising macromolecular hemoglobin
CA1055932A (en) * 1975-10-22 1979-06-05 Hematech Inc. Blood substitute based on hemoglobin
GB1578348A (en) * 1976-08-17 1980-11-05 Pharmacia Ab Products and a method for the therapeutic suppression of reaginic antibodies responsible for common allergic
FR2378094A2 (en) * 1977-01-24 1978-08-18 Inst Nat Sante Rech Med Biological reagent for diagnosis of specific illnesses - having an oxidised gluco-protein antibody on an insoluble support
US4454161A (en) * 1981-02-07 1984-06-12 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Process for the production of branching enzyme, and a method for improving the qualities of food products therewith
JPS57206622A (en) * 1981-06-10 1982-12-18 Ajinomoto Co Inc Blood substitute
DE3485810T2 (en) 1983-05-27 1992-12-10 Texas A & M Univ Sys METHOD FOR PRODUCING A RECOMBINANT BACULOVIRUS EXPRESSION VECTOR.
NZ210501A (en) 1983-12-13 1991-08-27 Kirin Amgen Inc Erythropoietin produced by procaryotic or eucaryotic expression of an exogenous dna sequence
US4703008A (en) * 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
US4496689A (en) * 1983-12-27 1985-01-29 Miles Laboratories, Inc. Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer
US4952496A (en) 1984-03-30 1990-08-28 Associated Universities, Inc. Cloning and expression of the gene for bacteriophage T7 RNA polymerase
IL77081A (en) 1984-12-04 1999-10-28 Genetics Inst Dna sequence encoding human erythropoietin process for the preparation thereof and a pharmaceutical composition of human erythropoietin
US4766106A (en) * 1985-06-26 1988-08-23 Cetus Corporation Solubilization of proteins for pharmaceutical compositions using polymer conjugation
US5217998A (en) * 1985-07-02 1993-06-08 Biomedical Frontiers, Inc. Composition for the stabilization of deferoxamine to chelate free ions in physiological fluid
FR2600894B1 (en) * 1986-07-02 1989-01-13 Centre Nat Rech Scient MACROMOLECULAR CONJUGATES OF HEMOGLOBIN, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS
US5362853A (en) * 1986-12-23 1994-11-08 Kyowa Hakko Kogyo Co., Ltd. Polypeptide derivatives of human granulocyte colony stimulating factor
US5214132A (en) * 1986-12-23 1993-05-25 Kyowa Hakko Kogyo Co., Ltd. Polypeptide derivatives of human granulocyte colony stimulating factor
US4863984A (en) * 1987-09-03 1989-09-05 General Electric Company Flame retardant extrudate of polypheylene ether blends, and method of making
JP2594123B2 (en) * 1987-09-12 1997-03-26 株式会社林原生物化学研究所 Desensitizer
US4904584A (en) * 1987-12-23 1990-02-27 Genetics Institute, Inc. Site-specific homogeneous modification of polypeptides
US4847325A (en) * 1988-01-20 1989-07-11 Cetus Corporation Conjugation of polymer to colony stimulating factor-1
FR2630329B1 (en) * 1988-04-20 1991-07-05 Merieux Inst MACROMOLECULAR CONJUGATES OF HEMOGLOBIN, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS
US4900780A (en) * 1988-05-25 1990-02-13 Masonic Medical Research Laboratory Acellular resuscitative fluid
US4925677A (en) * 1988-08-31 1990-05-15 Theratech, Inc. Biodegradable hydrogel matrices for the controlled release of pharmacologically active agents
US5420105A (en) * 1988-09-23 1995-05-30 Gustavson; Linda M. Polymeric carriers for non-covalent drug conjugation
US5218092A (en) * 1988-09-29 1993-06-08 Kyowa Hakko Kogyo Co., Ltd. Modified granulocyte-colony stimulating factor polypeptide with added carbohydrate chains
DE3836600A1 (en) * 1988-10-27 1990-05-03 Wolff Walsrode Ag CARBONIC ESTERES OF POLYSACCHARIDES AND METHOD FOR THE PRODUCTION THEREOF
EP0401384B1 (en) * 1988-12-22 1996-03-13 Kirin-Amgen, Inc. Chemically modified granulocyte colony stimulating factor
US6261800B1 (en) * 1989-05-05 2001-07-17 Genentech, Inc. Luteinizing hormone/choriogonadotropin (LH/CG) receptor
DE19975071I2 (en) * 1989-06-16 2000-02-03 Fresenius Ag Hydroxyethyl starch as a plasma expander Process for their production and use as a colloidal plasma substitute
JP2896580B2 (en) * 1989-08-25 1999-05-31 チッソ株式会社 Amylose-lysozyme hybrid, activated sugar and its production
JP2838800B2 (en) * 1989-09-02 1998-12-16 株式会社林原生物化学研究所 Desensitizer
DE69107672T2 (en) * 1990-05-07 1995-07-27 Shinetsu Chemical Co Foamable silicone rubber composition.
US5169784A (en) 1990-09-17 1992-12-08 The Texas A & M University System Baculovirus dual promoter expression vector
DK130991D0 (en) * 1991-07-04 1991-07-04 Immunodex K S POLYMER CONJUGATES
US5281698A (en) * 1991-07-23 1994-01-25 Cetus Oncology Corporation Preparation of an activated polymer ester for protein conjugation
DE4130807A1 (en) * 1991-09-17 1993-03-18 Wolff Walsrode Ag METHOD FOR PRODUCING POLYSACCHARIDE CARBONATES
US6172208B1 (en) * 1992-07-06 2001-01-09 Genzyme Corporation Oligonucleotides modified with conjugate groups
GB2270920B (en) * 1992-09-25 1997-04-02 Univ Keele Alginate-bioactive agent conjugates
EP0601417A3 (en) * 1992-12-11 1998-07-01 Hoechst Aktiengesellschaft Physiologically compatible and degradable polymer-based carbohydrate receptor blockers, a method for their preparation and their use
US5589356A (en) * 1993-06-21 1996-12-31 Vanderbilt University Litigation of sidechain unprotected peptides via a masked glycoaldehyde ester and O,N-acyl rearrangement
US5840900A (en) * 1993-10-20 1998-11-24 Enzon, Inc. High molecular weight polymer-based prodrugs
US5876980A (en) * 1995-04-11 1999-03-02 Cytel Corporation Enzymatic synthesis of oligosaccharides
WO1996040662A2 (en) * 1995-06-07 1996-12-19 Cellpro, Incorporated Aminooxy-containing linker compounds and their application in conjugates
US5736533A (en) * 1995-06-07 1998-04-07 Neose Technologies, Inc. Bacterial inhibition with an oligosaccharide compound
US5723589A (en) * 1995-12-21 1998-03-03 Icn Pharmaceuticals Carbohydrate conjugated bio-active compounds
KR100561788B1 (en) * 1996-03-12 2006-09-20 피지-티엑스엘 컴파니,엘.피. Compositions comprising water-soluble paclitaxel prodrugs and implantable medical devices comprising such compositions
DE19628705A1 (en) 1996-07-08 1998-01-15 Fresenius Ag New oxygen transport agents, hemoglobin-hydroxyethyl starch conjugates containing them, processes for their preparation and their use as blood substitutes
US5770645A (en) * 1996-08-02 1998-06-23 Duke University Medical Center Polymers for delivering nitric oxide in vivo
US5851984A (en) * 1996-08-16 1998-12-22 Genentech, Inc. Method of enhancing proliferation or differentiation of hematopoietic stem cells using Wnt polypeptides
US6011008A (en) * 1997-01-08 2000-01-04 Yissum Research Developement Company Of The Hebrew University Of Jerusalem Conjugates of biologically active substances
US5952347A (en) * 1997-03-13 1999-09-14 Merck & Co., Inc. Quinoline leukotriene antagonists
US6299881B1 (en) * 1997-03-24 2001-10-09 Henry M. Jackson Foundation For The Advancement Of Military Medicine Uronium salts for activating hydroxyls, carboxyls, and polysaccharides, and conjugate vaccines, immunogens, and other useful immunological reagents produced using uronium salts
US5990237A (en) * 1997-05-21 1999-11-23 Shearwater Polymers, Inc. Poly(ethylene glycol) aldehyde hydrates and related polymers and applications in modifying amines
US5847110A (en) * 1997-08-15 1998-12-08 Biomedical Frontiers, Inc. Method of reducing a schiff base
US6875594B2 (en) * 1997-11-13 2005-04-05 The Rockefeller University Methods of ligating expressed proteins
WO1999045163A1 (en) * 1998-03-05 1999-09-10 Asahi Glass Company Ltd. Sputtering target, transparent conductive film, and method for producing the same
CA2233725A1 (en) * 1998-03-31 1999-09-30 Hemosol Inc. Hemoglobin-hydroxyethyl starch complexes
US6660843B1 (en) * 1998-10-23 2003-12-09 Amgen Inc. Modified peptides as therapeutic agents
US6555660B2 (en) * 2000-01-10 2003-04-29 Maxygen Holdings Ltd. G-CSF conjugates
US6749865B2 (en) * 2000-02-15 2004-06-15 Genzyme Corporation Modification of biopolymers for improved drug delivery
US6586398B1 (en) * 2000-04-07 2003-07-01 Amgen, Inc. Chemically modified novel erythropoietin stimulating protein compositions and methods
US7118737B2 (en) * 2000-09-08 2006-10-10 Amylin Pharmaceuticals, Inc. Polymer-modified synthetic proteins
DE10112825A1 (en) * 2001-03-16 2002-10-02 Fresenius Kabi De Gmbh HESylation of active ingredients in aqueous solution
US6908963B2 (en) 2001-10-09 2005-06-21 Nektar Therapeutics Al, Corporation Thioester polymer derivatives and method of modifying the N-terminus of a polypeptide therewith
US7125843B2 (en) * 2001-10-19 2006-10-24 Neose Technologies, Inc. Glycoconjugates including more than one peptide
US7179617B2 (en) * 2001-10-10 2007-02-20 Neose Technologies, Inc. Factor IX: remolding and glycoconjugation of Factor IX
EP1438321B1 (en) * 2001-10-26 2010-05-26 Noxxon Pharma AG Modified l-nucleic acid
US6375846B1 (en) * 2001-11-01 2002-04-23 Harry Wellington Jarrett Cyanogen bromide-activation of hydroxyls on silica for high pressure affinity chromatography
DE10155098A1 (en) * 2001-11-09 2003-05-22 Supramol Parenteral Colloids Agent for protecting cell and tissue cultures against fungi, comprises water-soluble conjugate of polyene macrolide and polysaccharide
US6916962B2 (en) * 2001-12-11 2005-07-12 Sun Bio, Inc. Monofunctional polyethylene glycol aldehydes
DE10209822A1 (en) * 2002-03-06 2003-09-25 Biotechnologie Ges Mittelhesse Coupling of low molecular weight substances to a modified polysaccharide
DE10209821A1 (en) * 2002-03-06 2003-09-25 Biotechnologie Ges Mittelhesse Coupling of proteins to a modified polysaccharide
CA2487314A1 (en) * 2002-06-03 2003-12-11 The Institute For Systems Biology Methods for quantitative proteome analysis of glycoproteins
EA200500475A1 (en) * 2002-09-09 2005-10-27 Нектар Терапеутикс Ал, Корпорейшн WATER-SOLUBLE POLYMERIC ALCANALS
DE10242076A1 (en) * 2002-09-11 2004-03-25 Fresenius Kabi Deutschland Gmbh New covalently bonded conjugates of hydroxyalkyl starch with allergens, useful as modified allergens with depot effect for use in specific immunotherapy for combating allergies, e.g. hay fever
DE60323756D1 (en) * 2002-10-08 2008-11-06 Fresenius Kabi De Gmbh Pharmaceutically active oligosaccharide conjugates
JP4075722B2 (en) * 2003-07-22 2008-04-16 日産自動車株式会社 Display control device for vehicle
EP1653991A2 (en) * 2003-08-08 2006-05-10 Fresenius Kabi Deutschland GmbH Conjugates of a polymer and a protein linked by an oxime linking group
WO2005014655A2 (en) * 2003-08-08 2005-02-17 Fresenius Kabi Deutschland Gmbh Conjugates of hydroxyalkyl starch and a protein
CA2558738C (en) * 2004-03-11 2013-02-05 Fresenius Kabi Deutschland Gmbh Conjugates of hydroxyalkyl starch and a protein, prepared by reductive amination
CN102302787A (en) * 2004-03-11 2012-01-04 费森尤斯卡比德国有限公司 Conjugates of hydroxyalkyl starch and a protein
WO2005092369A2 (en) * 2004-03-11 2005-10-06 Fresenius Kabi Deutschland Gmbh Conjugates of hydroxyethyl starch and erythropoietin
EP1861124A2 (en) * 2005-03-11 2007-12-05 Fresenius Kabi Deutschland GmbH Production of bioactive glycoproteins from inactive starting materials by conjugation with hydroxyalkylstarch
EP2070951A1 (en) * 2007-12-14 2009-06-17 Fresenius Kabi Deutschland GmbH Method for producing a hydroxyalkyl starch derivatives with two linkers
EP2070950A1 (en) * 2007-12-14 2009-06-17 Fresenius Kabi Deutschland GmbH Hydroxyalkyl starch derivatives and process for their preparation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1003760B1 (en) * 1997-08-07 2004-07-28 The University Of Utah Prodrugs and conjugates of selenium containing compounds and use thereof
CN1596129A (en) * 2001-06-21 2005-03-16 费森尤斯卡比德国有限公司 Water-soluble antibiotic comprising an amino sugar, in the form of a polysaccharide conjugate
EP1398328A1 (en) * 2002-09-11 2004-03-17 Fresenius Kabi Deutschland GmbH Hydroxyalkyl starch derivatives

Also Published As

Publication number Publication date
AU2006291527A1 (en) 2007-03-22
CN102492047A (en) 2012-06-13
AU2006291527B2 (en) 2012-03-22
WO2007031266A2 (en) 2007-03-22
CN101262889A (en) 2008-09-10
BRPI0615732A2 (en) 2011-05-24
EA200800822A1 (en) 2008-08-29
ES2382303T3 (en) 2012-06-07
EA013910B1 (en) 2010-08-30
ZA200802252B (en) 2009-08-26
EP1933878B1 (en) 2012-02-01
KR20080065602A (en) 2008-07-14
EP1762250A1 (en) 2007-03-14
JP2009507973A (en) 2009-02-26
WO2007031266A3 (en) 2007-09-20
JP5242398B2 (en) 2013-07-24
CA2619036A1 (en) 2007-03-22
IL189466A0 (en) 2008-08-07
ATE543515T1 (en) 2012-02-15
HK1119395A1 (en) 2009-03-06
US20080207562A1 (en) 2008-08-28
EP1933878A2 (en) 2008-06-25

Similar Documents

Publication Publication Date Title
CN101262889B (en) Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine
CN1929865B (en) Conjugates of hydroxyalkyl starch and a protein
CN101918455B (en) Hydroxyalkyl starch derivatives and process for their preparation
JP5909755B2 (en) Glycopolysial oxidation of non-blood clotting proteins
US20080206182A1 (en) Conjugates of a Polymer and a Protein Linked by an Oxime Group
JP6208269B2 (en) Glycopolysial oxidation of non-blood clotting proteins
JP6711935B2 (en) Nucleophilic catalyst for oxime ligation
CN108079311A (en) For the nucleophilic catalyst that oxime is bonded
CN101137396A (en) Production of bioactive glycoproteins from inactive starting material
CN108884146A (en) Factor IX with extended half-life period and reduced ligand binding property
AU2015275284A1 (en) Nucleophilic Catalysts for Oxime Linkage
KR100473659B1 (en) Process for preparing hybrid protein replaced by available polymer at the saccharide chain by site-specific modification

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20130206

Termination date: 20140912

EXPY Termination of patent right or utility model