CN101255435A - Heat-proof DNA polymerase (Bcady-pol) gene and use of encoding protein thereof - Google Patents

Abstract

The invention relates to a heat resistant DNA polyase gene cloned from a genome of high-temperature deep-sea bacteria Bacillus caldolyticus DY. Active enzyme or modified enzyme modified in genetic engineer which is encoded by the gene can be widely applied to fields of various kinds of PCR, reverse record reaction and DNA sequence measurement. The invention firstly relates to extracting Bacillus caldolyticus D Y genome DNA, secondly PCR amplification and sequence analysis of heat-resistant DNA polymerase gene, thirdly expression and purification of heat-resistant DNA polymerase gene, fourthly measurement to property of recombination of heat-resistant DNA polymerase gene.

Description

The application of Taq DNA polymerase (Bcady-pol) gene and proteins encoded thereof

Technical field

The present invention relates to a kind of nucleotide sequence of the dna polymerase gene from high temperature bacterium (Bacillus caldolyticus DY) and the aminoacid sequence of this coded by said gene.The invention still further relates to by this nucleotide sequence coded protein function and application thereof.

Background technology

Archaeal dna polymerase DNA polymerases (EC 2.7.7.7) is to be template with DNA or RNA, the class of enzymes of catalysis synthetic DNA under the guiding of oligonucleotide or protein primer.At Mg ²⁺Exist down, can be added on the primer polynucleotide chain with 3 '-C-terminal by catalysis 5 '-triphosphate deoxyribose nucleotide, form the right second chain of complementary base.This fermentoid is having higher homology aspect dna sequence dna, aminoacid sequence, two, the tertiary structure, and and RNA polymerase and ThermoScript II between in various degree homology is also arranged.Simultaneously, archaeal dna polymerase has 3 '-5 ' exonuclease activity, can correct the mispairing of base in the polymerization process, plays the function of check and correction.Also have 5 '-3 ' exonuclease activity, can in half discontinuous synthesizing, the rugged segment 5 ' in excision ridge hold the RNA primer, can also excise the pyrimidine dimer that forms by uviolizing.The archaeal dna polymerase that has also has the activity of reversed transcriptive enzyme, can be template with RNA, and reverse transcription is cDNA.At present, existing kind more than 100 derives from not the dna polymerase gene of biology of the same race and is cloned and check order, and comprises thermoduric bacteria and archeobacteria.Some natural and the reorganization enzyme be purified and identify.Heat-stable archaeal dna polymerase plays an important role in different molecular biology is used, DNA cloning for example, order-checking and mark etc.It has been widely used in pathogen detection, genopathy diagnosis, tumor research, biological chemistry and molecular biological research field as the toolenzyme in the various PCR reactions.

The most frequently used hot resistant DNA polymerase is to derive from thermus aquaticus (Thermus aquaticus) to separate the TaqDNA polysaccharase that obtains at present, and this enzyme has thermotolerance, polymerization activity and 5 '-3 ' exonuclease activity.In addition, Taq also has the reverse transcription activity, is similar to reversed transcriptive enzyme, can use it among the RT-PCR, but amplification length is limited, so limited the application of this enzyme in some field.And at high temperature have active and 3 '-5 ' exonuclease activity of good reverse transcription from the archaeal dna polymerase of high temperature bacterium Bacillus caldolyticus DY, therefore the single enzyme process that can be applicable to the cDNA library makes up and amplification, can overcome the mRNA secondary structure to the restraining effect of transcriptive process,reversed (during synthetic cDNA, need under higher temperature, open the secondary structure of RNA), simplify making up and amplification procedure.

Summary of the invention

The applicant from the Eastern Pacific (12 ° 45 ' 42 of north latitude "; be separated to a bacterial strain high temperature bacterium Bacillus caldolyticus DY in the abyssal sediment that 103 ° of 41 ' 41 ") depth of water of west longitude is 3086 meters, about 65 ℃ of its optimum growth temperature, this bacterial strain can produce heat-stable archaeal dna polymerase, has very high application potential.But the hot resistant DNA polymerase amount that wild high temperature bacterium is produced is seldom, and strain culturing condition harshness, be difficult for large scale fermentation and cultivate obtain, so genetically engineered recombinant expressed be the optimal selection of obtaining hot resistant DNA polymerase in a large number.This bacterial strain is preserved in Chinese typical culture collection center, preserving number CCTCC NO:M20732 on April 2nd, 2007.

The present invention has extracted the genomic dna of high temperature bacterium Bacillus caldolyticus DY first, therefrom clone and identified hot resistant DNA polymerase (Bcady-pol) gene, and in colibacillus engineering, obtain recombinant expressed, thereby recombinase purifying and property testing have been carried out, for the practical application of this enzyme provides the foundation.

The nucleotide sequence of the coding Bcady-pol gene among the present invention is so to obtain.With Bacillus caldolyticusDY genomic dna is template, according to composition sequence SEQ ID No.3 and SEQ ID No.4 as primer, through pcr amplification resultant the sequence of SEQ ID No.1.By recombinant expressed Bcady-pol gene, purifying Bcady-pol expression of gene product, biological method prove that the polypeptide (SEQ ID No.2) of Bcady-pol genes encoding has the activity of hot resistant DNA polymerase then.

An object of the present invention is to provide a kind of new polynucleotide, a kind of new hot resistant DNA polymerase of this nucleotide coding, this enzyme is named as Bcady-pol.

Another object of the present invention provides a kind of method of utilizing recombinant technology to produce described Bcady-pol.

The present invention also provides this Bcady-pol gene order and its encoded polypeptide.

In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: a kind of isolated dna molecular, it is characterized in that, it comprises: the nucleotide sequence of coding Bcady-pol enzyme, and the nucleotide sequence of 1-2637 is by at least 70% similarity among described nucleotide sequence and the SEQID No.1; Perhaps described nucleotide sequence can be under medium rigorous condition with SEQ ID No.1 in the nucleotide sequence hybridization of 1-2637.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID No.2.More preferably, this sequence has the nucleotide sequence of 1-2637 position among the SEQ ID No.1.

At this aspect on the other hand, provide a kind of isolating Bcady-pol enzyme, it comprises: have polypeptide or its active fragments of SEQ ID No.2 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ IDNo.2 polypeptide of sequence.

In another aspect of this invention, provide a kind of generation to have the method for Bcady-pol enzyme.

In a specific embodiments of the present invention, isolating polynucleotide total length is 2637 Nucleotide among the present invention, and its detailed sequence is seen SEQ ID No.1, and wherein open reading frame is positioned at 1-2637 position Nucleotide.

In the present invention, term " Bcady-pol encoding sequence " is meant that coding has the active nucleotide sequence of hot resistant DNA polymerase, as 1-2637 bit sequence and the degenerate sequence thereof among the SEQ ID No.1.This degenerate sequence is meant, is arranged in the encoder block 1-2637 position Nucleotide of SEQID No.1 sequence, is replaced the back and the sequence of generation by the be encoded degenerate codon of same amino acid of one and a plurality of codons.Because the degeneracy of codon, thus with SEQ ID No.1 in 1-2637 position Nucleotide similarity be low to moderate about 70% the degenerate sequence described sequence of SEQ ID No.2 of also encoding out.This term also comprise with SEQ ID No.1 in the similarity at least 70% of nucleotide sequence of 1-2637, preferably at least 80%, at least 90% nucleotide sequence more preferably.

This term also comprises encoding to have SEQ ID No.1 sequence variations form with the Bcady-pol identical function.These forms comprise: several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and 5 ' and/or 3 ' add several (to be generally in 60, preferably be in 30, more preferably in 10, best in 5) Nucleotide.

In the present invention, term " Bcady-pol protein polypeptide " refers to have the active SEQ ID of thermolabile dnase No.2 polypeptide of sequence.This term also comprises the SEQ ID No.2 sequence variations form with Bcady-pol enzyme function.These variant forms include, but is not limited to: several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably be in 10, more preferably in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises the active fragments and the reactive derivative of Bcady-pol enzyme.

The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, modified forms, under high or low rigorous degree condition can with the coded albumen of the DNA of Bcady-pol gene recombination and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-Bcady-pol enzyme to obtain.The present invention also provides other polypeptide, as comprises Bcady-pol enzyme or its segmental fusion rotein.

The invention still further relates to the analogue of Bcady-pol enzyme, the difference of these analogues and natural B cady-pol enzyme can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic mutant, and the induce variation body can obtain by various technology, as by radiation or be exposed to the random mutagenesis that mutagenic compound produce, also can pass through site-directed mutagenesis method or other known Protocols in Molecular Biologies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme and finishes by polypeptide is exposed to.Modified forms also comprises the sequence with phosphorylated amino acid residue, also comprises the active or anti-proteolysis performance that has been improved its enzyme after modifying.

In the present invention, can select various carrier known in the art for use, as commercial carrier.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.

Description of drawings

The SDS-PAGE collection of illustrative plates of the recombinant expressed purifying of accompanying drawing 1 Bcady-pol.Be described as follows: M: lower molecular weight Marker; 1: recombinant vectors pTTQ-pol is at the not abduction delivering of bacterial strain DH I; 2: recombinant vectors pTTQ-pol is at the abduction delivering of bacterial strain DH I; 3: through the target protein Bcady-pol of Ni-NTA purifying gained (94kDa).

The mensuration collection of illustrative plates of accompanying drawing 2 Bcady-pol polysaccharase unit of activity.Be described as follows: 1-6 represents the different activities unit 0 of commercialization enzyme Tth, 0.04U, 0.07U, 0.1U, 0.1 5U, 0.2U respectively.7,8 represent Bcady-pol at 0.07 μ l respectively, the polysaccharase unit of activity assaying reaction result under the 0.15 μ l enzyme amount.

Accompanying drawing 3 Mg ²⁺The collection of illustrative plates that influences to Bcady-pol reversed transcriptive enzyme vigor.Be described as follows: 1-6 represents Mg respectively ²⁺Concentration is 0,1.5mol/L, and 3mol/L, 5mol/L, 7.5mol/L during 10mol/L, measures the influence of this metal ion to the reversed transcriptive enzyme vigor.

Accompanying drawing 4 pH values are to the collection of illustrative plates that influences of Bcady-pol reversed transcriptive enzyme vigor.Be described as follows: it is 7,7.5,8.0,8.3 that 1-5 represents at pH value respectively, measures the reversed transcriptive enzyme vigor in the reaction solution of 9.0 different pH values.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition such as molecular cloning laboratory manual (New York:Cold Spring Harbor LaboratoryPress, 2001) experiment condition described in, or the condition of being advised according to reagent or instrument production firm.

For achieving the above object, the present invention adopts following technical measures, and its concrete steps are:

1.Bacillus the extraction of caldolyticus DY genomic dna

Bacillus caldolyticus DY bacterial classification with transfering loop picking-80 ℃ preservation, (a kind of bacteria culture medium contains 1% tryptone, 1% sodium-chlor at the LB culture medium flat plate, 0.5% yeast extract, 1.5% agarose) go up to rule and separate single bacterium colony.Flat board after waiting to rule is put 65 ℃ of overnight incubation, single colony inoculation of picking (a kind of bacteria culture medium in the LB nutrient solution pipe of 5ml, contain 1% tryptone, 1% sodium-chlor, 0.5% yeast extract), 65 ℃ of wave and culture spend the night, and collect bacterium, and 6000g is supernatant discarded after centrifugal 8 minutes, precipitation is suspended in 200 μ l damping fluid (100mM NaCl again, 50mM Tris-HCl, 5mMEDTA, pH 8.0), add a small amount of N,O-Diacetylmuramidase, add 4ml lysate (4M guanidinium isothiocyanate) then, mixing is placed adding 100 μ l 1M MgCl after about 10 minutes gently ₂Virahol with the 2ml volume, after waiting to occur white flocks, centrifugal 30 seconds of 1000g abandons supernatant, and precipitation is with twice of 70% washing with alcohol, blot, add 800 μ l TES (10mM Tris-HCl, 1mM EDTA, 10mM NaCl respectively, pH 8.0), 10 μ l RNaseA (10mg/ml) and 40 μ l 10%SDS.Placement is spent the night, and adds 50 μ l Proteinase Ks (20mg/ml) again, and 55 ℃ digested 2 hours, with phenol/chloroform/primary isoamyl alcohol (25: 24: 1) extracting twice, and centrifugal 10 minutes of 15000g, supernatant carefully is transferred in another centrifuge tube.Use isopropanol precipitating DNA, use washing with alcohol twice again, precipitation is dissolved in the redistilled water-20 ℃ of preservations.

2. the pcr amplification and the sequential analysis of Taq DNA polymerase (Bcady-pol) gene

Bacillus caldolyticus DY genomic dna with extraction is a template, with the Bcady-pol gene of primer N and C amplification total length.

N：GAC GGATCCATGAGATTGAAAAAAAAGCTT (SEQ?ID?No.3)；

C：TCA TCT?AGATTATTTCGCGTCATACCA (SEQ?ID?No.4)；

Line part GGATCC represents the BamHI restriction enzyme site, and TCTAGA represents the XbaI enzyme cutting site.

The PCR reaction conditions is: contain 100ng template, 400nM primer N, 400nM C, 200 μ M dNTP, 2.5mM Mg in the reaction system of 50 μ l ²⁺, 5U LA-Taq archaeal dna polymerase (TaKARa company), 5 μ l, 10 * PCR reaction buffer; The pcr amplification program is 20 circulations: 96 ℃ of sex change 1 minute, and 55 ℃ of annealing 1 minute, 68 ℃ were extended 3 minutes.The purified back of PCR product is connected with the T carrier, is transformed among the competent escherichia coli cell XL-Blue, and picking has the positive of inserting dna fragmentation, and through order-checking, the Bcady-pol gene order sees SEQ ID No.1 for details.

The aminoacid sequence of the Bcady-pol that derives according to the nucleotide sequence that obtains, totally 879 amino-acid residues, its aminoacid sequence sees SEQ ID No.2 for details.

The reorganization Bcady-pol expression and purifying

To contain the plasmid BamHI and the XbaI enzyme cutting of Bcady-pol gene, glue reclaims the Bcady-pol gene fragment, simultaneously plasmid pTTQ is also carried out enzyme with identical enzyme and cuts.Both connections are spent the night (12-16 hour).Connect product and be transformed among the competent escherichia coli cell XL-Blue, extract plasmid, sequence verification.The recombinant expression plasmid pTTQ-pol transformed into escherichia coli DHI that will contain the Bcady-pol gene, choose positive colony in containing the LB substratum of 100mg/L penbritin 37 ℃ shake and train to A ₆₀₀=0.6 o'clock, add isopropylthio-(IPTG) to final concentration 0.1mmol/L, 30 ℃ are collected into bacterium liquid in the centrifuge tube of 200ml 5000g centrifugation bacterial cell after inducing 8h.Bacterial cell is suspended in again buffer A (the 0.5M NaCl of 10ml, the 30mM imidazoles, 0.5% TritonX-100,20mM Tris-HCl, pH 7.9) in, ultrasonication to bacterium liquid becomes translucent, 18000g is centrifugal 20 minutes again, supernatant with use lysis buffer equilibrated Ni-NTA Agarose mixing in advance, 4 ℃ in conjunction with 1 hour, purge process is carried out (Qiagen company) according to the purification kit explanation.The albumen of purifying is through 10% SDS-PAGE electrophoretic analysis, and its molecular weight is about 94kDa, and purity reaches more than 95%.The results are shown in Figure 1.

The reorganization Bcady-pol zymologic property

4.1 the mensuration of polysaccharase vigor:

Get the recombinant expressed archaeal dna polymerase liquid behind the 0.15 μ l purifying, add an amount of substrate: template calfthymus DNA, dNTP, dCTP (fluorescence dye cy5 mark), reaction buffer.The pH of enzyme reaction solution be adjusted at carry out under 8.3,70 ℃ Nucleotide mix the reaction 30 minutes.Commodity TthDNA polysaccharase (Roche company product) carries out parallel Nucleotide and mixes test under similarity condition.After reaction was finished, the uncorporated fluorescently-labeled dCTP of flush away carried out fluorescent scanning with sample spot on nylon membrane (Amersham company product).And compare with commodity TthDNA polysaccharase, calculating enzymic activity is 0.8U/ μ l.(Fig. 2)

4.2 the mensuration of reversed transcriptive enzyme vigor:

Get the recombinant expressed archaeal dna polymerase liquid behind the 0.5 μ l purifying, add an amount of substrate: template 1.2kbkanamycin resistance gene mRNA, Downstream Control Primer:5 '-AGCCGCCGTCCCGTCAAGTCAG-3 ', dNTP, dCTP (fluorescence dye cy5 mark), reaction buffer.The pH of enzyme reaction solution be adjusted at carry out under 8.3,50 ℃ reverse transcription Nucleotide mix the reaction 30 minutes.Commodity M-MLV reversed transcriptive enzyme (Promega company product) carries out parallel reverse transcription Nucleotide and mixes test under similarity condition.After reaction was finished, the uncorporated fluorescently-labeled dCTP of flush away carried out fluorescent scanning with sample spot on nylon membrane.And compare with commodity M-MLV reversed transcriptive enzyme, calculating enzymic activity is 8U/ μ l.

4.3 Mg ²⁺Influence to the reversed transcriptive enzyme vigor:

Require under all the same situation in the reaction conditions and 4.2, use Mg ²⁺Respectively 0,1.5mol/L, 3mol/L, 5mol/L, 7.5mol/L measures its influence to the reversed transcriptive enzyme vigor under the concentration of 10mol/L.The result is presented under the concentration of 3mol/L, metal ions M g ²⁺There is palpability ground to increase to the reversed transcriptive enzyme vigor.

4.4 pH value is to the influence of reversed transcriptive enzyme vigor:

Requiring under all the same situation in the reaction conditions and 4.2, is 7,7.5,8.0 at pH value respectively, measures the reversed transcriptive enzyme vigor in the reaction solution of 8.3,9.0 different pH values.It is 8.3 o'clock that the result is presented at pH value, and it is maximum that reverse transcriptase activity reaches.

Sequence table

1.SEQ the information of ID No.1

1) title: Bacillus caldolyticus DY Taq DNA polymerase gene

2) molecule type: DNA

3) sequence signature

A) length: 2637bp

B) type: nucleic acid

C) chain: two strands

D) topological framework: linearity

4) sequence description: SEQ ID No.1

1 ATGAGATTGA?AAAAAAAGCT?TGTTTTAATC?GACGGCAGCA?GCGTGGCGTA?CCGCGCCTTT

61 TTCGCCTTGC?CGCTTTTGCA?TAACGACAAA?GGCATCCATA?CGAACGCCGT?CTACGGGTTT

121 ACGATGATGT?TGAATAAAAT?TTTGGCGGAA?GAAGAGCCAA?CTCATATGCT?TGTCGCGTTT

181 GACGCCGGGA?AAACGACGTT?CCGGCATGAA?GCGTTTCAAG?AGTATAAAGG?TGGGCGCCAG

241 CAGACGCCAC?CGGAGCTGTC?GGAGCAGTTT?CCGCTGTTGC?GCGAGCTGCT?GAGGGCGTAT

301 CGCATCCCCG?CCTATGAACT?CGAGAACTAC?GAAGCGGACG?ATATTATCGG?AACGCTTGCC

361 GCCCGCGCTG?AGCAGGAAGG?GTTTGAGGTG?AAAGTCATTT?CCGGCGACCG?CGATCTGACC

421 CAGCTCGCCT?CCCCCCATGT?GACGGTGGAC?ATTACGAAAA?AAGGGATTAC?CGATATCGAA

481 CCGTACACGC?CGGAGGCGGT?CCGCGAAAAA?TACGGCTTAA?CTCCGGAACA?AATCGTTGAT

541 TTGAAAGGAT?TGATGGGCGA?CAAATCGGAC?AACATTCCCG?GAGTGCCGGG?CATCGGGGAA

601 AAGACGGCGG?TCAAGCTGCT?CAAGCAATTC?GGCACGGTCG?AAAACGTGCT?TGCCTCCATT

661 GACGAGATCA?AAGGCGAAAA?GTTGAAAGAA?ACGCTGCGCC?AACACCGGGA?GATGGCGCTG

721 TTAAGCAAAA?AGCTCGCCGC?CATTCGCCGC?GACGCCCCGG?TCGAGCTCTC?GCTTGATGAC

781 ATCGTCTATC?AAGGGGAAGA?CCGGGAGAAA?GTGGTCGCTT?TATTTAAAGA?GCTTGGGTTT

841 CAATCGTTTT?TAGAGAAAAT?GGAATCGCCG?TCATCAGAAG?AGGAAAAACC?GCTTGCCAAG

901 ATGGCATTTA?CGCTTGCTGA?CCGCGTGACG?GAGGAGATGC?TTGCCGACAA?GGCGGCGCTT

961 GTCGTTGAAG?TGGTCGAGGA?AAATTATCAT?GATGCGCCGA?TCGTCGGCAT?CGCTGTGGTC

1021 AACGAACATG?GACGGTTTTT?CCTGCGCCCG?GAGACGGCGC?TTGCCGATCC?GCAGTTTGTC

1081 GCCTGGCTTG?GTGATGAAAC?GAAGAAAAAA?AGCATGTTTG?ACTCAAAGCG?CGCGGCAGTC

1141 GCCTTGAAAT?GGAAAGGAAT?TGAGCTATGC?GGCGTTTCCT?TTGATTTATT?GCTGGCCGCC

1201 TATTTGCTTG?ATCCGGCGCA?AGGTGTTGAT?GATGTGGCTG?CCGCAGCAAA?AATGAAGCAA

1261 TACGAAGCGG?TGCGCCCGGA?TGAAGCGGTG?TATGGCAAAG?GGGCGAAGCG?GGCCGTGCCG

1321 GATGAGCCAG?TGCTCGCCGA?GCATCTCGTC?CGCAAGGCGG?CGGCGATTTG?GGCGCTCGAA

1381 CGGCCGTTTT?TGGATGAGCT?GCGCCGCAAC?GAACAAGATC?GGTTGCTCGT?CGAGCTCGAG

1441 CAGCCGTTGT?CTTCGATTTT?GGCGGAAATG?GAATTTGCCG?GAGTGAAAGT?GGATACGAAG

1501 CGGCTCGAAC?AGATGGGCGA?AGAGCTCGCC?GAGCAGCTGC?GCACGGTCGA?GCAGCGCATT

1561 TATGAGCTCG?CCGGCCAAGA?ATTCAACATC?AATTCACCGA?AACAGCTCGG?CGTCATTTTA

1621 TTTGAAAAAC?TGCAGCTGCC?CGTCTTGAAA?AAAACGAAAA?CCGGCTACTC?CACTTCGGCG

1681 GATGTGCTTG?AAAAACTTGC?GCCTTATCAC?GAGATCGTGG?AAAACATTTT?GCATTACCGC

1741 CAGCTTGGCA?AGTTGCAGTC?GACGTATATT?GAAGGATTGC?TGAAAGTCGT?GCGACCCGAT

1801 ACAAAGAAGG?TGCATACGAT?TTTCAATCAG?GCGTTGACGC?AAACCGGACG?GCTCAGCTCG

1861 ACGGAGCCGA?ACTTGCAAAA?CATTCCGATT?CGGCTTGAGG?AAGGACGGAA?AATCCGCCAA

1921 GCGTTCGTGC?CGTCGGAGTC?TGATTGGCTC?ATTTTCGCTG?CCGACTACTC?GCAAATTGAG

1981 TTGCGCGTCC?TCGCCCATAT?TGCGGAAGAT?GACAATTTAA?TGGAAGCGTT?CCGCCGCGAT

2041 TTGGATATCC?ATACGAAAAC?AGCGATGGAC?ATTTTCCAAG?TGAGCGAGGA?CGAAGTGACG

2101 CCCAACATGC?GCCGTCAGGC?GAAGGCGGTC?AACTTTGGGA?TCGTTTACGG?GATCAGTGAT

2161 TACGGCTTGG?CGCAAAACTT?AAATATTTCA?CGCAAAGAGG?CCGCTGAATT?CATCGAGCGC

2221 TACTTCGAAA?GCTTCCCTGG?CGTGAAGCGG?TATATGGAAA?ACATTGTGCA?AGAGGCAAAA

2281 CAGAAAGGGT?ATGTGACGAC?GCTGCTGCAT?CGGCGCCGCT?ATTTGCCGGA?TATCACGAGC

2341 CGCAACTTCA?ACGTCCGCAG?CTTTGCTGAA?CGGATGGCGA?TGAACACGCC?GATTCAAGGG

2401 AGCGCCGCTG?ACATTATTAA?AAAGGCGATG?ATCGATCTGA?ACGCCAGACT?GAAGGAAGAG

2461 CGGCTGCAAG?CGCGCCTTTT?GCTACAGGTG?CATGACGAGC?TCATTTTGGA?GGCGCCGAAA

2521 GAAGAGATGG?AGCGGCTGTG?CCGGCTCGTT?CCGGAAGTGA?TGGAGCAAGC?GGTCACACTT

2581 CGCGTGCCGC?TCAAAGTCGA?TTACCATTAT?GGCTCGACGT?GGTATGACGC?GAAATAA

2.SEQ the information of ID No.2

1) title: Bacillus caldolyticus DY Taq DNA polymerase

2) molecule type: protein

3) sequence signature

A) length: 878aa

B) type: amino acid

4) sequence description: SEQ ID No.2

1 MRLKKKLVLI?DGSSVAYRAF?FALPLLHNDK?GIHTNAVYGF?TMMLNKILAE?EEPTHMLVAF

61 DAGKTTFRHE?AFQEYKGGRQ?QTPPELSEQF?PLLRELLRAY?RIPAYELENY?EADDIIGTLA

121 ARAEQEGFEV?KVISGDRDLT?QLASPHVTVD?ITKKGITDIE?PYTPEAVREK?YGLTPEQIVD

181 LKGLMGDKSD?NIPGVPGIGE?KTAVKLLKQF?GTVENVLASI?DEIKGEKLKE?TLRQHREMAL

241 LSKKLAAIRR?DAPVELSLDD?IVYQGEDREK?VVALFKELGF?QSFLEKMESP?SSEEEKPLAK

301 MAFTLADRVT?EEMLADKAAL?VVEVVEENYH?DAPIVGIAVV?NEHGRFFLRP?ETALADPQFV

361 AWLGDETKKK?SMFDSKRAAV?ALKWKGIELC?GVSFDLLLAA?YLLDPAQGVD?DVAAAAKMKQ

421 YEAVRPDEAV?YGKGAKRAVP?DEPVLAEHLV?RKAAAIWALE?RPFLDELRRN?EQDRLLVELE

481 QPLSSILAEM?EFAGVKVDTK?RLEQMGEELA?EQLRTVEQRI?YELAGQEFNI?NSPKQLGVIL

541 FEKLQLPVLK?KTKTGYSTSA?DVLEKLAPYH?EIVENILHYR?QLGKLQSTYI?EGLLKVVRPD

601 TKKVHTIFNQ?ALTQTGRLSS?TEPNLQNIPI?RLEEGRKIRQ?AFVPSESDWL?IFAADYSQIE

661 LRVLAHIAED?DNLMEAFRRD?LDIHTKTAMD?IFQVSEDEVT?PNMRRQAKAV?NFGIVYGISD

721 YGLAQNLNIS?RKEAAEFIER?YFESFPGVKR?YMENIVQEAK?QKGYVTTLLH?RRRYLPDITS

781 RNFNVRSFAE?RMAMNTPIQG?SAADIIKKAM?IDLNARLKEE?RLQARLLLQV?HDELILEAPK

841 EEMERLCRLV?PEVMEQAVTL?RVPLKVDYHY?GSTWYDAK

3.SEQ the information of ID No.3

1) molecule type: oligonucleotide

2) sequence signature

A) length: 30bp

B) type: nucleic acid

C) chain: strand

D) topological framework: linearity

4) sequence description: SEQ ID No.3

GAC?GGA?TCC?ATG?AGA?TTG?AAA?AAA?AAG?CTT

4.SEQ the information of ID No.4

1) molecule type: oligonucleotide

2) sequence signature

A) length: 27bp

B) type: nucleic acid

C) chain: strand

D) topological framework: linearity

4) sequence description: SEQ ID No.4

TCA?TCT?AGA?TTA?TTT?CGC?GTC?ATA?CCA

Claims (5)

1. isolated dna molecular, it is characterized in that, it comprises: coding is from the nucleotide sequence of the Taq DNA polymerase gene of deep-sea high temperature bacterium Bacilluscaldolyticus DY, the nucleotides sequence of 1-2637 position is shown at least 70% similarity among perhaps described nucleotide sequence and the SEQID NO.1, perhaps described nucleotide sequence can be under medium rigorous condition with SEQ ID No.1 in the nucleotide sequence hybridization of 1-2637 position.

2. the dna molecular as requiring in the right 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID No.2.

3. isolating Bcady-pol protein polypeptide is characterized in that it comprises: have the polypeptide of the aminoacid sequence shown in the SEQ ID No.2, or its active fragments, or its reactive derivative.

4. a generation has the method for the polypeptide of Bcady-pol protein-active, it is characterized in that this method comprises:

A. the nucleotide sequence that coding is had the polypeptide of Bcady-pol protein-active operationally is connected with expression regulation sequence, form the Bcady-pol expression vector, show at least 70% similarity from the nucleotides sequence of Nucleotide 1-2637 position among described nucleotide sequence and the SEQ ID No.1;

B. change the expression vector among the step a over to host cell, form the reconstitution cell of Bcady-pol active polypeptide;

C. be fit to express under the condition of Bcady-pol active polypeptide the reconstitution cell among the culturing step b;

D. isolate active polypeptide with Bcady-pol.

5. method as claimed in claim 4 is characterized in that, the nucleotides sequence of the coded polypeptide of this reorganization is classified as among the SEQ IDNo.1 from Nucleotide 1-2637 position.

Images