CN101252950A

CN101252950A - Immunoglobulins comprising predominantly a GLCNACMAN3GLCNAC2 sugar form

Info

Publication number: CN101252950A
Application number: CNA2006800318624A
Authority: CN
Inventors: T·U·格恩格罗斯; S·威尔德特; H·李
Original assignee: Glycofi Inc
Current assignee: Glycofi Inc
Priority date: 2005-09-02
Filing date: 2006-09-01
Publication date: 2008-08-27

Abstract

Compositions and methods for producing compositions comprising immunoglobulins or immunoglobulin fragments having an N-linked glycosylation pattern consisting predominantly of the GlCNAcMan3GlcNAc2 N-glycan structure are disclosed. The GlCNAcMan3GlcNAc2 N-glycan structure effects an increase in binding to the Fc[Gamma]Rip receptors and a decrease in binding to the Fc[Gamma]RH receptors.

Description

Mainly comprise GLCNACMAN 3GLCNAC 2The immunoglobulin of sugar form

Background of invention

(1) invention field

The present invention relates to compositions and production method for compositions, described compositions comprises the immunoglobulin or the immunoglobulin fragment of the glycosylation pattern with N-connection, and the glycosylation pattern that described N-connects is by the GlcNAcMan as main N-polysaccharide ₃GlcNAc ₂Form.Described GlcNAcMan ₃GlcNAc ₂The N-glycan structures has regulating effect to the specific effect thing function of described immunoglobulin.

(2) description of related art

Glycoprotein is the many essential functions of mediation in human and other mammals, comprise catalysis, signal transduction, cell-cell communication, and molecular recognition and association.In eukaryote glycoprotein constituted non-cytoplasmic protein major part (Lis and Sharon, 1993, Eur.J.Biochem.218:1-27).At recent two decades, many glycoproteins have been used and have been used for the treatment of purpose, and the reorganization version of the glycoprotein of natural generation becomes the major part of biotechnological industries.Recombinant glycosylated proteic example as therapeutic agent comprises erythropoietin (EPO), therapeutic monoclonal antibodies (mAbs), tissue plasminogen activator (tPA), interferon-(IFN-γ), granulocyte-macrophage colony stimutaing factor (GM-CSF) and human chorionic gonadotropin (hCH) (Cumming et al., 1991, Glycobiology 1:115-130).Along with approaching clinical as the recombiant protein of potential prevention reagent and the generation of treatment reagent, the variation in the glycosylation pattern of the glycoprotein of recombinant production is a large amount of themes of paying close attention in scientific circles recently.

Antibody or immunoglobulin are the glycoproteins that plays central role in humoral immune reaction.Antibody can be counted as adapter molecule, and it provides the connection between body fluid and the cytophylaxis mechanism.The antigenic specificity identification of antibody causes the formation of immune complex, and it can activate multiple effect mechanism, causes the elimination and the destruction of described complex.In the general classes of immunoglobulin (Ig), five classes (isotype) antibody---IgM, IgD, IgG, IgA and IgE---can biochemistry on and distinguish out on the function that and the more subtle difference that is included in the variable region is the bonded specific reason of antigen.Among these five kinds of immunoglobulins, only have two kinds of light chains, it is called as lambda (λ) and kappa (κ).Do not have discovery feature difference between the antibody with λ or κ chain, the ratio of two types light chain is different between species and species.Have five kinds of heavy chain kinds or isotype, these have determined the functional activity of antibody molecule.Every kind of immunoglobulin has specific function in immunoreation, their unique function feature is partly to be given by the carboxyl terminal of heavy chain, and it does not associate with light chain at this.IgG be immunoglobulin isotype the abundantest in the blood plasma (referring to, Immunobiology for example, Janeway et al, 6th Edition, 2004, GarlandPublishing, New York).

The IgG molecule comprises Fab (Fab) domain and Fc (crystalline fragment) domain with constant region and variable region.The CH2 domain of each heavy chain contains the glycosylated single site that the N-polysaccharide is connected to the N-connection of immunoglobulin molecules on asparagine residue, usually at asparagine residue 297 (Asn-297) (Kabat et al., Sequences of proteinsof immunological interest, Fifth Ed., U.S.Department of Health and HumanServices, NIH Publication No.91-3242).

The analysis of the 26S Proteasome Structure and Function aspect of the oligosaccharide (oligosaccharide) that N-connects is that biology is interested, and three main causes are arranged: the glycosylation of (1) CH2 domain is guarded in evolution, has shown the important function of oligosaccharide; (2) immunoglobulin molecules has served as model system (Rademacher and Dwek, 1984 of oligosaccharide The Heterogeneity; Rademacher etal., 1982); And the dimerization that (3) antibody comprises two heavy chains associates, and it places mutually directly contact with two oligosaccharide units, interacts thereby immunoglobulin molecules has comprised special albumen-carbohydrate and carbohydrate-carbohydrate.

The different glycosylation pattern that has shown immunoglobulin and different biological properties be associated (Jefferis and Lund, 1997, Antibody Eng.Chem.Immunol., 65:111-128; Wright and Morrison, 1997, Trends Biotechnol., 15:26-32).Yet, the known biological function of giving expectation of the specific sugar form of minority only.For example, the immune globulin composite that has the mycose-baseization of reduction aspect the polysaccharide that connects at N-be in the news have to the enhanced combination of human Fc gamma RIII and thereby enhanced antibody dependent cellular cytotoxicity (antibody-dependent cellular cytotoxicity, ADCC) (Shields et al., 2002, J.Biol Chem, 277:26733-26740; Shinkawa et al., 2003, J.Biol.Chem.278:3466-3473).And, the G2 (Gal2GlcNAc of the mycose-baseization that in Chinese hamster ovary celI, generates ₂-Man3GlcNAc ₂) compositions of IgG is in the news and improved CDC (complement-dependent cytotoxicity, CDC) reach the degree (Raju bigger than the compositions of heterologous antibody, 2004, the disclosed patent application No.2004/0136986 of the U.S.).What also propose is, at the antibody of the best of tumor will be preferentially in conjunction with activation Fc receptor (Fc γ RI, Fc γ RIIa, Fc γ RIII) and minimally antibody (the Clynes et al. in conjunction with inhibition Fc γ RIIb receptor, 2000, Nature, 6:443-446).Therefore, the ability of the specific sugar form of enrichment immunoglobulin glycoprotein is high expectations.

Usually, the glycosylation structure (oligosaccharide) on the glycoprotein will depend on expressive host and condition of culture and change.The human cytokines that produces in the non-human host cell may contain the non-human glycosylation, and it may cause immunogenic response in the mankind, for example, and the super mannose groupization in the yeast (Ballou, 1990, Methods Enzymol.185:440-470); α in the plant (1,3)-trehalose and β (1,2)-xylose (Cabanes-Macheteau et al., 1999, Glycobiology, 9:365-372); N-n acetylneuraminic acid n in the Chinese hamster ovary cell (Noguchi et al., 1995.J.Biochem.117:5-62); And, the Gal α-1 in the mice, and the 3Gal glycosylation (Borrebaecket al., 1993, Immun.Today, 14:477-479).In addition, galactosylation can change with cell culture condition, depends on their specific galactose pattern, and it can be so that some immune globulin composite has immunogenicity (Patel et al., 1992.Biochem J.285:839-845).The oligosaccharide structure of the glycoprotein that non-human mammal produces is tended to more closely relevant with those of human glycoprotein.Thereby most of coml immunoglobulins produce in mammalian cell.Yet mammalian cell has several important shortcomings as the host cell of protein production.Except the expense height, in mammalian cell, express the heterogeneous population that proteic process has produced sugar form, have low volume titre (volumetric titers), and need ongoing (ongoing) virus prevention and plenty of time to produce stable cell line.

Should be understood that, different sugar forms can have a deep effect on the character of therapeutic glycoprotein, comprise pharmacokinetics, pharmacodynamics, acceptor interaction and tissue specificity targeting (Graddis etal., 2002, Curr Pharm Biotechnol.3:285-297).Particularly, for immunoglobulin, the oligosaccharide structure can influence the character relevant, the receptor-mediated antibody of FcRn with protease resistant serum half-life, with the combining of complement complex C1, it induces CDC (CDC), and with the combining of Fc γ R receptor, it is responsible for cytotoxicity (ADCC) approach, phagocytosis and antibody feedback of regulating the antibody dependent cellular mediation.(Nose?and?Wigzell，1983；Leatherbarrow?and?Dwek，1983；Leatherbarrow?et?al.，1985；Walkeret?al.，1989；Carter?et?al.，1992，Proc.Natl.Acad.Sci.USA，89：4285-4289)。

Because different sugar forms is relevant with different biological properties, the ability of one or more specific sugar forms of enrichment can be used to illustrate the relation between specific sugar form and the special biological.With after specific sugar form pattern is associated, can produce glycoprotein compositions at the biological function of expectation for useful sugar form structure enrichment.Thereby production is high expectations for the ability of the glycoprotein compositions of specific sugar form enrichment.

Summary of the invention

The invention provides the compositions that comprises panimmunity globulin or immunoglobulin fragment (a plurality ofimmunoglobulins or immunoglobulin fragments), every kind of immunoglobulin or fragment comprise at least a N-polysaccharide (at least one N-glycan attachedthereto) that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide kind (the predominant N-glycan species) is basically by GlcNAcMan ₃GlcNAc ₂Form.Thereby, the invention provides and comprise immunoglobulin or segmental compositions, described immunoglobulin or fragment have GlcNAcMan ₃GlcNAc ₂As main N-polysaccharide.

In specific implementations, described multiple N-polysaccharide greater than 20 molar percentages basically by GlcNAcMan ₃GlcNAc ₂Form.In embodiment further, described multiple N-polysaccharide greater than 50 molar percentages basically by GlcNAcMan ₃GlcNAc ₂Form.In embodiment further, described multiple N-polysaccharide greater than 75 molar percentages basically by GlcNAcMan ₃GlcNAc ₂Form.In embodiment further, described multiple N-polysaccharide greater than 90 percentage ratios basically by GlcNAcMan ₃GlcNAc ₂Form.In other embodiments, described GlcNAcMan ₃GlcNAc ₂The N-glycan structures exists with certain level, and about 5 molar percentages of the second main N-glycan structures of the described multiple N-polysaccharide of described horizontal exceeding are to about 50 molar percentages.Further provide the compositions that comprises anti-CD 20 antibodies, described anti-CD 20 antibodies has GlcNAcMan ₃GlcNAc ₂As main N-polysaccharide.

Immunoglobulin that compositions herein comprises or fragment have represented to the binding affinity of the reduction of Fc γ RIIa and/or Fc γ RIIb receptor and to the binding affinity of the raising of Fc γ RIIIa and/or Fc γ RIIIb receptor.Thereby, in one aspect, the invention provides and comprise panimmunity globulin or segmental compositions, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form, wherein said immunoglobulin or fragment have represented the binding affinity to the reduction of Fc γ RIIa and/or Fc γ RIIb receptor.In yet another aspect, the invention provides and comprise panimmunity globulin or segmental compositions, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form, wherein said immunoglobulin or fragment have represented the binding affinity to the raising of Fc γ RIIIa and/or Fc γ RIIIb receptor.

Further, the invention provides and comprise panimmunity globulin or segmental compositions, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form, wherein said immunoglobulin or fragment estimate to represent the antibody dependent cellular cytotoxicity (ADCC) of raising.

Of the present invention further aspect in, above-mentioned composition of the present invention comprises immunoglobulin or fragment, it does not have trehalose basically or lacks trehalose.

Compositions of the present invention also comprises pharmaceutical composition and pharmaceutically acceptable carrier.Compositions of the present invention also comprises immunoglobulin or segmental pharmaceutical composition, and described immunoglobulin or fragment are purified and are incorporated in the diagnostic kit.

The present invention further provides the method that comprises panimmunity globulin or segmental any above-mentioned composition of producing, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form.In one aspect, described method comprises the step of cultivating host cell, preferred eukaryote host cell, and described host cell is modified hereditarily or selected to express described immunoglobulin or fragment.Aspect specific, described host cell comprises coding immunoglobulin or segmental exogenous gene.Preferably, described host cell modified hereditarily or through engineering approaches to produce glycoprotein, described glycoprotein is for GlcNAcMan ₃GlcNAc ₂The N-polysaccharide is by enrichment.Thereby aspect specific, described host cell comprises and being selected from by α-1, one or more exogenous genes of the group that 2-mannosidase, mannosidase II, UDP-GlcNAc transport protein and GlcNAc transferring enzyme (GnT1) constitute.Preferably, also for the α-1 by OCH1 and congener coding, 6-mannose transferase activity is a defective to above-mentioned host cell.In further embodiment, above-mentioned host cell is a defective for the mannose group phosphorylation activity also, and in embodiment further, and above-mentioned host cell is being defective in β-mannose groupization aspect active also.Thereby, the invention provides to produce and comprise panimmunity globulin or segmental method for compositions, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form, comprise that (a) provides above-mentioned eukaryote host cell; (b) the described eukaryote host cell certain hour of growth in culture medium is enough to described eukaryote host cell and produces described immunoglobulin or fragment; With, (c) separate described immunoglobulin or fragment and produce described compositions.

Aspect preferred, described host cell is a lower eukaryotes.The lower eukaryotes cell (for example comprises yeast, fungus, ring-flagellate, microsporozoite, alveolates, dinoflagellate), stramenopiles (for example, Brown algae, protozoacide), Rhodophyta (for example, red algae), plant (for example, chlorella, plant cell, lichen) and other protisties.Yeast and fungus include but not limited to, Pichia sp., for example Pichia pastoris, Pichia finlandica, Pichiatrehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichiathermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichiastiptis and Pichia methanolica; Saccharomyces sp., for example Saccharomycescerevisiae; Hansenula polymorpha, Kluyveromyces sp., for example, Kluyveromyces lactis; Candida albicans, Aspergillus nidulans, Aspergillusniger, Aspergillus oryzae, Trichoderma reesei, Chrysosporiumlucknowense, Fusarium sp., for example Fusarium gramineum, Fusariumvenenatum, Physcomitrella patens and Neurospora crassa.Preferred lower eukaryotes of the present invention includes but not limited to Pichia pastoris, Pichia finlandica, Pichiatrehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijeri, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillusniger, Aspergillus oryzue, Trichoderma reseei, Chrysosporiumlucknowense, Fusarium sp.Fusarium gramineum, Fusarium venenatum and Neurospora crassa.

Thereby, the present invention further provides and in the lower eukaryotes host cell, produced any above-mentioned panimmunity globulin or segmental method for compositions of comprising, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form.Aspect specific, described lower eukaryotes host cell comprises coding immunoglobulin or segmental exogenous gene, and described host cell is modified hereditarily or through engineering approaches to produce glycoprotein, described glycoprotein is for GlcNAcMan ₃GlcNAc ₂The N-polysaccharide is by enrichment.Thereby aspect specific, described lower eukaryotes host cell comprises and being selected from by α-1, one or more exogenous genes of the group that 2-mannosidase, mannosidase II, GlcNAc transferring enzyme (GnT1) and UDP-GlcNAc transport protein constitute.Preferably, above-mentioned lower eukaryotes comprises each of aforementioned exogenous gene.Preferably, also for the α-1 by gene OCH1p or its congener coding, 6-mannose transferase activity is a defective to above-mentioned lower eukaryotes host cell.In further embodiment, above-mentioned lower eukaryotes host cell is defective (deletion of PNO1 and MNN4b gene or a destruction) for the mannose group phosphorylation activity also, in embodiment further, above-mentioned eukaryote host cell is being (deletion or the destruction that relate to one or more genes of β-mannose groupization) of defective in β-mannose groupization aspect active also.Thereby, the invention provides to produce and comprise panimmunity globulin or segmental method for compositions, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form, comprise that (a) provides above-mentioned lower eukaryotes host cell; (b) the described lower eukaryotes host cell certain hour of growth in culture medium is enough to make described lower eukaryotes host cell to produce described immunoglobulin or fragment; With, (c) separate described immunoglobulin or fragment and produce described compositions.

The present invention further provides the method that combines or improve ADCC that combines and reduce immunoglobulin and Fc γ RIIa and/or Fc γ RIIb receptor that improves immunoglobulin or fragment and Fc γ RIIIa and/or Fc γ RIIIb receptor, by in one of aforementioned host cell, producing immunoglobulin, described host cell is by through engineering approaches or select to express described immunoglobulin, GlcNAcMan in described immunoglobulin ₃GlcNAc ₂It is main N-polysaccharide.

Unless in this other definition, the Science and Technology term of related use with the present invention and term have the implication of those of ordinary skills' common sense.Further, unless context needs in addition, the term of odd number should comprise plural number, and the term of plural number should comprise odd number.Usually, the relevant name of using, and the technology of biochemistry described here, zymetology, molecule and cytobiology, microbiology, hereditism and protein and nucleic acid chemistry and hybridization is known in this field and normally used.

Definition

Except as otherwise noted, following term should be understood to have following implication.

As used herein, term " antibody ", " immunoglobulin " and " immunoglobulin molecules " use interchangeably.Every kind of immunoglobulin molecules has particular structure, and it allows its specific antigen in conjunction with it, but all immunoglobulins have identical overall structure described here.The known tetramer that comprises subunit of immunoglobulin structure unit on basis.Each tetramer is composed of by two identical polypeptide chains, and each pairing has " gently " chain (about 25kDa) and " weight " chain (about 50-70kDa).The amino terminal of every chain partly comprises about 100 to 110 or more a plurality of amino acid whose variable region of mainly antigen recognition being responsible for.The carboxyl terminal of every chain partly delimited the constant region that main pairing effect thing function is responsible for.Light chain is classified as kappa or lambda.Heavy chain is classified as gamma, mu, alpha, delta or epsilon, and the isotype that has defined antibody respectively is IgG, IgM, IgA, IgD and IgE.

Light chain and heavy chain be further divided into variable region and constant region (generally referring to, FundamentalImmunology (Paul, W., ed., 2nd ed.Raven Press, N.Y., 1989), Ch.7.The paired variable region of each light chain/heavy chain forms antibody combining site.Thereby complete antibody has two binding sites.Except in difunctional or bi-specific antibody, two binding sites are identical.Chain has all represented by three hypervariable regions, has been also referred to as the identical general structure of conservative framework region (FR) relatively that complementary determining region or CDR connect.The CDR of each paired two chain aims at by framework region, allows to combine with specific epi-position.This term comprises the form of natural generation, and fragment and derivant.Being included in the scope of this term is immunoglobulin (Ig) kind, that is, and and IgG, IgA, IgE, IgM and IgD.Also being included in the scope of this term is that IgG expresses hypotype, that is, and and IgG1, IgG2, IgG3 and IgG4.This term uses according to broad sense, comprises single monoclonal antibody (comprising excitability and antagonistic antibodies), and will be in conjunction with a plurality of epi-positions or antigenic antibody compositions.This term (is for example contained monoclonal antibody (comprising full length monoclonal antibodies), polyclonal antibody, multi-specificity antibody especially, bi-specific antibody) and antibody fragment, as long as they contain or modified at least a portion of the CH2 domain that contains immunoglobulin heavy chain constant region, described part comprises glycosylation site or its variant of the N-connection of CH2 domain.Being included in this term is the molecule that only comprises the Fc district, for example immunoadhesin (the disclosed patent application NO.20040136986 of the U.S.), Fc fusions and antibody sample molecule.Select as another kind, these terms can refer to the antibody fragment in Fab zone at least, and it contains the glycosylation site that N-connects at least.

Term " Fc " fragment is meant " fraction-crystalline " C-stub area (accompanying drawing 1) of the antibody that contains CH2 and CH3 domain.Term " Fab " fragment is meant " fragment antigen combination " zone (referring to accompanying drawing 1) of the antibody that contains VH, CH1, VL and CL domain.

The term of Shi Yonging " monoclonal antibody (mAb) " is meant the antibody that obtains from the antibody colony of homogeneity basically herein, that is, except may be with the possible abiogenous sudden change that exists on a small quantity, each antibody of forming described colony be same.Monoclonal antibody is a high degree of specificity, at one antigenic site.In addition, compare with (polyclonal) antibody preparation of routine, each mAb is at the single factor of determination on the antigen, and conventional antibody preparation usually comprises the different antibodies at different determinants (epi-position).Except that their specificity, the benefit of monoclonal antibody is that they can cultivate to synthesize by hybridoma, is not polluted by other immunoglobulins.Term " monoclonal " has shown that antibody is the characteristic that the antibody colony from homogeneity basically obtains, and can not be counted as needs by any special method production antibody.For example, monoclonal antibody used according to the invention can be passed through by (1975) such as Kohler, Nature, the hybridoma method preparation that 256:495 at first describes, maybe can prepare by recombinant DNA method (referring to, for example, the U.S. Patent No. 4,816,567 of Cabilly etc.).

Term " fragment " in the scope of term " antibody " or " immunoglobulin " comprises those by producing with various protease digestions, by chemical cracking and/or chemical those that produce that dissociate, and be recombinantly produced those, as long as this fragment still can specificity combining target molecule.Fc, Fab, Fab ', Fv, F (ab ') 2 and strand Fv (scFv) fragment are arranged in these fragments.Hereinafter, term " immunoglobulin " also comprises term " fragment ".

Immunoglobulin further is included in the immunoglobulin or the fragment of being modified on the sequence but still can specificity combining target molecule, comprising: chimeric or humanized antibody between kind; Antibody fusions; Different poly-antibody complex and antibody fusions, for example double antibody (diabody) (bi-specific antibody), strand double antibody and interior antibody (intrabody) (referring to, for example, IntracellularAntibodies:Research and Disease Applications, (Marasco, ed., Springer-Verlag New York, Inc., 1998).

As used herein, term " basically by ... form " will be understood as to infer and comprise the whole or whole colony (inclusion of a stated integer or group of integers) of claiming; And got rid of trim or other integral body that will influence or change this integral body of claiming in fact.For N-polysaccharide kind, the N-polysaccharide that term " basically by " is claimed " is formed " and will be interpreted as and comprise the N-polysaccharide, no matter whether this N-polysaccharide is locating mycose-baseization with the direct-connected N-acetylglucosamine of the asparagine residue of glycoprotein (GlcNAc).

As used herein, term " mainly (predominantly) " or variant will be understood to mean that as " mainly " or " main is ", handle with PNGase at glycoprotein, after for example MALDI-TOF MS or HPLC analyze the polysaccharide that discharges by mass spectrography, in total neutral N-polysaccharide, have the polysaccharide kind of the highest molar percentage (%).In other words, term " mainly " is defined as single entity, for example specific sugar form, and it exists with the molar percentage higher than any other corpus separatum.For example, if compositions is made up of the A kind of 40 molar percentages, the B kind of 35 molar percentages and the C kind of 25 molar percentages, said composition mainly comprises the A kind, and the B kind will be the second main kind (the next most predominantN-glycan structure).Some host cell can produce the compositions that comprises neutral N-polysaccharide and charged N-polysaccharide such as mannose group phosphoric acid.Thereby the compositions of glycoprotein can comprise multiple charged and uncharged or neutral N-polysaccharide.In the present invention, it is in the environment of whole multiple neutral N-polysaccharide in the compositions, GlcNAcMan in the described compositions ₃GlcNAc ₂It is main N-polysaccharide.Thereby as used herein, " main N-polysaccharide " is meant the main N-polysaccharide of whole multiple neutral N-polysaccharide in the compositions, and this main N-polysaccharide is GlcNAcMan ₃GlcNAc ₂

As used herein, term " does not have (essentially free of) " basically specific saccharide residue, for example trehalose or galactose or the like are used to show that this glycoprotein compositions lacks the N-polysaccharide that contains this residue basically.Represent according to purity, basically the quantity that is not meant the N-glycan structures that contains this saccharide residue is no more than 10%, preferably is lower than 5%, preferredly is lower than 1%, most preferredly be lower than 0.5%, wherein said percentage ratio is according to weight or according to molar percentage.Thereby all basically N-polysaccharide do not have trehalose or galactose or both in glycoprotein compositions according to the present invention.

As used herein, when these saccharide residues that at any time do not have detectable amount are present on the N-glycan structures, the saccharide residue that glycoprotein compositions " lacks " or " shortage " is specific, for example trehalose or galactose.For example, of the present invention preferred embodiment in, described glycoprotein compositions by as the lower eukaryotes of above definition produce, comprise yeast (for example, Pichia sp.; Saccharomyces sp.; Kluyveromyces sp.; Aspergillus sp.), and with " shortage trehalose ", because these organisms do not have the required enzyme of the mycose-base N-glycan structures of generation.Thereby term " does not have trehalose " basically to be contained term and " lacks trehalose ".Yet even compositions once contained mycose-base N-glycan structures or contained aforesaid mycose-base N-glycan structures limited but detectable amount, compositions can be " not having trehalose basically ".

The interaction of antibody and antibody-antigenic compound and immune cell and the variation of reaction, the cytotoxicity (ADCC) and CDC (CDC), the removing (phagocytosis) of immune complex, the antibody producing and the IgG serum half-life of B cell that comprise the antibody dependent cellular mediation define in following document respectively: Daeron et al., 1997, Annu.Rev.Immunol.15:203-234; Ward and Ghetie, 1995, Therapeutic Immunol.2:77-94; Cox and Greenberg, 2001, Semin.Immunol.13:339-345; Heyman, 2003, Immunol.Lett.88:157-161; And Ravetch, 1997, Curr.Opin.Immunol.9:121-125.

Brief description of drawings

Accompanying drawing 1 has shown at the Asn-297 place of each CH2 chain to have GlcNAcMan ₃GlcNAc ₂The sketch map of the immunoglobulin molecules of N-glycan structures.

Accompanying drawing 2A has shown the plasmid figure of the pDX343 of encoding D X-IgG1 light chain in the pCR2.1 TOPO carrier.

Accompanying drawing 2B has shown the plasmid figure of coding from the pDX344 of Kar2 (Bip) signal sequence of pDX343 and DX-IgG1 light chain.

Accompanying drawing 2C has shown the plasmid figure of the pDX360 of the DX-IgG1 heavy chain in the coding pCR2.1 TOPO carrier.

Accompanying drawing 2D has shown encoded K ar2 SS in the pPICZA carrier of coding AOX2 promoter and from the plasmid figure of the pDX458 of the light chain of pDX344.

Accompanying drawing 2E has shown encoded K ar2 (Bip) signal sequence and from the plasmid figure of the pDX468 of the DX-IgG1 heavy chain of the DX-IgG1 of pDX360.

Accompanying drawing 2F has shown encoded K ar2 SS and from the plasmid figure (embodiment 1) of the pDX478 of the DX-IgG1 heavy chain of the pDX360 of sub-clone in the pDX458.

Accompanying drawing 3 has shown separation, and (DX-IgG1 has GlcNAcMan from the MALDI-TOF spectrum of the sample F 060708 of bacterial strain YDX554 ₃GlcNAc ₂As the main N-polysaccharide of expressing among the bacterial strain YSH37).

Accompanying drawing 4 has shown relatively have GlcNAcMan ₃GlcNAc ₂Result as the bonded ELISA binding analysis of the DX-IgG1 (F060708) of main N-polysaccharide and RITUXIMAB and Fc γ RIIb.

Accompanying drawing 5A has shown relatively have GlcNAcMan ₃GlcNAc ₂Result as the bonded ELISA binding analysis of the DX-IgG1 (F060708) of main N-polysaccharide and RITUXIMAB and Fc γ RIIIa-LF phenotype.

Accompanying drawing 5B has shown relatively have GlcNAcMan ₃GlcNAc ₂Result as the bonded ELISA binding analysis of the DX-IgG1 (F060708) of main N-polysaccharide and RITUXIMAB and Fc γ RIIIa-LV phenotype.

Detailed description of the invention

The invention provides the composition of the colony that comprises the white or fragment of the immune globulin with multiple N-glycan, wherein main N-glycan is basically by structure GlcNAcMan₃GlcNAc ₂Group Become. GlcNAcMan₃GlcNAc ₂The N-glycan structures can be expressed as especially [(GlcNAc β 1,2-Man α 1,3) (Man α 1,6) Man β Isosorbide-5-Nitrae-GlcNAc β Isosorbide-5-Nitrae-GlcNAc].

The present invention has shown at this, the GlcNAcMan on immune globulin is white₃GlcNAc ₂The N-glycan Specific antibody effect thing function had impact. For example, as in this demonstration, comprise main The N-glycan is GlcNAcMan₃GlcNAc ₂The white composition of immune globulin, this immune globulin is white Have to Fc γ RIIIa-LF and-raising of LV acceptor direct in conjunction with active and Fc γ RIIb is subjected to (or shortage) of the reduction of body, is directly in conjunction with active. , have in conjunction with active according to above-mentioned GlcNAcMan₃GlcNAc ₂Estimate in vain to mediate other antibody as the immune globulin of main N-glycan Effect thing function, the ADCC that for example improves is active or that improve, and B cell antibody produces, and causes The reduction of activate the phagocytic capacity. Thereby, comprise and have GlcNAcMan₃GlcNAc ₂Poly-as main N-The composition of panimmunity globulin of sugar, wherein said immune globulin have in vain Fc γ RIII are subjected to The raising of body in conjunction with active and to the reduction of Fc γ RII acceptor in conjunction with active. Thereby, described group Compound estimates to cause that the B cell antibody of raising, the raising of ADCC activity produces and reduces Phagocytosis.

The present invention further provides to produce to comprise and had GlcNAcMan₃GlcNAc ₂As mainly The method of the composition that the immune globulin of N-glycan is white. Generation has main sugared form (glycoform) The benefit of the white composition of immune globulin be that it has avoided having the immune globulin of unexpected sugared form The generation of the heterogeneous mixture that white generation and/or immune globulin are white, they may induce unexpected Effect and/or dilute the concentration of more effective immune globulin white sugar form. Thereby, be contemplated that bag Contain and have GlcNAcMan₃GlcNAc ₂As the white medicine combination of the immune globulin of main N-glycan Thing may be effective at lower dosage, thereby have higher effectiveness or potentiality.

In one aspect, the asparagine residue in the white molecule of immune globulin CH2 structure territory of heavy chain in the Fc district of comprising of composition numbering 297 (Asn-297) locate to have GlcNAcMan₃GlcNAc ₂The N-glycan structures, wherein the hydroxyl of terminal GlcNAc (N-acetyl-β-GLUCOSAMINE) is covalently bound Arrive the amide groups of the asparagus fern acid amides at 297 places, position. Resisting in the mediated immunity globulin molecule of Fc zone Bulk effect thing function. Preferably, described GlcNAcMan₃GlcNAc ₂Glycan structures is in dimerization Each Asn-297 residue in white each the CH2 zone of immune globulin on (referring to accompanying drawing 1). Thereby, provide the white composition of immune globulin, wherein in the main sugared form at Asn-297 place GlcNAcMan₃GlcNAc ₂The N-glycan structures. As selection, deposit on the white molecule of immune globulin One or more other carbohydrate part can be deleted or add described molecule to, because of And add or delete the quantity that described immune globulin go up sugared baseization site in vain. Further, described exempting from The position in the sugar baseization site that the N-in the CH2 zone of epidemic disease globulin molecule connects can be passed through Asparagus fern acid amides or other N-sugar base are introduced in white intramolecular one or more other positions of immune globulin Changing the site changes.

Although Asn-297 is the N-sugar baseization site that generally is present in mouse and the human IgG molecule (Kabat et al., Sequences of Proteins of Immunological Interest, 1991), The Asn-297 site is not can by unique site of sugar baseization, needn't on the white molecule of immune globulin yet For function is kept this site. Use known mutagenesis method, the white nucleic acid of coding immune globulin Molecule can be modified, thereby coding comprises the nucleotide sequence quilt in the N-sugar baseization site of Asn-297 It is no function that deletion or change becomes for N-sugar baseization, at the nuclear of the white molecule of immune globulin of encoding The nucleotide sequence that coding N-sugar baseization site is introduced in another position in the acid is created in non-natural The position has GlcNAcMan₃GlcNAc ₂Immune globulin as main N-glycan is white. Coding N-Other nucleotide sequences in sugar baseization site be directed in the above-mentioned nucleic acid and (or introduce coding The nucleic acid in Asn-297 N-sugar baseization site), be created in the intramolecular tool on the position that surpasses The white molecule of immune globulin that the N-glycan is arranged, wherein GlcNAcMan₃GlcNAc ₂It is main N-glycan. Yet, preferably in the CH2 zone of the white molecule of immune globulin, create described N-sugar baseization position The point. Yet the sugar baseization in the Fab zone that immune globulin is white is retouched in 30% serum antibody Stated---usually find (Rademacher et al., 1986, Biochem.Soc. at Asn-75 Symp., 51:131-148). Thereby, the sugar baseization in the Fab zone of the white molecule of immune globulin Be can with the Fc zone in N-sugar baseization other sites combination or independent.

Generally, it is white that described composition comprises immune globulin, and wherein main N-glycan is GlcNAcMan₃GlcNAc ₂, it exists with certain level, and described level surpasses described restructuring immunity At least about 5 moles of percentages of the second main N-glycan structures of globulin composition. In preferred reality Execute in the mode described GlcNAcMan₃GlcNAc ₂The N-glycan structures exists with certain level, institute It is at least about that the level of stating surpasses the second main N-glycan structures of the white composition of described restructuring immune globulin 10 moles of percentages are to about 25 moles of percentages. In preferred enforcement mode, described GlcNAcMan₃GlcNAc ₂The N-glycan structures exists with certain level, and described level surpasses described heavy At least about 25 moles of percentages of the second main N-glycan structures of the white composition of group immune globulin are to about 50 moles of percentages. In preferred enforcement mode, described GlcNAcMan₃GlcNAc ₂N-Glycan structures exists with certain level, and described level surpasses the white composition of described restructuring immune globulin The second main N-glycan structures is greater than about 50 moles of percentages. In preferred enforcement mode, Described GlcNAcMan₃GlcNAc ₂The N-glycan structures exists with certain level, and described level surpasses The second main N-glycan structures of the white composition of described restructuring immune globulin is greater than about 75 moles of percentages Ratio. In most preferred embodiments, described GlcNAcMan₃GlcNAc ₂The N-glycan structures with Certain level exists, and described level surpasses the second main of the white composition of described restructuring immune globulin The N-glycan structures is greater than about 90 moles of percentages.

Immune globulin white chessman class has shown the different binding affinities that have the Fc acceptor (Huizinga et al., 1989, J.of Immunol., 142:2359-2364). Every kind of subclass can Provide special advantage at different aspect of the present invention. Thereby, provide comprise IgG1, IgG2, The composition of IgG3, IgG4 or its mixture, wherein main N-glycan is GlcNAcMan₃GlcNAc ₂ In further enforcement mode, provide composition, wherein GlcNAcMan₃GlcNAc ₂Be the immune globulin of main N-glycan be selected from vain by IgA, IgD, IgE, The group that IgM and IgG consist of. Yet, preferred immune globulin be in vain be selected from by hypotype IgG1, IgG2, The mankind or the people source IgG of the group that IgG3 and IgG4 consist of. Preferred, preferably described Immune globulin is the IgG1 hypotype in vain.

Preferably, described composition comprises by the MIg of nucleic acid coding (antibody), and described nucleic acid produces GlcNAcMan when being imported into host's cell₃GlcNAc ₂It is main N-glycan Glycoprotein. Monoclonal antibody herein for example comprises " antibody in people source ". The antibody in people source Can transplant by complementary determining region (CDR) and obtain (R.Kontermann﹠S.Duebel (2001) Recombinant antibodies-Laboratory Manuals.Verlag ISBN 3-540-41354-5 and list of references wherein). CDR transplants and comprises with monoclonal antibody (example Such as mouse) the hypermutation ring replace the hypermutation ring of human antibody. Additive method comprises " again smooth (resurfacing) " (Duebel﹠Kontermann (2001), Roguska et al. (1996) A Comparison of two murine monoclonal antibodies humanized by CDR-grafting and variable domain resurfacing.Prot Eng.9:895-904). The people Again another kind method of source antibody comprises shuffles (shuffling) V-gene and selects at antigen. Shuffling of V-gene can adopt the bacteriophage displaying to carry out, but is not limited to this (Duebel﹠ Kontermann (2001), Jespers et al. (1994) Guiding the selection of human Antibodies from phage-display repertoires to a single epitope.Bio/Technol 12:899-903). Thereby a kind of light chain variable district of source can with the heavy chain from separate sources The constant region montage, otherwise or, perhaps the fusion of variable district or constant region and allos protein is not examined Consider source species or the white type of immune globulin or subclass title (referring to, such as U.S. of Cabilly etc. State patent No.4,816,567; Mage and Lamoyi, in Monoclonal Antibody Production Techniques and Applications, pp.79-97 (Marcel Dekker, Inc., New York, 1987)).

The most common form of people source antibody is that people's immune globulin is white, wherein from people's immune globulin The residue of white CDR is expected special from having of inhuman species such as mouse, rat or rabbit The property, compatibility and the residue of accepting the CDR of power (capacity) substitute. Generally, people's sourceization is anti-Body comprises basically all at least one, generally is two variable domains, and is wherein, all Or basically all CDR district corresponding to the CDR district of non-human immunoglobulin and all or Basically all framework districts (FR) are the framework districts of the white consensus sequence of people's immune globulin. The FR district The territory be adjacent to or flank in the part in the variable district of the antibody of CDR. Generally, these FR districts The territory have the variable district of impact conformation surpass a kind of structure function, and more directly to antigen Be combined with the specificity of antibody and be responsible for, yet however, the FR zone can affect interaction. People source antibody most desirably also will comprise at least a portion of the white constant region of immune globulin (Fc), It generally is the part of the white constant region of people's immune globulin. In some situation, people's immune globulin White FR residue is substituted by corresponding inhuman residue. In addition, people source antibody can comprise neither The residue that in the CDR that introduces or FR sequence, does not exist in recipient's antibody, again. Carry out this The a little modification with further improvement and maximumization antibody performance. Further details is referring to Jones et al., 1986, Nature 321:522-524; Reichmann et al., 1988, Nature 332:323-327, And Presta, 1992, Curr.Op.Struct.Biol.2:593-596.

Monoclonal antibody herein further comprises " chimeric " antibody (immune globulin is white), and is wherein heavy The part of chain and/or light chain be same as or with come from from first species or belong to specific antibody Sequence in the antibody of kind or subclass, and all the other parts of chain are same as or same coming from from difference Kind or belong to sequence in the antibody of different antibodies kind or subclass, and the sheet of such antibody Section is as long as they contain or quilt is modified to contain at least one CH2. Non-human (for example, mouse) " people source " form of antibody be recombinate specifically that immune globulin is white, immunoglobulin chain or its fragment (for example, other antigens of Fv, Fab, Fab ', F (ab ') 2 or antibody are in conjunction with subsequence), It contains from the white sequence of people's immune globulin. The Fv fragment of antibody has kept complete molecule Minimum unit in conjunction with the antibody of feature and specificity. The Fv fragment is the variable of antibody heavy chain and light chain The different dimer of the non-covalent association in district. F (ab) ' 2 fragment is to contain by two of disulfide bond connection The fragment of the arm of bar Fab fragment. Embodiment 1 has illustrated the structure of the expression vector of the chimeric antibody of encoding Build, described chimeric antibody comprise the constant region that is fused to human IgG1, for antigens c D20 The variable district of mouse IgG1.

Has GlcNAcMan₃GlcNAc ₂As the immune globulin of main N-glycan in vain to the combination of the raising of Fc γ RIII acceptor

In conjunction with the white effect thing function of immune globulin of Fc γ RIIIa and/or Fc γ RIIIb acceptor, for example The activation of ADCC is by the Fc zone mediation of the white molecule of immune globulin. Different functions are by this Different structure territory mediation in the zone. Accompanying drawing 6A and 6B have shown to comprise to have GlcNAMan3 GlcNAc₂As the composition (such as in restructuring Pichia pastoris, expressing of describing among the embodiment 3) of the anti-CD 20 antibodies of main N-glycan, (for example, RITUXIMAB) do not have a GlcNAMan3 GlcNAc with anti-CD 20 antibodies wherein₂Combination phase as main N-glycan Ratio has the combination to Fc γ RIIIa acceptor of raising. Thereby, the invention provides immune globulin White molecule and composition, the Fc zone on the white molecule of wherein said immune globulin has GlcNAcMan₃GlcNAc ₂As main N-glycan and the white molecule of wherein said immune globulin and shortage GlcNAcMan₃GlcNAc ₂As the immune globulin of main N-glycan compare in vain with Fc γ RIIIa and/or Fc γ RIIIb acceptor have raising in conjunction with the aspect.

Interesting ground, Fc γ RIIIa gene dimorphism produces two kinds of types of the same race: Fc γ RIIIa-158V and Fc γ RIIIa-158F (Dall ' Ozzo et al., 2004, Cancer Res.64:4664-4669). The genotype homozygote of Fc γ RIIIa-158V is relevant with higher clinical response to RITUXIMAB (Cartron et al., 2002, Blood, 99:754-758). Yet most of colonies carry one Fc γ RIIIa-158F allele. In this assorted individuality that closes, RITUXIMAB is for passing through It is more not effective that the ADCC of Fc γ RIIIa combination induces. Yet, when the RITUXIMAB sample resists CD20 antibody when lacking host's cells of rock algae glycosyl transferase activity, this kind antibody Equate that for strengthen ADCC by Fc γ RIIIa-158F and Fc γ RIIIa-158V ground effectively (Niwa et al., 2004, Clin.Canc Res.10:6248-6255). It is of the present invention that some is preferred The antibody of enforcement mode at host's cells, described host's cell does not add the sea to the N-glycan Algae sugar (for example, Pichia pastoris, a kind of yeast host that lacks the ability of adding trehalose). Accompanying drawing 5A has shown the composition that comprises anti-CD 20 antibodies, and described anti-CD 20 antibodies has GlcNAcMan₃GlcNAc ₂As main N-glycan and such as in restructuring Pichia pastoris, expressing of describing among the embodiment 3, compare with RITUXIMAB and aspect Fc γ RIIIa-LF acceptor, have about 3 to 4 times of raisings, RITUXIMAB does not have GlcNAcMan₃GlcNAc ₂As Main N-glycan, accompanying drawing 5B have shown that said composition compares in combination with RITUXIMAB Fc γ RIIIa-LV acceptor aspect has about 10 times of raisings. Thereby, be contemplated that to have GlcNAcMan₃GlcNAc ₂As main N-glycan and further lack the anti-CD20 of trehalose Antibody will have the combination to the enhancing of Fc γ RIIIa-158F, for the treatment those have right The individuality of the clinical response of the reduction of RITUXIMAB may be useful especially.

Has GlcNAcMan₃GlcNAc ₂As the immune globulin of main N-glycan in vain to the combination of the reduction of Fc γ RIIb acceptor

The effect thing function of the white molecule of immune globulin also comprises with Fc γ RIIb acceptor is combined. With Fc γ RIIb in conjunction with thereby it seems the antibody of reduction of the phagocytosis that causes reduction, B cell produce, And the ADCC activity that reduces. Accompanying drawing 4 has shown to comprise to have GlcNAcMan₃GlcNAc ₂As the immune globulin of the above-mentioned composition of the anti-CD 20 antibodies of main N-glycan white with RITUXIMAB compares the combination to Fc γ RIIb acceptor with reduction. Thereby the present invention carries Supplied the white molecule of immune globulin and composition, wherein the Fc zone of the white molecule of immune globulin has GlcNAcMan₃GlcNAc ₂As main N-glycan and its have reduction to Fc γ RIIb acceptor Combination.

The cell toxicity of the antibody dependent cellular mediation that improves

Has GlcNAcMan₃GlcNAc ₂Immune globulin as main N-glycan is white Fc γ RIIIa and/or Fc γ RIIIb may also give the anti-of Fc γ RIII mediation in conjunction with the raising of aspect The raising of cell toxicity (ADCC) aspect of body dependence cell mediation. Determine well That Fc γ RIII (CD16) acceptor is to active (Daeron et al., 1997, the Annu.Rev. of being responsible for of ADCC Immunol.15:203-234). Has GlcNAcMan₃GlcNAc ₂As main N-glycan The Fc γ RIIa of the white molecule of immune globulin or composition and/or Fc γ RIIb also can in conjunction with the reduction of aspect Can give the active aspect of ADCC raising (referring to, Clynes et al., 2000, above). Cause This has GlcNAcMan₃GlcNAc ₂The white molecule of immune globulin or bag as main N-glycan Contain the white composition of described immune globulin and estimate to have the ADCC activity of raising.

The phagocytosis (macrophage is to the removing of immune compound) that reduces

In another enforcement mode, has GlcNAcMan₃GlcNAc ₂As main N-glycan The white Fc γ RIIa of immune globulin given the Fc γ RIIa of immune compound in conjunction with the reduction of aspect The reduction of removing (phagocytosis) aspect of mediation. What shown is Fc γ RIIa (CD32) Acceptor the immune compound of macrophage removed be responsible for (Cox and Greenberg, 2001, Semin.Immunol.13:339-345). Thereby, be contemplated that to have GlcNAcMan₃GlcNAc ₂White and comprise the white composition of described immune globulin and may open up as the immune globulin of main N-glycan The phagocytosis that now reduces.

The antibody of the raising of B cell produces

Shown antibody by modulability Fc γ R approach participate in to antitumor (Clynes et al., 2000, Nature, 6:443-446). Especially, be known that when Fc γ RIIb with contain based on The acceptor of the activation motif (ITAM) of immunity acceptor tyrosine for example B-cell receptor (BCR), When Fc γ RI, Fc γ RIII and Fc γ RI co-crosslinking, it suppresses the signal (Vivier of ITAM mediation And Daeron, 1997, Immunol.Today, 18:286-291). For example, add Fc γ RII spy Heterogenetic antibody blocking-up Fc is in conjunction with Fc γ RIIb, cause increase B cell proliferation (Wagle et al., 1999, J of Immunol.162:2732-2740). Thereby, have GlcNAcMan₃GlcNAc ₂The white composition white with comprising described immune globulin of immune globulin as main N-glycan estimated to be situated between Lead acceptor in conjunction with the reduction of aspect, cause the activation of B cell, it follows the antibody of catalysis thick liquid cell Produce (Parker, D.C.1993, Annu.Rev.Immunol.11:331-360).

Other immunology activity

The surface expression of the change of effect thing cell molecule has shown on the neutrophilia granulocyte To the sensitiveness of the raising of bacillary infection (Ohsaka et al., 1997, Br.J.Haematol.98: 108-113). What further proved is, in conjunction with the IgG of Fc γ RIIIa effect cell acceptor The expression of adjusting tumour necrosin ﹠ (TNF-α (Blom et al., 2004, Arthritis Rheum., 48:1002-1014)). In addition, the TNF-α that induces of Fc γ R also improves the combination of neutrophilia granulocyte Coated erythrocytic ability (Capsoni et al., 1991, the J.Clin.Lab with engulfing IgG Immunol.34:115-124). Thereby be contemplated that in demonstration aspect Fc γ RIIIa acceptor Improve, have a GlcNAcMan₃GlcNAc ₂As the immune globulin of main N-glycan white and Comprise the white composition of described immune globulin and also may give the increase of TNF-alpha expression.

The raising of Fc γ RII and Fc γ RIII acceptor activity has shown raising lysosome β-glucose aldehyde Secretion (Kavai et al., 1982, the Adv.Exp Med.Biol. of acid enzyme and other lysosome enzymes 141:575-582; Ward and Ghetie, 1995, Therapeutic Immunol., 2:77-94). In addition, the important step after immune acceptor is participated by their part is them The inherenceization and to the sending of lysosome (Bonnerot et al., 1998, EMBO J., 17: 4906-4916). Thereby be contemplated that aspect Fc γ RIIIa and/or Fc γ RIIIb acceptor Show raising and had GlcNAcMan₃GlcNAc ₂Immune globulin as main N-glycan is white The raising that white composition also may be given the lysosome enzyme secretion with comprising described immune globulin.

More sophisticated medullary cell (for example, mononuclear phagocyte, granulocyte and neutrophil cell) produces via the peroxide with Fc γ RIIa bonded activation causing raising.In addition, the generation of the peroxide group of neutrophil cell be the health system of defense key factor (Huizinga, et al., 1989, J Immunol., 142:2365-2369).Thereby be contemplated that aspect Fc γ RIIa receptor, showing and reduce and have a GlcNAcMan ₃GlcNAc ₂Also may give the reduction of peroxide generation aspect as the immunoglobulin of main N-polysaccharide and the compositions that comprises described immunoglobulin.

Exclusively play main effect in the assembling of Fc γ RIIIb at immune complex that exists on the neutrophil cell, its gathering has activated destructive phagocytosis, flailing action and the respiratory pulse of the pathogen that causes conditioning.The activation of neutrophil cell causes the secretion with the proteolytic cleavage soluble form of the corresponding receptor of two extracellular domain.Soluble Fc γ RIIIb is by the competitive inhibition of Fc γ R dependency effector function and via bringing into play regulatory function with combining of complement receptors CR3, the generation of causing inflammation property amboceptor (Sautes-Fridman et al., 2003, ASHIQuarterly, 148-151).Thereby be contemplated that aspect Fc γ RIIIb receptors bind, shown raising, have a GlcNAcMan ₃GlcNAc ₂Also may promote the assembling of immune complex as the immunoglobulin of main N-polysaccharide and the compositions that comprises described immunoglobulin.

Comprise and have GlcNAcMan ₃GlcNAc ₂Generation as the compositions of the immunoglobulin molecules of main N-polysaccharide

Described immunoglobulin produces in host cell, and described host cell is had GlcNAcMan by genetically engineered the generation ₃GlcNAc ₂Compositions as the glycoprotein of main N-polysaccharide.Usually, one or more nucleic acid that are specific to the heavy chain of the antigenic immunoglobulin of specific objective and light chain with coding transform, stable conversion recombinant host cell preferably.In one embodiment, the nucleic acid of coding heavy chain of immunoglobulin and light chain uses overlapping oligonucleotide synthetic individually separately, and is cloned into individually separately that (referring to embodiment 1) is used for expressing at host cell in the expression vector.In specific embodiment, be humanized immunoglobulin by the recombination immunoglobulin of described nucleic acid coding.Preferably, described recombinant host cell with described immunoglobulin secretion to the culture medium that is used for cultivating described reconstitution cell.Recombinant host cell is hatched being suitable for producing under the condition of described immunoglobulin then, and described immunoglobulin will have GlcNAcMan ₃GlcNAc ₂As main N-polysaccharide.Described immunoglobulin separates from other compositions of culture medium then, and is resuspended in the suitable vehicle (vehicle) and produces compositions.Though for many recombination immunoglobulins, GlcNAcMan ₃GlcNAc ₂To be connected with the nitrogen of the amide groups of Asn-297, but in specific embodiment, the site that the N-polysaccharide connects can be the agedoite (except Asn-297) that is in different loci place in the immunoglobulin molecules, or with the Fab zone in the combination of N-glycosylation site.

Recombinant host cell can be eucaryon or prokaryotic host cell, for example, animal, plant, insecticide, bacterial cell or the like, it is by through engineering approaches or select to produce and mainly have GlcNAcMan ₃GlcNAc ₂The immune globulin composite of N-glycan structures.

In preferred embodiment, GlcNAcMan wherein ₃GlcNAc ₂The described immune globulin composite that is main N-polysaccharide produces in lower eukaryotes.Low eukaryotic host cell such as grade does not produce usually has GlcNAcMan ₃GlcNAc ₂As the glycoprotein of main N-polysaccharide, yet lower eukaryotes can be modified with generation hereditarily has GlcNAcMan ₃GlcNAc ₂Glycoprotein as main N-polysaccharide.Modify with generation hereditarily and have GlcNAcMan ₃GlcNAc ₂As the reorganization lower eukaryotes cell of the glycoprotein of main N-polysaccharide those mammalian cells preferably, it produces natively but with low yield has GlcNAcMan ₃GlcNAc ₂The glycoprotein of N-polysaccharide.Using another advantage of reorganization lower eukaryotes host cell for example described here is that the compositions of immunoglobulin can repeatedly have GlcNAcMan ₃GlcNAc ₂As main N-polysaccharide.Further benefit is again, and is low grade for eukaryotic cell can be grown in the culture medium of regulation, and it has avoided for example use of calf serum of animal product.

Preferably, recombinant host cell of the present invention is the low eukaryotic host cell that waits, and it is as WO 02/00879, and WO 04/074498, and WO 04/074499, Choi et al., 2003, PNAS, 100:5022-5027; Hamilton et al., 2003, Nature, 301:1244-1246 andBobrowicz et al., 2004, Glycobiology, 14:757-766, and Davidson et al, 2004 Glycobiology.14 (5): describe among the 399-407 by genetically engineered or modify.The lower eukaryotes cell (for example comprises yeast, fungus, ring-flagellate, microsporozoite, alveolates, dinoflagellate), stramenopiles (for example, Brown algae, protozoacide), Rhodophyta (for example, red algae), plant (for example, chlorella, plant cell, lichen) and other protisties.Yeast and fungus include but not limited to, Pichia sp., for example Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichiaminuta (Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichiathermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijeri, Pichiastiptis, and Pichia methanolica; Saccharomyces sp., for example Saccharomycescerevisiae; Hansenula polymorpha, Kluyveromyces sp., for example Kluyveromyceslactis; Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Chrysosporium lucknowense, Fusarium sp., for example Fusarium gramineum, Fusarium venenatum, Physcomitrella patens and Neurospora crassa.Preferred lower eukaryotes of the present invention includes but not limited to Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichiathermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichiastiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillusntger, Aspergillus oryzue, Trichoderma reseei, Chrysosporiumlucknowense, Fusarium sp.Fusarium gramineum, Fusarium venenatum and Neurospora crassa.Particularly preferred species are Pichia pastoris.

Generation has GlcNAcMan ₃GlcNAc ₂As an embodiment of the immunoglobulin of main N-polysaccharide shown in the embodiment 2.In embodiment 2, the carrier of coding gomphosis immunoglobulin is imported into recombination yeast Pichia pastoris YSH37 bacterial strain (Hamilton et al., 2003, Science, 301:1244-1246), described gomphosis immunoglobulin comprises heavy chain and the variable region of light chain with the heavy chain mice IgG1 that be connected with constant region of light chain, that be specific to CD20 of IgG 1.The YSH37 restructuring yeast strains lacks endogenous α-1,6-mannose transferase activity (Och1p) and contain three heterologous genes: coding for alpha-1, the gene of 2-mannosidase (MnsIA), it navigates to endoplasmic reticulum, with coding UDP-N-acetylglucosamine (UDP-GlcNAc) transport protein β-1, the gene of 2-N-acetylglucosamine based transferase 1 (GlcNAc transferring enzyme 1 or GnT1) and mannosidase II (MnsII) all navigates to Golgi body.Usually, heterologous gene comprises fungus II type memebrane protein and from the synthetic fusions between the organic catalyst structure domain beyond the Pichia pastoris.Because the glycoprotein that produces in restructuring yeast strains mainly has GlcNAcMan ₃GlcNAc ₂N-glycan structures, the immunoglobulin that produces in the restructuring yeast strains for example immunoglobulin of embodiment 2 will have GlcNAcMan ₃GlcNAc ₂As main N-polysaccharide.Embodiment 3 has shown that the anti-CD20 immunoglobulin that produces has GlcNAcMan in the YSH37 restructuring yeast strains ₃GlcNAc ₂As main N-polysaccharide.About 20% sugar form is by GlcNAcMan ₃GlcNAc ₂Form, have multiple other sugar forms of lesser amt.

In further embodiment, above-mentioned restructuring yeast strains comprises the deletion or the destruction of PNO1 and MNN4b gene, and it causes the elimination (referring to, for example, the disclosed patent application No.20060160179 of the U.S.) of mannose group phosphorylation.The mannose group phosphorylation causes the generation of charged N-polysaccharide.This further genetic modification provides and can produce GlcNAcMan ₃GlcNAc ₂Be the restructuring yeast strains of the immune globulin composite of main N-polysaccharide, and wherein said immunoglobulin do not have mannose group phosphoric acid (and thereby net negative charge), this may produce unusual immunogenicity activity in the mankind.In other embodiments, above-mentioned restructuring yeast strains comprises the deletion or the destruction (referring to WO2005106010 and relevant U.S. Patent application No.11/118,008) of one or more genes that relate to β-mannose groupization.These further genetic modifications provide and can produce GlcNAcMan ₃GlcNAc ₂Be the restructuring yeast strains of the immune globulin composite of main N-polysaccharide, and wherein said immunoglobulin do not have β-mannose groupization, this may produce unusual immunogenicity activity in the mankind.More further in the embodiment, above-mentioned restructuring yeast strains comprises PNO1 and MNN4b gene and the deletion and the destruction that relate to one or more genes of β-mannose groupization.These further genetic modifications provide and can produce GlcNAcMan ₃GlcNAc ₂Be the immune globulin composite of main N-polysaccharide, and wherein said immunoglobulin does not have mannose group phosphorylation and β-mannose groupization.

Though having described recombinant yeast cell is used for producing and has GlcNAcMan ₃GlcNAc ₂As the immunoglobulin of main N-polysaccharide, other protein expression host systems comprise that animal, plant, insecticide, bacterial cell or the like can be used for generation and have GlcNAcMan ₃GlcNAc ₂Immunoglobulin as main N-polysaccharide.These protein expression host systems can be by genetically engineered or modify or select to express and have GlcNAcMan ₃GlcNAc ₂As the immunoglobulin of main N-polysaccharide, or can produce natively and have GlcNAcMan ₃GlcNAc ₂Glycoprotein as main N-glycan structures.The example of through engineering approaches protein expression host system that generation has a glycoprotein of main sugar form comprise gene knockout body/mutant (Shields et al., 2002, JBC, 277:26733-26740); In the Chinese hamster ovary cell genetically engineered ( Et al., 1999, Nature Biotech., 17:176-180), or both combinations.Alternatively, some cell is expressed main sugar form natively, for example chicken, the mankind and cattle (Raju et al., 2000, Glycobiology, 10:477-486).These cells can be modified has GlcNAcMan with generation ₃GlcNAc ₂Immunoglobulin as main N-polysaccharide.Thereby, have GlcNAcMan ₃GlcNAc ₂Can be as the expression of the immunoglobulin of main N-polysaccharide or compositions by those skilled in the art by selecting at least a acquisition of multiple expressive host system.Further the expressive host system comprises Chinese hamster ovary celI: WO9922764A1 and WO03035835A1; Hybridoma: Trebak etal., 1999, J.Immunol.Methods, 230:59-70; Insect cell Hsu et al., 1997, JBC, 272:9062-970 and plant cell: WO04074499A2.

The purification of immunoglobulin

The method of purification and separating immune globulin be known (referring to, for example, Kohler﹠amp; Milstein, (1975) Nature 256:495; Brodeur et al., Monoclonal AntibodyProduction Techniques and Applications, pp.51-63, Marcel Dekker, Inc., New York, (1987); .Goding, Monoclonal Antibodies:Principles andPractice, pp.59-104 (Academic Press, 1986); And Jakobovits et al., 1993, Proc.Natl.Acad.Sci.USA 90:2551-255, and Jakobovits et al., 1993, Nature 362:255-258).In further embodiment, use McCafferty et al. (1990) Nature, the technology of describing among the 348:552-554 (1990), use interested antigen to select antibody or the antibody fragment that is fit to, can be from antibody phage storehouse separation antibody or antibody fragment.

Embodiment 3 provide produce in the yeast cells that is separated in genetic modification, have a GlcNAcMan ₃GlcNAc ₂As the method for the immunoglobulin molecules of main N-polysaccharide, described yeast cells is modified to produce hereditarily has GlcNAcMan ₃GlcNAc ₂Glycoprotein as main N-polysaccharide.Glycan analysis and distribution to isolating immunoglobulin molecules can be measured by several mass spectrometry methods well known by persons skilled in the art, include but not limited to HPLC, NMR, LCMS and MALDI-TOF MS.In preferred embodiment, as disclosed among the embodiment 5, the polysaccharide distribution is analyzed by MALDI-TOF MS and is measured.

Pharmaceutical composition

Has GlcNAcMan ₃GlcNAc ₂Can be incorporated in the pharmaceutical composition that immunoglobulin wherein is an active treatment reagent (referring to Remington ' sPharmaceutical Science (15th ed. as the immunoglobulin of main N-polysaccharide, Mack Publishing Company, Easton, Pennsylvania, 1980).Preferred compositions depends on the expection mode of using and treating application.The preparation that depends on expectation, compositions also can comprise pharmaceutically acceptable, nontoxic carrier or diluent, and it is defined as being generally used for preparing the vehicle that is used for the pharmaceutical composition that animal or human's class uses.Thereby select diluent not influence the biologic activity of combination.The example of these diluent is distilled water, physiology's phosphate buffered saline (PBS), Ringer ' s solution, glucose solution and Hank ' s solution.In addition, pharmaceutical composition or preparation also can comprise other carriers, adjuvant, or the stabilizing agent of nontoxic, non-therapeutic, non-immunogenic, or the like.

The pharmaceutical composition that is used for parenteral administration is aseptic, isoosmotic, pyrogen-free, aseptic basically, and according to U.S. food and drug administration or similar means GMP prepare.Described compositions can be used as the solution of material in physiology ground acceptable diluent or the injectable dosage of suspension is used, and having can be for example water, oil, saline, glycerol or alcoholic acid pharmaceutical carrier of sterile liquid.In addition, the adjuvant material, for example wetting agent or emulsifying agent, surfactant, pH value buffer agent or the like may reside in the compositions.Other parts of pharmaceutical composition are those of oil, animal, plant or synthetic source, for example, and Oleum Arachidis hypogaeae semen, Oleum Glycines and mineral oil.Usually, ethylene glycol for example propylene glycol or Polyethylene Glycol is preferred liquid-carrier, particularly for Injectable solution.Compositions can be used with the form of bank injection or implant goods, and it can be prepared in the mode of the lasting release that allows active component.Usually, this compositions is prepared as injectable, as liquid solution or suspension; Also can be prepared as the solid form that before injection, is suitable for being dissolved in or being suspended in liquid vehicle.Goods can also emulsifying be sealed in liposome or microgranule in, for example polyactide, poly-Acetic acid, hydroxy-, bimol. cyclic ester or copolymer, be used for enhanced adjuvant effect, as discussed above (referring to Langer, Science 249,1527 (1990) and Hanes, AdvancedDrug Delivery Reviews 28,97-119 (1997).

Diagnostic products

Has GlcNAcMan ₃GlcNAc ₂Immunoglobulin molecules as main N-polysaccharide also can be incorporated in various diagnostic kits and other diagnostic products such as the array.Usually be attached to solid phase in advance immunoglobulin is provided, for example be attached to the hole of microdroplet degree plate.Test kit also usually contains the label that is useful on the detection bonded reagent of immunoglobulin and the operation instruction of test kit is provided.Immunity meter or sandwich assay are the preferred forms (referring to United States Patent(USP) Nos. 4,376,110,4,486,530,5,914,241 and 5,965,375) of diagnostic kit.For example at United States Patent (USP) NO.5, antibody array has been described in 922,615,5,458,852,6,019,944 and 6,143,576.

Has GlcNAcMan ₃GlcNAc ₂Immunoglobulin molecules of the present invention as main N-polysaccharide has many treatments to use for indication, for example cancer, diseases associated with inflammation, infection, immunological diseases, autoimmune disease comprise idiopathic thrombocytopenic purpura, arthritis, systemic lupus erythematosus and autoimmune hemolytic anemia.Interested target spot comprises growth factor receptors (for example, FGFR, PDGFR, EGFR, NGFR and VEGF) and their part.Other target spots have the G protein receptor, comprise material K receptor, angiotensin receptor, α-and B-adrenergic receptor, serotonine enteramine receptor and paf receptor.(referring to, Gilman for example, Ann.Rev.Biochem.56:625-649 (1987).Other target spots comprise ion channel (for example, calcium, sodium, potassium channel), M-ChR, acetylcholinergic receptor, GABA receptor, glutamate receptor and dopamine receptor (referring to Harpold, U.S.5,401,629 and U.S.5,436,128).Other target spots have attachment proteins, for example integrin, select element and immunoglobulin superfamily member (referring to Springer, Nature 346:425-433 (1990) .Osborn, Cell 62:3 (1990); Hynes, Cell 69:11 (1992)).Other target spots have cytokine, and for example interleukin IL-1 is to IL-13, tumor necrosis factor and β, interferon-ALPHA, β and γ, tumorgrowthfactor-(TGF-β) colony stimulating factor (CSF) and granulocyte mononuclear cell colony stimulating factor (GMCSF).Referring to Human Cytokines:Handbook for Basic﹠amp; Clinical Research (Aggrawal etal.eds., Blackwell Scientific, Boston, MA 1991).Other target spots have in hormone, enzyme and the cell and iuntercellular courier, for example adenyl cyclase, amidino groups cyclase and phospholipase C.Interested other target spots have human leucocyte antigen, for example CD20 and CD33.Medicine also may be interested target spot.The target spot molecule can be the mankind, mammal or antibacterial.Other target spots are antigen, for example comprise albumen, glycoprotein, the carbohydrate of virus and antibacterial and tumor from microbial pathogens.At U.S.4, other target spot has again been described in 366,241.

According to conventional method well known in the art and as various and the description of list of references more specifically usually carry out method of the present invention and technology, these lists of references are cited in this manual and discuss unless otherwise stated.Referring to, for example: Sambrook et al.MolecularCloning:A Laboratory Manual, 2d ed., Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, N.Y. (1989); Ausubel et al., Current Protocolsin Molecular Biology, Greene Publishing Associates (1992, andSupplements to 2002); Harlow and Lane, Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990); Taylor and Drickamer, Introduction to Glycobiology, Oxford Univ.Press (2003); Worthington Enzyme Manual, Worthington Biochemical Corp., Freehold, NJ; Handbook of Biochemistry:Section A Proteins, Vol I, CRCPress (1976); Handbook of Biochemistry:Section A Proteins, Vol II, CRCPress (1976); Essentials of Glycobiology, Cold Spring Harbor LaboratoryPress (1999); Immunobiology, Janeway et al, 6th Edition, 2004, GarlandPublishing, New York).

All publications, patent and other lists of references intactly merge them by reference referred in this.

Following examples intention promotes further understanding of the present invention.

Embodiment 1

The carrier that makes up the chimeric anti-CD-20 monoclonal antibody of coding is used for having GlcNAcMan in reorganization Pichiapastoris generation ₃GlcNAc ₂Humanized anti-CD 20 monoclonal antibody as main N-polysaccharide, described chimeric anti-CD-20 monoclonal antibody is formed by light chain (L) fusion rotein with the mice variable region of light chain that is fused to human constant region of light chain and by heavy chain (H) fusion rotein that the mice variable heavy chain zone that is fused to the human heavy chain constant region is formed, and described reorganization Pichia pastoris is modified to produce hereditarily has GlcNAcMan ₃GlcNAc ₂Glycoprotein as main N-polysaccharide.

The clone of nucleic acid that be used for expressing at Pichia pastoris, the chimeric anti-CD-20 monoclonal antibody DX-IgG1 of coding is as follows basically.The light chain of DX-IgG1 chimeric antibody and heavy chain are made up of mice variable region and human constant region.The nucleotides sequence of encoding murine/human chimeric light chain is listed in shown in the SEQ ID NO:1, and the nucleotides sequence of encoding murine/human chimeric heavy chain is listed in shown in the SEQ IDNO:2.Use is synthesized heavy chain and light chain code nucleic acid available from the overlapping oligonucleotide of Integrated DNA Technologies (IDT).

For the nucleic acid of composite coding variable region of light chain, buy 15 overlapping oligonucleotide (SEQ IDNO:5-19), use EX TAQ (Takada) annealing in the PCR reaction to produce the nucleic acid of encoded light chain variable region with 5 ' MlyI site.This variable region of light chain code nucleic acid uses 5 ' MlyI primer CD20L/up (SEQ ID NO:20), 3 ' variable region/5 ' constant region primer LfusionRTVAAPS/up (SEQ ID NO:21), 3 ' constant region primer LfusionRTVAAPS/lp (SEQ ID NO:22) and 3 ' CD20L/lp (SEQ ID NO:23) to press nucleic acid (SEQ ID NO:3) (the Gene Art that reading frame inserts the coding constant region of light chain by overlapping PCR then, Toronto, Canada).The last MlyI nucleic acid of the chimeric mice-human light chain segments of encoding (it comprises 5 ' AG base pair) inserts pCR2.1 TOPO carrier then, and (Invitrogen Corporation, Carlsbad CA) produce pDX343 (accompanying drawing 2A).

For heavy chain, available from IDT, and use EX TAQ annealing corresponding to 17 overlapping oligonucleotide (SEQ ID NO:24-40) of the nucleotide sequence of encoding murine variable region of heavy chain.The segmental nucleic acid of this encoding murine variable region of heavy chain uses 5 ' MlyI primer CD20H/up (SEQ ID NO:41), 5 ' variable region/constant region primer HchainASTKGPS/up (SEQ ID NO:42), 3 ' variable region/constant region primer HchainASTKGPS/lp (SEQ IDNO:43) and 3 ' constant region primer HFckpnl/lp (SEQ ID NO:44) to press the nucleic acid (SEQ ID NO:4) (Gene Art) that reading frame inserts coding human heavy chain constant region by overlapping PCR then.The segmental last MlyI nucleic acid of the chimeric mice-human heavy chain of encoding (it comprises 5 ' AG base pair) inserts pCR2.1 TOPO carrier and produces pDX360 (accompanying drawing 2C).

The nucleic acid of coding total length chimeric light chain and total length chimeric heavy chain separates as the Mly1-Not1 nucleic acid fragment from corresponding TOPO carrier.These light chains and heavy chain code nucleic acid fragment are connected to Kar2 (Bip) signal sequence (SEQ ID NO:45) then separately, use 4 overlapping oligonucleotide-P.BiPss/UP1-EcoRI, P.BiPss/LP1, P.BiPss/UP2 and P.BiP/LP2 (being respectively SEQ ID NO:46-49), be connected to the EcoRI-Not1 site of pPICZA then, produce the pDX468 (accompanying drawing 2E) that carries the pDX344 (accompanying drawing 2B) of Kar2-light chain and AOX1 transcription terminator (AOX1 terminator or TT) and carry the kar2-heavy chain.

From the BglII-BamHI fragment of pDX344 then sub-clone in the pBK85 that contains the AOX2 promoter gene, be used for chromosomal integration, produce pDX458 (accompanying drawing 2D).

From the BglII-BamHI fragment of the pDX468 that carries heavy chain then sub-clone in pDX458, produce pDX478 (accompanying drawing 2F), its coding is in the chimeric heavy chain and the chimeric light chain of the total length of the anti-CD-20 monoclonal antibody under the control of AOX1 promoter.The chimeric antibody of pDX478 coding is called as DX-IgG1.Then before transforming with SpeI with plasmid pDX478 linearisation, be used for utilizing the AOX2 locus (referring to embodiment 2) of the transformant that the Zeocin resistance selects.

RITUXIMAB/RITUXAN is available from Biogen-IDEC/Genentech, SanFrancisco, anti-CD20 mice/human chimeric IgG1 of CA.

Pcr amplification.(Westbury NY) is used to all PCR reactions to Eppendorf Mastercycler.The PCR reaction contains template DNA, 125 μ M dNTPs, every kind of forward of 0.2 μ M and reverse primer, EX TAQ polymerase buffer (Takara Bio Inc., Shiga is Japan) with EX TAQ polymerase or pFU Turbo polymerase buffer (Stratagene) and pFU Turbo polymerase.Use 97 ℃ 15 seconds, 55 ℃ 15 seconds, 72 ℃ 30 circulations of 90 seconds, at 97 ℃ of initial denaturing steps of two minutes and at 72 ℃ of final extension steps of seven minutes, amplification of DNA fragments.

Separate the PCR sample by agarose gel electrophoresis, use from the gel extraction kit of Qiagen and extract and the purify DNA band.All DNA purification are eluting in 10mM Tris, pH 8.0, handles outside the last PCR (overlapping all three fragments), and it is eluting in deionization H2O.

Embodiment 2

This embodiment has shown the GlcNAcMan that has that produces by pDX478 or pJC140 coding in recombinant yeast cell ₃GlcNAc ₂Method for the chimeric Humanized anti-CD 20 monoclonal antibody of main N-polysaccharide.

The IgG carrier is as follows basically to the conversion of Pichia pastoris bacterial strain YSH37 (Hamilton et al., 2003).By adding sodium acetate prepares pDX478 to the final concentration of 0.3M carrier DNA.Hundred-percent ice-cold ethanol adds in the DNA sample final concentration to 70% then.By centrifugal with DNA groupization (12000g * 10 minute), with twice of 70% ice-cold washing with alcohol.Dry DNA is resuspended among 10mM Tris, the pH 8.0 of 50 μ l.

Want transformed yeast cells to pass through at BMGY (buffered minimum glycerol: 100mM potassium phosphate, pH6.0; 1.34% yeast nitrilo; 4 * 105% biotin; 1% glycerol) the less culture of expansion prepares to about O.D. of 2 to 6 in.Yeast cells is resuspended in the conduction that becomes in about 1 to 2mL 1M sorbitol 3 times by washing in the 1M sorbitol then.Carrier DNA (1 to 2 μ g) mixes with the competent yeast of 100 μ L, and hatches 10 minutes on ice.Use BTX Electrocell Manipulator 600 to use following parameter then with yeast cells electroporation: 1.5kV, 129ohms and 25 μ F.One milliliter YPDS (1% yeast extract, 2% peptone, 2% glucose, 1M sorbitol) adds the cell of electroporation to.The yeast that transforms is tiled on the selectivity agar plate that contains zeocin subsequently.

The condition of culture that IgG1 produces in Pichia pastoris is as follows basically.The single colony of the YSH37 bacterial strain that transforms with pDX478 is inoculated in the 10mL BMGY culture medium of 50ml Falcon centrifuge tube (being made up of 1% yeast extract, 2% peptone, 100mM kaliumphosphate buffer (pH 6.0), 1.34% yeast nitrogen base, 4 * 105% biotin and 1% glycerol) as mentioned above.Hatch culture 24 ℃/170-190rpm shake 48 hours saturated up to culture.BMGY with 100mL adds in the 500ml baffle plate flask then.Inoculum is transferred in the baffle plate flask that contains 100mL BMGY culture medium then.Hatch this culture, shook 24 hours with 170 to 190rmp at 24 ℃.The inclusions of flask pours in two 50mL Falcon centrifuge tubes, at 3000rpm centrifugal 10 minutes.With the 20mL BMGY washed cell granule that does not have glycerol once, use 20ml BMMY resuspension (BMGY has 1%MeOH and replaces 1% glycerol) mildly subsequently.The cell transfer that suspends is in 250mL baffle plate flask.Hatch this culture, shook 24 hours with 170 to 190rpm at 24 ℃.Then, the inclusions of flask pours in two 50mL Falcon centrifuge tubes, at 3000rpm centrifugal 10 minutes.Before the Separation of Proteins of describing as embodiment 6, measure proximate antibody titer by the elisa assay culture supernatants.

Antibody is quantitatively undertaken by enzyme-linked immunosorbent assay (ELISA) in the culture supernatants.It is high that (San Diego CA) wraps quilt, 4 ℃ of overnight incubation for Biocarta, Inc with the anti-human Fab of 24 μ g goats among 10mL PBS, the pH 7.4 in conjunction with microtitration plate (Costar).Remove buffer, add sealing buffer (3%BSA among the PBS), at room temperature hatched then one hour.Remove the deblocking buffer, with dull and stereotyped 3 times of PBS washing.The last time after the washing, that adds the antibody culture supernatants increases progressively volume amount (0.4,0.8,1.5,3.2,6.25,12.5,25 and 50 μ L), at room temperature hatches dull and stereotyped one hour.Dull and stereotyped with the PBS washing that contains 0.05%Tween20 then.After the washing, add anti-human Fc-HRP to 1: in the 2000PBS solution, at room temperature hatched then 1 hour the last time.Then with dull and stereotyped 4 times of PBS-Tween 20 washings.It is dull and stereotyped to use tmb substrate test kit (Pierce Biotechnology) to analyze according to the description of producer.

Method according to above demonstration produces yeast strain DX554, is used for pDX478 is transformed into restructuring yeast strains YSH37.

Embodiment 3

The inosculating antibody CD20 Purification of Monoclonal Antibodies that produces among the embodiment 2 is as follows basically.The antibody that produces with the pDX478 transformed yeast cells is called as DX-IgG1.

(Amersham Biosciences, Piscataway is NJ) from the culture supernatants capture antibody to use STREAMLINE protein A post.Eluting antibody in Tris-Glycine pH 3.5 uses 1M Tris pH 8.0 neutralizations.Use hydrophobic interaction chromatography (HIC) to be further purified.The particular type of HIC post depends on antibody.For DX-IgG1, with 20mM Tris (7.0), 1M (NH ₄) ₂SO ₄Buffer together uses phenyl SEPHAROSE post (also can use octyl group SEPHAROSE), with 1M (NH ₄) ₂SO ₄Beginning also is reduced to 0M (NH ₄) ₂SO ₄The linear gradient buffer solution elution.Concentrated and exchanged to from the antibody fraction of phenyl SEPHAROSE post and be used in 50mM NaOAc/Tris pH 5.2 buffer at last by cation exchange (SP SEPHAROSE Fast Flow) (GE Healthcare) column purification.Use 50mM Tris, 1M NaCl (pH 7.0) to use linear gradient elution antibody.DX-IgG1 antibody separates from the culture medium according to the culture of the DX554 of embodiment 2 growth.

Protein concentration in the chromatography fraction use albumin as standard (Pierce ChemicalCompany, Rockford, IL), use Bradford to analyze that (Bradford, M.1976, Anal.Biochem. (1976) 72,248-254) measure.

Embodiment 4

The detection of the antibody purification by the SDS-polyacrylamide gel electrophoresis is as follows.

Description (NuPAGE bis-Tris Electrophoresis System according to producer; Invitrogen Corporation) uses ready-formed gel that the DX-IgG1 antibody of purification is mixed with the sample loading buffer of suitable volumes and experience sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).With Coomassie brilliant blue dyestuff (BIO-RAD, Hercules, CA) gel protein that dyes.

Embodiment 5

The auxiliary laser desorption ionization time of the substrate of flight mass spectrum method (MALDI-TOF MS) is used to analyze the GlcNAcMan that has that produces among the embodiment 2 ₃GlcNAc ₂Oligosaccharide as the connection of the Asn on the DX-IgG1 antibody of main neutral N-polysaccharide.

(Glycobiology 8, and the step of the modification of 445-454 (1998) comes to discharge the polysaccharide that N-connects from antibody from Papac etc. in use.Briefly, make antibody sample degeneration and being applied on the 96 hole pvdf membrane flat boards.Then with dithiothreitol, DTT raw sample and come carboxy methylation also with iodoacetic acid.Use polyvinylpyridine capping hole then.The antibody sample passes through then at 30 μ L 10mMNH ₄HCO ₃(EMD Biosciences, La Jolla CA) are hatched at 37 ℃ and were come de-glycosylation in 16 hours with the N-dextranase of 1mU in (pH 8.3).The solution that contains the polysaccharide of release is removed also evaporate to dryness by the centrifugal pvdf membrane that passes then.Be dissolved in the 15 μ L water from the exsiccant polysaccharide of each reacting hole, 0.5 μ L point sample on rustless steel MALDI sample plate, is mixed with the S-DHB substrate of 0.5 μ L (the 5-methoxyl group-salicylic acid of the 9mg/mL resorcylic acid/1mg/mL in 1: 1 water/acetonitrile/0.1% trifluoroacetic acid) and allows drying.The irradiation of the pulse nitrogen laser (337nm) by the 4-ns burst length produces ion.Accelerating potential with 125ns delay and 20kV allows instrument to postpone extracting mode.Grid voltage is 93.00%, and guide wire voltage is 0.1%, and internal pressure is to be lower than 5 * 10 ⁷The holder (1 the holder=133Pa), the low-molecular-weight thresholding is 850Da.Produce spectrum from 100-200 laser pulse altogether, obtain with the 500-MHz digital converter.Man5GlcNAc ₂(Mr1257[M+Na]+) oligosaccharide is used as foreign molecules amount standard.Use instrument to produce whole spectrum with cation mode.

Accompanying drawing 3 has shown the MALDI-TOF MS spectrum of the compositions of the fermented product No.F060708 that comes self-contained DX-IgG1 antibody, and described fermented product produces by the YDX554 cell according to the scheme among the embodiment 2.Accompanying drawing 3 has shown that the main N-glycan structures in the compositions is GlcNAcMan ₃GlcNAc ₂Yet, as showing that in accompanying drawing 3 said composition also comprises other N-glycan structures.These N-polysaccharide comprise GlcNAcMan4GlcNAc ₂, Man6GlcNAc ₂GlcNAcMan5GlcNAc ₂, Man7GlcNAc ₂, GlcNAcMan6GlcNAc ₂, Man8GlcNAc ₂, Man9GlcNAc ₂And Man10GlcNAc ₂

In order to measure the relative populations of various neutral N-glycan structures, carry out HPLC, according to relatively and the area under the HPLC scanning survey strength detection of retention time and the every kind of corresponding peak of above-mentioned N-glycan structures.HPLC is to use PREVAIL Carbohydrate ES 5 μ m250mm * 4.6mm (Cat#_35101; Alltech Associates, Avondale, quick amino PA)-silicon polysaccharide separates.Sample volume is 45 μ L, and solvent is acetonitrile and LSS (50mM NH ₄Formate pH4.4).Flow velocity is 1.0mL/ minute, and column temperature is 30 ℃.Gradient is as follows:

time

0,80% acetonitrile: 20%LSS; Times 50,40% acetonitrile, 60%LSS, times 55,30% acetonitrile, 70%LSS;

Times

60,80% acetonitrile, 20%LSS; And

times

70,80% acetonitrile, 20%LSS.The result of HPLC is shown in the table 1.HPLC analyzes demonstration, finds main N-glycan structures GlcNAcMan ₃GlcNAc ₂Comprise about 20% of total neutral N-glycan structures.

Table 1

Embodiment 6

According to as Shields et al., 2001, J.Biol.Chem, the scheme of describing among the 276:6591-6604 is carried out the Fc receptor binding assay to Fc γ RIIb, Fc γ RIIIa and Fc γ RIIIb.

For Fc γ RIIb binding analysis, in PBS, pH 7.4 the Fc γ RIIb fusion rotein of 1 μ g/mL be coated on the ELISA flat board (Nalge-Nunc, Naperville, IL) go up 4 ℃ 48 hours.Sealed dull and stereotyped one hour with 3% bovine serum albumin (BSA) among the PBS at 25 ℃.DX-IgG1 by mixing 2: 1 molal quantities or RITUXIMAB and the bonded F of HRP (Ab ') 2 anti-F (Ab ') 2 one hours at 25 ℃ in PBS in 1%BSA preparation DX-IgG1 or RITUXIMAB dimer complex.The dimerization complex then in 1%BSA/PBS with serial dilution in 1: 2, and be coated on flat board last one hour at 25 ℃.The substrate that uses is 3,3 ', 5,5 '-tetramethyl benzidine (TMB) (Vector Laboratories, Inc., Burlingame, CA).(Vector Laboratories Inc.) reads absorbance at 450nm according to the explanation of producer.

For Fc γ RIIIa-LF and Fc γ RIIIa-LV binding analysis, Fc γ RIIIa-LF or the Fc γ RIIIa-LV fusion rotein of 0.8 μ g/mL and 0.4 μ g/mL are coated on ELISA flat board (Nalge-Nunc at 4 ℃ respectively in PBS, pH 7.4, Naperville, IL) last 48 hour.Sealed dull and stereotyped one hour with the 3%BSA among the PBS at 25 ℃.DX-IgG1 by mixing 2: 1 molal quantities or RITUXIMAB and the bonded F of HRP (Ab ') 2 anti-F (Ab ') 2 one hours at 25 ℃ in PBS in 1%BSA preparation DX-IgG1 or RITUXIMAB dimer complex.The dimerization complex then in 1%BSA/PBS with serial dilution in 1: 2, and be coated on flat board last one hour at 25 ℃.The substrate that uses is 3,3 ', 5,5 '-tetramethyl benzidine (TMB) (VectorLaboratories, Inc.).According to the explanation of producer (Vector Laboratories Inc.) reads absorbance at 450nm.

The glycoprotein of YDX554 (express DX-IgG1 bacterial strain YSH37) is originated from use, according to said method for Fc γ RIIb and Fc γ RIIIa-LF and Fc γ RIIIa-LV obtain in conjunction with the result respectively shown in accompanying drawing 5,6A and the 6B.

Accompanying drawing 4 has shown to comprise to have GlcNAcMan ₃GlcNAc ₂Above-mentioned composition as the anti-CD 20 antibodies of main N-polysaccharide is compared the combination that has the reduction of Fc γ RIIb receptor with RITUXIMAB.

Accompanying drawing 5A has shown to comprise to have GlcNAcMan ₃GlcNAc ₂As main N-polysaccharide, compare with RITUXIMAB as the compositions of the anti-CD 20 antibodies of in reorganization Pichia pastoris, expressing described among the embodiment 3 and aspect Fc γ RIIIa-LF receptor, to have about 304 times of raisings, described RITUXIMAB does not have GlcNAcMan ₃GlcNAc ₂As main N-polysaccharide.

Accompanying drawing 5B has shown that described compositions compares with RITUXIMAB have about 10 times raising aspect Fc γ RIIIa-LV receptor.Therefore, the antibody compositions that produces from cell line has combination that Fc γ RIIb is reduced and the combination that Fc γ RIIIa is improved, and described cell line quilt through engineering approaches hereditarily comprises GlcNAcMan with generation ₃GlcNAc ₂Glycoprotein as main N-polysaccharide.

The explanation of sequence

The nucleotide sequence of SEQ ID NO:1 encoding D X-IgG1 light chain.

The nucleotide sequence of SEQ ID NO:2 encoding D X-IgG1 heavy chain.

The nucleotide sequence of the human constant region of SEQ ID NO:3 coding IgG1 light chain.

The nucleotide sequence of the human constant region of SEQ ID NO:4 coding IgG1 heavy chain.

SEQ ID NO:5 to 19 coding is used for 15 overlapping oligonucleotide by the Mus variable region of light chain of polymerase chain reaction (PCR) synthetic DX-IgG1.

SEQ ID NO:20 to 23 coding is used to connect four oligonucleotide primers of DX-IgG1 Mus variable region of light chain to human constant region of light chain.

SEQ ID NO:24 to 40 coding is used for 17 overlapping oligonucleotide by the Mus variable region of heavy chain of polymerase chain reaction (PCR) synthetic DX-IgG1.

SEQ ID NO:41 to 44 coding is used to connect four oligonucleotide primers of DX-IgG1 Mus variable region of heavy chain to the human heavy chain constant region.

SEQ ID NO:45 coding has the nucleotide sequence in the terminal EcoRI of N-site, described nucleotide sequence coded Kar2 (Bip) signal sequence.

SEQ ID NO:46-49 coding is used to connect the Kar2 signal sequence to the light chain of DX-IgG1 and four oligonucleotide primers of heavy chain.

Though described the present invention at this with reference to illustrated embodiment, should be understood that to the invention is not restricted to this.Have the ordinary skill of this area and the personnel of acceptance instruction herein and will recognize that other are revised and embodiment is in its scope.Thereby, the claim restriction that the present invention is only subsidiary from here.

Sequence table

<110>Glycofi，Inc.

Gerngross，Yillman?U.

Li，Huijuan

Wildt，Stefan

＜120〉mainly comprise the immunoglobulin of GLCNACMAN3GLCNAC2 sugar form

<130>GF0009Y-PCT

<150>60/714,109

<151>200509-02

<150>60/714,108

<151>2005-09-02

<160>49

<170>FastSEQ?for?Windows?Version?4.0

<210>1

<211>642

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the chimeric IgG1 mice of mice/people of DX-IgG light chain

<400>1

caaatcgtct?tgtctcaatc?cccagctatt?ttgtctgctt?cccctggaga?gaaggtcacc?60

atgacttgta?gagcctcttc?ctctgtctct?tacattcact?ggttccagca?aaagccaggt?120

tcctctccaa?agccatggat?ctacgctact?tccaacttgg?cttccggtgt?tccagttaga?180

ttctctggtt?ctggttccgg?tacctcctac?tctcttacca?tctccagagt?tgaagccgag?240

gacgctgcta?cttactactg?tcagcaatgg?acttctaacc?caccaacttt?cggtggtggt?300

accaaattgg?agattaagag?aactgttgct?gctccatccg?ttttcatttt?cccaccatcc?360

gacgaacaat?tgaagtctgg?tacagcttcc?gttgtttgtt?tgttgaacaa?cttctaccca?420

agagaggcta?aggttcagtg?gaaggttgac?aacgctttgc?aatccggtaa?ctcccaagaa?480

tccgttactg?agcaggattc?taaggattcc?acttactcct?tgtcctccac?tttgactttg?540

tccaaggctg?attacgagaa?gcacaaggtt?tacgcttgtg?aggttacaca?tcagggtttg?600

tcctccccag?ttactaagtc?cttcaacaga?ggagagtgtt?aa 642

<210>2

<211>1356

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the chimeric IgG1 heavy chain of mice/people of DX-IgG

<400>2

caagtccagt?tgcaacagcc?tggtgccgag?ttggtcaagc?caggtgcttc?tgttaagatg?60

tcctgtaagg?cttctggtta?cactttcacc?tcctacaaca?tgcactgggt?caagcaaact?120

ccaggtagag?gtttggagtg?gattggtgcc?atctacccag?gtaacggtga?cacttcttac?180

aaccaaaaat?tcaagggaaa?ggctactctt?accgctgata?agtcctcttc?caccgcctac?240

atgcaattgt?cttccttgac?ttctgaagat?tctgctgttt?actactgtgc?tagatccacc?300

tactacggtg?gagactggta?cttcaacgtt?tggggtgctg?gtaccactgt?caccgtttcc?360

gctgcttcta?ctaagggacc?atccgttttt?ccattggctc?catcctctaa?gtctacttcc?420

ggtggtactg?ctgctttggg?atgtttggtt?aaggactact?tcccagagcc?tgttactgtt?480

tcttggaact?ccggtgcttt?gacttctggt?gttcacactt?tcccagctgt?tttgcaatct?540

tccggtttgt?actccttgtc?ctccgttgtt?actgttccat?cctcttcctt?gggtactcag?600

acttacatct?gtaacgttaa?ccacaagcca?tccaacacta?aggttgacaa?gaaggttgag?660

ccaaagtcct?gtgacaagac?acatacttgt?ccaccatgtc?cagctccaga?attgttgggt?720

ggtccatccg?ttttcttgtt?cccaccaaag?ccaaaggaca?ctttgatgat?ctccagaact?780

ccagaggtta?catgtgttgt?tgttgacgtt?tctcacgagg?acccagaggt?taagttcaac?840

tggtacgttg?acggtgttga?agttcacaac?gctaagacta?agccaagaga?ggagcagtac?900

aactccactt?acagagttgt?ttccgttttg?actgttttgc?accaggattg?gttgaacgga?960

aaggagtaca?agtgtaaggt?ttccaacaag?gctttgccag?ctccaatcga?aaagactatc?1020

tccaaggcta?agggtcaacc?aagagagcca?caggtttaca?ctttgccacc?atccagagat?1080

gagttgacta?agaaccaggt?ttccttgact?tgtttggtta?aaggattcta?cccatccgac?1140

attgctgttg?agtgggaatc?taacggtcaa?ccagagaaca?actacaagac?tactccacca?1200

gttttggatt?ctgacggttc?cttcttcttg?tactccaagt?tgactgttga?caagtccaga?1260

tggcaacagg?gtaacgtttt?ctcctgttcc?gttatgcatg?aggctttgca?caaccactac?1320

actcaaaagt?ccttgtcttt?gtccccaggt?aagtaa 1356

<210>3

<211>324

<212>DNA

＜213〉artificial sequence

<220>

＜223〉constant region of light chain of IgG 1

<400>3

agaactgttg?ctgctccatc?cgttttcatt?ttcccaccat?ccgacgaaca?attgaagtct?60

ggtacagctt?ccgttgtttg?tttgttgaac?aacttctacc?caagagaggc?taaggttcag?120

tggaaggttg?acaacgcttt?gcaatccggt?aactcccaag?aatccgttac?tgagcaggat?180

tctaaggatt?ccacttactc?cttgtcctcc?actttgactt?tgtccaaggc?tgattacgag?240

aagcacaagg?tttacgcttg?tgaggttaca?catcagggtt?tgtcctcccc?agttactaag?300

tccttcaaca?gaggagagtg?ttaa 324

<210>4

<211>990

<212>DNA

＜213〉artificial sequence

<220>

＜223〉CH of IgG 1

<400>4

tctactaagg?gaccatccgt?ttttccattg?gctccatcct?ctaagtctac?ttccggtggt?60

actgctgctt?tgggatgttt?ggttaaggac?tacttcccag?agcctgttac?tgtttcttgg?120

aactccggtg?ctttgacttc?tggtgttcac?actttcccag?ctgttttgca?atcttccggt?180

ttgtactcct?tgtcctccgt?tgttactgtt?ccatcctctt?ccttgggtac?tcagacttac?240

atctgtaacg?ttaaccacaa?gccatccaac?actaaggttg?acaagaaggt?tgagccaaag?300

tcctgtgaca?agacacatac?ttgtccacca?tgtccagctc?cagaattgtt?gggtggtcca?360

tccgttttct?tgttcccacc?aaagccaaag?gacactttga?tgatctccag?aactccagag?420

gttacatgtg?ttgttgttga?cgtttctcac?gaggacccag?aggttaagtt?caactggtac?480

gttgacggtg?ttgaagttca?caacgctaag?actaagccaa?gagaggagca?gtacaactcc?540

acttacagag?ttgtttccgt?tttgactgtt?ttgcaccagg?attggttgaa?cggaaaggag?600

tacaagtgta?aggtttccaa?caaggctttg?ccagctccaa?tcgaaaagac?tatctccaag?660

gctaagggtc?aaccaagaga?gccacaggtt?tacactttgc?caccatccag?agatgagttg?720

actaagaacc?aggtttcctt?gacttgtttg?gttaaaggat?tctacccatc?cgacattgct?780

gttgagtggg?aatctaacgg?tcaaccagag?aacaactaca?agactactcc?accagttttg?840

gattctgacg?gttccttctt?cttgtactcc?aagttgactg?ttgacaagtc?cagatggcaa?900

cagggtaacg?ttttctcctg?ttccgttatg?catgaggctt?tgcacaacca?ctacactcaa?960

aagtccttgt?ctttgtcccc?aggtaagtaa 990

<210>5

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LF1

<400>5

aggagtcgta?ttcaaatcgt?cttgtctcaa?tccccagcta?ttttg 45

<210>6

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LF2

<400>6

tctgcttccc?ctggagagaa?ggtcaccatg?acttgtagag?cctct 45

<210>7

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LF3

<400>7

tcctctgtct?cttacattca?ctggttccag?caaaagccag?gtt?cc 45

<210>8

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LF4

<400>8

tctccaaagc?catggatcta?cgctacttcc?aacttggctt?ccggt 45

<210>9

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LF5

<400>9

gttccagtta?gattctctgg?ttctggttcc?ggtacctcct?actct 45

<210>10

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LF5

<400>10

cttaccatct?ccagagttga?agccgaggac?gctgctactt?actac 45

<210>11

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LF7

<400>11

tgtcagcaat?ggacttctaa?cccaccaactttcggtggtg?gtacc 45

<210>12

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the mice variable region of light chain adds the overlapping oligonucleotide CD20LF8 of human constant region of light chain

<400>12

aaattggaga?ttaagagaac?tgttgctgct?ccatcc 36

<210>13

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LR1

<400>13

caacagttct?cttaatctcc?aatttggtac?caccaccgaa?agttg 45

<210>14

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LR2

<400>14

gtgggttaga?agtccattgc?tgacagtagt?aagtagcagc?gtcct 45

<210>15

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LR3

<400>15

cggcttcaac?tctggagatg?gtaagagagt?aggaggtacc?ggaac 45

<210>16

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LR3

<400>16

agaaccagag?aatctaactg?gaacaccgga?agccaagttg?gaag 44

<210>17

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LR5

<400>17

tagcgtagat?ccatggcttt?ggagaggaac?ctggcttttg?ctgga 45

<210>18

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LR6

<400>18

ccagtgaatg?taagagacag?aggaagaggc?tctacaagtc?atgg 44

<210>19

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mice light chain variable area overlapping oligonucleotide CD20LR7

<400>19

tgaccttctc?tccaggggaa?gcagacaaaa?tagctgggga?ttgag 45

<210>20

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉5 ' MlyI primer CD20L/up

<400>20

aggagtcgta?ttcaaatcgt?c 21

<210>21

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉3 ' variable region/5 ' constant region primer LfusionRTVAAPS/up

<400>21

agaactgttg?ctgctccatc?c 21

<210>22

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉3 ' constant region primer LfusionRTVAAPS/lp

<400>22

ggatggagca?gcaacagttc 20

<210>23

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉3 ' primer CD20L/lp

<400>23

ctggtacctt?aacactctcc?tctgttgaag 30

<210>24

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HF1 in murine heavy chain variable region

<400>24

aggagtcgta?ttcaagtcca?gttgcaacag?cctggtgccg?agttg 45

<210>25

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HF2 in murine heavy chain variable region

<400>25

gtcaagccag?gtgcttctgt?taagatgtcc?tgtaaggctt?ctggt 45

<210>26

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HF3 in murine heavy chain variable region

<400>26

tacactttca?cctcctacaa?catgcactgg?gtcaagcaaactcca 45

<210>27

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HF4 in murine heavy chain variable region

<400>27

ggtagaggtt?tggagtggat?tggtgccatc?tacccaggta?acggt 45

<210>28

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HF5 in murine heavy chain variable region

<400>28

gacacttctt?acaaccaaaa?attcaaggga?aaggctactc?ttacc 45

<210>29

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HF6 in murine heavy chain variable region

<400>29

gctgataagt?cctcttccac?cgcctacatg?caattgtctt?ccttg 45

<210>30

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HF7 in murine heavy chain variable region

<400>30

acttctgaag?actctgctgt?ttactactgt?gctagatcca?cctac 45

<210>31

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HF8 in murine heavy chain variable region

<400>31

tacggtggag?actggtactt?caacgtttgg?ggtgctggta?ccact 45

<210>32

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the murine heavy chain variable region adds the overlapping oligonucleotide CD20HF9 of human heavy chain constant region

<400>32

gtcaccgttt?ccgctgcttc?tactaaggga?ccatcc 36

<210>33

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the murine heavy chain variable region adds the overlapping oligonucleotide CD20HR1 of human heavy chain constant region

<400>33

tagtagaagc?agcggaaacg?gtgacagtgg?taccagcacc?ccaaa 45

<210>34

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HR2 in murine heavy chain variable region

<400>34

cgttgaagta?ccagtctcca?ccgtagtagg?tggatctagc?acag 44

<210>35

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HR3 in murine heavy chain variable region

<400>35

agtaaacagc?agagtcttca?gaagtcaagg?aagacaattg?catgt 45

<210>36

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HR4 in murine heavy chain variable region

<400>36

aggcggtgga?agaggactta?tcagcggtaa?gagtagcctt?tccct 45

<210>37

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HR5 in murine heavy chain variable region

<400>37

tgaatttttg?gttgtaagaa?gtgtcaccgt?tacctgggta?gatgg 45

<210>38

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HR6 in murine heavy chain variable region

<400>38

caccaatcca?ctccaaacct?ctacctggag?tttgcttgac?ccagt 45

<210>39

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HR7 in murine heavy chain variable region

<400>39

gcatgttgta?ggaggtgaaa?gtgtaaccag?aagccttaca?ggaca 45

<210>40

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the overlapping oligonucleotide CD20HR8 in murine heavy chain variable region

<400>40

tcttaacaga?agcacctggc?ttgaccaact?cggcaccagg?ctgtt 45

<210>41

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉5 ' MlyI primer CD20H/up

<400>41

aggagtcgta?ttcaagtcca?g 21

<210>42

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉5 ' variable region/constant region primer HchainASTKGPs/up

<400>42

gcttctacta?agggaccatc?c 21

<210>43

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉3 ' variable region/constant region primer HchainASTKGPs/lp

<400>43

ggatggtccc?ttagtagaag?c 21

<210>44

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉3 ' constant region primer HFckpn1/lp

<400>44

ctggtattact?tacctgggg?acaaagac 28

<210>45

<211>105

<212>DNA

＜213〉artificial sequence

<220>

＜223〉have the Kar2 signal sequence of EcoRI

<400>45

gaattcgaaa?cgatgctgtc?gttaaaacca?tcttggctga?ctttggcggc?attaatgtat?60

gccatgctat?tggtcgtagt?gccatttgct?aaacctgtta?gagct 105

<210>46

<211>70

<212>DNA

＜213〉artificial sequence

<220>

＜223〉overlapping oligonucleotide P.BiPss/UP1-EcoRI

<400>46

aattcgaaac?gatgctgtct?ttgaagccatcttggcttac?tttggctgct?ttgatgtacg?60

ctatgctttt 70

<210>47

<211>41

<212>DNA

＜213〉artificial sequence

<220>

＜223〉overlapping oligonucleotide P.BiPss/LP1

<400>47

ccaaagtaag?ccaagatggc?ttcaaagaca?gcatcgtttc?g 41

<210>48

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉overlapping oligonucleotide P.BiPss/UP2

<400>48

ggttgttgtt?ccatt?tgcta?agccagttag?agct 34

<210>49

<211>59

<212>DNA

＜213〉artificial sequence

<220>

＜223〉overlapping oligonucleotide P.BiPss/LP2

<400>49

agctctaact?ggcttagcaa?atggaacaac?aaccaaaagc?atagcgtaca?tcaaagcag?59

Claims

1. comprise panimmunity globulin or segmental compositions, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form.

2. the compositions of claim 1, wherein said multiple N-polysaccharide greater than 50 molar percentages basically by GlcNAcMan ₃GlcNAc ₂Form.

3. the compositions of claim 1, wherein said multiple N-polysaccharide greater than 75 molar percentages basically by GlcNAcMan ₃GlcNAc ₂Form.

4. the compositions of claim 1, wherein said multiple N-polysaccharide greater than 90 molar percentages basically by GlcNAcMan ₃GlcNAc ₂Form.

5. the compositions of claim 1, wherein said GlcNAcMan ₃GlcNAc ₂The N-polysaccharide exists with certain level, and about 5 molar percentages of the second main N-glycan structures of the described multiple N-polysaccharide of described horizontal exceeding are to about 50 molar percentages.

6. the compositions of claim 1, wherein said immunoglobulin or fragment represent the binding affinity to the reduction of Fc γ RII receptor.

7. the compositions of claim 6, wherein said Fc γ RII receptor is a Fc γ RIIa receptor.

8. the compositions of claim 7, wherein said immunoglobulin or fragment represent the phagocytosis (immune complex of macrophage is removed) of reduction.

9. the compositions of claim 6, wherein said Fc γ RII receptor is a Fc γ RIIb receptor.

10. the compositions of claim 9, wherein said immunoglobulin or fragment activating B cell.

11. the compositions of claim 1, wherein said immunoglobulin or fragment represent the binding affinity to the raising of Fc γ RIII receptor.

12. the compositions of claim 11, wherein said Fc γ RIII receptor is a Fc γ RIIIa receptor.

13. the compositions of claim 11, wherein said Fc γ RIII receptor is a Fc γ RIIIb receptor.

14. the compositions of claim 1, wherein said immunoglobulin or fragment represent antibody dependent cellular cytotoxicity (ADCC) activity of raising.

15. the compositions of claim 1, wherein said immunoglobulin or fragment do not have trehalose basically.

16. the compositions of claim 1, wherein said immunoglobulin or fragment lack trehalose.

17. the compositions of claim 1, wherein said immunoglobulin or fragment are in conjunction with the antigen that is selected from the group that is made of somatomedin, FGFR, EGFR, VEGF, human leucocyte antigen, CD20, CD33, cytokine, TNF-α and TNF-β.

18. the compositions of claim 1, wherein said immunoglobulin or fragment comprise the Fc zone that is selected from the group that is made of IgG1, IgG2, IgG3 and IgG4Fc zone.

19. comprise the compositions of claim 1 and the pharmaceutical composition of pharmaceutically acceptable carrier.

20. the pharmaceutical composition of claim 19, wherein said immunoglobulin or fragment do not have trehalose basically.

21. the pharmaceutical composition of claim 19, wherein said immunoglobulin or fragment lack trehalose.

22. the pharmaceutical composition of claim 19, wherein said immunoglobulin or fragment comprise in conjunction with the antigenic antibody that is selected from the group that is made of somatomedin, FGFR, EGFR, VEGF, human leucocyte antigen, CD20, CD33, cytokine, TNF-α and TNF-β.

23. the pharmaceutical composition of claim 19, wherein said immunoglobulin or fragment comprise the Fc zone that is selected from the group that is made of IgG1, IgG2, IgG3 and IgG4Fc zone.

24. comprise the test kit of the compositions of claim 1.

25. comprise the eukaryotic host cell of coding immunoglobulin or its segmental exogenous gene, the immune globulin composite of claim 1 is modified or selected to express to wherein said eukaryotic host cell hereditarily.

26. the host cell of claim 25, wherein said host cell are the low eukaryotic host cells that waits.

Comprise panimmunity globulin or segmental method for compositions 27. produce, every kind of immunoglobulin or fragment comprise at least a N-polysaccharide that is attached thereto, thereby wherein said compositions comprises multiple N-polysaccharide, and wherein main N-polysaccharide is basically by GlcNAcMan ₃GlcNAc ₂Form, comprising:

(a) provide the eukaryote host cell of claim 25;

(b) the described eukaryote host cell certain hour of growth in culture medium is enough to make described eukaryote host cell to produce described immunoglobulin or fragment; And,

(c) separate described immunoglobulin or fragment and produce described compositions.

28. the method for claim 27, wherein said host cell are the low eukaryotic host cells that waits.