CN101240350A - Primer and probe sequence for detecting dengue virus IV type nucleic acid fragment - Google Patents
Primer and probe sequence for detecting dengue virus IV type nucleic acid fragment Download PDFInfo
- Publication number
- CN101240350A CN101240350A CNA2007100741901A CN200710074190A CN101240350A CN 101240350 A CN101240350 A CN 101240350A CN A2007100741901 A CNA2007100741901 A CN A2007100741901A CN 200710074190 A CN200710074190 A CN 200710074190A CN 101240350 A CN101240350 A CN 101240350A
- Authority
- CN
- China
- Prior art keywords
- primer
- dengue virus
- probe
- sequence
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention is a PCR amplifying primer and probe sequence for dengue virus IV nucleotide fragment. The primer sequence includes a primer pair composed of upstream primer Den IV pf having sequence GAAAGGACCCTTACGGATGGT and downstream primer Den IV pr having sequence AGAATCCCTGCTGTTGGTGG. The probe Den IV pb sequence is TCATCACGTTTTTGCGAGTCCTTTCCA.
Description
Technical field
The present invention relates to a kind of primer and probe sequence that is used to detect dengue virus IV type nucleotide fragments.
Background technology
(dengue virus DEN) is the sub-thread positive chain RNA virus of Flavivirus to dengue virus, according to the proteic antigenicity difference of E, is divided into I type, II type, III type and four serotypes of IV type.Dengue virus is a communication media with Aedes aegypti and Aedes albopictus, cause singapore hemorrhagic fever (classicaldengue fever, be called for short DF) and dengue hemorrhagic fever/step on and remove from office shock syndromes (den-gue hemorrhagi fever/dengue shocksyndrome is called for short DHF/DSS).The torrid zone, the annual whole world has 100,000,000 people to infect dengue virus with the subtropical zone, wherein the south east asia popular the most serious (WHO.1998) to border on China.In 20th century, singapore hemorrhagic fever took place all over the world repeatedly to be very popular, the millions of meters of case, and be region in South East Asia popular always.China Guangdong took place popular in 1978, and isolated IV type dengue virus.After this, little I, II, the III C-type virus C isolated in the groove in 1979,1980,1985.In recent years, China south the popular of singapore hemorrhagic fever that take place frequently, the time case report of DHF/DSS arranged.DHF/DSS shows as high heat, and is hemorrhage, shock, and case fatality rate is higher, but its mechanism is not clear, and most scholars think the biological nature that is subjected to virus itself of DHF/DSS and patient's the influence of immune factor two aspects.In recent years, along with the increase of movement of population, development of urbanization, the region of dengue virus type distributes destroyed, and the epidemic regions of DF enlarges, and the DHF/DSS case also has the trend that increases.This disease has become a serious public health problem of the torrid zone and subtropical zone at present.Owing to lack effective vaccine, thereby in time diagnose the illness, in time handle epidemic situation and just become very important, this just need a kind of not only accurately but also fast the laboratory detection method determine cause of disease. this also is a requisite link of clinical diagnosis and epidemiological study.
The laboratory diagnosis of dengue virus, all set up a whole set of proven technique both at home and abroad, traditional method mainly contains hemagglutination-inhibition test, complement fixation test (CFT), neutralization test etc., these methods exist to some extent all that susceptibility is low, poor specificity, complex operation, deficiency such as consuming time, especially are difficult to accurate somatotype.Along with the success of dengue virus Study of Monoclonal Antibodies, somatotype authentication method based on dengue virus type specificity monoclonal antibody, be widely used in each dengue virus test experience chamber, the whole world as IiT (IFA), enzyme linked immunological adsorption technology (ELIA), the accurate somatotype problem of dengue virus is resolved, but all these technology, still exist experiment problem consuming time inevitably, because these methods all are to be based upon on the basis of viral separation and Culture, be not suitable for early diagnosis as singapore hemorrhagic fever.
Along with the development of Protocols in Molecular Biology, the regular-PCR method has been widely used in clinical diagnosis, but this Technology Need carries out aftertreatment to the PCR product, very easily causes the PCR product pollution, and certain non-specific amplification is arranged simultaneously.The fluorescent PCR technology then is on the basis of regular-PCR technology, adds a specific fluorescent probe again in a pair of Auele Specific Primer of adding in amplification reaction system, uses the fluorescent PCR detector of monitoring in real time to detect the technology of target nucleotide sequences.Except the advantage with regular-PCR, it also has the following advantages:
(1) specificity is stronger, and sensitivity is higher.Since used more one can with the fluorescent probe of template complementary pairing, improved specificity, and collected fluorescent signal by self-reacting device, avoided the subjectivity of artificial judgment, can further improve sensitivity again.(2) totally-enclosed reaction, online real-time monitoring fluorescence, aftertreatment that need not the PCR product is avoided polluting, and has guaranteed result's reliability.(3) data analysis is selected in the logarithmic phase of nucleic acid amplification, abandons the multifactor interferential end point analysis method that is subjected to of regular-PCR method, makes quantitatively more accurately and reliably.(4) can realize the two inspections of single tube or many inspections, also can design mark in the specific aim, monitoring extraction efficiency and get rid of inhibitor and disturb.(5) do not contact toxic reagent, operational safety.(6) help mass-producing, automatization and network management.(7) scope of application is wider, can detect the nucleic acid of any virus in theory.
Summary of the invention
The purpose of this invention is to provide a kind of primer and probe sequence that is used to detect dengue virus IV type nucleotide fragments.
Based on above-mentioned purpose, the present invention by the following technical solutions:
The primer and the probe sequence that are used to detect dengue virus IV type nucleotide fragments comprise: by upstream primer DenIV pf sequence be GAAAGG ACCCTTACGGATGGT and downstream primer Den IV pr sequence be the primer formed of AGAATCCCTGCTGTTGGTGG to probe Den IV pb sequence be TCATCACGTTTTTGCGAGTCCTTTCCA.
Concrete principle of the present invention is to utilize Auele Specific Primer and a specificity fluorescent probe of a pair of target nucleotide sequences, adopt hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomer compositions such as (dNTP), and use the nucleic acid fragment amplification that round pcr is realized target nucleotide sequences.Employed probe is the oligonucleotide of two ends difference mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete, the reporter group fluorescent signal emitted is absorbed by quenching group, and in the pcr amplification process, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific combination on the target nucleotide fragment, the fluorescence report group is free in the reaction system, the shielding effect that has broken away from the fluorescent quenching group, the fluorescent signal of fluorescence report group just can by instrument detecting to, the variation of fluorescent signal amount is directly proportional with the amplified production amount, thereby judges the existence of target nucleotide sequences in the sample to be tested.
Description of drawings
Fig. 1 utilizes primer denIVpf/denIVpr and probe denIVpb to be detected the fluorescent PCR amplification figure of dengue virus IV type positive.
Embodiment
1. primer and probe design: by respectively all known dengue virus IV type genome sequences being compared analysis, select the section of no secondary structure and high conservative, design manyly to primer and probe, primer length is generally about 20 bases, no complementary sequence between primer and in the primer.Optimum primer, probe sequence make up as follows:
Upstream primer DenIVpf:GAAAGGACCCTTACGGATGGT
Downstream primer DenIVpr:AGAATCCCTGCTGTTGGTGG
Probe DenIVpb:TCATCACGTTTTTGCGAGTCCTTTCCA
2. the foundation of reaction system and optimization: the dengue virus IV type that utilizes deactivation is as sample to be checked, extracts virus genome RNA with the extracting method of TrIVzol nucleic acid extraction agent, be stored in after the packing respectively-20 ℃ standby.
2.1 under the optimization of the primer concentration situation that other condition is identical in reaction system, the primer concentration of dengue virus IV type is done the multiple proportions serial dilution from 0.1 μ mol/L to 1.6 μ mol/L respectively, analysis by test-results is compared, and determines that best primer final concentration is 0.4 μ mol/L.
2.2 under the optimization of the magnesium ion concentration situation that other condition is identical in reaction system, with MgCl
2Concentration increase progressively with 1mmol/L from 1mmol/L to 10mmol/L, be magnesium ion concentration in the test kit reaction system through the selected 5mmol/L of repeated experiments repeatedly.
2.3 the optimization of ThermoScript II (AMV RnaseXL) consumption is compared through the test-results of using the different concns ThermoScript II, selected 5U is as the consumption of ThermoScript II in the test kit reaction system.
2.4 the optimization of Taq archaeal dna polymerase (Taq enzyme) consumption is by comparing the optimization experiment result of Taq enzyme dosage (in the Unit of unit), selected 5U is as the consumption of Taq enzyme in the test kit reaction system.
2.5 the optimization of dNTPs concentration detects by the dNTPs that uses different concns, selects the usage quantity of 1mmol/L as dNTPs in the test kit reaction system after the comprehensive assessment.
2.6 under the optimization of the concentration and probe concentration situation that other condition is identical in reaction system, the concentration and probe concentration of dengue virus IV type is done to detect after the multiple proportions serial dilution from 0.1 μ mol/L to 0.5 μ mol/L respectively, analysis by test-results is compared, and determines that best probe final concentration is 0.2 μ mol/L.
Utilize above-mentioned primer and probe to carry out the foundation of reaction system, determine that at last the dengue virus IV type real-time fluorescence PCR reaction system that adopts is 25 μ l systems, required each component and respective concentration see Table 1.
Each component situation in the reaction of table 1 dengue virus IV type real-time fluorescence PCR
| Component | Consumption/ |
| 10× |
1× |
| 25mmol/L MgCl 2 | 5mmol/L |
| dNTP Mixture | 1mmol/L |
| RNase Inhibitor | 40Unit |
| Primer | 0.4μmol/L each |
| Probe | 0.2μmol/L |
| Template | 10μl |
| AMV RNaseXL | 5Unit |
| Taq | 5Unit |
Annotate: the instrument difference that a. uses, reaction parameter should be done suitably to adjust.
B. different according to detecting the sample source, should suitably adjust the template dosage.
3. the selection of instrument detecting passage: when carrying out the fluorescent PCR reaction, the collection of tackling reaction tubes fluorescent signal in the used instrument is provided with, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, should be with reference to the instrument working instructions.
4.PCR it is as follows that condition is selected:
50 ℃ 30 minutes, 95 ℃ 2 minutes, 1 circulation;
95 ℃ 5 seconds, 60 ℃ 40 seconds, 40 circulations.
5. detection step:
5.1 choose primer and probe;
5.2 prepare template to be measured, can adopt TRIZOL nucleic acid extraction method to extract the nucleic acid of dengue virus IV type in the sample of various sources;
5.3 the foundation of reaction system: a, determine best primer concentration; B, determine magnesium ion concentration; C, determine the consumption of ThermoScript II; D, determine the Taq enzyme dosage; E, determine dNTPs concentration; F, determine concentration and probe concentration;
5.4 select the sense channel of instrument;
5.5 last machine testing.
6. embodiment
6.1 the preparation of template to be measured: with the extracting method of Trizol nucleic acid extraction agent
6.1.1 get testing sample 600 μ l, 12000 rev/mins of centrifugal removal macromole impurity.100 μ, 1 supernatant liquor is added in the centrifuge tube of 1.5ml, organize extract to the TrizoL that wherein adds 300 μ l again, fully vibration on vibrator.Then 13000 rev/mins centrifugal 15 minutes, supernatant is moved in the centrifuge tube of 1.5ml;
6.1.2 in supernatant liquor, add the pre-cold isopropanol of 400 μ l, after fully vibrating on the vibrator;
6.1.3 13000 rev/mins centrifugal 10 minutes so that obtain the RNA precipitation;
6.1.4 carefully outwell supernatant, add 600 μ l, 75% ethanol, with putting upside down washing for several times on hand down.(note: can not thermal agitation, prevent to be difficult to precipitate again behind the fracture of RNA and the RNA resolution of precipitate);
6.1.5 13000 rev/mins centrifugal 10 minutes, slowly inhale and abandon supernatant, about 25 minutes of drying at room temperature treats to add 25-40 μ l after ethanol volatilizees fully and does not have the water dissolution of RNA enzyme (abundant springing mixing, or repeatedly blow and beat with rifle) ,-20 ℃ store for future use.
6.2 the amplification condition of dengue virus IV type real-time fluorescence PCR reaction
According to table 1 application of sample, will add excellent PCR pipe and be placed in the fluorescent PCR instrument, after being set, corresponding phosphor collection condition increases, and response procedures is as follows:
6.2.1 50 ℃ were carried out the reverse transcription of RNA in 30 minutes, 95 ℃ of 3 minutes deactivation ThermoScript II;
6.2.1 95 ℃ of sex change in 15 seconds, 55 ℃ of annealing in 30 seconds, 72 ℃ of extensions in 1 minute so repeat 5 circulations and increase in advance;
6.2.3 95 ℃ of sex change in 10 seconds, are extended at 60 ℃ of annealing in 40 seconds, so repeat 40 circulations and carry out the segmental augmentation detection of purpose, test-results can be monitored in real time.
6.3 the detected result of dengue virus IV type real-time fluorescence PCR
After testing, then show positive amplification curve if contain dengue virus IV type in the nutrient solution to be checked, its detection sensitivity can reach 1000 copy/ml; Then do not have amplified signal if do not contain dengue virus IV type in the nutrient solution to be checked, point out above-mentioned primer having good sensitivity and specificity with probe.
Advantage of the present invention:
(1) detection sensitivity of primer provided by the invention and probe can reach 1000 copy/ml, illustrates that it has good sensitivity.
(2) primer provided by the invention and probe without amplified signal, illustrate that it has good specificity for the detection sample standard deviation that does not contain dengue virus IV type.
(3) because the present invention compares analysis to all known dengue virus IV type genome sequences respectively, select to carry out the design of primer and probe without the section of secondary structure and high conservative, avoided the generation of false negative result.
(4) because the present invention adopts Fluorescence PCR assay as detection method, whole reaction is all carried out in the reaction tube of sealing, has avoided other nucleic acid detection methods such as PCR-electrophoresis etc. to be easy to form Aerosol Pollution and causes false positive results; Because the PCR product is carried out Real-Time Monitoring, greatly saved monitoring time, saved manpower and materials.
SEQUENCE LISTING
＜110〉Shenzhen Taitai Genetic Engineering Co., Ltd.
＜120〉a kind of primer and probe sequence that is used to detect dengue virus IV type nucleotide fragments
<130>9
<160>3
<170>PatentIn version 3.3
<210>1
<211>21
<212>DNA
＜213〉artificial sequence
<400>1
gaaaggaccc ttacggatgg t 21
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<400>2
<210>3
<211>27
<212>DNA
＜213〉artificial sequence
<400>3
tcatcacgtt tttgcgagtc ctttcca 27
Claims (2)
1. primer sequence that is used to detect dengue virus IV type nucleotide fragments is characterized in that described primer sequence comprises: by upstream primer DenIVpf sequence is that GAAAGGACCCTTACGGATGGT and downstream primer DenIVpr sequence are that the primer formed of AGAATCCCTGCTGTTGGTGG is right.
2. a probe sequence that is used to detect dengue virus IV type nucleotide fragments is characterized in that described probe DenIVpb sequence is TCATCACGTTTTTGCGAGTCCTTTCCA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100741901A CN101240350A (en) | 2007-05-08 | 2007-05-08 | Primer and probe sequence for detecting dengue virus IV type nucleic acid fragment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100741901A CN101240350A (en) | 2007-05-08 | 2007-05-08 | Primer and probe sequence for detecting dengue virus IV type nucleic acid fragment |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101240350A true CN101240350A (en) | 2008-08-13 |
Family
ID=39932173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007100741901A Pending CN101240350A (en) | 2007-05-08 | 2007-05-08 | Primer and probe sequence for detecting dengue virus IV type nucleic acid fragment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101240350A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286636A (en) * | 2011-07-20 | 2011-12-21 | 深圳市检验检疫科学研究院 | Dengue virus detection and parting method, special chip and kit |
-
2007
- 2007-05-08 CN CNA2007100741901A patent/CN101240350A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286636A (en) * | 2011-07-20 | 2011-12-21 | 深圳市检验检疫科学研究院 | Dengue virus detection and parting method, special chip and kit |
| CN102286636B (en) * | 2011-07-20 | 2013-10-23 | 深圳市检验检疫科学研究院 | Dengue virus detection and parting method, special chip and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106367533A (en) | Nucleic acid for detecting Zika virus, real-time fluorescence RPA kit and method | |
| CN102140543B (en) | Multiple real-time quantitative PCR primer, probe and detection method for identifying viral pathogens relevant to fever with eruption syndrome as infection diseases | |
| CN105755124A (en) | Method for detecting salmonella with fluorescence method on basis of enzymatic remediation isothermal cycle amplification | |
| CN101144107A (en) | Primer and probe sequence for detecting dengue virus nucleic acid fragment | |
| CN100580093C (en) | Primer and probe sequence for detecting dengue virus II type nucleic acid fragment | |
| CN101294223B (en) | Primer and probe sequence for testing type II pig circular ring virus nucleotide fragment | |
| CN101139638B (en) | Primer and probe sequence for detecting dengue virus 3 nucleotides fragment | |
| CN101638693B (en) | Kit for detecting human enteric viruses by real-time fluorescent quantitative PCR | |
| CN103060452A (en) | Kit for detecting chlamydia trachomatis (CT) | |
| CN101144108A (en) | Primer and probe sequence for detecting high pathogenicity porcine reproductive and respiratory syndrome virus nucleic acid fragment | |
| CN101139637A (en) | Primer and probe sequence for detecting dengue virus 1 nucleotides fragment | |
| CN102952896A (en) | Universal loop-mediated isothermal amplification kit for detecting influenza A virus and application of universal loop-mediated isothermal amplification kit | |
| CN101748197A (en) | Target sequence for detection of yersinia enterocolitica and kit | |
| CN100386442C (en) | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus | |
| CN101240350A (en) | Primer and probe sequence for detecting dengue virus IV type nucleic acid fragment | |
| CN102154519A (en) | General TaqMan real-time fluorescent quantitative polymerase chain reaction (PCR) detection kit for dengue virus | |
| CN100386443C (en) | Primer and probe sequence for detecting nucleotide fragment of 0139 group choleraic vibrio | |
| CN100381578C (en) | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype | |
| CN110295254A (en) | Identify the Multiplex real-time PCR primer and probe of detection Rift Valley fever virus | |
| CN100395350C (en) | Prime and probe sequence for detecting nucleotide fregment of comma bacillus | |
| CN100395347C (en) | Primer for detecting salmonella nucleotide fragment and probe sequence | |
| CN101186949B (en) | Primer and probe sequence for detecting swine breeding and breath syndrome virus nucleic acid fragment | |
| CN100395346C (en) | Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence | |
| CN101928780A (en) | A type foot-and-mouth disease virus two-color fluorescence PCR detection method and kit thereof | |
| CN101736091A (en) | Kit for real-time fluorescence RT-PCR detection of H7 subtype avian influenza virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080813 |