CN101087806A - Immunoglobulins comprising predominantly a Ga1GlcNAcMan5GLcNAc2 glycoform - Google Patents

Abstract

The present invention relates to immunoglobulin glycoprotein compositions having predominant N-glycan structures on an immunoglobulin glycoprotein which confer a specific effector function. Additionally, the present invention relates to pharmaceutical compositions comprising an antibody having a particular enriched N-glycan structure, wherein said N-glycan structure is GalGlcNAcMan5GlcNAc2.

Description

Mainly contain GalGlcNAcMan 5GLcNAc 2The immunoglobulin (Ig) of sugar shape

Related application

The application requires the U.S. Provisional Application No.60/639 that submits on December 23rd, 2004, and 657 and the U.S. Provisional Application No.60/639 that submits on December 23rd, 2004,698 right of priority.The application also is the U.S. series application No.10/500 that submits on June 25th, 2004,240 the application that continues (" CIP "), application No.10/500, the 240th, requirement the U.S. Provisional Application No.60/344 that submits on December 27 calendar year 2001, international application No.PCT/US02/41510 169 right of priority, that submit on December 24th, 2002 enters the application documents in country's stage.The application also is the U.S. series application No.11/108 that submits on April 15th, 2005,088 CIP, application No.11/108,088 is the U. S. application No.10/371 that submitted on February 20th, 2003,877 CIP, application No.10/371, the 877th, the U. S. application No.09/892 that submit to June 27 calendar year 2001,591 CIP, application No.09/892,591 require in the U.S. Provisional Application No.60/214 of submission on June 28th, 2000,358, the U.S. Provisional Application No.60/215 that submits on June 30th, 2000,638 and the U.S. Provisional Application No.60/279 that submits to March 30 calendar year 2001,997 rights and interests.Above-mentioned application of quoting all intactly is incorporated into herein as a reference.

Invention field

The present invention relates to be used for producing to have composition and the method that specific N-connects the glycoprotein of glycosylation pattern.Especially, the present invention relates to comprise the multiple composition N-glycan, immunoglobulin (Ig) glycoprotein with specific N-glycan structures, more particularly, relate to the composition that contains immunoglobulin (Ig) glycoprotein, wherein regulating and control on the immunoglobulin (Ig) that for example promotes the specific effect function one or more sugared shape (glycoform) structures that take advantage are arranged.

Background of invention

Glycoprotein can be regulated and control multiple basic function in human body and other Mammals, comprise katalysis, signal effect, cell-cell communication and molecular recognition and contact.In eukaryote, glycoprotein constituted most non-cytosol albumen (Lis and Sharon, 1993, Eur.J.Biochem.218:1-27).Developed many glycoprotein and be used for the treatment of purpose, in the past 20 years, the recombinant vectors of naturally occurring glycoprotein has become the major portion of biotechnology industry.The recombinant glycosylated proteic example that is used for the treatment of comprises erythropoietin (EPO), treatment monoclonal antibody (mAbs), tissue fibers activation of zymogen thing (tPA), interferon-beta (IFN-β), granulocyte-macrophage colony stimutaing factor (GM-CSF), reaches human chorionic gonadotrophin (hCH) (Cumming et al., 1991, Glycobiology 1:115-130).Because the recombinant protein of producing can be used as preventative clinically and the therapeutic means, so the variation of glycosylation pattern has become very noticeable theme recently in the glycoprotein of recombinant production in scientific circles.Antibody or immunoglobulin (Ig) (Ig) are the glycoprotein of performance central role in humoral immunoresponse(HI).Antibody can be considered between body fluid and cytophylaxis mechanism provides " joint " that be connected molecule.

Antibody can cause the formation immunocomplex to antigenic specific recognition, and it can activate multiple effect mechanism, causes the removal and the destruction of mixture.In the common classification of immunoglobulin (Ig), can be 5 types antibody---IgM, IgD, IgG, IgA and IgE according to biochemistry and function distinguishing, and more subtle difference concentrate on the antigenic variable region of specific combination.In this 5 class Igs, has only two types light chain, called after lambda (λ) and kappa (κ).Between antibody, do not have function difference, but the ratio of two types of light chains is different because of species with λ and κ chain.Have 5 types heavy chain or isotype, they have determined the functionally active of antibody molecule.5 kinds of function types of immunoglobulin (Ig) are: immunoglobulin M (IgM), immunoglobulin D (IgD), immunoglobulin G (IgG), immunoglobulin A (IgA) and immunoglobulin E (IgE).Every kind of isotype has specific function in immunne response, their distinguished functional performances are partly to be given by the C-terminal of heavy chain, and it doesn't matter with light chain.IgG be immunoglobulin (Ig) isotype the abundantest in the blood plasma (referring to for example Immunobiology, Janeway etal, 6 ^ThEdition, 2004, Ga rland Publishing, New York).

Immunoglobulin G (IgG) molecule contains Fab (Fab) structural domain and Fc (FC) structural domain with constant region and variable region.The CH2 structural domain of each heavy chain contains one N-at connection N-glycan with the asparagine residue place of Ig molecule and is connected glycosylation site, residue A sn-297 (Kabat et al. normally, Sequences of proteins ofimmunological interest, Fifth Ed., U.S.Department of Health andHuman Services, NIH Publication No.91-3242).

Because following three major causes, the structure of N-connection oligosaccharides and the analysis of functional performance are had important biological significance: the glycosylation of (1) CH2 structural domain is kept in evolution, shows that oligosaccharides has important effect; (2) immunoglobulin molecules can be used as modular system (Rademacher and Dwek, 1984 of analyzing the allos oligosaccharides; Rademacher et al., 1982); (3) antibody comprises two heavy chains that connect with dimer, and this makes two oligosaccharides unit be in direct contact with one another, so immunoglobulin (Ig) participates in specific albumen-carbohydrate and carbohydrate-carbohydrate interacts.

The different glycosylation pattern that has shown Igs and different biological characters be associated (Jefferis and Lund, 1997, Antibody Eng.Chem.Immunol., 65:111-128; Wright and Morrison, 1997, Trends Biotechnol., 15:26-32).But, only known several specific sugared shape that the expectation biological function is provided.For example, reported that a kind of immune globulin composite that has the fucosylation of minimizing on N-connects glycan can strengthen and the combining of people Fc γ RIII, therefore and strengthen cytotoxicity (ADCC) (the Shieldset al. that antibody relies on, 2002, J.Biol Chem, 277:26733-26740; Shinkawa et al., 2003, J.Biol.Chem.278:3466-3473).And, it is reported, compare the fucosylation G2 (GaI that in Chinese hamster ovary celI, generates with the heterologous antibody composition ₂GIcNAc ₂-Man ₃GlcNAc ₂) the IgG composition can significantly increase the cytotoxicity (CDC) active (Raju, 2004, US Pat.Appl.No.2004/0136986) that complement relies on.Also show suitable tumour antibody can be preferentially in conjunction with activation Fc acceptor (Fc γ RI, Fc γ RIIa, Fc γ RIII), and to the inhibition minimum of Fc γ RIIb acceptor (Clynes et al., 2000, Nature, 6:443-446).Therefore, demand the ability of the specific sugared shape of enrichment on Ig glycoprotein urgently.

Usually, the glycosylation structure (oligosaccharides) on the glycoprotein is according to expressive host and culture condition and change.Treatment in the production of non-human host cell may contain the non-human glycosylation that causes immunne response in human body with albumen, for example, super mannose groupization (Ballou in the yeast, 1990, Methods Enzymol.185:440-470), α (l in the plant, 3)-trehalose and β (l, 2)-wood sugar (Cabanes-Macheteau et al., 1999, Glycobiology, 9:365-372), N-n acetylneuraminic acid n in Chinese hamster ovary cell (Noguchi et al., 1995.J.Biochem.117:5-62) and mouse in Gal α-l, 3Gal glycosylation (Borrebaeck et al., 1993, Immun.Today, 14:477-479).In addition, galactosylation can change with cell culture condition, this can according to its specific semi-lactosi pattern give some immune globulin composite immunity (Patel et al., 1992.BiochemJ.285:839-845).The oligosaccharide structure of the glycoprotein of being produced by the non-human mammal cell may have nearer relation with the structure in the human glycoprotein.Therefore, most commercial immunoglobulin (Ig)s are all produced in mammalian cell.But, mammalian cell has several critical defects as the protein production host cell.Except costliness, in mammalian cell, can produce allos sugar shape colony in the process of expressing protein, have lower capacity titre (volumetric titers) and need continuous load virus and considerable time to produce stable clone.

But should understand the characteristic of different sugared shape remarkably influenced treatments, comprise pharmacokinetics, pharmacodynamics, acceptor interaction and tissue specificity location (Graddis et al., 2002, CurrPharm Biotechnol.3:285-297).Particularly, antagonist, the structure of oligosaccharides can influence with the serum half-life of protease resistant, the receptor-mediated antibody of FcRn, with the combining of the complement mixture C1 of the cytotoxicity (CDC) of inducing complement to rely on, and with relevant characteristic (Nose and Wigzell, 1983 of retroactive effect of combination, phagolysis and the antibody of the Fc γ R acceptor of cell-mediated cytotoxicity (ADCC) approach of being responsible for the dependence of regulation and control antibody; Leatherbarrow and Dwek, 1983; Leatherbarrow et al., 1985; Walker etal., 1989; Carter et al., 1992, Proc.Natl.Acad.Sci.USA, 89:4285-4289).

Because different sugared shape is relevant with different biological natures, so can assess relation between specific sugared shape and the specific biological function by the ability of the one or more specific sugared shapes of enrichment.If required biological function is relevant with certain specific sugared shape pattern, the glycoprotein compositions of favourable sugared shape structure that then can produce enrichment.Therefore, be starved of the ability of glycoprotein compositions of specific sugared shape that to have produced enrichment.

Summary of the invention

The invention provides a kind of composition that contains a plurality of immunoglobulin (Ig)s, each immunoglobulin (Ig) contains a connected N-glycan at least, and therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage is mainly by GalGlcNAcMan5GlcNAc ₂Form.In optimized technical scheme, the described multiple N-glycan that surpasses percent 50 molecular fractions is mainly by GalGlcNAcMan5GlcNAc ₂Form.More preferably, surpass the described multiple N-glycan of percent 75 molecular fractions mainly by GalGlcNAcMan5GlcNAc ₂Form.Most preferably, surpass the described multiple N-glycan of percent 90 molecular fractions mainly by GalGlcNAcMan5GlcNAc ₂Form.In other optimized technical scheme, described GalGlcNAcMan ₅GlcNAc ₂The level of N-glycan structures exceeds about percent 5 to about 50 molecular fractions than the N-glycan structures that accounts for second advantage in the described multiple N-glycan at least.

The present invention also provides by specific sugared shape (for example, the GalGlcNAcMan of enrichment on immunoglobulin (Ig) ₅GlcNAc ₂) the bonded method that increases the combination of Fc γ RIIIa and Fc γ RIIIb acceptor and reduce Fc γ RIIb acceptor.An optimized technical scheme provides a kind of production to contain the method for compositions of a plurality of immunoglobulin (Ig)s, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, the N-glycan that wherein takes advantage mainly is made up of GalGlcNAcMan5GlcNAc2, and described method comprises cultivating transformation or screening host cell makes it express described immunoglobulin (Ig) or its fragment.Another optimized technical scheme provides produces the method for compositions that contains a plurality of immunoglobulin (Ig)s, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, the N-glycan that wherein takes advantage mainly is made up of GalGlcNAcMan5GlcNAc2, and described method comprises cultivate to be transformed or screening is low etc. that eukaryotic host cell makes it express described immunoglobulin (Ig) or its fragment.In other technical scheme of the present invention, host cell contains coding immunoglobulin (Ig) or its segmental foreign gene, transforming or screening described eukaryotic host cell makes it express described immunoglobulin (Ig) or its fragment, thereby produce the composition that contains the panimmunity sphaeroprotein, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage mainly is made up of GalGlcNAcMan5GlcNAc2.In other other technical scheme of the present invention, the low eukaryotic host cell that waits contains coding immunoglobulin (Ig) or its segmental foreign gene, transforming or screening described eukaryotic host cell makes it express described immunoglobulin (Ig) or its fragment, thereby produce the composition that contains the panimmunity sphaeroprotein, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage mainly is made up of GalGlcNAcMan5GlcNAc2.

In optimized technical scheme of the present invention, contain that each immunoglobulin (Ig) contains a connected N-glycan at least in the panimmunity globulin composite, therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage is mainly by GalGlcNAcMan5GlcNAc ₂Form, wherein said immunoglobulin (Ig) has reduction and binding affinity Fc γ RIIb acceptor.In other optimized technical scheme of the present invention, contain that each immunoglobulin (Ig) contains a connected N-glycan at least in the panimmunity globulin composite, therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage is mainly by GalGlcNAcMan5GlcNAc ₂Form, wherein said immunoglobulin (Ig) has increase and binding affinity Fc γ RIIIa and Fc γ RIIIb acceptor.In another optimized technical scheme of the present invention, contain the panimmunity globulin composite, each immunoglobulin (Ig) contains a connected N-glycan at least, and therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage is mainly by GalGlcNAcMan5GlcNAc ₂Form, wherein said immunoglobulin (Ig) has the cytotoxicity (ADCC) of the antibody dependence of increase.

In a technical scheme, composition of the present invention contains the immunoglobulin (Ig) that is substantially free of trehalose.In another technical scheme, composition of the present invention contains the immunoglobulin (Ig) that lacks trehalose.Composition of the present invention also contains pharmaceutical composition and pharmaceutically acceptable carrier.Composition of the present invention also contains purifying and is included in the pharmaceutical composition of the immunoglobulin (Ig) in the test kit.

Therefore, the invention provides the material and the method that are used for producing glycoprotein compositions, particularly, provide to have mainly by GalGlcNAcMan5GlcNAc with the glycosylation structure that takes advantage ₂N-glycan immunoglobulin (Ig) or the antibody molecule formed.

Brief description of the drawings

Fig. 1. have GalGlcNAcMan5GlcNAc ₂The synoptic diagram of the IgG of glycan structures.

Fig. 2. in YAS385-1, express the painted SDS-PAGE glue of Coomassie brilliant blue that (as described in embodiment 2) also passes through the JC-IgG of albumin A post (swimming lane 1) and phenyl sepharose gel column (swimming lane 2) purifying from substratum (as described in embodiment 3).(2.5 μ g albumen/swimming lane)

Fig. 3. in YAS385-1, express the painted SDS-PAGE glue of Coomassie brilliant blue that (as described in embodiment 2) also passes through the DX-IgG of albumin A post (swimming lane 1) and phenyl sepharose gel column (swimming lane 2) purifying from substratum (as described in embodiment 3).(2.5 μ g albumen/swimming lane)

That Fig. 4 A. expresses in YAS385-1, mainly have a GalGlcNAcMan with what galactosyltransferase was handled ₅GlcNAc ₂The MALDI-TOF collection of illustrative plates of the JC-IgG of N-glycan.B. in YAS385-1, express, mainly have a GalGlcNAcMan with what galactosyltransferase was handled ₅GlcNAc ₂The MALDI-TOF collection of illustrative plates of the DX-IgG of N-glycan.

Fig. 5 A.Fc γ RIIIb combines test with the ELISA of JC-IgG and Rtuximab .B.FcyRIIIB combines test with the ELISA of DX-IgG and Rtuximab .(GGM5=GalGlcNAcMan ₅GlcNAc ₂The N-glycan)

Fig. 6 .Fc γ RIIIa-158F combines test with the ELISA of JC-IgG and Rtuximab .(GGM5=GalGlcNAcMan ₅GlcNAc ₂The N-glycan)

Fig. 7 A.Fc γ RIIb combines test with the ELISA of JC-IgG and Rtuximab .Fig. 7 B.FcgRIIb combines test with the ELISA of DX-IgG and Rtuximab .(GGM5=GalGlcNAcMan ₅GlcNAc ₂The N-glycan)

The concise and to the point description of sequence

The variable nucleotide sequence with human constant region of mouse in the SEQ ID NO:1 encoding D X-IgGl light chain.

The variable nucleotide sequence with human constant region of mouse in the SEQ ID NO:2 encoding D X-IgGl heavy chain.

The nucleotide sequence of human constant region in the SEQ ID NO:3 coding IgGl light chain.

The nucleotide sequence of human constant region in the SEQ ID NO:4 coding IgGl heavy chain.

SEQ ID NO:5 to 19 15 the eclipsed oligonucleotide that are used for synthesizing mouse DX-IgGl variable region of light chain of encoding by polymerase chain reaction (PCR).

SEQ ID NO:20 to 23 4 Oligonucleolide primers that are used to connect mouse DX-IgGl variable region of light chain and people's constant region of light chain of encoding.

SEQ ID NO:24 to 40 17 the eclipsed oligonucleotide that are used for synthesizing mouse DX-IgGl variable region of heavy chain of encoding by PCR.

SEQ ED NO:41 to 44 4 Oligonucleolide primers that are used to connect mouse DX-IgGl variable region of heavy chain and people's CH of encoding.

SEQ ID NO:45 coding nucleotide sequence---its codified has Kar2 (Bip) signal sequence in the terminal EcoRI of N-site.

SEQ ID NO:46 to 49 4 Oligonucleolide primers that are used to connect Kar2 signal sequence and DX-IgGl light chain and heavy chain of encoding.

SEQ ID NO:50 coding and the corresponding nucleotide sequence in the middle IgGl variable region of mouse JC-IgGl light chain (GenBank#AF013576).

SEQ ID NO:51 coding and the corresponding nucleotide sequence in the middle IgGl variable region of mouse JC-IgGl heavy chain (GenBank#AF013577).

12 eclipsed oligonucleotide sequences that are used for the synthetic mouse JC-IgGl variable region of light chain of PCR of SEQ ID NO:52 to 63 coding.

12 of SEQ ID NO:64 to 75 codings are used for the synthetic segmental eclipsed oligonucleotide sequence of mouse JC-IgGl heavy chain Fab of PCR.

12 of SEQ ID NO:76 to 87 codings are used for synthesizing the segmental eclipsed oligonucleotide sequence of mouse JC-IgGl heavy chain Fc by PCR.

SEQ ID NO:88 coding and Fc fragment 3 ' terminal corresponding 3 ' Kpnl primer.

The nucleotide sequence of SEQ ID NO:89 coding human serum albumin (HSA).

SEQ ID NO:90 coding is used for the nucleotide sequence of zymoplasm hydrolysis of the present invention.

The detailed description of invention

Unless definition is arranged in this article in addition, science related to the present invention and technical term and Phrase be those of ordinary skills the general implication of understanding. In addition, only about Literary composition has needs in addition, also comprises odd number otherwise singular references will comprise plural number, plural term. Usually, As herein described for biochemistry, zymetology, molecule and cell biology, microbiology, The name that science of heredity and protein are relevant with technology such as nucleic acid chemistry and hybridization is this area Know and commonly use. Method among the present invention and technology, except as otherwise noted, common basis Conventional method known in the art is carried out, and is a plurality of comprehensive and more concrete what quote Document in describe to some extent, and in the present technique explanation, discuss. Referring to, for example, Sambrook et al.Molecular Cloning:A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002); Harlow and Lane, Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1 990); Taylor and Drickamer, Introduction to Glycobiology, Oxford Univ.Press (2003); Worthington Enzyme Manual, Worthington Biochemical Corp., Freehold, NJ; Handbook of Biochemistry:SectionA Proteins, Vol I, CRC Press (1976); Handbook of Biochemistry:Section A Proteins, Vol II, CRC Press (1976); Essentials of Glycobiology, Cold Spring Harbor Laboratory Press (1999); Immunobiology, Janeway et al, 6^th Edition，2004，Garland Publishing，New York)。

All publications, patent and other document that this paper is mentioned, all as a reference intactly Be incorporated into herein.

Following term. Except as otherwise noted, be interpreted as having following implication:

In this paper usage, term " N-glycan ", " glycan " and " sugared shape " replaceable making With, refer to the oligosaccharides that N-connects, for example, by the 2-Acetamido-2-deoxy-D-glucose residue with or The oligosaccharides that once was connected with the ammonia nitrogen of asparagine residue in the protein. Institute in glycoprotein The sugar that takes advantage of finding is glucose, galactolipin, mannose, trehalose, N-acetyl ammonia Base galactolipin (GalNAc), 2-Acetamido-2-deoxy-D-glucose (GlcNAc) and sialic acid (example As, 5-Acetamido-3,5-dideoxy-D-glycero-D-galactonulosonic acid (NANA)). The processing of glycosyl in the ER inner chamber with translation Carry out simultaneously, and in golgiosome, be processed into the glycoprotein that N-connects.

The N-glycan has 5 total sugared core---Man₃GlcNAc ₂(" Man " refers to Mannose; " Glc " refers to glucose; " NAc " refers to the N-acetyl group; GlcNAc Refer to 2-Acetamido-2-deoxy-D-glucose). The difference of N-glycan is contained periphery sugar The number of class (for example, GlcNAc, galactolipin, trehalose and sialic acid) branch (giving prominence to), These branches add Man to₃GlcNAc ₂On (" Man3 ") core texture---this structure is also Be called " 3 mannose core ", " 5 sugared core " or " MOS core ". The N-glycan Form classify (for example, high mannose, compound or heterozygosis) according to its branch. " high sweet Revealing sugar " the N-glycan of type contains 5 or more mannose residue. Typically " compound " The N-glycan of type has at least one and is attached in " 3 mannose core " on 1, the 3 mannose arm GlcNAc, and at least one is attached in " 3 mannose core " on 1, the 6 mannose arm GlcNAc. Compound N-glycan also can contain by sialic acid or derivative (for example, " NANA " Or " NeuAc ", wherein " Neu " refers to neuraminic acid, and " Ac " refers to acetyl group) The galactolipin of modifying (" Gal ") or N-acetylamino galactosamine (GalNAc) residue. Compound N-glycan also can have by " separating " GlcNAc and core trehalose (" Fuc ") Substitute in the chain that forms. Compound N-glycan can also have in " 3 mannose core " A plurality of outstanding, usually be referred to as " giving prominence to glycan " more. The N-glycan of " heterozygosis " is at 3 sweet dews 1,3 mannose arm end of sugar core has at least one GlcNAc, in 3 mannose cores 0 or more mannose are arranged on 1, the 6 mannose arm. Multiple N-glycan is also referred to as " sugar Shape ".

Abbreviation used herein is the common usage of this area, referring to, the abbreviation of for example above-mentioned sugar.Other common abbreviation comprises " PNGase " or " glycanase " or " glucuroide ", and they all refer to Peptide N-glycosidase F (EC 3.2.2.18).

" isolating " or " pure basically " nucleic acid or polynucleotide (such as RNA, DNA or mix polymer) are meant other cellular component that just contains natural polynucleotide under natural situation its natural reservoir (of bird flu viruses) cell---for example, natural relevant rrna, polysaccharase and genome sequence---in abundant isolated nucleic acid or polynucleotide.This term refers to that nucleic acid or polynucleotide (1) separate from its natural environment of living in, (2) with the environment of finding " isolating polynucleotide " in all or part polynucleotide no longer include contact, (3) can effectively be connected on not connected polynucleotide under the natural situation, (4) do not exist at occurring in nature.Term is isolating " or " purified basically " also be used to refer to the polynucleotide analogue of DNA isolate, chemosynthesis reorganization or the clone or by allos system synthetic polynucleotide analogue.

But, " isolating " must not require described nucleic acid or polynucleotide itself separating physically to take place with its natural surroundings.For example, if exogenous array is placed in endogenous nucleic acid sequence annex and the expression of endogenous nucleic acid sequence is changed, then the endogenous nucleic acid sequence in the body genome also can be regarded as " isolating " in this article.In this linguistic context, heterologous sequence be with endogenous nucleic acid sequence state of nature under non-conterminous sequence, and no matter heterologous sequence self be endogenous (from identical host cell or its descendant) or (from different host cells or its offspring) of external source.As an example, the promoter sequence of the natural promotor of gene can be replaced (for example, passing through homologous recombination) in the host cell gene group, and this expression of gene pattern can change like this.This gene is exactly " isolating " now, because it has separated with the natural sequence of joining of at least a portion and its.

Nucleic acid if it contains the non-existent modification of corresponding nucleic native state in any genome, also can be thought " isolating ".For example,---such as passing through human intervention---insertion, disappearance or point mutation of introducing just can be thought " isolating " if interior source coding sequence contains manually." isolating nucleic acid " is also included within the allos site and is incorporated into nucleic acid on the host cell chromosome, and the nucleic acid construct that participates in the episome form.In addition,, be substantially free of other cellular material, perhaps be substantially free of substratum, when producing, be substantially free of precursor or other chemical reagent by chemosynthesis when " isolating nucleic acid " when being to use recombinant technology to produce.

In this paper usage, " the degeneracy varient " of phrase reference nucleic acid sequence is meant according to the standard genetic codon and contains the nucleotide sequence that can be translated, the aminoacid sequence with reference nucleic acid sequence translation back-sample can be provided.Term " degenerate oligonucleotide " or " degenerated primer " be used for representing can with the oligonucleotide of target nucleic acid sequence hybridization, they needn't be in full accord on sequence, as long as directly in one or more specific fragments homology is arranged each other.

In the text, " the per-cent sequence identity " of term nucleotide sequence or " identity " are meant two sequences wherein identical residue when carrying out maximum corresponding comparison.The length of sequence identity comparison can be a section at least about 9 Nucleotide, usually at least about 20 Nucleotide, more commonly at least about 24 Nucleotide, typically be at least about 28 Nucleotide, more typically be at least about 32 Nucleotide, be preferably at least about 36 or polynucleotide more.There are many known algorithms of different to can be used to measure the identity of nucleotide sequence in this area.For example, can use FASTA, Gap or Bestfit---they are Wisconsin Package Version10.0, Genetics Computer Group (GCG), Madison, the program among the Wisconsin---come many nucleotide sequences.FASTA can provide the comparison and the per-cent sequence identity of best overlapping region between search sequence and the search sequence.Pearson, Methods Enzymol.183:63-98 (1990) (intactly being incorporated into herein as a reference).For example, per-cent sequence identity between the nucleotide sequence can (word length be 6 with its default parameter by FASTA, the matrix of the keeping the score use NOPAM factor) or by Gap determine by the default parameter that GCG Version 6.1 is provided with it, be incorporated into herein as a reference.In addition, the program that can use a computer BLAST (Altschul et al., J.Mol.Biol.215:403-410 (1990); Gishand States, Nature Genet.3:266-272 (1993); Madden et al., Meth.Enzymol.266:131-141 (1996); Altschul et al., Nucleic Acids Res.25:3389-3402 (1997); Zhang and Madden, Genome Res.7:649-656 (1997)), especially blastp or tblastn (Altschul et al., Nucleic Acids Res.25:3389-3402 (1997)) come comparative sequences.

Term " homology basically " or " similar basically ", when being used to refer to nucleic acid or its fragment, show when the optimum that carries out having suitable Nucleotide to insert with another nucleic acid (or its complementary strand) or delete is compared, the identity of nucleotide sequence is at least about 50%, it more preferably is 60% nucleotide base, be generally at least about 70%, more common is at least about 80%, preferably at least about 90%, more preferably be at least about 95%, 96%, 97%, 98% or 99% nucleotide base,---these are by any known sequences identity algorithm, example FASTA as discussed above, BLAST or Gap measure.

In addition, if nucleic acid or its fragment under tight hybridization conditions can with a chain or the hybridization of its complementary strand of another nucleic acid, another nucleic acid, then homology or similar basically." the tight hybridization conditions " of nucleic acid hybridization experiment reaches " tight elution requirement " and depends on a plurality of different physical parameters in this article.Nucleic acid hybridization is subjected to the such condition effect of nucleotide base number such as mispairing between the length in the based composition of salt concn, temperature, solvent, hybridization kind, complementary district, the hybrid nucleic acid, and those skilled in the art can recognize these easily.Those of ordinary skill in the art understands how to adjust these parameters to obtain the specific tight degree of hybridization.

Usually, under a series of certain conditions, at melting temperature(Tm) (T than specific DNA heterozygote _m) carry out " tight hybridization " low about 25 ℃ the time.Under a series of certain conditions, at T than specific DNA heterozygote _mCarry out " tight wash-out " under low about 5 ℃ temperature.T _mThe temperature that is 50% target sequence when mating probe hybridization fully.Referring to Sambrook et al., Molecular Cloning:A Laboratory Manual, 2d ed., Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y. (1 989), the page number is 9.51, is incorporated into herein as a reference.In this paper usage, defined " stringent condition " hybridizes mutually at solution, as hybridization in the water of 6 * SSC (wherein 20 * SSC contains 3.0M NaCl and 0.3M Trisodium Citrate), 1%SDS (promptly, do not contain methane amide), in 65 ℃ of hybridization 8-12 hour, then in 0.2 * SSC, 0.1%SDS,, wash altogether twice in 65 ℃ of wash-outs 20 minutes.Those skilled in the art will appreciate that hybridization speed and difference, depend on the multiple factor that comprises hybridization sequences length and percentage identity at 65 ℃.

Term " sudden change " refers to that the Nucleotide in the nucleotide sequence is compared with reference nucleic acid sequence when being used for nucleotide sequence, can be inserted into, lack or change.On a locus, can produce single change (point mutation), or on the individual gene seat, insert, lack or change a plurality of Nucleotide.In addition, can produce one or more changes on the locus of the arbitrary number in nucleotide sequence.Can come the mutant nucleic acid sequence by any currently known methods in this area, include, but are not limited to (under the lower condition of the copy fidelity of archaeal dna polymerase, carry out the process of PCR reaction, in the length range of whole PCR product, can obtain a high proportion of point mutation like this such as " fallibility PCR "; Referring to, Leung et al. for example, Technique, 1:11-15 (1989) and Caldwelland Joyce, PCR Methods Applic.2:28-33 (1992)) and " sudden change of oligonucleotide fixed point " (can in required arbitrarily cloned DNA fragment, generate the process of locus specificity sudden change; Referring to, Reidhaar-Olson and Sauer for example, Science 241:53-57 (1988)) such sudden change generating technique.

Term used herein " carrier " is used to refer to the nucleic acid molecule that can transport another nucleic acid that is attached thereto.One type carrier is " plasmid ", and finger ring shape double-stranded DNA ring wherein can connect extra dna fragmentation.Other carrier comprises clay, bacterial artificial chromosome (BAC) and yeast artificial chromosome (YAC).The carrier of another kind of type is a virus vector, and wherein extra dna fragmentation can be connected in the viral genome and (hereinafter will more go through).Some carrier can self-replicating (for example, having the carrier that can bring into play the replication orgin of function in host cell) in the host cell that it changed over to.Other carrier can be incorporated into after changing host cell in the host cell gene group, therefore duplicates with host genome.In addition, some preferred carrier can instruct and its expression of gene that effectively is connected.This class carrier is referred to herein as " recombinant expression vector " (perhaps simpler, " expression vector ").

In this paper usage, and term " target sequence " perhaps " target gene " be meant and usually in host cell, do not produce---typically, proteins encoded---nucleotide sequence.Method described herein allows one or more target sequence or target gene stable integration in the host cell gene group.The non-limitative example of target sequence comprises coding, and one or more have the polypeptide of enzymic activity---for example, such as mannose transferase, N-acetylglucosaminyl transferase, UDP-N-acetylglucosamine transhipment, galactosyltransferase, UDP-N-ethanoyl galactotransferase, sialytransferase and trehalose transferring enzyme such in the host, influence N-glycan synthetic enzyme---sequence.

Term " flag sequence " or " marker gene " thereby be meant can show activity in host cell can be to existing or deletion sequence be carried out the nucleotide sequence that positive or negative is selected.For example, P.pastoris URA5 gene is a marker gene, because can select its existence according to the ability that the cell that contains this gene can be grown in lacking the environment of uridylic.Also can oppositely select its existence according to the characteristics that the cell that contains this gene can not be grown in having the environment of 5-FOA.Flag sequence or gene are not to have the positive and negative selectivity simultaneously.Comprise ADEl, ARG4, HIS4 and URA3 from the flag sequence of P.pastoris or the non-limitative example of gene.For the antibiotics resistance marker gene, kantlex, Xin Meisu, Geneticin (or G418), paromycin and hygromycin gene are generally used for allowing to grow under these antibiotic situations of existence.

" effectively connect " expression regulation sequence and be meant a kind of connection, wherein expression regulation sequence and target gene are adjacent with the controlled target gene, and cross over or controlled target expression of gene regulating and controlling sequence on certain distance.

Term in this paper usage " expression regulation sequence " is meant that effectively being connected, influencing it with encoding sequence expresses necessary polynucleotide sequence.Expression regulation sequence is the sequence that back incident and translation were transcribed, transcribed to the control nucleotide sequence.Expression regulation sequence comprises suitable transcription initiation, termination, promotor and enhancer sequence; Such as montage and the such RNA processing signal of polyadenylation signal; The sequence of stabilized cell matter mRNA; Strengthen the sequence (for example, ribosome bind site) of translation efficiency; Strengthen the sequence of protein stability; And if necessary, strengthen the signal of protein excretion.The character of these regulating and controlling sequences is different according to host's body; In prokaryotic organism, this class regulating and controlling sequence generally comprises promotor, ribosome bind site and transcription termination sequence.

Term " regulating and controlling sequence " is meant and comprises the necessary whole components of expression on minimum degree, can comprise that also its existence is favourable extra component, for example, and homing sequence and fusion partial sequence.

Term used herein " recombinant host cell " (" expression host cell ", " expressive host system ", " expression system ", or abbreviation " host cell ") is meant the cell of wherein having introduced recombinant vectors.Should understand these terms and not only be meant specific recipient cell, and comprise the offspring of this cell.Because sudden change or environmental influence in the generation afterwards some modification can take place, therefore, in fact, these offsprings can be inconsistent with parental cell, but still be included in the category of all terms of this paper " host cell ".Recombinant host cell can be isolated cells or the clone that is grown in the substratum, also can be to be positioned at biological tissue or the intravital cell of machine.

Term " eucaryon " is meant nucleolate cell or body, comprises insect cell, vegetable cell, mammalian cell, zooblast and eukaryotic cell such as low.Term " the low eukaryotic cell that waits " comprises yeast, fungi, the capsule flagellate, microsporidium, alveolates (for example, dinoflagellates), send out whip algae door (for example, brown alga, protozoon), rhodophyta (for example, red algae), plant (for example, green alga, vegetable cell, liver moss) and other protobiont, yeast and fungi comprise, but be not limited to: pichia (Pichia sp.), such as Pichia pastoris (Pichia pastoris), Pichia fnlandica, happiness trehalose pichia (Pichia trehalophila), Pichia koclamae, palama pichia (Pichiamembranaefaciens), Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichia thermotolerans, willow pichia (Pichiasalictaria), Pichia guercuum, Pi Jiepushi pichia (Pichia pijperi), tool handle (Pichia stiptis) and Pichia methanolica; Yeast saccharomyces cerevisiae (Saccharomycessp.), such as cereuisiae fermentum (Saccharomyces cerevisiae); Multiform Hansenula anomala (Hansenula polymorpha), Crewe Vickers yeast (Kluyveromyces sp.), for example newborn Crewe Vickers yeast (Kluyveromyces lactis); White candiyeast (Candidaalbicans), Aspergillus nidulans (Aspergillus nidulans), aspergillus niger (Aspergillus niger), aspergillus oryzae (Aspergillus oryzae), wooden mould Trichoderma reesei, golden pityrosporion ovale (Chrysosporium lucknowense), sickle spore bacterium (Fusarium sp.), such as Fusarium graminearum (Fusarium gramineum), Fusarium venenatum; Physcomitrellapatens and coarse chain satisfy mould (Neurospora crassa).

Term used herein " peptide " is meant short polypeptide, for example, and typically less than 50 amino acid longs and more typically less than the polypeptide of 30 amino acid longs.Term used herein comprises resemblance and the analogue with analog structure and biological function.

Term " polypeptide " comprises albumen and fragment, varient, derivative and analogue naturally occurring and that non-natural exists.Polypeptide can be monomeric or polymeric.In addition, polypeptide can comprise the structural domain that some is different, and each has the activity of one or more uniquenesses.

Term " isolating albumen " or " isolated polypeptide " are finger protein or polypeptide, according to origin or source, (1) not with its native state under the related component followed have the related of native state, (2) exist with the unexistent purity form of nature, its moderate purity can be assert (for example according to the existence of other cellular material, there is not congener other albumen), (3) by different types of cell expressing, perhaps (4) do not exist (for example at nature, what find at nature is a fragment of polypeptide, perhaps it comprises unexistent amino acid homology thing of nature or derivative, or unexistent connector on other standard peptide skeleton).Therefore, chemosynthesis or in the cell system different with the cell of its natural origin the synthetic polypeptide, be exactly from its natural related component " isolating ".Also can use this area known protein purification technology make polypeptide or albumen be substantially free of related component under the native state by separating.Therefore according to definition, " isolating " and do not require described albumen, polypeptide, peptide or oligopeptides will with its natural surroundings physical sepn.

Term used herein " polypeptide fragment " is meant the polypeptide of deletion to some extent, for example, compares with full-length polypeptide, has deleted N-terminal and/or C-terminal.In an optimized technical scheme, polypeptide fragment is a successive sequence, and wherein segmental aminoacid sequence is consistent with the corresponding position in the naturally occurring sequence.Typically, fragment has 5,6,7,8,9 or 10 amino acid longs at least, preferably, be at least 12,14,16 or 18 amino acid longs, more preferably, be at least 20 amino acid longs, more preferably be at least 25,30,35,40 or 45 amino acid, more preferably being at least 50 or 60 amino acid longs, more preferably is at least 70 amino acid longs.

" modified derivative " is meant actual homologous polypeptide or its fragment on primary structure, comprise, for example, in the body or external chemistry and bio-modification or integrated the amino acid that does not have in the natural polypeptides.This class is modified and is comprised, for example, and acetylize, carboxylation, phosphorylation, glycosylation, ubiquitinization, mark---such as radioactive nuleus, and the plurality of enzymes modification, those skilled in the art is easy to just will appreciate that these.Labeling polypeptide and alternate several different methods or the marker that is used for this purpose are known in this area, comprise such as ¹²⁵I, ³²P, ³⁵S and ³The such radio isotope of H, can with anti-part (such as antibody) bonded part, fluorophore, chemical reflective reagent, the enzyme of mark and the anti-part that can be used as the specific combination coupling member of tagged ligand.The selection of marker depend on required susceptibility, with the easy degree of primer bonded, desired stability and available instrument.The method of labeling polypeptide is known in this area.Referring to, Ausubel et al. for example, Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and 2002 replenish) (being incorporated into herein as a reference)

Term " fusion rotein " is meant and contains polypeptide or the segmental polypeptide that is connected with the allogeneic amino acid sequence.Fusion rotein is very useful, and contains from 2 or a plurality of difference proteic 2 or a plurality of required function element because they are built into.Fusion rotein comprises at least 10 successive amino acid from required polypeptide, more preferably is at least 20 or 30 amino acid, more preferably is at least 40,50 or 60 amino acid, more preferably is at least 75,100 or 125 amino acid.Contain that whole proteic fusion is useful especially among the present invention.The heterologous polypeptide length that comprises in the fusion rotein of the present invention is at least 6 amino acid, and normal length is at least 8 amino acid, and useful length is at least 15,20 and 25 amino acid.Merge and to comprise, perhaps even such as green fluorescent protein (" GFP ") contain chromophoric albumen or have the so whole albumen of total length immunoglobulin (Ig) of specific end use such as immunoglobulin Fc fragment or IgF ab fragment bigger polypeptide like this.Can be by making up nucleotide sequence---the mode that the nucleotide sequence of its coded polypeptide or its fragment and encode different albumen or peptide is expressed this fusion rotein in same reading frame, is then come the recombinant production fusion rotein.Perhaps, can come the chemical production fusion rotein by the mode that polypeptide or its fragment and another albumen is mutually crosslinked.

In this paper usage, term " antibody ", " immunoglobulin (Ig) ", " IgG " reach " Ig molecule " replaceable use.Every kind of antibody has can make its unique texture that combines with specific antigen, but all antibody/immunoglobulin (Ig)s all have identical general structure as described herein.Known basic antibody structure unit is made up of the tetramer of subunit.Each tetramer has two pairs of the same polypeptide chains, and every pair contains " gently " chain (about 25kDa) and " weight " chain (about 50-70kDa).The N-terminal of every chain partly comprises about 100 to 110 or the variable region of amino acids more, mainly is responsible for antigen recognition.The C-terminal of every chain partly is a constant region of mainly being responsible for effector function.Light chain can be divided into κ or λ two classes.Heavy chain can be divided into γ, μ, α, δ or ε, and determines that respectively the type of antibody is IgG, IgM, IgA, IgD and IgE.Light chain and heavy chain can be further divided into variable region and constant region (referring to, FundamentalImmunology (Paul, W., ed., 2nd ed.Raven Press, N.Y., 1989), chapter 7 (as with reference to its all purposes intactly are incorporated into herein).Every light/the right variable region of heavy chain has formed antibody combining site.Therefore, a complete antibody has two binding sites.Except difunctional or bi-specific antibody, these two binding sites are identical.All chains all have the identical conventional structures by 3 framework regions of guarding relatively (FR) that the hypervariable region connected, and are also referred to as complement determining area or CDRs.CDRs from every pair of two chains aligns by framework region, can combine with special antigenic determinant.Term comprises naturally occurring form, and fragment and derivative.Being included in has an Igs class in the category of term, that is, and and IgG, IgA, IgE, IgM and IgD.Be included in the IgGs subclass in addition in the term category, that is, and IgGl, IgG2, IgG3 and IgG4.Term all uses with broad sense, comprise single monoclonal antibody (comprising exciting type antibody and antagonism type antibody) and with a plurality of antigenic determinants or antigen bonded antibody component.Term has clearly covered monoclonal antibody (comprising full length monoclonal antibodies), polyclonal antibody, multi-specificity antibody (for example, bi-specific antibody) and antibody fragment, as long as they contain at least or modified after---N-that it contains the CH2 structural domain connects glycosylation site---CH2 structural domain part, perhaps its varient that contain the heavy chain immunoglobulin constant region.Being included within the term is the molecule that contains the Fc district, such as immune adherence element (U.S. Patent application No.2004/0136986), Fc fusion molecule and antibody class are like molecule.Perhaps, these terms can refer to the antibody fragment in Fab district at least, and it contains N-at least and connects glycosylation site.

" crystallizable fragment " that term " Fc " fragment is meant the antibody C-stub area that contains CH2 and CH3 structural domain (Fig. 1).Term " Fab " fragment be meant " " contain VH, CH1, VL and CL structural domain antibody " Fab " zone (Fig. 1).

In this paper usage, term " monoclonal antibody " (mAb) is meant the antibody that obtains the homologous antibody basically from a group, that is, the monospecific antibody that constitutes by colony, except the possible natural spontaneous mutation that exists with low quantity, they all are consistent.Monoclonal antibody is a high special, at single antigen site.In addition,---typically, comprise different antibodies---with conventional (polyclone) Antibody Preparation and compare that every kind of mAb is at single determiner on the antigen at different determiners (antigenic determinant).Except its specificity, the advantage of monoclonal antibody is that they can be next synthetic by the hybridoma cultivation, is not subjected to the pollution of other immunoglobulin (Ig).The feature of term " monoclonal " expression antibody needs any special method from obtaining the homologous antibody colony basically, should not be construed as in antibody producing.For example, can pass through Kohler et al. according to monoclonal antibody used in the present invention, (1975) Nature, 256:495, or may be made by recombinant DNA methods (see, e.g., U.S.Pat.No.4,816,567 to Cabilly et al.) hybridoma method of explaination prepares first.

Monoclonal antibody herein comprises by antibody heterozygosis and reorganization, by (for example with variable (comprise high variable) structural domain of certain antibody and constant domain, " humanization " antibody) or with light chain and heavy chain or will from chain of certain species with produce from chain of another species or with the mode that fusant and heterologous protein carry out montage, and needn't consider the monoid of source of species or selected immunoglobulin (Ig) or subclass (referring to, for example, the U.S. Patent No. 4 of Cabilly et al, 816,567; Mage and Lamoyi, inMonoclonal Antibody Production Techniques and Applications, pp.79-97 (Marcel Dekker, Inc., New York, 1987)).Monoclonal antibody herein specifically comprises " chimeric " antibody (immunoglobulin (Ig)), consistent or the homology of corresponding sequence in the part of heavy chain and/or light chain and first species that antibody is originated wherein, perhaps belong to specific antibody monoid or subclass, and the consistent or homology of corresponding sequence in the remainder of chain and other species that antibody is originated, perhaps belong to different antibody monoid or subclass, the fragment of these antibody is also like this, if they contain or modify after contain at least one CH2." humanization " form of inhuman source (for example, mouse) antibody is distinctive embedment type immunoglobulin (Ig), immunoglobulin chain or its fragment (such as Fv, Fab, Fab ', F (ab ') ₂Perhaps other the subsequence of conjugated antigen of antibody), they contain the sequence that is derived from human normal immunoglobulin.The Fv fragment of antibody is that antibody is kept whole molecule in conjunction with feature and specific least unit.The allos dipolymer right and wrong of Fv fragment and heavy chain of antibody and variable region of light chain are covalently bound.F (ab ') ₂Fragment is the fragment that contains segmental two arms of the Fab that is connected by the disulfide linkage bridge.

The modal type of humanized antibody is human normal immunoglobulin (receptor antibody), and the residue that wherein comes autoreceptor complement determining area (CDR) is by from having replaced such as the residue that has the CDR of required specificity, affinity and load in the such inhuman species (donor antibody) of mouse, rat or rabbit.In some example, the Fv framework residue of human normal immunoglobulin is substituted by corresponding inhuman source residue.In addition, humanized antibody can contain unexistent residue in the CDR of receptor antibody and introducing or framework sequence.Producing these modifications is in order further to improve and optimization antibody performance.Usually, humanized antibody contains at least one basically, typically is 2 whole variable domains, whole CDR district and inhuman source immunoglobulin (Ig) regional corresponding all or basically wherein, all or whole basically CDR district be the concensus sequence of human normal immunoglobulin.The humanized antibody of optimizing also comprises the part of constant region for immunoglobulin (Fc), the part of human normal immunoglobulin typically at least.Further details is referring to Jones et al., 1986, Nature 321:522-524; Reichmann et al., 1988, Nature332:323-327, and Presta, 1992, Curr.Op.Struct.Biol.2:593-596..

" fragment " in term antibody or immunoglobulin (Ig) category comprises by the fragment that produces with the multiple protein enzymic digestion, by chemical shearing and/or the chemistry fragment that the fragment that produces and reorganization produce of dissociating---if fragment still can with the target molecule specific combination.Fc, Fab, Fab ', Fv, F (ab ') are arranged in this class fragment ₂, and strand Fv (scFv) fragment.

Among the present invention antibody at target comprise growth factor receptors (for example, FGFR, PDGFR, EGFR, NGFR and VEGF) and part thereof.Other target has the G protein receptor, comprises substrate K acceptor, Angiotensin Receptors, α-and receptor,, serotonin receptor and paf receptor.Referring to, Gilman for example, Ann.Rev.Biochem.56:625-649 (1987).Other target comprises ionic channel (for example, calcium, sodium, potassium channel), M-ChR, acetylcholine receptor, GABA acceptor, glutamate receptor and Dopamine Receptors (referring to Harpold, U.S.5,401,629 and U.S.5,436,128).That other target has is plain such as integrating, select the such adhesion protein of element and immunoglobulin superfamily member (referring to Springer, Nature 346:425-433 (1990) .Osborn, Cell 62:3 (1990); Hynes, Cell 69:11 (1992)).Other target has such as interleukin I L-1 to IL-13, Zhong Liuhuaisiyinziα ﹠amp; β, interferon alpha, β and γ, tumor growth factor Beta (TGF-β), G CFS (CSF) and the such cytokine of granulocyte monocyte G CFS (GMCSF).Referring to Human Cytokines:Handbook for Basic ﹠amp; Clinical Research (Aggrawal et al.eds., BlackwellScientific, Boston, MA 1991).Other target have hormone, enzyme and such as in the such cell of adenyl cyclase, guanylate cyclase and Phospholipase C with the intercellular signal molecule.Other target has such as CD20 and the such human leucocyte antigen of CD33.Medicine also can be required target.Target molecule can be the mankind, Mammals or bacterium.The such antigen of albumen, glycoprotein and carbohydrate that other target has such as from the microorganism cause of disease---virus, bacterium and tumour---.At U.S.4, other target has been described in 366,241.

The immune Fc acceptor that this paper discusses can comprise: Fc γ RI, FcyRIIa, Fc γ RIIb, Fc γ RIIIa, Fc γ RIIIb and FcRn (newborn infant's acceptor).Unless explanation is arranged in addition, otherwise term Fc γ RI can refer to any Fc γ RI hypotype.Unless explanation is arranged in addition, otherwise term Fc γ RII can refer to any Fc γ RII hypotype.Unless explanation is arranged in addition, otherwise term Fc γ RIII can refer to any Fc γ RIII hypotype.

" derivative " in the term category be included in the sequence modified but still can with the antibody (or its fragment) of target molecule specific combination, comprise: chimeric and humanized antibody, antibody fusions, different poly-property antibody complex and antibody fusions between kind, antibody in for example bivalent antibody (bi-specific antibody), strand bivalent antibody reach (referring to, such as IntracellularAntibodies:Research and Disease Applications, (Marasco, ed., Springer-Verlag New York, Inc., 1998).

Term " non-peptide analogs " is meant the compound that has similar quality with reference polypeptide.Non-peptide mixt also can be described as " simulating peptide " or " plan peptide ".Referring to, Jones for example, AminoAcid and Peptide Synthesis, Oxford University Press (1992); Jung, Combinatorial Peptide and Nonpeptide Libraries:A Handbook, JohnWiley (1997); Bodanszky et al., Peptide Chemistry--A Practical Textbook, Springer Verlag (1993); Synthetic Peptides:A Users Guide, (Grant, ed., W.H.Freeman and Co., 1992); Evans et al., J.Med.Chem.30:1229 (1987); Fauchere, J.Adv.Drug Res.15:29 (1986); Veber and Freidinger, Trends Neurosci., 8:392-396 (1985); Above-mentioned each reference of quoting all is incorporated into herein as a reference.This compounds is developed by means of the molecular model of Computer Processing usually.The simulating peptide structurally similar to peptide useful among the present invention can be used to produce effector of equal value, therefore can be considered a part of the present invention.

Amino acid replacement can comprise that " (1) reduces the susceptibility to protease hydrolysis; (2) reduce the susceptibility to oxidation; (3) change the binding affinity to formed albumen composition; (4) change binding affinity or enzymic activity, and (5) give or modify other physical chemistry or the functional performance of this class analogue for these.

In this paper usage, the 20 kinds of conventional amino acid and the conventional usage of use of abridging thereof.Referring to Immunology-A Synthesis (Golub and Gren eds., Sinauer Associates, Sunderland, Mass., 2 ^NdEd.1991), be incorporated into herein as a reference.20 kinds of amino acid whose steric isomers of routine (for example, D-amino acid), such as α-, the suitable ingredients that such alpha-non-natural amino acid, N-hydroxy-amino-acid and other the unconventional amino acid of α-two alternative amino acid can be polypeptide of the present invention.Unconventional amino acid whose example comprises: 4-Hydroxyproline, Gla, ε-N, N, N-trimethyl lysine, ε-N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-Methyl histidine, 5-hydroxylysine, N-methylarginine and other similar amino acid and imino-acid (for example, 4-Hydroxyproline).In polypeptide symbol used herein, corresponding to N-terminal, right end is corresponding to C-terminal, with normal usage and conventional consistent at the side end.

If second proteic nucleotide sequence of a proteic nucleotide sequence and coding has similar sequences, then have " homology " or " homologous ".Perhaps, if two albumen have " similar " aminoacid sequence, then this albumen and second albumen have homology.(therefore, defined term " homologous protein " is meant that two albumen have similar aminoacid sequence.) in an optimized technical scheme, homologous protein is the albumen that has at least 65% sequence homology with wild-type protein, more preferably is at least 70% sequence homology.More preferably homologous protein and wild-type protein have at least 75%, 80%, 85% or 90% sequence homology.In the technical scheme that another is more preferably, homologous protein has at least 95%, 98%, 99% or 99.9% sequence identity.In this paper usage, the homology between two zones of aminoacid sequence (especially for the structural similarity of predicting) can be considered and have similarity on function.

When " homology " is used to refer to albumen or polypeptide, can think that different residue positions has different conserved amino acids to substitute usually." conserved amino acid substitutes " is meant that the amino-acid residue in the sequence is replaced by the amino-acid residue that another its side chain (R group) has similar chemical property (for example, electric charge or hydrophobicity).Usually, conserved amino acid substitutes and can not make proteic functional performance that the material change is taken place.Since conservative substituting make under the situation that two or more aminoacid sequences differ from one another, can be to adjusted per-cent sequence identity or homology degree, so that the conservative character of alternate is proofreaied and correct.The method of carrying out this adjusting is known for a person skilled in the art.Referring to, for example, Pearson, 1994, Methods MoI.Biol.24:307-31 and 25:365-89 (herein being incorporated into herein as a reference).

Below every group of 6 group contained be to be conservative alternate amino acid each other: 1) Serine (S), Threonine (T); 2) aspartic acid (D), L-glutamic acid (E); 3) l-asparagine (N), glutamine (Q); 4) arginine (R), Methionin (K); 5) Isoleucine (I), leucine (L), methionine(Met) (M), L-Ala (A), Xie Ansuan (V); And 6) phenylalanine (F), tyrosine (Y), tryptophane (W).

The sequence homology of polypeptide is also referred to as the per-cent sequence with-property, typically, can use sequence analysis software to measure.Referring to, such as the Sequence Analysis SoftwarePackage of the Genetics Computer Group (GCG), University ofWisconsin Biotechnology Center, 910 University Avenue, Madison, Wisconsin 53705.Analysis of protein software uses the homology measuring method---substitute, delete and other modification various, comprise that conservative amino acid replacement carries out assignment---mate similar sequences.For example, GCG contains such as " Gap " and reaches " Bestfit " such program, can use default parameter to determine the polypeptide of nearer relation---for example from different types of homeopeptide or wild-type protein in the biology and its mutain---between sequence homology or sequence identity.Referring to, for example, GCG Version 6.1.

When with specific peptide sequence when containing in a large number database from the sequence of different biologies and compare, a preferred algorithm is exactly computer program BLAST (Altschul et al., J.Mol. Biol.215:403-410 (1990); Gish and States, Nature Genet.3:266-272 (1993); Madden et al., Meth.Enzymol.266:131-141 (1996); Altschul et al., Nucleic Acids Res.25:3389-3402 (1997); Zhang and Madden, GenomeRes.7:649-656 (1997)); Especially blastp or tblastn (Altschul et al., NucleicAcids Res.25:3389-3402 (1997)).

The preferred parameter of BLASTp is: expected value: 10 (default); Filter: seg (default); The open cost in room: 11 (default); Cost is expanded in the room: 1 (default); High specific is right: 100 (default); Word length: 11 (default); Record and narrate number: 100 (default); Point penalty matrix: BLOWSUM62.

The length of carrying out the peptide sequence of homology comparison generally is at least about 16 amino-acid residues, is generally at least about 20 residues, more common is at least about 24 residues, typically is at least about 28 residues, is preferably more than about 35 residues.When search contains in a large number database from different biological sequences, preferably, answer the comparing amino acid sequence.Carrying out database search with aminoacid sequence can be undertaken by the algorithm of the blastp of being different from known in the art.For example,---program among the GCG Version 6.1---comes many peptide sequences can to use FATA.FASTA provides the sequence alignment and the per-cent sequence identity of best overlapping region between inquiry and the search sequence.Pearson, Methods Enzymol.183:63-98 (1990) (being incorporated into herein as a reference).For example, the per-cent sequence identity between the aminoacid sequence can---as provide among the GCG Version 6.1---be come definite by FASTA with its default parameter (word length is 2, uses the PAM250 matrix of keeping the score), be incorporated into herein as a reference.

" specific combination " be meant in environment two molecules with respect to other molecule bonded bonded ability each other.Typically, " specific combination " by at least 2 times, more typically at least 10 times, be generally at least 100 times of accidental combinations of distinguishing in the reaction.Typically, the affinity of specific binding reaction or avidity---come quantitatively by dissociation constant---to be about 10 ^-7M or stronger by (for example, about 10 ^-8M, 10 ^-9M or stronger).

Term used herein " zone " is meant the part of physically adjoining in the biomolecules primary structure.In albumen, the zone is determined by the part of adjoining in this Argine Monohydrochloride sequence.

Term term used herein " structural domain " is meant the structure of the biomolecules that has known or unknown function in the biomolecules.Structural domain can have identical category with zone or its part; Structural domain also can comprise in the biomolecules independently, the non-zone of closing on.

Term used herein " molecule " is meant any compound, including but not limited to, small molecules, peptide, albumen, glycoprotein, sugar, Nucleotide, nucleic acid, fat etc., this compounds can be natural or synthetic.

Term used herein " comprises " or such as " comprising (comprises) " or " comprising (comprising) " such morphological change, is interpreted as comprising certain whole or whole group, but do not get rid of any other whole or whole group.

Term used herein " basically by ... form " be interpreted as comprising certain whole or whole group, but got rid of modification or other integral body that in fact can influence or change given integral body.Kind about the N-glycan, the N-glycan that term is given " in fact is made up of given N-glycan " and is understood to include the N-glycan, and no matter whether the N-glycan---it directly with the asparagicacid residue of glycoprotein link to each other---on mycose-baseization has taken place at N-acetylglucosamine (GlcNAc).

Term used herein " ground takes advantage " or such as " main " or " being the most significant " such modification, be interpreted as being meant handling and discharging with PNGase and pass through mass spectrum at glycoprotein---for example, behind MALDI-TOF MS---the glycan analyzed, in whole N-glycan, has the glycan kind of the highest molar percentage (%).In other words, phrase " ground takes advantage " is defined as an independent entity---such as a specific sugared shape, it has higher molar percentage than other any independent entity.For example, if certain component contains the kind A of 40 molar percentages, the kind C of the kind B of 35 molar percentages and 25 molar percentages, then this component mainly contains kind A, and kind B is second kind that has superiority.

Term used herein " is substantially free of " specific glycosyl---such as trehalose or semi-lactosi etc., be to be used for showing that glycoprotein fraction is substantially devoid of the N-glycan of these residues.Explain according to purity, be substantially free of and be meant that the N-glycan structures that contains these glycosyls less than 10%, is preferably lower than 5%, more preferably be lower than 1%, most preferably be lower than 0.5%, wherein per-cent is weight or molar percentage.Therefore, used N-glycan structures does not contain trehalose, semi-lactosi or these two in the glycoprotein compositions of the present invention basically.

In this paper usage, but when also not having certain glycosyl of detection limit when no matter when on the N-glycan structures, glycoprotein compositions " lacks " or " not having " this specific glycosyl, such as trehalose or semi-lactosi.For example, in optimized technical scheme of the present invention, glycoprotein compositions is by aforesaid lower eukaryotes---comprise yeast [for example, Pichia sp.; Saccharomyces sp.; Kluyveromyces sp.; Aspergillus sp.]---produce, will " lack trehalose ", because these biological cells do not produce the necessary enzyme of N-glycan structures of mycose-baseization.Therefore, term " is substantially free of trehalose " and comprises that term " lacks trehalose ".But, even but composition contain the N-glycan structures of aforesaid mycose-baseization or contain the N-glycan structures of mycose-baseization limited, that do not have detection limit in certain time, also can be " being substantially free of trehalose ".

Phrase used herein " enhanced is in conjunction with activity " can be replaced with " enhanced binding affinity " and use, and is meant that the IgG molecule has increased with combining of acceptor or other known molecular.Phrase used herein " combination of reduction is active " can be replaced with " binding affinity of reduction " and use, and is meant that the IgG molecule has reduced with combining of acceptor or other known molecular.

Phrase used herein " phagolysis " is meant the removing of immunocomplex.Phagolysis is an immunocyte---including but not limited to scavenger cell and neutrophilic granulocyte---a kind of immunocompetence.

The interaction of cell and various replying in antibody and antibody-antigenic compound and the immunity system, comprise cytotoxicity (CDC) that cytotoxicity (ADCC) that antibody relies on and complement rely on, immunocomplex removing (phagolysis), produce antibody and IgG serum half-life by the B cell, all definition respectively in following document: Daeron et al., 1997, Annu.Rev.Immunol.15:203-234; Ward and Ghetie, 1995, TherapeuticImmunol.2:77-94; Cox and Greenberg, 2001, Semin.Immunol.13:339-345; Heyman, 2003, Immunol.Lett.88:157-161; And Ravetch, 1997, Curr.Opin.Immunol.9:121-125.

Except as otherwise noted, otherwise all technology used herein and scientific terminology are the common implication of understanding of ordinary person in the field related to the present invention.Can describe method and material as example below, also can be used in the present invention's practice with method similar or of equal value described herein and material, this is conspicuous for a person skilled in the art.All mentioned publications and all complete as a reference being incorporated into herein of other reference.---comprise be defined in---is as the criterion if any conflict, with this narration.Given material, method and example are just in order to explain but not limit.

Reorganization Ig-GalGlcNAcMan ₅GlcNAc ₂Molecule

The invention provides the composition that contains glycosylated Ig colony, described Ig mainly contains GalGlcNAcMan ₅GlcNAc ₂N-connects sugared shape.The present invention also provides mainly to contain possesses the such antibody mediated effect function GalGlcNAcMan of mediation such as receptors bind ₅GlcNAc ₂N-connects the Ig and the composition of sugared shape.Preferably, the Ig among the present invention makes directly with interaction between the Fc γ RIII acceptor and has combined increased activity.And preferably, the Ig among the present invention and interaction between the Fc γ RIIb acceptor make directly to have combined and have actively reduced (or not having).In another technical scheme, Ig of the present invention or composition are to having reduced in conjunction with activity of giving by the enrichment/advantage of certain sugared shape structure.A prominent feature of the present invention has provided and mainly contained special sugared shape---its mediate antibody effector function for example strengthens the ADCC activity or increases the antibody that the B cell produces---Ig and composition.In another technical scheme, Ig of the present invention or its composition have enhanced ADCC activity or have increased the antibody that the B cell produces by the enrichment/advantage of certain sugared shape.In addition, what it will be apparent to those skilled in the art that is: a favourable part of producing the Ig with the sugared shape that takes advantage is to have avoided like this producing the Ig with undesired sugared shape and/or producing the Igs heterogeneous mixture---this can cause beyond thought effect and/or dilute the concentration of more efficiently Ig sugar shape.Therefore, can expect to contain and mainly contain GalGlcNAcMan ₅GlcNAc ₂The pharmaceutical composition of Igs of sugar shape has better feature, including but not limited to, reduce and the combining of Fc γ RIIb, and the combining of enhancing and Fc γ RIIIa and Fc γ RIIIb, so also very effective than low dosage the time, have higher effect/potential.

In a technical scheme, Ig molecule of the present invention contains at least a GalGlcNAcMan at the Asn-297 of the heavy chain CH2 in the Fc zone of the numerator mediated antibody mediated effect function of Ig structural domain ₅GlcNAc ₂Glycan structures.Preferably, GalGlcNAcMan ₅GlcNAc ₂Glycan structures is on the Asn-297 in each CH2 district of dimer Ig (Fig. 1).In another technical scheme, the invention provides at Asn-297 and have the GalGlcNAcMan of being essentially ₅GlcNAc ₂The composition of the glycosylated Igs of glycan structures (Fig. 1).Optionally, can in the Ig molecule, delete and/or increase one or more carbohydrate parts, thereby increase or reduce the number that Ig goes up glycosylation site.In addition, the position of the N-in Ig molecule CH2 district connection glycosylation site can change by the site of introducing N-glycan in l-asparagine (ASN) or the change molecule.Wherein Asn-297 is N-glycan (the Kabat et al. that typically finds in mouse and human IgG molecule, Sequences of Proteins of Immunological Interest, 1991) site, this site are not unique expections, and neither to keep function essential in this site.By known mutation method, the technician can change the dna molecular of coding Ig of the present invention, thereby the N-glycosylation site of deletion Asn-297, and can further change dna molecular, thus create one or more N-glycosylation sites in other site of Ig molecule.Preferably, create the N-glycosylation site in the CH2 district of Ig molecule.But, the N-glycosylation in the Fab district of the Ig in 30% serum antibody usually Asn-75 (Rademacher et al., 1986, Biochem.Soc.Symp., 51:131-148).The glycosylation in Ig molecule Fab district is other to unite site existence or Individual existence with the glycosylation of Fc district.

In a technical scheme, the invention provides a kind of Ig composition of reorganization, have the GalGlcNAcMan of being mainly ₅GlcNAc ₂The N-glycan structures, wherein said GalGlcNAcMan ₅GlcNAc ₂The level that glycan structures exists is at least than second kind of high about 5 molecular fraction of main glycan structures in the reorganization Ig composition.In optimal technical scheme, the invention provides the Ig composition of reorganization, have the GalGlcNAcMan of being mainly ₅GlcNAc ₂The N-glycan structures, wherein said GalGlcNAcMan ₅GlcNAc ₂The level that glycan structures exists arrives about 25 molecular fractions than second kind of main glycan structures high about 10 in the Ig composition of reorganization at least.In more preferably technical scheme, the invention provides the Ig composition of reorganization, have the GalGlcNAcMan of being mainly ₅GlcNAc ₂The N-glycan structures, wherein said GalGlcNAcMan ₅GlcNAc ₂The level that glycan structures exists arrives about 50 molecular fractions than second kind of main glycan structures high about 25 in the reorganization Ig composition at least.In optimized technical scheme, the invention provides provides the Ig of reorganization composition, has the GalGlcNAcMan of being mainly ₅GlcNAc ₂The N-glycan structures, wherein said GalGlcNAcMan ₅GlcNAc ₂The level that glycan structures exists is at least than second kind of high about 50 molecular fraction of main glycan structures in the reorganization Ig composition.In another optimized technical scheme, the invention provides the Ig composition of reorganization, have the GalGlcNAcMan of being mainly ₅GlcNAc ₂The N-glycan structures, wherein said GalGlcNAcMan ₅GlcNAc ₂The level that glycan structures exists is at least than second kind of high about 75 molecular fraction of main glycan structures in the reorganization Ig composition.In another technical scheme, the invention provides the Ig composition of reorganization, have the GalGlcNAcMan of being mainly ₅GlcNAc ₂The N-glycan structures, wherein said GalGlcNAcMan ₅GlcNAc ₂The level that glycan structures exists is at least than second kind of high about 90 molecular fraction of main glycan structures in the reorganization Ig composition.Be mainly GalGlcNAcMan ₅GlcNAc ₂The MALDI-TOF of the N-glycan of the JC-IgG of N-glycan (59.2%) analyzes shown in Fig. 4 A.Be mainly GalGlcNAcMan ₅GlcNAc ₂The MALDI-TOF of the N-glycan of DX-IgG (66%) analyzes shown in Fig. 4 B.

Ig-GalGlcNAcMan ₅GlcNAc ₂Enhancing with Fc γ RIII receptors bind

The effector function that Ig combines with Fc γ RIIIa and Fc γ RIIIb, such as the activation of ADCC are that the Fc district by the Ig molecule mediates.Different structure territory by this district mediates different functions.Therefore, the invention provides Ig molecule and composition, wherein the GalGlcNAcMan that can realize effector function is mainly contained in the Fc zone on the Ig molecule ₅GlcNAc ₂The N-glycan.In a technical scheme, mainly contain GalGlcNAcMan ₅GlcNAc ₂The Fc zone of N-glycan has strengthened and the combining of Fc γ RIIIa (Fig. 6) and Fc γ RIIIb (Fig. 5).In another technical scheme, Fc mainly contains GalGlcNAcMan ₅GlcNAc ₂The N-glycan.It will be apparent to one skilled in the art that: such as immune binder (Chamow and Ashkenazi, 1996, Trends BiotechnoL.14:52-60; Ashkenazi and Chamow, 1997, CurrOpin.Immunol.9:195-200), Fc fusions and the such molecule that contains the Fc zone of antibody-like molecule, be also contained in the scope of the invention.

The combining active (affinity) and can measure by experiment of Ig molecule and Fc acceptor.In embodiment 6, describe Fc γ RIII and combined the example of testing with IgG.Skilled in the art will recognize that this experiment is easy to be applicable to checks immunoglobulin molecules arbitrarily.

Shown in Fig. 5 A, compare with Rituximab , mainly contain GalGlcNAcMan ₅GlcNAc ₂The JC-IgG of N-glycan (a kind of Ig prepared in accordance with the present invention) has combined increased activity 10 times with Fc γ RIIIb's, as shown in Figure 6, is higher than 10 times with the activity that combines of Fc γ RIIIa.Shown in Fig. 5 B, compare with Rituximab , mainly contain GalGlcNAcMan ₅GlcNAc ₂The DX-IgG of N-glycan (a kind of Ig prepared in accordance with the present invention) has combined increased activity about 10 times with Fc γ RIIIb's.

Be that Fc γ RIIIa gene dimorphism has generated two kinds of abnormal shapes the most enjoyably: Fc γ RIIIa-158V and Fc γ RIIIa-158F (Dall ' Ozzo et al., 2004, Cancer Res.64:4664-4669).The Fc γ RIIIa-158V genotype of isozygotying relevant with higher clinical response at Rituximab  (Cartron et al., 2002, Blood, 99:754-758).But, most crowds carry a Fc γ RIIIa-158F allelotrope, make that therefore Rituximab  has reduced by the validity that causes ADCC in conjunction with Fc γ RIIIa for majority.Yet, when expressing the anti-CD 20 antibodies of class Rituximab  in the host cell that is lacking the trehalose transferase active, is being equivalent (Niwa et al by Fc γ RIIIa-158F and the antibody by Fc γ RIIIa-158V strengthening aspect the ADCC, 2004, Clin.Canc Res.10:6248-6255).Antibody in some optimal technical scheme of the present invention is not have (such as P.pastoris---a kind of yeast host that lacks trehalose of expressing in the host cell of trehalose on its N-glycan; Referring to embodiment 1 and 2).Therefore, can estimate, lack trehalose among the present invention and can strengthen with Fc γ RIIIa-158F bonded antibody particularly useful in the many patients that decrease at the clinical response of Rituximab  of treatment.

Ig-GalGlcNAcMan ₅GlcNAc ₂Reduction with Fc γ RIIIb receptors bind

The effector function that Ig combines with Fc γ RIIb, for example increase and the active enhancing of ADCC of the antibody that is produced by the B cell is that the Fc district by the Ig molecule mediates.Different structure territory by this district mediates different functions.Therefore, the invention provides Ig molecule and composition, wherein the GalGlcNAcMan that can realize effector function is mainly contained in the Fc zone on the Ig molecule ₅GlcNAc ₂The N-glycan.In a technical scheme, mainly contain GalGlcNAcMan ₅GlcNAc ₂The Fc zone of the Ig of N-glycan has reduced and the combining of Fc γ RIIb acceptor.It will be apparent to one skilled in the art that: such as immune binder (Chamow and Ashkenazi, 1996, Trends Biotechnol.14:52-60; Ashkenazi and Chamow, 1997, Curr Opin.Immunol.9:195-200), Fc fusions and the such molecule that contains the Fc zone of antibody-like molecule, be also contained in the scope of the invention.

The combining active (affinity) and can measure by experiment of Ig molecule and Fc acceptor.In embodiment 6, describe Fc γ RIIb and combined the example of testing with IgG1.Skilled in the art will recognize that this experiment is easy to be applicable to immunoglobulin molecules arbitrarily.

Shown in Fig. 7 A, compare with Rituximab , mainly contain GalGlcNAcMan ₅GlcNAc ₂The JC-IgG of N-glycan (a kind of Ig prepared in accordance with the present invention) has reduced about 4 times with the activity that combines of Fc γ RIIb.Shown in Fig. 7 B, compare with Rituximab , mainly contain GalGlcNAcMan ₅GlcNAc ₂The DX-IgG of N-glycan (a kind of Ig prepared in accordance with the present invention) has reduced about 4 times with the activity that combines of Fc γ RIIb.

The increase of the cytotoxicity of antibody-dependant cell mediation

In a technical scheme, Fc γ RIIIa or Fc γ RIIIb with GalGlcNAcMan ₅GlcNAc ₂Be the mainly Ig molecule of N-glycan or the combination enhancing of composition, thereby increase the ADCC of Fc γ RIII mediation.Very clear and definite Fc γ RIII (CDl6) and ADCC active relevant (Daeron et al., 1997, Annu.Rev.Immunol.15:203-234).In another technical scheme, Fc γ RIIb with GalGlcNAcMan ₅GlcNAc ₂Be that the Ig molecule of main N-glycan or the bonded of composition reduce, can strengthen ADCC (Clyneset al., 2000, the same).In another technical scheme, Ig molecule of the present invention or composition are owing to have the GalGlcNAcMan that takes advantage ₅GlcNAc ₂Glycan and strengthen the ADCC activity.

The example that experiment in vitro detection B cell consumption and fluorescence discharge the ADCC experiment has been described in embodiment 7.Skilled in the art will recognize that these described experiments are easy to be applicable to any Ig molecule.In addition, according to Borchmann et al., 2003, Blood, 102:3737-3742, Niwa et al., 2004, Cancer Research, the ADCC experiment also can be used for the IgG of any specific in 64:2127-2133 and the embodiment 7, the body in the animal model.

The B cell produces the increase of antibody

Known by regulation and control Fc γ R approach Antybody therapy tumour (Clynes et al., 2000, Nature, 6:443-446).Particularly, known when Fc γ RIIb with based on the time such as the immunity receptor tyrosine co-crosslinking of the active element of B-cell receptor (BCR), Fc γ RI, Fc γ RIII and such the containing of Fc ε RI (ITAM) acceptor, signal (the Vivierand Daeron that can suppress the ITAM mediation, 1997, Immunol.Today, 18:286-291).In addition, add combining of the special antibody Fc capable of blocking of FcgRII and FcgRIIB, thereby cause the propagation (Wagle et al., 1999, J of Immunol.162:2732-2740) of B cell.Therefore, activation (the Parker that in a technical scheme, Ig molecule of the present invention can cause the reduction of Fc γ RIIb receptors bind, causes the B cell---it produces antibody by plasmocyte catalysis---, D.C.1993, Annu.Rev.Immunol.11:331-360).In embodiment 6, describe the B cell that a detection contains IgG1 and produced the example of the experiment of antibody.Skilled in the art will recognize that this experiment is easy to be applicable to detects immunoglobulin molecules arbitrarily.

Other immunocompetence

Shown the surface expression that changes effector cell's molecule on the neutrophilic granulocyte can strengthen susceptibility to infectation of bacteria (Ohsaka et al., 1997, Br.J.Haematol.98:108-113).Further show the IgG with Fc γ RIIIa effector cell receptors bind can regulate the expression of tumour necrosis factor alpha (TNF-α) (Blom et al., 2004, Arthritis Rheum., 48:1002-1014).In addition, Fc γ R inductive TNF-α has also improved the neutrophilic granulocyte combination and has engulfed bag by the erythrocytic ability of IgG (Capsoni et al., 1991, J.Clin.Lab Immunol.34:115-124).Therefore can predict the expression that enhanced Ig molecule and composition can improve TNF-α that combines of of the present invention and Fc γ RIII.

Shown that the activity that strengthens Fc γ RIII acceptor can improve secretion (Kavai et al., 1982, the Adv.Exp Med.Biol.141:575-582 of beta-glucuronidase in the lysosome and other lysosomal enzymes; Ward and Ghetie, 1995, Therapeutic Immunol., 2:77-94).In addition, an important step after immunity receptor engages by its aglucon be move in them and be delivered in the lysosome (Bonnerot et al., 1998, EMBOJ., 17:4906-4916).Therefore combine the secretion that enhanced Ig molecule or composition can improve lysosomal enzymes with Fc γ RIIIa and Fc γ RJIIb among measurable the present invention.

The single-minded Fc γ RIIIb that is present on the neutrophilic granulocyte is playing an important role aspect the assembling of immunocomplex, and its gathering can activate phagolysis, cell threshing, and respiratory burst, causes easily the destruction of the pathogenic agent of being engulfed by phagocytic cell.The soluble form that the activation of neutrophilic granulocyte can cause two extracellular domains of acceptor to be sheared with proteolysis is secreted.The effector function that soluble Fc γ RIIIb relies on by Fc γ R reaches by bringing into play adjusting function with complement receptor CR3 bonded competitive inhibition, cause producing mediators (the Sautes-Fridman et al. that causes inflammation, 2003, ASHI Quarterly, 148-151).

Therefore the present invention provides and has contained mainly by GalGlcNAcMan ₅GlcNAc ₂The immunoglobulin molecules of the N-glycan of forming; And the composition that contains immune globulin bletilla multiple N-glycan attached to it is provided, wherein the N-glycan that takes advantage in above-mentioned multiple N-glycan is mainly by GalGlcNAcMan ₅GlcNAc ₂Form.In arbitrary embodiment shown in this paper, the above the GalGlcNAcMan that takes advantage of immunoglobulin (Ig) ₅GlcNAc ₂The N-glycan preferably provides required treatment effect activity, has improved in addition and the combining and reduced and the combining of Fc γ RIIb of Fc γ RIIIa and Fc γ RIIIb.

Immunoglobulin subclass

Shown the IgG subclass to the Fc acceptor have different binding affinities (Huizinga et al., 1989, J.of Immunol., 142:2359-2364).Every kind of IgG subclass has specific advantage at different aspect of the present invention.Therefore, on the one hand, the invention provides with attached to the GalGlcNAcMan on the IgG1 molecule ₅GlcNAc ₂IgG1 composition as main N-glycan.On the other hand, the present invention comprises with attached to the GalGlcNAcMan on the IgG2 molecule ₅GlcNAc ₂IgG2 composition as main N-glycan.The another one aspect, the present invention contains with attached to the GalGlcNAcMan on the IgG3 molecule ₅GlcNAc ₂IgG3 composition as main N-glycan.On the other hand, the present invention comprises with attached to the GalGlcNAcMan on the IgG4 molecule ₅GlcNAc ₂IgG4 composition as main N-glycan.

Optionally, the present invention can be applicable to whole 5 kinds of main immunoglobulin (Ig) kinds: IgA, IgD, IgE, IgM and IgG.Preferred immunoglobulins of the present invention is a human IgG, and some from IgGl, IgG2, IgG3 or the IgG4 hypotype preferably.More preferably, immunoglobulin (Ig) of the present invention is the IgG1 molecule.

The production of mediate antibody effector function and active recombination immunoglobulin (Ig) molecule

On the one hand, the invention provides and produce that reorganization Ig molecule---its N-glycan on 297 Asn of CH2 structural domain is mainly by GalGlcNAcMan ₅GlcNAc ₂Glycan structures is formed---method, wherein numerator mediated antibody mediated effect function of Ig and activity, and similarly, provide the method for compositions of producing immunoglobulin (Ig) are GalGlcNAcMan attached to the N-glycan that takes advantage on the immunoglobulin (Ig) wherein ₅GlcNAc ₂

In a technical scheme, use heavy chain and the light chain of the synthetic Ig of eclipsed oligonucleotide, and be cloned into (embodiment 1) in the expression vector respectively, in host cell, express.In an optimized technical scheme, increase GalGlcNAcMan in main catalysis ₅GlcNAc ₂Host strain in express recombinant Ig heavy chain and light chain.In a technical scheme, this sugar shape structure more specifically is expressed as [Gal-(GlcNAc β 1,2-Man α 1,3) (Man α 1,3 Man α 1,6 Man α 1,6) Man β 1,4-GlcNAc β 1,4-GlcNAc]---it is 297 amino acid whose nitrogen of Asn in Fc zone and GalGlcNAcMan on Ig ₅GlcNAc ₂Form a connection between the oh group of the N-acetyl-β on the glycan-D-glucosamine.In the another one technical scheme, this glycan that takes advantage can add on the aspartic acid on the Ig intramolecularly different loci (except 297 Asn), or is connected on the N-glycosylation site in Fab zone.

In lower eukaryotes, produce and mainly contain GalGlcNAcMan ₅GlcNAc ₂Ig

One aspect of the present invention provides the reorganization eukaryotic host cell---and it can be used for producing mainly is GalGlcNAcMan ₅GlcNAc ₂The immunoglobulin (Ig) or the antibody molecule of sugar shape are compared with glycoprotein compositions expressed in the mammalian cell of the very low above-mentioned sugared shape of natural production output, and it more has superiority.

Another advantage of the present invention be glycoprotein compositions with predetermined, be easy to the regenerated glycosylation pattern and provide.For required characteristic, can the character of this based composition be evaluated and optimized, minimize or avoid fully disadvantageous effect.

The present invention also provides and has produced through transforming or selecting to express one or more nucleic acid---and be used for producing and contain mainly by GalGlcNAcMan ₅GlcNAc ₂The Ig molecule of the N-glycan of forming and have the GalGlcNAcMan that takes advantage ₅GlcNAc ₂The Ig composition of glycan structures---the method for recombinant host cell.In some optimized technical scheme of the present invention, recombinant host cell is preferably the low eukaryotic host cell that waits of reorganization, is used to produce the above-mentioned GalGlcNAcMan that mainly contains ₅GlcNAc ₂The Ig molecule and the composition of glycan.

In other optimized technical scheme, the present invention comprises can be from recombinant host cell or the glycoprotein that obtains by method of the present invention.

Can be with the carrier in coding required Ig zone, and transform host cell among the present invention with coding one or more described herein and carriers glycosylation involved enzyme, the screening expression has the GalGlcNAcMan that takes advantage then ₅GlcNAc ₂The reorganization Ig molecule or the composition of N-glycan.Recombinant host cell of the present invention can be such as animal, plant, insect, bacterial cell or other similar eucaryon or prokaryotic host cell---they can produce after transforming or screening mainly contains GalGlcNAcMan ₅GlcNAc ₂The Ig composition of N-glycan structures.

Preferably, recombinant host cell of the present invention is that (WO 02/00879, and WO 03/056914, and WO 04/074498, WO04/074499, Choi et al., 2003, PNAS, 100:5022-5027 as the described conventional low eukaryotic host cell of transforming such as grade in this area; Hamilton et al., 2003, Nature, 301:1244-1246 and Bobrowicz et al., 2004, Glycobiology, 14:757-766).Particularly, WO 02/00879 and WO 04/074499 have described to express and have had GalGlcNAcMan ₅GlcNAc ₂The method of the glycoprotein of N-glycan, and the method that β-1,4 galactotransferase is changed over to lower eukaryotes has been described.More specifically, U. S. application No.11/108088 has described and has mainly contained GalGlcNAcMan ₅GlcNAc ₂The glycoprotein of N-glycan (comprising immunoglobulin (Ig)).

In a technical scheme, with the coding IgG1 carrier---the AOX1/pPICZA carrier that for example contains JC-IgG1 (embodiment 1)---be transferred in the yeast P.pastoris YAS385-1 bacterial strain.Similar (the Hamilton et al. of this YAS385-1 bacterial strain to the YSH44 bacterial strain of removing the K3 reporter protein, 2003, Sclence, 301:1244-1246), and contain PNO1 and the MNN4b gene that (the U.S. Patent application No.11/020808) that described knocked out, and β-1, the 4 galactotransferase I gene that contains (U.S. Patent application No.11/108088) importing of having described.Two the knocking out of Δ pnol Δ mnn4b can cause losing mannose group-phosphorylation.Can delete as described about YSH44 (Hamiltonet al. by go up the cultivation bacterial strain at 5-fluororotic acid (5-FOA), 2003) flank that imports like that is mannosidase II gene (the Guthrie and Fink of URA5 gene, 1991, Guide to Yeast Genetics and MolecularBiology, Methods in Enzymology, Vol. 169, Academic Press, SanDiego).The deletion of mannosidase II gene can be kept 5 seminose core textures---terminal α-1,3 and α-1,6 seminose and α-1,6 seminose arms link to each other, β-1,2 GlcNAc and terminal β-1 on α-1,3 seminose, 4 semi-lactosis and β-1,2 GlcNAc links to each other.Use UR43 to knock out plasmid then, it has inserted the URA3 gene and has destroyed AMR2 gene (Guthrie and Fink, 1991, the same) on the AMR2 locus, thereby has deleted β-mannose glycosylation (U.S. Patent application No.11/118008).This YAS385-1 bacterial strain is expressed and is mainly contained GalGlcNAcMan ₅GlcNAc ₂And GlcNAcMan ₅-GlcNAc ₂Glycoprotein, therefore generated and mainly contained GalGlcNAcMan ₅GlcNAc ₂And GlcNAcMan ₅-GlcNAc ₂JC-IgG.Handle this with β-1,4 galactosyltransferase and mainly contain GalGlcNAcMan ₅GlcNAc ₂And GlcNAcMan ₅-GlcNAc ₂JC-IgG (embodiment 3), can generate and mainly contain GalGlcNAcMan ₅GlcNAc ₂The JC-IgG of N-glycan (Fig. 4 A).

In another technical scheme, the carrier (embodiment 1) that will contain coding IgG1 among the AOX1/pPICZA of DX-IgG also imports in the yeast P.pastoris YAS385-1 bacterial strain (the same), purifying, use β-1 then, 4 galactosyltransferases are handled (embodiment 3), thereby are mainly contained GalGlcNAcMan ₅GlcNAc ₂The DX-IgG of N-glycan (Fig. 4 B).

Optionally, antibody of the present invention can be expressed (Monoclonal Antibody Production Techniques and Applications, pp.79-97 Marcel Dekker, Inc. by several different methods as known in the art, New York, 1987).

The expression of glycosyltransferase and temperature genetic integration are in lower eukaryotes

Described to use and heterologous gene is imported and confirmed to be incorporated into method in the eucaryon host bacterial strain (such as P.pastoris) such as low such as the such selective marker of URA3, URA5, HIS4, SUC2, G418, BLA or HBLA.When in lower eukaryotes, producing expression system, can adjust these methods to produce Ig of the present invention.In addition, described and consider and reuse the URA3 mark to remove the active method of unwanted mannose transferase.Alaniet al., 1987, Genetics, 116:541-545 and U.S. Patent No. 6,051,419 have been described based on the ruined selective system of URA3 gene among the P.pastoris.Preferably, P can be used for destroying any gene in URA3, URA5 or the uridylic biosynthetic pathway based on the destruction box of pURA3-or PpURA5-, and can carry out the positive and the negative (Boeke of selection based on uracil auxotrophy and to the resistance of 5-fluororotic acid (5FOA), et al., 1984, Mol.Gen.Genet., 197:345-346).Therefore, the technician knows that this system is by selecting can to insert a plurality of heterologous genes with reverse selection.

Further enzyme modification

Further enzymatic deletion is useful or essential for separating the Ig that does not contain seminose phosphorylation or β-mannose glycosylation---they may cause unusual immune response activity in human body---.As mentioned above, U.S. Patent application No.11/020808 has described the method for removing the seminose phosphorylation, and U.S. Patent application No.11/118008 has described the method for removing β-mannose glycosylation.

In other protein expression system, produce and mainly contain GalGlcNAcMan ₅GlcNAc ₂The Ig of glycan structures

The technician knows for the heterologous protein expression, can select to need or do not need to process the expressive host system (body) that contains the glycan structures that takes advantage with expression.Embodiment provided herein is to having specific glycan at 297 Asn or having the N-glycosylation in other site or the example of the method that Ig that the two all has expresses.Those skilled in the art can transform the details and the embodiment of arbitrary protein expression system (body) in the invention easily.

Other protein expression host system---comprise animal, plant, insect, bacterial cell and other analog system, can be used for producing Ig molecule of the present invention and composition.Can transform or screen the sugared shape that this proteinoid expressive host system takes advantage with expression, perhaps selectively, can natural production have the glycoprotein of the glycan structures that takes advantage.Example that transform to produce the protein expression host system of glycoprotein with the sugared shape that takes advantage comprise gene knockout/sudden change (Shields etal., 2002, JBC, 277:26733-26740), genetically engineered (

Et, al., 1999, Nature Biotech., 17:176-180)) or the combination of the two.Perhaps, the specific cells that some can certain sugared shape that takes advantage of natural expression--for example, chicken, people and ox (Raju et al., 2000, Glycobiology, 10:477-486).Therefore, according to the selected at least a expressive host system of those skilled in the art, can realize have the Ig glycoprotein of certain the specific glycan structures that takes advantage or the expression of composition of the present invention.The further expressive host system that being used to of finding in this area produced glycoprotein comprises: Chinese hamster ovary celI---RajuWO9922764A1 and Presta WO03/035835A1; Hybridoma---Trebak etal., 1999, J.Immunol.Methods, 230:59-70; Insect cell---Hsu et al., 1997, JBG, 272:9062-970; And vegetable cell---Gerngross et al., WO04/074499A2.

The purifying of IgG

The method of purifying and separation antibody is known in this area and has obtained describing.Referring to, for example, Kohler ﹠amp; Milstein, (1975) Nature 256:495; Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp.51-63, (Marcel Dekker, Inc., New York, 1987); Goding, Monoclonal Antibodies:Principles and Practice, pp.59-104 (Academic Press, 1986); And Jakobovitset, al. (1993) Proc.Natl.Acad.ScL USA 90:2551-255 and Jakobovits et al, (1993) Nature 362:255-258.In a further technical scheme, from passing through McCafferty et al. (1990) Nature, in the antibody phage library that the technology that 348:552-554 (1990) describes generates, use suitable antibody or the antibody fragment of target antigen screening, thus separation antibody or antibody fragment.

The reorganization Ig molecule of producing according to the inventive method can come purifying according to the method for narration among the embodiment 3.Shown in Figure 2 is the SDS-PAGE Coomassie brilliant blue dyeing gel of the JC-IgG of purifying from YAS385-1.Shown in Figure 3 is the SDS-PAGE Coomassie brilliant blue dyeing gel of the DX-IgG of purifying from YAS385-1.In another technical scheme, the Ig antibody of purifying is with GlcNAcMan ₅GlcNAc ₂As main N-glycan.Can be by several mass spectrometry methods well known by persons skilled in the art---including but not limited to: HPLC, NMR, LCMS and MALDI-TOF MS-analyze glycan and determine its distribution on Ig molecule arbitrarily.In an optimized technical scheme, the distribution of glycan is analyzed to determine by MALDI-TOF MS, shown in embodiment 5.Shown in Fig. 4 A is MALDI-TOF collection of illustrative plates (embodiment 3) purifying and that use the JC-IgG of β-1,4 galactosyltransferase processing from YAS385-1.This MALDI-TOF shows that total N-glycan of about 59.2% mol ratio is GalGlcNAcMan ₅GlcNAc ₂Shown in Fig. 4 B is MALDI-TOF collection of illustrative plates purifying and that use the DX-IgG of β-1,4 galactosyltransferase processing from YAS385-1.This MALDI-TOF shows that total N-glycan of about 66% mol ratio is GalGlcNAcMan ₅GlcNAc ₂

Pharmaceutical composition

Antibody of the present invention can be incorporated in the pharmaceutical composition that contains antibody as active treatment preparation and various other pharmaceutically acceptable component.Referring to Remington ' s PharmaceuticalScience (15th ed., Mack Publishing Company, Easton, Pennsylvania, 1980).Preferred form depends on predetermined administering mode and therepic use.According to required prescription, said composition also comprises pharmaceutically acceptable, nontoxic carrier or diluent, as carrier, is generally used for illustrating the pharmaceutical composition of animal or human's administration.The diluent of selecting does not influence the biologic activity of composition.The example of this diluent is distilled water, phosphoric acid physiological saline, Ringer ' s solution, glucose solution and Hank ' s solution.In addition, pharmaceutical composition or prescription also comprise other carrier, adjuvant or nontoxic, no therapeutic, non-immunity stablizer etc.

The pharmaceutical composition of enteron aisle external administration is aseptic, isobaric substantially, do not contain thermal source, according to the GMP of FDA or same equipment preparation.Antibody can carry out the administration of injected dose by the solution or the suspension of this material, and this substance dissolves can be aseptic liquid, for example in water, oil, salt, glycerine or the ethanol in having the physiologically acceptable diluent of carrier pharmaceutically.In addition, auxiliary substance, for example moistening agent or emulsifying agent, tensio-active agent, pH buffer substance etc. can be present in the composition.The group of other medicines composition comprises oil, animal, plant, perhaps synthetic source, for example, peanut oil, soya-bean oil and mineral oil.Usually, be preferred liquid vehicle such as third rare ethylene glycol or the such ethylene glycol of polyethylene glycol, particularly like this for Injectable solution.The storage injection that antibody can be prepared in the mode of sustainable release of active ingredients or the form administration of implantation preparation.Typically, the injectable forms with liquor or suspension prepares composition; Also can prepare solid form, it can be dissolved in before injection or be suspended in the liquid vehicle.As mentioned above, preparation also can be an emulsive, perhaps be packaged in the liposome methods, or such as polylactide, the such microparticle of polyoxyethylene glycol, or in the multipolymer, be used to strengthen the effect of adjuvant (referring to Langer, Science 249,1527 (1990) and Hanes, Advanced Drug Delivery Reviews 28,97-119 (1997)).

The diagnostic product

Antibody of the present invention can be included in multiple diagnostic kit and other diagnostic product, for example in the array.Usually the antibody that provides is combined on the solid phase in advance, for example in the hole of microwell plate.Test kit also contains usually and detects antibodies and mark so that the reagent of guidance to be provided.Immunity or sandwich assay method are the forms (referring to United States Patent (USP) 4,376,110,4,486,530,5,914,241 and 5,965,375) of preferred diagnostic kit.Antibody array is described in, for example, and US5,922,615, among US 5,458,852, US 6,019,944 and the US 6,143,576.

Therapeutic is used

The invention provides the glycoprotein compositions that in glycoprotein, mainly contains specific sugared shape.A feature of the present invention is, in optimal technical scheme, when the administration Mammals comprises man-hour, the pharmaceutical cpd that contains novel glycoprotein compositions is compared with the glycoprotein compositions that other has same principle construction, is beneficial to show better body internal characteristic.Therefore, novel compositions of the present invention can be used as used glycoprotein pharmaceutical preparation at present, can be beneficial to characteristic and enhanced consistence that improvement is provided on production batch.Preparation of the present invention according to specific medicine or medicament and target domain thereof can be used as solution, unit dosage form for example tablet and capsule be used for oral, and suspension, ointment etc.

In particular aspects, the invention provides the novel compositions of glycoprotein pharmaceutical preparation, medicine or medicament, wherein glycoprotein comprises immunoglobulin molecules, composition mainly comprises the specific sugared shape of glycoprotein preparation.According to a particular aspect of the invention, the composition that provides comprises the GalGlcNAcMan5GlcNAc2 glycan structures that N-connects oligosaccharides that is mainly described herein.Aspect preferred, glycoprotein is antibody, particularly monoclonal antibody.The present invention further provides method for compositions of the present invention and the instrument produced.

The present invention further comprises the pharmaceutical composition that contains the present invention's sugar shape preparation.Said composition is preferably aseptic.When composition was the aqueous solution, preferably glycoprotein was soluble.When composition is lyophilized powder, preferably can be heavy molten in suitable solvent.

In others, the present invention includes the method for treatment disease, comprise the pharmaceutical composition of the present invention of the required Mammals treatment of administration effective dose.Further target of the present invention provides the sugared shape preparation of spendable commodity or kit form, is used for the treatment of disease or imbalance.

The GalGlcNAc-Man that mainly contains of the present invention ₅GlcNAc ₂The Ig molecule of N-glycan has the purposes of the multiple indication of treatment, for example cancer, inflammatory disease, infection, Immunological diseases, auto-immune disease comprise primary thrombocytopenic purpura, sacroiliitis, systemic lupus erythematous and autoimmune hemolytic anemia.

Following examples are used to illustrate that the present invention is about producing the composition and the method for Ig glycoprotein compositions.These embodiment are not that the present invention is limited only for illustrative purposes.The technician should understand various modification of the present invention and expansion comprises that it is possible optimizing.This modification or expansion are considered to a part of the present invention.

Embodiment 1

Clone and expression DX-IgGl in pichia spp

Light chain (L) and the heavy chain (H) of DX-IgGl (anti-CD20 IgGl) are made up of mouse variable region and human constant region.Light chain is expressed as SEQ ID NO:1, and heavy chain is SEQ ID NO:2.Heavy chain and sequence of light chain are by the overlapping oligonucleotide synthetic available from Integrated DNA Technologies (IDT).To variable region of light chain, bought 15 overlapping oligonucleotide (SEQID NOs:5-19), produce variable region of light chain fragment by annealing with the Extaq (Takada) in the PCR reaction with 5 ' MlyI site.Then with variable region of light chain fragment and CH (SEQ ID NO:3) (Gene Art, Toronto Canada) is connected by carrying out overlapping PCR with 5 ' MlyI primer CD20L/up (SEQ ID NO:20), 3 ' variable region/5 ' constant region primer LfusionRTVAAPS/up (SEQ ID NO:21), 3 ' constant region primer LfusionRTVAAPS/lp (SEQ ID NO:22) with 3 ' CD20L/lp (SEQ ID NO:23).Then final MlyI-light chain segments (comprising 5 ' AG base pair) is inserted in the pCR2.1 topo carrier (Invitrogen), obtains pDX343.For heavy chain, bought 17 overlapping oligonucleotide (SEQID NOs:24-40) from IDT, and annealed with Extaq corresponding to the mouse variable region of heavy chain.Then this variable region of heavy chain fragment is connected by overlapping PCR with 5 ' MlyI primer CD20H/up (SEQ ID NO:41), 5 ' variable region/5 ' constant region primer HchainASTKGPS/up (SEQID NO:42), 3 ' variable region/constant region primer HchainASTKGPS/lp (SEQ ID NO:43), 3 ' constant region primer HFckpnl/lp (SEQ ID NO:44) with CH (SEQ ID NO:4) (Gene Art).Reach the MlyI-heavy chain fragment (comprising 5 ' AG base pair) that finally obtains and be inserted in the pCR2.1topo carrier (Invitrogen), obtain pDX360.From the topo carrier, separate full-length light chains and total length heavy chain, as MlyI and NotI fragment.Then with forward light chain and heavy chain fragment by 4 overlapping oligonucleotide---P.BiPss/UPl-EcoRI, P.BiPss/LPl, P.BiPss/UP2 and P.BiP/LP2 (sequence is respectively SEQ ID NOS:46-49) are connected on Kar2 (Bip) signal sequence (SEQ ID NO:45), be connected to the EcoRI-NotI site of pPICZA then, thus the pDX468 that obtains carrying the pDX344 of Kar2-light chain and carry the Kar2-heavy chain.Then will be from the BglII-BamHI fragment subclone of pDX344 to the pBK85 that contains the AOX2 promoter gene that is used for chromosomal integration, thus pDX458 obtained.To from the BglII-BamHI fragment subclone of the pDX468 that carries heavy chain in pDX458, obtain being positioned at the pDX478 that contains CD20 heavy chain and light chain under the AOX1 promotor, simultaneously.To carry BglII-BamHI fragment subclone among the pDX468 of heavy chain then in pDX458, obtain being positioned at the pDX478 that contains CD20 heavy chain and light chain under the AOX1 promotor, simultaneously.Then before conversion with SpeI with this plasmid linearization, to be incorporated into AOX2 site (referring to embodiment 2) with transformant with the Zeocin resistance screening.

Clone and expression JC-IgG in pichia yeast

The light chain of JC-IgGl (L) and heavy chain (H) are made up of mouse variable region and human constant region.The variable light chain of mouse is expressed as SEQ ID NO:50 (GenBank#AF013576), and the mouse variable heavy chain is SEQ ID NO:51 (GenBank#AF013577).Heavy chain and sequence of light chain are by the overlapping oligonucleotide synthetic available from Integrated DNA Technologies (IDT).To light chain, bought 12 overlapping oligonucleotide (SEQ ID NOs:52-63), produce the light chain of 660 bases with 5 ' EcoRI site and 3 ' KpnI site by annealing with the Extaq (Takada) in the PCR reaction.Then with this light chain subclone in pPICZa carrier (Invitrogen), obtain the EcoRI-KpnI fragment.For heavy chain, bought 12 corresponding to the segmental overlapping oligonucleotide of Fab (SEQ ID NOs:64-75), anneal to produce the Fab fragment of 660 bases with Extaq.The Fc fragment is synthesized by same overlapping PCR reaction with 12 overlapping oligonucleotide (SEQ ID NOs:76-87).Then heavy chain Fab and Fc fragment are used corresponding to terminal 5 ' the EcoRI primer (SEQ ID NO:64) of heavy chain Fab fragment 5 ' with corresponding to Fc fragment 3 ' terminal 3 ' KpnI primer (SEQ ID NO:88) and annealed with pFU Turbo polysaccharase (Stratagene), obtain the heavy chain of 1,330 base pair.With the primer that contains 5 ' EcoRI and 3 ' KpnI site heavy chain is cloned in the pPICZa carrier.Will be in final pPICZa carrier as the AOX2 primer sequence subclone of integration site, then, will contain the BglII-BstBl fragment of AOX1 promotor and containing from BstBl-BamHI fragment (SEQ ID NO:89), zymoplasm site (SEQ IDNO:90) and the equal subclone of JC light chain of the HSA sequence in people's liver cDNA library BamHI site to the AOX2/pPICZa carrier.Then, the BlgII-BstBI fragment and the BamHI site of the BstIBl-BamHI fragment subclone that contains HAS sequence, zymoplasm site and JC heavy chain that another are contained the AOXl promotor to same pPICZa carrier.Final carrier contains the JC light chain of AOX2 integration site, band HSA-label and the JC heavy chain of band HSA-label, thereby obtains pJC140.The zero mycin resistance of this expression cassette with the screening transformant is incorporated on the AOX2 site (referring to embodiment 2) of pichia yeast bacterial strain.

Rituximab  Rituxan Be available from Biogen-IDEC/Genentech, SanFrancisco, anti-CD20 mouse/people's mosaic type IgGl of CA.

Pcr amplification.Carry out all PCR reactions with Eppendorf Mastercycler thermal cycler.The PCR reaction contains template DNA, 125 μ M dNTPs, 0.2 μ M forward and reverse primer, Ex Taq polymerase buffer (Takara Bio Inc.) and Ex Taq polysaccharase or pFU Turbo polymerase buffer (Stratagene) and pFU Turbo polysaccharase.By 30 cyclic amplification dna fragmentations, 97 ℃ 15 seconds, 55 ℃ 15 seconds, 72 ℃ 90 seconds, initial denaturing step is for to carry out 2 minutes at 97 ℃, extends 7 minutes at 72 ℃ at last.

Separate the PCR sample by agarose gel electrophoresis, extract the DNA band, extract with the glue recovery test kit of Qiagen.All DNA purifying things are at 10mM Tris, wash-out under the pH8.0, and final PCR (all 3 are segmental overlapping) uses the deionized water wash-out.

Embodiment 2

The IgG carrier is transformed among the pichia yeast bacterial strain YAS385-1.By adding sodium-acetate to final concentration is that 0.3 M prepares DNA.Adding 100% cold ethanol to final concentration then in the DNA sample is 70%.Make the DNA precipitation by centrifugal (12000g * 10 minute), and with 70% cold washing with alcohol 2 times.Dry DNA, and be resuspended to 50 μ l 10mM Tris, among the pH8.0.YAS385-1 yeast culture to be transformed (Choi et al., 2003; Hamilton et al., 2003) (cushion basic glycerine: 100mM vitriolate of tartar, pH6.0 by enlarged culturing BMGY; 1.34% yeast nitrogen, 4 * 10 ^-5The % vitamin H; 1% glycerine) O.D. that is cultured to for a short time in prepares competent cell for～2～6.Then yeast cell is washed 3 times in the 1M sorbyl alcohol, and be resuspended in the 1M sorbyl alcohol of about 1-2 milliliter.DNA (1-2 μ g) is mixed with 100 μ l competent cells, incubation on ice 10 minutes.With BTX Electrocell Manipulator600 yeast cell is carried out electroporation then, use following parameter: 1.5kV, 129ohms and 25 μ F.In electroporation of cells, add 1ml YPDS (1% yeast extract, 2% peptone, 2% dextran, 1M sorbyl alcohol).Then the yeast that transforms is transformed at the selectivity agarose plate that contains zero mycin.

The culture condition of IgG1 in pichia spp.To be inoculated into the mono-clonal YAS385-1 that pDX478 or pJC140 transform and contain 10ml BMGY substratum and (contain 1% yeast extract, 2% peptone, 100mM vitriolate of tartar damping fluid (pH6.0), 1.34% yeast nitrogen, 4 * 10 ⁵% vitamin H and 1% glycerine) 50ml Falcon centrifuge tube in.Culture is saturated to culture 24 ℃ of shaking culture 48 hours.In 500ml baffle plate type flask, add 100ml BMGY then.Inoculum is transferred in the baffle plate type flask that contains 100ml BMGY substratum then.With culture 24 ℃ of shaking culture 24 hours.Content in the flask is poured in 2 50mlFalcon centrifuge tubes gently centrifugal 10 minutes of 3000rpm.Precipitate 1 time with not glycerinated 20ml BMGY washed cell, be resuspended in gently then among the 20ml BMMY (BMGY replaces 1% glycerine with 1%MeOH).With the cell transfer that suspends in 250ml baffle plate type flask.With culture 24 ℃/170-190rpm shaking culture 24 hours.Content in the flask is poured in 2 50ml Falcon centrifuge tubes gently centrifugal 10 minutes of 3000rpm.By elisa assay culture supernatant, before albumen sepn, to measure about antibody titers (referring to embodiment 3).

By enzyme linked immunological absorption detecting method (ELISAs) antibody in the culture supernatant is decided Amount:Be dissolved in 10ml PBS with 24 μ g, and the goat-anti human Fab among the pH7.4 (Biocarta, Inc, SanDiego, CA) bag is by high associativity microwell plate (Costar), and 4 ℃ of placements are spent the night.Remove damping fluid, add sealing damping fluid (PBS that contains 3%BSA), the room temperature incubation is 1 hour then.Remove the deblocking damping fluid, plate is washed 3 times with PBS.After the washing, add the antibody culture supernatant (0.4,0.8,1.5,3.2,6.25,12.5,25 and 50 μ l) that increases volume gradually, room temperature incubation 1 hour the last time.Use PBS+0.05%Tween 20 wash plate then.After the washing, adding is dissolved in 1: 2000 anti-people Fc-HRP in the PBS solution the last time, and the room temperature incubation is 1 hour then.With PBS-Tween 20 plate is washed 4 times then.(Pierce Biotechnology) comes analysis plates according to specification sheets with the tmb substrate test kit.

Embodiment 3

The purifying of IgGl

From culture supernatant, catch monoclonal antibody with Streamline albumin A post.With Tris-glycine pH3.5 wash-out antibody, and neutralize with 1M Tris pH8.0.(HIC) carries out further purifying with hydrophobic interaction chromatograph.Select the HIC post of particular type according to antibody.For JC-IgG and DX-IgG, can use phenyl sepharose post (also can use octyl sepharose), damping fluid is 20mM Tris (7.0), 1M (Na) ₂SO ₄Damping fluid uses linear gradient damping fluid 1M to 0M (NH ₄) ₂SO ₄Wash-out.Collect the antibody component on the phenyl sepharose post, and exchange in the 50mM NaOAc/Tris pH5.2 damping fluid, (the quick wash-out post of SP agarose) (GE Healthcare) carries out final purifying by cationic exchange coloum.Use 50mMTris, 1M NaCl (pH7.0) antagonist carries out linear elution.

With JC-IgG and the DX-IgG among β-1, the 4 galactosyltransferase processing YAS385-1

IgG (JC-IgG or the DX-IgG) buffering of 5mg purifying is exchanged to 50mMNH ₄Ac is among the pH5.0.In the pipe of silication, to being dissolved in 50mM NH ₄Ac, add among the IgG of the purifying among the pH5.0 0.3U derive from β-1,4 galactosyltransferase in the milk (EMDBiosciences, La Jolla, CA), 37 ℃ incubation 16-24 hour.With this sample concentration drying, be resuspended in the water, analyze with MALDI-TOF.Then as mentioned above by the antibody in phenyl sepharose purifying β-1,4 galactosyltransferase.

Embodiment 4

The detection of the Ig of purifying

The JC-IgG or the DX-IgG of purifying are mixed with about isopyknic sample sample-loading buffer, by pre-prepared colloid (NuPAGE bis-Tris electrophoresis system; InvitrogenCorporation, Carlsbad Calif) carries out dodecyl semi-annular jade pendant acid sodium-polyacrylamide gel electrophoresis (SDS-PAGE) according to product description.(Bio-Rad, Hercules CA) dye to gel protein with the Coomassie brilliant blue staining fluid.Referring to Fig. 2 and 3.

Antibody concentration

By the Bradford detection method (Bradford, M.1976, Anal.Biochem. (1976) 72,248-254), (Pierce, Rockford IL) are the concentration of standard test albumen chromatographic component with albumin.

Embodiment 5

The IgGl carbohydrate analysis

Substance assistant laser desorpted attached ionization/flight time mass spectrum technology (MALDI-TOFMS).The MALDI-TOF of the oligosaccharides that aspartic acid connects analyzes: with P apac et al., Glycobiology 8, and the program release JC-IgG that 445-454 (1998) revises is connected glycan with the N-among the DX-IgG.With the reduction of antibody sample, and carry out carboxymethylation, closing membrane, water is with hole washing 3 times.Contain 1mU N-Glycosylase (EMD Biosciences, La Jolla, 10 mM NH CA) by adding 30ul ₄HCO ₃(pH8.3) make the de-glycosylation of IgG albumen.After 16 hours, remove the solution that contains glycan 37 ℃ of reactions by centrifugal, and concentrate drying.Dry glycan in each hole is dissolved in the 15 μ l water, and with 0.5 μ l point sample in the stainless steel sample panel, mix with 0.5 μ l S-DHB substrate (9mg/ml resorcylic acid/1mg/ml of 5-methoxyl group-Whitfield's ointment is dissolved in 1: 1 water/acetonitrile/0.1% trifluoroacetic acid), and carry out drying.Pass through radiation by pulse nitrogen laser (337nm) with the burst length of 4-ns and produce ion.Pattern is drawn in the delay that this instrument postpones with 125-ns and acceleration voltage is that 20kV operates.Line voltage is 93.00%, and wire voltage is 0.1%, internal pressure＜5 * 10 ^-7Torr (1torr=133Pa), low molecule threshold is 75 Da.From 100-200 laser pulse, produce spectrum, and obtain spectrum by the 500-MHz quanxtizer.With (Man) ₅(GlcNAc) ₂Oligosaccharides is as foreign molecules amount standard.All spectrum obtains under cation mode with instrument.

Embodiment 6

Antigen bonded ELISA detection method

With being dissolved in PBS, the antigen coated height of the 10ug among the pH7.4 is in conjunction with microwell plate (Costar), and 4 ℃ are spent the night.Remove damping fluid, add sealing damping fluid (PBS that contains 3%BSA), then room temperature incubation 1 hour.Remove the deblocking damping fluid, plate is washed 3 times with PBS.The last time after the washing, add from 0.2ng to 100ng the antibody purification of increasing amount gradually, room temperature incubation 1 hour.Use PBS+0.05%Tween 20 wash plate then.After the washing, adding is dissolved in 1: 2000 anti-people Fc-HRP in the PBS solution the last time, and the room temperature incubation is 1 hour then.With PBS-Tween 20 plate is washed 4 times then.(PierceBiotechnology) comes analysis plates according to specification sheets with the tmb substrate test kit.

Fc receptors bind detection method

According to the program of former description to Fc γ RIIb, Fc γ RIIIa and FcyRIIIb carry out Fc receptors bind detection method (Shields et al., 2001, J.Biol.Chem, 276:6591-6604).To Fc γ RIII combination: at 4 ℃, with being dissolved in 1 μ g/ml Fc γ RIIIb (Fig. 5) among the PBS and F γ RIIb (Fig. 7) fusion rotein or 0.8 μ g/ml Fc γ RIIIa-LF (Fig. 6) fusion rotein bag by elisa plate (Nalge-Nunc, Naperville, IL) 48 hours.Plate was sealed 1 hour at 25 ℃ with the PBS that contains 3% bovine serum albumin (BSA).F (Ab ') with JC-IgG or DX-IgG and HRP-coupling connection ₂Anti-F (Ab ') ₂Mixed 1 hour at 25 ℃ with 2: 1 molar weights, thereby preparation is dissolved in JC-IgG or DX-IgG dimer mixture among the PBS that contains 1%BSA.Then with the dimer mixture in 1%BSA/PBS with 1: 2 serial dilution, and, wrap onboard by 1 hour at 25 ℃.Used substrate is 3,3 ', 5,5 '-tetramethyl benzidine (TMB) (Vector Laboratories).Read the absorption value (Vector Laboratories) at 450nm place according to the instrument specification sheets.

The ELISPOT detection method of antibody feedback in the B cell

This detection method is according to Westman, et al., and 1997, Scand.J.Immunol.46:10-15 is described to carry out.At first, obtain the BSA-IgG mixture with BSA (bovine serum albumin) and IgG antibody coupling connection.Measure the cell number of the special IgG of secretion BSA by the ELISPOT detection method.From the mouse of injection, remove spleen, at the DMEM that contains 0.5% normal mouse serum (Gibco, NewYork) middle preparation cell suspension.100 microlitre cell suspensions are added in the microwell plate (referring to as above ELISA program) of BSA bag quilt, at 37 ℃, 5%CO ₂Incubation is 3.5 hours under the condition.Wash plate, and with the sheep anti-mouse igg of the 50 μ l couplings connection alkaline phosphatase that is dissolved among the PBS-Tween 1/100 dilution at 4 ℃ of incubations.Under the room temperature, in 50 μ l 5-bromo-, 3 chloro-indyl (indoyl) phosphoric acid (Sigma-Aldrich), sample was developed the color 1 hour, and under stereoscopic microscope, count.

Embodiment 7

Heme organon (for example B cell consumption) is measured ADCC.As Vugmeyster andHowell, 2004, Int.Immunopharm.4:1117-1124 is described.To not have whole blood regeneration in dyeing damping fluid (Hank ' s balanced salt solution (HBSS) that contains 1%BSA and 0.1% sodium azide) of blood plasma and red corpuscle (RBCs), white corpuscle is suspended in the dyeing damping fluid.With centrifugal 5 minutes of whole blood sample 1000g, remove supernatant (blood plasma) then, precipitation is with ammonium chloride cracking (ACL) agent treated, washing, and be resuspended in isopyknic dyeing damping fluid. B-is thin Born of the same parents consume detection method:10 μ l, 100 μ g/ml antibody-solutions or dyeing damping fluid are added in the 90 μ l SB substrates 37 ℃ of incubations 1 hour.Sample was dyeed 30 minutes at 25 ℃ with anti--CD 19-FITC and anti--CD45-PE immediately.Then that sample is fixing in 1% formaldehyde, carry out 3 times and repeat.Measure the amount of B cell consumption by the flow cytometry method. The flow cytometry of B cell consumption Number is analyzed:FACS Calibur (BDBiosciences) the instrumental analysis all samples of sample and cell counting software is gone up in use with automatic FACS.Hematimeter QC and setting comprise successive CaliBrite microballoon and SpheroTech color micro-sphere (BD Biosciences), with the function of validation instrument and the linearity of detector.Operation isotype and compensation contrast in each the detection are with the setting of validation instrument.Obtain the per-cent of B cell in the total lymphocyte by following gate strategy.Lymphocyte populations is labeled as direct scattering/sidewise scattered scattering spectra, is defined as zone 1 (R1).According to the incident among the R1, fluorescence intensity point district shows as CD 19 and CD45 marker.With fluorescently-labeled isotype blank determination CD19 and the stagnation point separately of the CD45 positive.Measure %B with CellQuest, be expressed as have the CD19-positive in the R1 zone, the percentage ratio of the cell of the positive phenotype of CD45-.Each treatment group is carried out repeat samples 3 times.Use formula: average [(%B/ that l-handles with control antibodies average [with the %B of SB processing] calculates the per-cent of B cell consumption to 100*. Fluorescence beam material discharges the ADCC detection method; PBMC separates: at heparin tube (Becton Dickinson Vacutainer Systems, Rutherford, NJ, USA) the middle peripheric venous blood (10-20) of collecting healthy individual or blood donor of heparinization.2 mouse of infusing need 5ml blood approximately.By OptiPrep according to specification sheets by centrifugation peripheral blood lymphocytes (BMCs).With containing RPMI 1640,2mM L-L-glutamic acid, 100IU/ml penicillin, l00g/ml Streptomycin sulphate (Gibco/BRL), the perfect medium (CM) of adding 20% foetal calf serum washs PBMCs once, is resuspended in then among the CM, and concentration is 1 * 10 ⁶/ ml, and transfer to the 250ml culturing bottle (Falcon, NJ, USA) in, carry out monocyte consumption.At 37 ℃, 5%CO ₂Following incubation 1 hour is collected not attached cell, and with the substratum washing once, it is 25 * 100 that peripheral blood lymphocyte (PRLs) is adjusted concentration ⁷/ ml CM. Fluorescence beam material discharges ADCCPrerequisite after the ADCC detection method is can stimulate Fc γ receptors bind on target cell and the effector cell with CD20 or CD40 antigen presentation target cell (being respectively Raji clone or BCLl-3B3 cell) bonded antibody.This can promote to present the cracking of CD20 or the antigenic target cell of CD40 conversely, and release can quantitative inner fluorescence dye.With Alamar-blue fluorescence surrogate markers ⁵¹The target cell of Cr in 96 hole tissue culturing plates, is presented Raji cell suspension (1 * 10 with 50ul CD20- ⁴Cell)-DX-IgG anti-with 50ul or anti--JC-IgG mAb (various concentration) and the isolating as mentioned above PBMC effector cell of 50ul mix (ratio of effector cell and target cell is 100: 1,50: 1,25: 1 and 12.5: 1), 37 ℃, 5%CO ₂Following incubation was beneficial to the cracking of Raji or BCL1-3B3 cell in 4 hours.Add 50 μ l Alamar blue, continued incubation 5 hours, dyestuff is absorbed and is metabolised to the fluorescence state.On vibrator, plate is cooled to room temperature, in luminoscope, reads and excite 530nm, the fluorescent value of emission 590nm.With the concentration mapping of relative fluorescence unit (RFU) and mAb, from control antibodies, the concentration of calculation sample in the typical curve of Rituximab  for example. With Reconstruction in Sever Combined Immunodeciency (SCID) mouse body The interior ADCC that detects(Niwa et al., 2004, Cancer Research, 64:2127-2133).Human peripheral blood mononuclear cell's (PMBCs) that can be by transplanting the healthy blood donor mouse model is measured intravital ADCC activity, comprises allos (Fc γ RIIIa-LF/Fc γ RIIIa-LV) and homology (Fc γ RIIIa-LV/Fc γ RIIIa-LV and Fc γ RIIIa-LF/Fc γ RIIIa-LF) genotype.Detect with this model system, compare with Rituximab  or any other control antibodies, the Igs that mainly contains the N-glycan has enhanced ADCC activity.The detailed procedure of ADCC detection method is referring to Niwa et al. in this body, and 2004, the same.

Sequence table

SEQ ID NO:01 (the chimeric IgG1 light chain of mouse/people)

caatcgtcttgtctcaatccccagctattttgtctgctccccctggagagaaggtcaccatgacttgtagagcctcttcctctgt

ctcttacattcactggttccagcaaaagccaggttcctctccaaagccatggacctacgctacttccaacttggcttccggtgtt

ccagttagattctctggttctggttccggtacctcctactctcttaccatctccagagagaagccgaggacgctgctacttact

actgtcagcaatggacttctaacccaccaactttcggtggtggtaccaaattggagattaagagaactgttgctgctccatcc

gttttcattttcccaccatccgacgaacaattgaagtctggtacagcttccgttgtttgtttgttgaacaacttctacccaagaga

ggctaaggttcagtggaaggttgacaacgctttgcaatccggtaactcccaagaatccgttactgagcaggattctaaggatt

ccacttactccttgtcctccactttgactttgtccaaggctgattacgagaagcacaaggtttacgcttgtgaggttacacatca

gggtttgtcctccccagttactaagtccttcaacagaggagagtgttaa

SEQ ID NO:02 (the chimeric IgG1 heavy chain of mouse/people)

caagtccagttgcaacagcctggtgccgagttggtcaagccaggtgcttctgttaagatgtcctgtaaggcttctggttacact

ttcacctcctacaacatgcactgggtcaagcaaatccasstagaggtttggagtggttggtgccatctacccaggtaacgg

tgacacttcttacaaccaaaaattcaagggaaaggctactcttaccgctgataagtcctcttccaccgcctatcatgcaattgtot

tccttgacttctgaagattctgctgtttactactgtgctagatccacctactncggtggagactggtacttcaacgtttggggtgc

tggtaccactgtcaccgtttccgctgcttctactaagggaccatccgtttttccattsgctccatcctctaagtctacttccggtg

gtactgctgctttgggatgtttggttaaggactacttcccagagcctgttactgtttcttggaactccggtgctttgacttctggtg

ttcacactttcccagctgttttgcaatcttccggtttgtactccttgtcctccgttgttactgttccatcctcttccttgggtactcaga

cttacatctgtaacgttaaccacaagccatccaacactaaggttgacaagaaggctgagccaaagtcctgtgacaagacac

atacttgtccaccatgtccagctccagaattgttgggtggtccatccgttttcttgttcccaccaaagccaaaggacactttgat

gatctccagaactccagaggttacatgtgttgttgttgacgtttctcacgaggacccagaggttaagttcaactggtacgttga

cggtgttgaagucacaacgctaagactaagccaagagaggagcagtacaactccacttacagagttgtttccgttttgactg

ttttgcaccaggattggttgaacggaaaggagtacaagtgtaaggtttccaacaaggctttgccagctccaatcgaaaagac

tatciccaaggctaagggtcaaccaagagagccacaggtttactttgccaccatccagagatgagttgactaagaacca

ggtttccttgacttgtttggttaaaggattctacccatccgacattgctgttgagtgggaatctaacggtcaaccagagaacaa

ctacaagactactccaccagttttggattctgacggttccttcttcttgtactccaagttgactgttgacaagtccagatggaaca

gggtaacgttttctcctgttccgttatgcalgaggctttgcacaaccactacactcaaaagtccttgtctttgtccccaggtaagt

aa

SEQ ID NO:03 (the constant region of light chain IgG1 of team)

agaaccgttgctgctccatccgttttcattttcccaccatccgacgaacaattgaagtctggtacagcttccgttgtttgtttgttg

aacaacttctacccaagagaggctaaggttcagtggaaggttgacaacgctttgcaatccggtaactcccaagaatccgtta

ctgagcaggattctaaggattccacttactccttgtcctccactttgacttgtccaaggctgattacgagaagcacaaggttca

cgcttgtgaggttacacatcagggtttttcctccccagttactangtccttcaacagaggagagtgttaa

SEQ ID NO:04 (the CH IgG1 of team)

tctactaagggaccatccgtttttccattggctccatcctctugtctacttccggtggtactgctgctttgggatgtttggttaag

gactacttcccagagcctgttactgtttcttggaactccggtgctttgacttctggtgttcacactttcccagctgttttgcaatctt

ccggtttgtactccttgtcctccgttgttactgttccatcctcttccttgggtactcagacttacatctgtaacgttaaccacaagc

catccaacactaaggttgacaagaaggctgagccaaagtcctgtgacaagacacatacttgtccatgtccagatccag

aattgttgggtggtccatccgttttcttgttcccaccaaagccaaaggacactttgatgatctccagaactccagaggttacatg

tgttgttgttgacgtttctcacgasgacccagaggttaagttcaactggtacgttgacggtgttgaagttcacaacgctaagac

taagccaagagaggagcagtacaactccacttacagagttgtttccgttttgactgttttgcaccaggattggttgaacggaa

aggagtacaagtgtaaggtttccaacaaggctttgccagctccaatcgaaaagactatctccaaggctaagggtcaaccaa

gagagccacaggtttacactttgccaccatccagagatgagttgactaagaaccaggtttccttgacttgtttggttaaaggat

tctacccatccgacangctgttgagtgggaatctaacggtcaaccagagaacaactacaagactactccaccagttttggat

tctgacggttccttcttcttgtactccaagttgacttgttgacaagtccagatggaacagggtaacgttttctcctgttccgttatgc

atgaggctttgcacaaccactacactcaaaagtccttgtctttgtccccaggtaagtaa

SEQ?ID?NO：05(CD20LF1)

aggagtcgtattcaaatcgtcttgtctcaatccccagctattttg

SEQ?ID?NO：06(CD20LF2)

tctgcttcccctggagagaaggtcaccatgacttgtagagcctct

SEQ?ID?NO：07(CD20LF3)

tcctctgtctcttacattcactggttccagcaaaagccaggttcc

SEQ?ID?NO：08(CD20LF4)

tctccaaagccatggatctacgctacttccaacttggcttccggt

SEQ?ID?NO：09(CD20LF5)

gttccagttagattctctggttctggttccggtacctcctactct

SEQ?ID?NO：10(CD20LF6)

cttaccatctccagagttgaagccgaggacgctgctacttactac

SEQ?ID?NO：11(CD20LF7)

tgtcagcaatggacttctaacccaccaactttcggtggtggtacc

SEQ?ID?NO：12(CD20LF8)

aaattggagattaagagaactgttgctgctccatcc

SEQ?ID?NO：13(CD20LR1)

caacagttctcttaatctccaatttggtaccaccaccgaaagttg

SEQ?ID?NO：14(CD20LR2)

gtgggttagaagtccattgctgacagtagtaagtagcagcgtcct

SEQ?ID?NO：15(CD20LR3)

cggcttcaactctggagatggtaagagagtaggaggtaccggaac

SEQ?ID?NO：16(CD20LR4)

agaaccagagaatctaactggaacaccggaagccaagttggaag

SEQ?ID?NO：17(CD20LR5)

tagcgtagatccatggctttggagaggaacctggcttttgctgga

SEQ?ID?NO：18(CD20LR6)

ccagtgaatgtaagagacagaggaagaggctctacaagtcatgg

SEQ?ID?NO：19(CD20tR7)

tgaccttctctccaggggaagcagacaaaatagctggggattgag

SEQ?ID?NO：20(CD20L/up)

aggagtcgtattcaaatcgtc

SEQ?ID?NO：21(LfusionRTVAAPS/up)

agaactgttgctgctccatcc

SEQ?ID?NO：22(LfusionRTVAAPS/lp)

ggatggagcagcaacagttc

SEQ?ID?NO：23(CD20L/lp)

ctggtaccttaacactctcctctgttgaag

SEQ?ID?NO：24(CD20HF1)

aggagtcgtattcaagtccagttgcaacagcctggtgccgagttg

SEQ?ID?NO：25(CD20HF2)

gtcaagccaggtgcttctgttaagatgtcctgtaaggcttctggt

SEQ?ID?NO：26(CD20HF3)

tacactttcacctcctacaacatgcactgggtcaagcaaactcca

SEQ?ID?NO：27(CD20HF4)

ggtagaggtttggagtggattggtgccatctacccaggtaacggt

SEQ?ID?NO：28(CD20HF5)

gacacttcttacaaccaaaaattcaagggaaaggctactcttacc

SEQ?ID?NO：29(CD20HF6)

gctgaataagtcctcttccaccgcctacatgcaattgtcttccttg

SEQ?ID?NO：30(CD20HF7)

acttctgaagactctgctgtttactactgtgctagatccacctac

SEQ?ID?NO：31(CD20HF8)

tacggtggagactggtacttcaacgtttggggtgctggtaccact

SEQID?NO：32(CD20HF9)

gtcaccgtttccgctgcttctactaagggaccatcc

SEQ?ID?NO：33(CD20HR1)

tagtagaagcagcggaaacggtgacagtggtaccagcaccccaaa

SEQ?ID?NO：34(CD20HR2)

cgttgaagtaccagtctccaccgtagtaggtggatctagcacag

SEQ?ID?NO：35(CD20HR3)

agtaaacagcagagtcttcagaagtcaaggaagacaattgcatgt

SEQ?ID?NO：36(CD20HR4)

aggcggtggaagaggacttatcagcggtaagagtgcctttccct

SEQ?ID?NO：37(CD20HR5)

tgaatttttggttgtaagaagtgtcaccgttacctgggtagatgg

SEQ?ID?NO：38(CD20HR6)

caccaatccactccaaacctctacctggagtttgcttgacccagt

SEQ?ID?NO：39(CD20HR7)

gcatgttgtaggaggtgaaagtgtaaccagaagccttacaggaca

SEQ?ID?NO：40(CD20HR8)

tcttaacagaagcacctggcttgaccaactcggcaccaggctgtt

SEQ?ID?NO：41(CD20H/up)

Aggagtcgtattcaagtccag

SEQ?ID?NO：42?(HchainASTKGPs/up)

gcttctactaagggaccatcc

SEQ?ID?NO：43(HchainASTKGPs/lp)

ggatggtcccttagtagaagc

SEQ?ID?NO：44(HFckpnl/lp)

ctggtattacttacctggggacaaagac

SEQ ID NO:45 (has EcoRIThe Kar2 signal sequence)

g aattcgaaacgatgctgtcgttaaaaccatcttggctgactttggcggcattaatgtatgccatgctattggtcgtagtgccat

ttgctaaacctgttagagct

SEQ?ID?NO：46(P.BiPss/UP1-EcoRI)

aattcgaaacgatgctgtctttgaagccatcttggcttactttggctgctttgatgtacgctatgctttt

SEQ?ID?NO：47(P.BiPss/LP1)

ccaaagtaagccaagatggcttcaaagacagcatcgtttcg

SEQ?ID?NO：48(P.BiPss/UP2)

ggttgttgttccatttgctaagccagttagagct

SEQ?ID?NO：49(P.BiPss/LP2)

agctctaactggcttagcaaatggaacaacaaccaaaagcatagcgtacatcaaagcag

SEQ?ID?NO：50(GenBank#AF013576)

gatgctgttatgactcaaaacccattgtctttgcctgtttctcttggtgatgaagcttctatttcttgtagatcctctcaatctttgga

aaactctaacggtaacactttcttgaactggttctttcagaagccaggtcaatctccacaattgttgatttacagagtttctaaca

gattttctggtgttccagatagattttctggttctggttctggtactgatttcactttgaagatttctagagttgaagctgaagatttg

ggtgtttacttctgtttgcaagttactcatgttccatacacttttggtggtggtactactttggaaattaagagaactgttgctgctc

catctgtcttcatctttccaccatctgatgaacaattgaagtctggtactgcttctgttgtttgtcttcttaacaacttctacccaaga

gaagctaaggttcagtggaaggttgataacgctttgcaatctggtaactctcaagaatctgttactgaacaagattctaaggat

tctacttactctttgtcttctactttgactttgtctaaggctgattacgaaaagcataaggtttacgcttgtgaagttactcatcaag

gtttgtcttctccagttactaagtcctttaacagaggtgaatgttag

SEQ?ID?NO：51(GenBank#AF013577)

gatattcaattgcaacaatctggtccaggtttggttaagccatctcaatctttgtctttgacttgttctgttactggttactctattact

actaactacaactggaactggattagacaatttccaggtaacaagttggaatggatgggttacattagatacgatggtacttct

gaatacaccccatctttgaagaacagagtttctattactagagatacttctatgaaccaattcttcttgagattgacttctgttactc

cagaagatactgctacttactactgtgctagattggattactggggtcaaggtacttctgttactgtttcttctgcttctactaagg

gtccatctgtttttccacttgctccatcttctaagtctacttctggtggtactgctgctttgggttgtttggttaaggattactttccag

aaccagttactgtttcttggaactctggtgctttgacttctggtgttcatacttttccagctgttttgcaatcttctggtttgtactcttt

gtcttctgttgttactgttccatcttcttctttgggtactcaaacttacatttgtaacgttaaccataagccatctaacactaaggttg

ataagagagttgaaccaaaatcttgtgataaaactcatacatgtccaccatgtccagctcctgaacttctgggtggaccatca

gttttcttgttcccaccaaaaccaaaggatacccttatgatttctagaactcctgaagtcacatgtgttgttgttgatgtttctcatg

aagatcctgaagtcaagttcaactggtacgttgatggtgttgaagttcataatgctaagacaaagccaagagaagaacaata

caactctacttacagagttgtctctgttcttactgttctgcatcaagattggctgaatggtaaggaatacaagtgtaaggtctcca

acaaagctcttccagctccaattgagaaaaccatttccaaagctaaaggtcaaccaagagaaccacaagtttacaccttgcc

accatccagagatgaactgactaagaaccaagtctctctgacttgtctggttaaaggtttctatccatctgatattgctgttgaat

gggagtctaatggtcaaccagaaaacaactacaagactactcctcctgttctggattctgatggttccttcttcctttactctaag

cttactgttgataagtccagatggcaacaaggtaacgtcttctcatgttccgttatgcatgaagctttgcataaccattacactca

gaagtctctttccctgtctccaggtaaataa

SEQ?ID?NO：52?mh285L-1?cggaattc-

gatgctgttatgactcaaaacccattgtctttgcctgtttctcttggtga

tgaagcttctatttcttgtag

SEQ?ID?NO：53?mh285L-2

agaaccagttcaagaaagtgttaccgttagagttttccaaagattgagaggatctacaagaaatagaagcttcat

SEQ?ID?NO：54?mh285L-3

actttcttgaactggttctttcagaagccaggtcaatctccacaattgttgatttacagagtttctaacagattt

SEQ?ID?NO：55?mh285L-4

caaagtgaaatcagtaccagaaccagaaccagaaaatctatctggaacaccagaaaatctgttagaaactctgta

SEQ?ID?NO：56?mh285L-5

tctggtactgatttcactttgaagatttctagagttgaagctgaagatttgggtgtttacttctgtttgcaagttac

SEQ?ID?NO：57?mh285L-6

caacagttctcttaatttccaaagtagtaccaccaccaaaagtgtatggaacatgagtaacttgcaaacagaagtaa

SEQ?ID?NO：58mh285L-7

tggaaattaagagaactgttgctgctccatctgtcttcatctttccaccatctgatgaacaattgaagtctggta

SEQ?ID?NO：59?mh285L-8

tgaaccttagcttctcttgggtagaagttgttaagaagacaaacaacagaagcagtaccagacttcaattgttcat

SEQ?ID?NO：60?mh285L-9

cccaagagaagctaaggttcagtggaaggttgataacgctttgcaatctggtaactctcaagaatctgttactgaa

SEQ?ID?NO：61?mh285L-10

ccttagacaaagtcaaagtagaagacaaagagtaagtagaatccttagaatcttgttcagtaacagattcttgaga

SEQ?ID?NO：62?mh285L-11

ctactttgactttgtctaaggctgattacgaaaagcataaggtttacgcttgtgaagttactcatcaaggtttgtc

SEQ?ID?NO：63?mh285L-12

ggggtaccctaacattcacctctgttaaaggacttagtaactggagaagacaaaccttgatgagtaac

SEQ?ID?NO：64?mh285H-1

cggaattc-gatattcaattgcaacaatctggtccaggtttggttaagccatctcaatctttgtctttgacttgttctg

SEQ?ID?NO：65?mh285H-2

ggaaattgtctaatccagttccagttgtagttagtagtaatagagtaaccagtaacagaacaagtcaaagacaaag

SEQ?ID?NO：66?mh285H-3

aactggattagacaatttccaggtaacaagttggaatggatgggttacattagatacgatggtacttctgaatac

SEQ?ID?NO：67?mh285H-4

attggttcatagaagtatctctagtaatagaaactctgttcttcaaagatggggtgtattcagaagtaccatcgta

SEQ?ID?NO：68?mh285H-5

gagatacttctatgaaccaattcttcttgagattgacttctgttactccagaagatactgctacttactactgtgc

SEQ?ID?NO：69?mh285H-6

agtagaagcagaagaaacagtaacagaagtaccttgaccccagtaatccaatctagcacagtagtaagtagcagta

SEQ?ID?NO：70mh285H-7

ctgtttcttctgcttctactaagggtccatctgtttttccacttgctccatcttctaagtctacttctggtggta

SEQ?ID?NO：71?mh285H-8

gaaacagtaactggttctggaaagtaatccttaaccaaacaacccaaagcagcagtaccaccagaagtagactta

SEQID?NO：72?mh285H-9

tccagaaccagttactgtttcttggaactctggtgctttgacttctggtgttcatacttttccagctgttttgcaa

SEQ?ID?NO：73?mh285H-10

ccaaagaagaagatggaacagtaacaacagaagacaaagagtacaaaccagaagattgcaaaacagctggaaaagt

SEQ?ID?NO：74?mh285H-11

ctgttccatcttcttctttgggtactcaaacttacatttgtaacgttaaccataagccatctaacactaaggttga

SEQ?ID?NO：75?mh285H-12

tgtatgagttttatcacaagattttggttcaactctcttatcaaccttagtgttagatgg

SEQ?ID?NO：76Fc-1

5’gctgaaccaaaatcttgtgataaaactcatacatgtccaccatgtccagctcctgaacttctgggtggaccatcagtttt?3’

SEQ?IDNO：77?Fc-2

5’atgtgacttcaggagttctagaaatcataagggtatcctttggttttggtggtgggaacaagaaaactgatggtccacccaga

3’

SEQ?ID?NO：78Fc-3

5’ctagaacccctgaagtcacatgtgttgttgttgatgtttctcatgaagatcctgaagtcaagttcaactggtacgttgat3’

SEQ?ID?NO：79?Fc-4

5’taagtagagttgtattgttcttctcttggctttgtcttagcattatgaacttcaacaccatcaacgtaccagttgaactt3’

SEQ?ID?NO：80?Fc-5

5’agaacaatacaactctacttacagagttgtctctgttcttactgttctgcatcaagattggctgaatggtaaggaataca?3’

SEQ?ID?NO：81?Fc-6

5’agctttggaaatggttttctcaattggagctggaagagctttgttggagaccttacacttgtattccttaccattcagcc?3’

SEQ?ID?NO：82?Fc-7

5’gagaaaaccatttccaaagctaaggtcaaccaagagaaccacaagttttacaccttgccaccatccagagatgaactga

c?3’

SEQ?ID?NO：83?Fc-8

5’cagcaatatcagatggatagaaacctttaaccagacaagtcagagagacttggttcttagtcagttcatctctggatggt

3’

SEQ?ID?NO：84?Fc-9

5’tctatccatctgatattgctgttgaatgggagtctaatggtcaaccagaaaacaactacaagactactcctcctgttctg?3t

SEQ?ID?NO：85Fc-10

5’tgccatctggacttatcaacagtaagcttagagtaaaggaagaaggaaccatcagaatccagaacaggaggagtagtct

t?3’

SEQ?ID?NO：86Fc-11

5’tgttgataagtccagatggcaacaaggtaacgtcttctcatgttccgttatgcatgaagctttgcataaccattacactc?3’

SEQ?ID?NO：87?Fc-12

5’ttatttacctggagacagggaaagagacttctgagtgtaatggttatgcaaag?3’

SEQ?ID?NO：88Fc/LP5

5’ggggtaccttatttacctggagacagggaaagagacttct?3’

SEQ ID NO:89 (human serum albumin, HSA)

atgaagtgggtacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagt

gaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagt

gtccatttgaagatcatgtaaaattagtgaatgaagtaactgaatttgcaaaaacatgtgttgctgatgagtcagctgaaaattg

tgacaaatcacttcataccctttttggagacaaattatgcacagttgcaactcttcgtgaaacctatggtgaaatggctgactgc

tgtgcaaaacaagaacctgagagaaatgaatgcttcttgcaacacaaagatgacaacccaaacctcccccgattggtgaga

ccagaggttgatgtgatgtgcactgcttttcatgacaatgaagagacatttttgaaaaaatacttatatgaaattgccagaagac

atccttacttttatgccccggaactccttttctttgctaaaaggtataaagctgcttttacagaatgttgccaagctgctgataaag

ctgcctgcctgttgccaaagctcgatgaacttcgggatgaagggaaggcttcgtctgccaaacagagactcaagtgtgcca

gtctccaaaaatttggagaaagagctttcaaagcatgggcagtagctcgcctgagccagagatttcccaaagctgagtttgc

agaagtttccaagttagtgacagatcttaccaaagtccacacggaatgctgccatggagatctgcttgaatgtgctgatgaca

gggcggaccttgccaagtatatctgtgaaaatcaagattcgatctccagtaaactgaaggaatgctgtgaaaaacctctgttg

gaaaaatcccactgcattgccgaagtggaaaatgatgagatgcctgctgacttgccttcattagctgctgattttgttgaaagt

aaggatgtttgcaaaaactatgctgaggcaaaggatgtcttcctgggcatgtttttgtatgaatatgcaagaaggcatcctgat

tactctgtcgtgctgctgctgagacttgccaagacatatgaaaccactctagagaagtgctgtgccgctgcagatcctcatga

atgctatgccaaagtgttcgatgaatttaaacctcttgtggaagagcctcagaatttaatcaaacaaaattgtgagctttttgag

cagcttggagagtacaaattccagaatgcgctattagttcgttacaccaagaaagtaccccaagtgtcaactccaactcttgt

agaggtctcagaaacctaggaaaagtgggcagcaaatgttgtaaacatcctgaagcaaaaagaatgccctgtgcagaag

SEQ ID NO:90 (zymoplasm site)

ctcgagcccggcggcggcggcggccgcctggttcctcgtggcttcggtacc

Sequence table

<110>GlycoFi，Inc.

Gerngross，Tillman?U.

Li，Huijuan

Wildt，Stefan

＜120〉mainly contain the immunoglobulin (Ig) of GALGLCNACMAN5GLCNAC2 sugar shape

<130>GF0018Y

<140>PCT/US05/025663

<141>2005-07-19

<150>60/639,657

<151>2004-12-23

<150>60/639,698

<151>2004-12-23

<160>90

<170>FastSEQ?for?Windows?Version?4.0

<210>1

<211>642

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the chimeric IgG1 sequence of light chain of synthetic people/mouse

<400>1

caaatcgtct?tgtctcaatc?cccagctatt?ttgtctgctt?cccctggaga?gaaggtcacc?60

atgacttgta?gagcctcttc?ctctgtctct?tacattcact?ggttccagca?aaagccaggt?120

tcctctccaa?agccatggat?ctacgctact?tccaacttgg?cttccggtgt?tccagttaga 180

ttctctggtt?ctggttccgg?tacctcctac?tctcttacca?tctccagagt?tgaagccgag 240

gacgctgcta?cttactactg?tcagcaatgg?acttctaacc?caccaacttt?cggtggtggt 300

accaaattgg?agattaagag?aactgttgct?gctccatccg?ttttcatttt?cccaccatcc 360

gacgaacaat?tgaagtctgg?tacagcttcc?gttgtttgtt?tgttgaacaa?cttctaccca 420

agagaggcta?aggttcagtg?gaaggttgac?aacgctttgc?aatccggtaa?ctcccaagaa 480

tccgttactg?agcaggattc?taaggattcc?acttactcct?tgtcctccac?tttgactttg 540

tccaaggctg?attacgagaa?gcacaaggtt?tacgcttgtg?aggttacaca?tcagggtttg 600

tcctccccag?ttactaagtc?cttcaacaga?ggagagtgtt?aa 642

<210>2

<211>1354

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the chimeric IgG1 sequence of heavy chain of synthetic people/mouse

<400>2

caagtccagt?tgcaacagcc?tggtgccgag?ttggtcaagc?caggtgcttc?tgttaagatg 60

tcctgtaagg?cttctggtta?cactttcacc?tcctacaaca?tgcactgggt?caagcaaact 120

ccaggtagag?gtttggagtg?gttggtgcca?tctacccagg?taacggtgac?acttcttaca 180

accaaaaatt?caagggaaag?gctactctta?ccgctgataa?gtcctcttcc?accgcctaca 240

tgcaattgtc?ttccttgact?tctgaagatt?ctgctgttta?ctactgtgct?agatccacct 300

actacggtgg?agactggtac?ttcaacgttt?ggggtgctgg?taccactgtc?accgtttccg 360

ctgcttctac?taagggacca?tccgtttttc?cattggctcc?atcctctaag?tctacttccg 420

gtggtactgc?tgctttggga?tgtttggtta?aggactactt?cccagagcct?gttactgttt 480

cttggaactc?cggtgctttg?acttctggtg?ttcacacttt?cccagctgtt?ttgcaatctt 540

ccggtttgta?ctccttgtcc?tccgttgtta?ctgttccatc?ctcttccttg?ggtactcaga 600

cttacatctg?taacgttaac?cacaagccat?ccaacactaa?ggttgacaag?aaggctgagc 660

caaagtcctg?tgacaagaca?catacttgtc?caccatgtcc?agctccagaa?ttgttgggtg 720

gtccatccgt?tttcttgttc?ccaccaaagc?caaaggacac?tttgatgatc?tccagaactc 780

cagaggttac?atgtgttgtt?gttgacgttt?ctcacgagga?cccagaggtt?aagttcaact 840

ggtacgttga?cggtgttgaa?gttcacaacg?ctaagactaa?gccaagagag?gagcagtaca 900

actccactta?cagagttgtt?tccgttttga?ctgttttgca?ccaggattgg?ttgaacggaa 960

aggagtacaa?gtgtaaggtt?tccaacaagg?ctttgccagc?tccaatcgaa?aagactatct 1020

ccaaggctaa?gggtcaacca?agagagccac?aggtttacac?tttgccacca?tccagagatg 1080

agttgactaa?gaaccaggtt?tccttgactt?gtttggttaa?aggattctac?ccatccgaca 1140

ttgctgttga?gtgggaatct?aacggtcaac?cagagaacaa?ctacaagact?actccaccag 1200

ttttggattc?tgacggttcc?ttcttcttgt?actccaagtt?gactgttgac?aagtccagat 1260

ggaacagggt?aacgttttct?cctgttccgt?tatgcatgag?gctttgcaca?accactacac 1320

tcaaaagtcc?ttgtctttgt?ccccaggtaa?gtaa 1354

<210>3

<211>324

<212>DNA

<213>Homo?Sapiens

<400>3

agaactgttg?ctgctccatc?cgttttcatt?ttcccaccat?ccgacgaaca?attgaagtct 60

ggtacagctt?ccgttgtttg?tttgttgaac?aacttctacc?caagagaggc?taaggttcag 120

tggaaggttg?acaacgcttt?gcaatccggt?aactcccaag?aatccgttac?tgagcaggat 180

tctaaggatt?ccacttactc?cttgtcctcc?actttgactt?tgtccaaggc?tgattacgag 240

aagcacaagg?tttacgcttg?tgaggttaca?catcagggtt?tgtcctcccc?agttactaag 300

tccttcaaca?gaggagagtg?ttaa 324

<210>4

<211>989

<212>DNA

<213>Homo?Sapiens

<400>4

tctactaagg?gaccatccgt?ttttccattg?gctccatcct?ctaagtctac?ttccggtggt 60

actgctgctt?tgggatgttt?ggttaaggac?tacttcccag?agcctgttac?tgtttcttgg 120

aactccggtg?ctttgacttc?tggtgttcac?actttcccag?ctgttttgca?atcttccggt 180

ttgtactcct?tgtcctccgt?tgttactgtt?ccatcctctt?ccttgggtac?tcagacttac 240

atctgtaacg?ttaaccacaa?gccatccaac?actaaggttg?acaagaaggc?tgagccaaag 300

tcctgtgaca?agacacatac?ttgtccacca?tgtccagctc?cagaattgtt?gggtggtcca 360

tccgttttct?tgttcccacc?aaagccaaag?gacactttga?tgatctccag?aactccagag 420

gttacatgtg?ttgttgttga?cgtttctcac?gaggacccag?aggttaagtt?caactggtac 480

gttgacggtg?ttgaagttca?caacgctaag?actaagccaa?gagaggagca?gtacaactcc 540

acttacagag?ttgtttccgt?tttgactgtt?ttgcaccagg?attggttgaa?cggaaaggag 600

tacaagtgta?aggtttccaa?caaggctttg?ccagctccaa?tcgaaaagac?tatctccaag 660

gctaagggtc?aaccaagaga?gccacaggtt?tacactttgc?caccatccag?agatgagttg 720

actaagaacc?aggtttcctt?gacttgtttg?gttaaaggat?tctacccatc?cgacattgct?780

gttgagtggg?aatctaacgg?tcaaccagag?aacaactaca?agactactcc?accagttttg?840

gattctgacg?gttccttctt?cttgtactcc?aagttgactg?ttgacaagtc?cagatggaac?900

agggtaacgt?tttctcctgt?tccgttatgc?atgaggcttt?gcacaaccac?tacactcaaa?960

agtccttgtc?tttgtcccca?ggtaagtaa 989

<210>5

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>5

aggagtcgta?ttcaaatcgt?cttgtctcaa?tccccagctattttg 45

<210>6

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>6

tctgcttccc?ctggagagaa?ggtcaccatg?acttgtagag?cctct 45

<210>7

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>7

tcctctgtct?cttacattca?ctggttccag?caaaagccag?gttcc 45

<210>8

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>8

tctccaaagc?catggatcta?cgctacttcc?aacttggctt?ccggt 45

<210>9

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>9

gttccagtta?gattctctgg?ttctggttcc?ggtacctcct?actct 45

<210>10

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>10

cttaccatct?ccagagttga?agccgaggac?gctgctactt?actac 45

<210>11

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>11

tgtcagcaat?ggacttctaa?cccaccaact?ttcggtggtg?gtacc 45

<210>12

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>12

aaattggaga?ttaagagaac?tgttgctgct?ccatcc 36

<210>13

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>13

caacagttct?cttaatctcc?aatttggtac?caccaccgaa?agttg 45

<210>14

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>14

gtgggttaga?agtccattgc?tgacagtagt?aagtagcagc?gtcct 45

<210>15

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>15

cggcttcaac?tctggagatg?gtaagagagt?aggaggtacc?ggaac 45

<210>16

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>16

agaaccagag?aatctaactg?gaacaccgga?agccaagttg?gaag 44

<210>17

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>17

tagcgtagat?ccatggcttt?ggagaggaac?ctggcttttg?ctgga 45

<210>18

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>18

ccagtgaatg?taagagacag?aggaagaggc?tctacaagtc?atgg 44

<210>19

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>19

tgaccttctc?tccaggggaa?gcagacaaaa?tagctgggga?ttgag 45

<210>20

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>20

aggagtcgta?ttcaaatcgt?c 21

<210>21

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>21

agaactgttg?ctgctccatc?c 21

<210>22

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>22

ggatggagca?gcaacagttc 20

<210>23

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>23

ctggtacctt?aacactctcc?tctgttgaag 30

<210>24

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>24

aggagtcgta?ttcaagtcca?gttgcaacag?cctggtgccg?agttg 45

<210>25

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>25

gtcaagccag?gtgcttctgt?taagatgtcc?tgtaaggctt?ctggt 45

<210>26

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>26

tacactttca?cctcctacaa?catgcactgg?gtcaagcaaa?ctcca 45

<210>27

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>27

ggtagaggtt?tggagtggat?tggtgccatc?tacccaggta?acggt 45

<210>28

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>28

gacacttctt?acaaccaaaa?attcaaggga?aaggctactc?ttacc 45

<210>29

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>29

gctgataagt?cctcttccac?cgcctacatg?caattgtctt?ccttg 45

<210>30

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>30

acttctgaag?actctgctgt?ttactactgt?gctagatcca?cctac 45

<210>31

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>31

tacggtggag?actggtacttcaacgtttgg?ggtgctggta?ccact 45

<210>32

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>32

gtcaccgttt?ccgctgcttc?tactaaggga?ccatcc 36

<210>33

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>33

tagtagaagc?agcggaaacg?gtgacagtgg?taccagcacc?ccaaa 45

<210>34

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>34

cgttgaagta?ccagtctcca?ccgtagtagg?tggatctagc?acag 44

<210>35

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>35

agtaaacagc?agagtcttca?gaagtcaagg?aagacaattg?catg 45

<210>36

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>36

aggcggtgga?agaggactta?tcagcggtaa?gagtagcctt?tccct 45

<210>37

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>37

tgaatttttg?gttgtaagaa?gtgtcaccgt?tacctgggta?gatgg 45

<210>38

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>38

caccaatcca?ctccaaacctctacctggag?tttgcttgac?ccagt 45

<210>39

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>39

gcatgttgta?ggaggtgaaa?gtgtaaccag?aagccttaca?ggaca 45

<210>40

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>40

tcttaacaga?agcacctggc?ttgaccaact?cggcaccagg?ctgtt 45

<210>41

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>41

aggagtcgta?ttcaagtcca?g 21

<210>42

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>42

gcttctacta?agggaccatc?c 21

<210>43

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>43

ggatggtccc?ttagtagaag?c 21

<210>44

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>44

ctggtattac?ttacctgggg?acaaagac 28

<210>45

<211>105

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>45

gaattcgaaa?cgatgctgtc?gttaaaacca?tcttggctga?ctttggcggc?attaatgtat?60

gccatgctat?tggtcgtagt?gccatttgct?aaacctgtta?gagct 105

<210>46

<211>70

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>46

aattcgaaac?gatgctgtct?ttgaagccat?cttggcttac?tttggctgct?ttgatgtacg?60

ctatgctttt 70

<210>47

<211>41

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>47

ccaaagtaag?ccaagatggc ttcaaagaca?gcatcgtttc?g 41

<210>48

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>48

ggttgttgtt ccatttgcta?agccagttag?agct 34

<210>49

<211>59

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>49

agctctaact?ggcttagcaa?atggaacaac?aaccaaaagc?atagcgtaca?tcaaagcag 59

<210>50

<211>660

<212>DNA

<213>Mus?Musculus

<400>50

gatgctgtta?tgactcaaaa?cccattgtct?ttgcctgttt?ctcttggtga?tgaagcttct 60

atttcttgta?gatcctctca?atctttggaa?aactctaacg?gtaacacttt?cttgaactgg 120

ttctttcaga?agccaggtca?atctccacaa?ttgttgattt?acagagtttc?taacagattt 180

tctggtgttc?cagatagatt?ttctggttct?ggttctggta?ctgatttcac?tttgaagatt 240

tctagagttg?aagctgaaga?tttgggtgtt?tacttctgtt?tgcaagttac?tcatgttcca 300

tacacttttg?gtggtggtac?tactttggaa?attaagagaa?ctgttgctgc?tccatctgtc 360

ttcatctttc?caccatctga?tgaacaattg?aagtctggta?ctgcttctgt?tgtttgtctt 420

cttaacaact?tctacccaag?agaagctaag?gttcagtgga?aggttgataa?cgctttgcaa 480

tctggtaact?ctcaagaatc?tgttactgaa?caagattcta?aggattctac?ttactctttg 540

tcttctactt?tgactttgtc?taaggctgat?tacgaaaagc?ataaggttta?cgcttgtgaa 600

gttactcatc?aaggtttgtc?ttctccagtt?actaagtcct?ttaacagagg?tgaatgttag 660

<210>51

<211>1329

<212>DNA

<213>Mus?Musculus

<400>51

gatattcaat?tgcaacaatc?tggtccaggt?ttggttaagc?catctcaatc?tttgtctttg 60

acttgttctg?ttactggtta?ctctattact?actaactaca?actggaactg?gattagacaa 120

tttccaggta?acaagttgga?atggatgggt?tacattagat?acgatggtac?ttctgaatac 180

accccatctt?tgaagaacag?agtttctatt?actagagata?cttctatgaa?ccaattcttc 240

ttgagattga?cttctgttac?tccagaagat?actgctactt?actactgtgc?tagattggat 300

tactggggtc?aaggtacttc?tgttactgtt?tcttctgctt?ctactaaggg?tccatctgtt 360

tttccacttg?ctccatcttc?taagtctact?tctggtggta?ctgctgcttt?gggttgtttg 420

gttaaggatt?actttccaga?accagttact?gtttcttgga?actctggtgc?tttgacttct 480

ggtgttcata?cttttccagc?tgttttgcaa?tcttctggtt?tgtactcttt?gtcttctgtt 540

gttactgttc?catcttcttc?tttgggtact?caaacttaca?tttgtaacgt?taaccataag 600

ccatctaaca?ctaaggttga?taagagagtt?gaaccaaaat?cttgtgataa?aactcataca 660

tgtccaccat?gtccagctcc?tgaacttctg?ggtggaccat?cagttttctt?gttcccacca 720

aaaccaaagg?atacccttat?gatttctaga?actcctgaag?tcacatgtgt?tgttgttgat 780

gtttctcatg?aagatcctga?agtcaagttc?aactggtacg?ttgatggtgt?tgaagttcat 840

aatgctaaga?caaagccaag?agaagaacaa?tacaactcta?cttacagagt?tgtctctgtt 900

cttactgttc?tgcatcaaga?ttggctgaat?ggtaaggaat?acaagtgtaa?ggtctccaac 960

aaagctcttc?cagctccaat?tgagaaaacc?atttccaaag?ctaaaggtca?accaagagaa 1020

ccacaagttt?acaccttgcc?accatccaga?gatgaactga?ctaagaacca?agtctctctg 1080

acttgtctgg?ttaaaggttt?ctatccatct?gatattgctg?ttgaatggga?gtctaatggt 1140

caaccagaaa?acaactacaa?gactactcct?cctgttctgg?attctgatgg?ttccttcttc 1200

ctttactcta?agcttactgt?tgataagtcc?agatggcaac?aaggtaacgt?cttctcatgt 1260

tccgttatgc?atgaagcttt?gcataaccat?tacactcaga?agtctctttc?cctgtctcca 1320

ggtaaataa 1329

<210>52

<211>79

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>52

cggaattcga?tgctgttatg?actcaaaacc?cattgtcttt?gcctgtttct?cttggtgatg 60

aagcttctat?ttcttgtag 79

<210>53

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>53

agaaccagttcaagaaagtg?ttaccgttag?agttttccaa?agattgagag?gatctacaag 60

aaatagaagc?ttcat 75

<210>54

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>54

actttcttga?actggttctttcagaagcca?ggtcaatctc?cacaattgtt?gatttacaga 60

gtttctaaca?gattt 75

<210>55

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>55

caaagtgaaa?tcagtaccag?aaccagaacc?agaaaatcta?tctggaacac?cagaaaatct 60

gttagaaact?ctgta 75

<210>56

<211>77

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>56

tctggtactg?atttcacttt?gaagatttct?agagttgaag?ctgaagattt?gggtgtttac 60

ttctgtttgc?aagttac 77

<210>57

<211>77

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>57

caacagttct?cttaatttcc?aaagtagtac?caccaccaaa?agtgtatgga?acatgagtaa 60

cttgcaaaca?gaagtaa 77

<210>58

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>58

tggaaattaa?gagaactgtt?gctgctccat?ctgtcttcat?ctttccacca?tctgatgaac 60

aattgaagtc?tggta 75

<210>59

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>59

tgaaccttag?cttctcttgg?gtagaagttg?ttaagaagac?aaacaacaga?agcagtacca 60

gacttcaatt?gttcat 76

<210>60

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>60

cccaagagaa?gctaaggttc?agtggaaggt?tgataacgct?ttgcaatctg?gtaactctca?60

agaatctgtt?actgaa 76

<210>61

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>61

ccttagacaa?agtcaaagta?gaagacaaag?agtaagtaga?atccttagaa?tcttgttcag 60

taacagattc?ttgaga 76

<210>62

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>62

ctactttgac?tttgtctaag?gctgattacg?aaaagcataa?ggtttacgct?tgtgaagtta 60

ctcatcaagg?tttgtc 76

<210>63

<211>68

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>63

ggggtaccct?aacattcacc?tctgttaaag?gacttagtaa?ctggagaaga?caaaccttga 60

tgagtaac 68

<210>64

<211>70

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>64

gatattcaat?tgcaacaatc?tggtccaggt?ttggttaagc?catctcaatc?tttgtctttg 60

acttgttctg 70

<210>65

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>65

ggaaattgtc?taatccagtt?ccagttgtag?ttagtagtaa?tagagtaacc?agtaacagaa 60

caagtcaaag?acaaag 76

<210>66

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>66

aactggatta?gacaatttcc?aggtaacaag?ttggaatgga?tgggttacat?tagatacgat 60

ggtacttctg?aatac 75

<210>67

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>67

attggttcat?agaagtatct?ctagtaatag?aaactctgtt?cttcaaagat?ggggtgtatt 60

cagaagtacc?atcgta 76

<210>68

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>68

gagatacttc?tatgaaccaa?ttcttcttga?gattgacttc?tgttactcca?gaagatactg 60

ctacttacta?ctgtgc 76

<210>69

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>69

agtagaagca?gaagaaacag?taacagaagt?accttgaccc?cagtaatcca?atctagcaca?60

gtagtaagta?gcagta 76

<210>70

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>70

ctgtttcttc?tgcttctact?aagggtccat?ctgtttttcc?acttgctcca?tcttctaagt 60

ctacttctgg?tggta 75

<210>71

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>71

gaaacagtaa?ctggttctgg?aaagtaatcc?ttaaccaaac?aacccaaagc?agcagtacca 60

ccagaagtag?actta 75

<210>72

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>72

tccagaacca?gttactgttt?cttggaactc?tggtgctttg?acttctggtg?ttcatacttt?60

tccagctgtt?ttgcaa 76

<210>73

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>73

ccaaagaaga?agatggaaca?gtaacaacag?aagacaaaga?gtacaaacca?gaagattgca 60

aaacagctgg?aaaagt 76

<210>74

<211>76

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>74

ctgttccatc?ttcttctttg?ggtactcaaa?cttacatttg?taacgttaac?cataagccat 60

ctaacactaa?ggttga 76

<210>75

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>75

tgtatgagtt?ttatcacaag?attttggttc?aactctctta?tcaaccttag?tgttagatgg?60

<210>76

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>76

gctgaaccaa?aatcttgtga?taaaactcatacatgtccac?catgtccagc?tcctgaactt 60

ctgggtggac?catcagtttt 80

<210>77

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>77

atgtgacttc?aggagttcta?gaaatcataa?gggtatcctt?tggttttggt?gggaacaaga?60

aaactgatgg?tccacccaga 80

<210>78

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>78

ctagaacccc?tgaagtcaca?tgtgttgttg?ttgatgtttc?tcatgaagat?cctgaagtca?60

agttcaactg?gtacgttgat 80

<210>79

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>79

taagtagagt?tgtattgttc?ttctcttggc?tttgtcttag?cattatgaac?ttcaacacca 60

tcaacgtacc?agttgaactt 80

<210>80

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>80

agaacaatac?aactctacttacagagttgt?ctctgttcttactgttctgc?atcaagattg 60

gctgaatggt?aaggaataca 80

<210>81

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>81

agctttggaa?atggttttct?caattggagctggaagagct?ttgttggaga?ccttacactt?60

gtattcctta?ccattcagcc 80

<210>82

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>82

gagaaaacca?tttccaaagc?taaaggtcaa?ccaagagaac?cacaagttta caccttgcca 60

ccatccagag?atgaactgac 80

<210>83

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>83

cagcaatatc?agatggatag?aaacctttaa?ccagacaagt?cagagagact?tggttcttag 60

tcagttcatc?tctggatggt 80

<210>84

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>84

tctatccatc?tgatattgct?gttgaatggg?agtctaatggtcaaccagaa?aacaactaca 60

agactactcc?tcctgttctg 80

<210>85

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>85

tgccatctgg?acttatcaac?agtaagctta?gagtaaagga?agaaggaacc?atcagaatcc 60

agaacaggag?gagtagtctt 80

<210>86

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>86

tgttgataag?tccagatggc?aacaaggtaa?cgtcttctca?tgttccgtta?tgcatgaagc?60

tttgcataac?cattacactc 80

<210>87

<211>53

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>87

ttatttacct?ggagacaggg?aaagagactt?ctgagtgtaa?tggttatgca?aag 53

<210>88

<211>40

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>88

ggggtacctt?atttacctgg?agacagggaa?agagacttct 40

<210>89

<211>1423

<212>DNA

<213>Homo?Sapiens

<400>89

atgaagtggg?taacctttat?ttcccttctt?tttctcttta?gctcggctta?ttccaggggt 60

gtgtttcgtc?gagatgcaca?caagagtgag?gttgctcatc?ggtttaaaga?tttgggagaa 120

gaaaatttca?aagccttggt?gttgattgcc?tttgctcagt?atcttcagca?gtgtccattt 180

gaagatcatg?taaaattagt?gaatgaagta?actgaatttg?caaaaacatg?tgttgctgat 240

gagtcagctg?aaaattgtga?caaatcactt?catacccttt?ttggagacaa?attatgcaca 300

gttgcaactc?ttcgtgaaac?ctatggtgaa?atggctgact?gctgtgcaaa?acaagaacct 360

gagagaaatg?aatgcttctt?gcaacacaaa?gatgacaacc?caaacctccc?ccgattggtg 420

agaccagagg?ttgatgtgat?gtgcactgct?tttcatgaca?atgaagagac?atttttgaaa 480

aaatacttat?atgaaattgc?cagaagacat?ccttactttt?atgccccgga?actccttttc 540

tttgctaaaa?ggtataaagc?tgcttttaca?gaatgttgcc?aagctgctga?taaagctgcc 600

tgcctgttgc?caaagctcga?tgaacttcgg?gatgaaggga?aggcttcgtc?tgccaaacag 660

agactcaagt?gtgccagtct?ccaaaaattt?ggagaaagag?ctttcaaagc?atgggcagta 720

gctcgcctga?gccagagatt?tcccaaagct?gagtttgcag?aagtttccaa?gttagtgaca 780

gatcttacca?aagtccacac?ggaatgctgc?catggagatc?tgcttgaatg?tgctgatgac 840

agggcggacc?ttgccaagta?tatctgtgaa?aatcaagatt?cgatctccag?taaactgaag 900

gaatgctgtg?aaaaacctct?gttggaaaaa?tcccactgca?ttgccgaagt?ggaaaatgat 960

gagatgcctg?ctgacttgcc?ttcattagct?gctgattttg?ttgaaagtaa?ggatgtttgc 1020

aaaaactatg?ctgaggcaaa?ggatgtcttc?ctgggcatgt?ttttgtatga?atatgcaaga 1080

aggcatcctg?attactctgt?cgtgctgctg?ctgagacttg?ccaagacata?tgaaaccact 1140

ctagagaagt?gctgtgccgc?tgcagatcct?catgaatgct?atgccaaagt?gttcgatgaa 1200

tttaaacctc?ttgtggaaga?gcctcagaat?ttaatcaaac?aaaattgtga?gctttttgag 1260

cagcttggag?agtacaaatt?ccagaatgcg?ctattagttc?gttacaccaa?gaaagtaccc 1320

caagtgtcaa?ctccaactct?tgtagaggtc?tcaagaaacc?taggaaaagt?gggcagcaaa 1380

tgttgtaaac?atcctgaagc?aaaaagaatg?ccctgtgcag?aag 1423

<210>90

<211>51

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>90

ctcgagcccg?gcggcggcgg?cggccgcctg?gttcctcgtg?gcttcggtac?c 51

Claims (according to the modification of the 19th of treaty)

1. composition that contains the panimmunity sphaeroprotein, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, and the described multiple N-glycan that wherein surpasses percent 50 molecular fractions mainly is made up of GalGlcNAcMan5GlcNAc2.

2. the composition of claim 1, the described multiple N-glycan that wherein surpasses percent 75 molecular fractions mainly is made up of GalGlcNAcMan5GlcNAc2.

3. the composition of claim 1, the described multiple N-glycan that wherein surpasses percent 90 molecular fractions mainly is made up of GalGlcNAcMan5GlcNAc2.

4. the composition of claim 1, wherein said GalGlcNAcMan ₅GlcNAc ₂The level of N-glycan exceeds percent 5 to 50 molecular fractions than the N-glycan structures that accounts for second advantage in the described multiple N-glycan at least.

5. the binding affinity that the composition of claim 1, wherein said immunoglobulin (Ig) demonstrate with Fc γ RIIb acceptor reduces.

6. the binding affinity that the composition of claim 1, wherein said immunoglobulin (Ig) demonstrate with Fc γ RIII acceptor increases.

7. the composition of claim 6, wherein said Fc γ RIII acceptor is a kind of Fc γ RIIIa acceptor.

8. the composition of claim 6, wherein said Fc γ RIII acceptor is a kind of Fc γ RIIIb acceptor.

9. the composition of claim 1, wherein said immunoglobulin (Ig) demonstrate cytotoxicity (ADCC) activity that antibody with increase relies on.

10. the composition of claim 1, wherein said immunoglobulin (Ig) is substantially free of trehalose.

11. the composition of claim 1, wherein said immunoglobulin (Ig) lacks trehalose.

12. the composition of claim 1, wherein said immunoglobulin (Ig) combines with the antigen that is selected from somatomedin, FGFR, EGFR, VEGF, human leucocyte antigen, CD20, CD33, cytokine, TNF-α and TNF-β.

13. the composition of claim 1, wherein said immunoglobulin (Ig) contain the Fc district that is selected from IgGl, IgG2, IgG3 and IgG4 district.

14. a pharmaceutical composition contains the composition and the pharmaceutically acceptable carrier of claim 1.

15. the pharmaceutical composition of claim 14, wherein said immunoglobulin (Ig) is substantially free of trehalose.

16. the pharmaceutical composition of claim 14, wherein said immunoglobulin (Ig) lacks trehalose.

17. the pharmaceutical composition of claim 14, wherein said immunoglobulin (Ig) contain the antibody that combines with the antigen that is selected from somatomedin, FGFR, EGFR, VEGF, human leucocyte antigen, CD20, CD33, cytokine, TNF-α and TNF-β.

18. the pharmaceutical composition of claim 14, wherein said immunoglobulin (Ig) contain the Fc district that is selected from IgGl, IgG2, IgG3 and IgG4 district.

19. test kit that contains composition in the claim 1.

20. eukaryotic host cell that contains coding immunoglobulin (Ig) or its segmental foreign gene, transforming or screening described eukaryotic host cell makes it express described immunoglobulin (Ig) or its fragment, thereby produce the composition that contains the panimmunity sphaeroprotein, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage mainly is made up of GalGlcNAcMan5GlcNAc2.

21. the host cell of claim 20, wherein host cell is the low eukaryotic host cell that waits.

22. in eukaryotic host cell, produce the method for compositions that contains the panimmunity sphaeroprotein for one kind, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, and wherein the N-glycan that takes advantage in described multiple N-glycan mainly is made up of GalGlcNAcMan5GlcNAc2.

23. the method for claim 22, wherein host cell is the low eukaryotic host cell that waits.

Claims (24)

1. composition that contains the panimmunity sphaeroprotein, each immunoglobulin (Ig) contains a connected N-glycan at least, and therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage mainly is made up of GalGlcNAcMan5GlcNAc2.

2. the composition of claim 1, the described multiple N-glycan that wherein surpasses percent 50 molecular fractions mainly is made up of GalGlcNAcMan5GlcNAc2.

3. the composition of claim 1, the described multiple N-glycan that wherein surpasses percent 75 molecular fractions mainly is made up of GalGlcNAcMan5GlcNAc2.

4. the composition of claim 1, the described multiple N-glycan that wherein surpasses percent 90 molecular fractions mainly is made up of GalGlcNAcMan5GlcNAc2.

5. the composition of claim 1, wherein said GalGlcNAcMan5GlcNAc ₂The level of N-glycan exceeds percent 5 to 50 molecular fractions than the N-glycan structures that accounts for second advantage in the described multiple N-glycan at least.

6. the binding affinity that the composition of claim 1, wherein said immunoglobulin (Ig) demonstrate with Fc γ RIIb acceptor reduces.

7. the binding affinity that the composition of claim 1, wherein said immunoglobulin (Ig) demonstrate with Fc γ RIII acceptor increases.

8. the composition in the claim 7, wherein said Fc γ RIII acceptor is a kind of Fc γ RIIIa acceptor.

9. the composition in the claim 7, wherein said Fc γ RIII acceptor is a kind of Fc γ RIIIb acceptor.

10. the composition of claim 1, wherein said immunoglobulin (Ig) demonstrate cytotoxicity (ADCC) activity that antibody with increase relies on.

11. the composition of claim 1, wherein said immunoglobulin (Ig) is substantially free of trehalose.

12. the composition of claim 1, wherein said immunoglobulin (Ig) lacks trehalose.

13. the composition of claim 1, wherein said immunoglobulin (Ig) combines with the antigen that is selected from somatomedin, FGFR, EGFR, VEGF, human leucocyte antigen, CD20, CD33, cytokine, TNF-α and TNF-β.

14. the composition of claim 1, wherein said immunoglobulin (Ig) contain the Fc district that is selected from IgG1, IgG2, IgG3 and IgG4 district.

15. a pharmaceutical composition contains composition and pharmaceutically acceptable carrier among any one of the claim 1-14.

16. the pharmaceutical composition of claim 15, wherein said immunoglobulin (Ig) is substantially free of trehalose.

17. the pharmaceutical composition of claim 15, wherein said immunoglobulin (Ig) lacks trehalose.

18. the pharmaceutical composition of claim 15, wherein said immunoglobulin (Ig) contain the antibody that combines with the antigen that is selected from somatomedin, FGFR, EGFR, VEGF, human leucocyte antigen, CD20, CD33, cytokine, TNF-α and TNF-β.

19. the pharmaceutical composition of claim 15, wherein said immunoglobulin (Ig) contain the Fc district that is selected from IgG1, IgG2, IgG3 and IgG4 district.

20. test kit that contains composition in the claim 1.

21. eukaryotic host cell that contains coding immunoglobulin (Ig) or its segmental foreign gene, transforming or screening described eukaryotic host cell makes it express described immunoglobulin (Ig) or its fragment, thereby produce the composition that contains the panimmunity sphaeroprotein, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, and the N-glycan that wherein takes advantage mainly is made up of GalGlcNAcMan5GlcNAc2.

22. the host cell of claim 21, wherein host cell is the low eukaryotic host cell that waits.

23. in eukaryotic host cell, produce the method for compositions that contains the panimmunity sphaeroprotein for one kind, each immunoglobulin (Ig) contains a connected N-glycan at least, therefore described composition contains multiple N-glycan, and wherein the N-glycan that takes advantage in described multiple N-glycan mainly is made up of GalGlcNAcMan5GlcNAc2.

24. the method for claim 23, wherein host cell is the low eukaryotic host cell that waits.

Images