CN101225439A - Conserved sequence amplified polymorphic molecular marker and analytical method thereof - Google Patents

Abstract

The invention discloses a conserved sequence expansion polymorphic molecule marker and an analysis method, which is characterized in that a PCR expansion product of a primer is designed according to an expression sequence label EST and a protection sequence of an intron; the product is analyzed and tested with PCR and polyacrylamide gel electrophoresis, and the DNA polymorphism is obtained. The conserved sequence expansion polymorphic molecule marker has the advantages of economy and convenience, less requirement of template, moderate yield, high repeatability and reliable result. The analysis method is a widely used and universally applicable technique and can research the genetic polymorphism, the germplasm resources, the genetic relationship and the molecular marker-assisted selection of plant, animal, human and microbe.

Description

Conserved sequence amplified polymorphic molecular marker and analytical procedure thereof

Technical field

The invention belongs to biological technical field, relate to a kind of conserved sequence amplified polymorphic molecular marker and analytical procedure thereof especially.

Background technology

Dna molecular marker is emerging Protocols in Molecular Biology, can directly reflect biological inheritance from dna level, multiple advantages such as having that quantity is many, polymorphism is high, be not subjected to season, environmental influence, detection means are simply rapid.Molecule marker has become the field, forward position of life science, be widely used in biological heredity polymorphism analysis, genetic linkage maps structure, germ plasm resource evaluation, the assignment of genes gene mapping, sibship analysis, sex identification, genomic mapping, gene clone, library construction and molecular marker assisted selection breeding or the like many aspects, promoted agricultural, forestry, animal husbandry, and medical science comprises the fast development of aspects such as medical jurisprudence.

1980, molecule marker RFLP (Restriction Fragment Length Polymorphism, restrictive fragment length polymerphism, Botstein D, White R L, Skolnick M, Davis R W.Construction of a genetic linkage map in man using restriction fragmentlength polymorphisms[J] .American Journal of HumanGene-tics, 1980,32:314～331) occur with the bibliographical information form.Because the change of nucleotide sequence spreads all over whole genome, the quantity of genetic marker no longer becomes limiting factor, and its advantage obviously surpasses classical protein polymorphisms, has from then on started and has utilized dna polymorphism to carry out the new stage of molecule marker.But the shortcoming of RFLP also clearly: must cut the hybridization with DNA through enzyme, therefore, the DNA requirement is big, and detection technique is numerous and diverse, is difficult to promote the use of on a large scale, and it is imperative to develop new molecular marking technique.Nineteen ninety, the scientist Williams of du pont company (Williams J G K, Kubelik A R, LivakK J, et al.DNA Polymorphisms Amplified by Arbitrary Primers Are Usefulas Genetic Markers[J] .Nucl Acid Res.1990,18:6531-6535) with Welsh (the Welsh J of California biological study institute, McClelland M, Fingerprinting genomesusing PCR with arbitrary primers.Nucleic AcidsResearch, 1990,18 (24): 7213～7218) two groups of leader almost are applied to molecule marker with round pcr simultaneously respectively, develop and a kind of New Molecular Marker technology RAPD (randomamplified polymorphic DNA, randomly amplified polymorphic DNA).The RAPD technology is quick, easy, and is with low cost.But, it is found that it is the dominant marker that there is certain defective: RAPD in this technology, can not provide complete information along with going deep into of research; Be subject to the experiment condition influence; Poor stability; The result can not distinguish homozygote and heterozygote.1989, Tautz has proposed SSR (Simple Sequence Repeat, simple sequence repeats, Tautz D.Hypervariability of simple sequences as ageneral source for polymorphic DNA markers[J] .N ucleic Aci dsResearch, 1989,17:6463～64711), claim microsatellite DNA (MicrosateliteDNA (Litt and Luty 1989 again, Litt M, LutyJ A.A hypervariable microsatelliterevealed by in vit2ro amplification of dinucleotide repeat within thecardiac muscle actin gene.A merican Journal of Human Genetics, 1989,44:397～4011).The SSR mark is to utilize the specific dna sequence dna in its two ends to design a pair of primer to carry out pcr amplification, gel electrophoresis then, data analysis.This technology has good stability and polymorphism, and the DNA consumption is few, and repeatability is high.But her exploitation and synthetic new SSR primer drop into height, difficulty is big, and a large amount of previous works must be arranged.(Moore SS such as Moore in 1991, Sargeant LL, King TJ, etal.The conservation of dinucleotide microsatellites among mammaliangenomes allows the use of heterologous PCR primer pairs in closelyrelated species[J] .Genomics, 1991,10:654～660) having founded SSR is the microsatellite DNA molecule marker.SSR distributes extensively, rich polymorphism, and synthetic SSR primer input is high, difficulty is big but early development reaches.The SSR mark is often away from functional gene, and is unfavorable to the research functional gene.Because SSR mutation rate height, the primer that develops can not be general.1992, Holland scholar Zabeau Marc and VosPieter (VosP, Hogers R, BleekerMetal.AFLP:a new technique for DNA fingerprinting.Nucleic Acids Research, 1995,21:4407～4414) RAPD and RFLP technology are combined, invented new molecule marker AFLP technology (amplified fragment lengthploymorphism, amplified fragment length polymorphism), obtained EUROPEAN PATENT OFFICE's patent in 1993, the patent No. is EP0534858A1 (Zabeau M, Vos P.Selective restriction fragmentamplification:a general method for DNA finger printing[P] .EuropeanPatent Office Publication 1993,0535858AI.).This technology fast, efficient, resolving power height, good reproducibility, be easy to stdn, be generalized to biological every field very soon.But also have significant disadvantages: technology is loaded down with trivial details; Process time is long; What detect is not allele; The expense costliness; The AFLP mark is the dominant marker, and complete information can not be provided.In addition, it usually uses radio isotope, and false positive is frequent.Nineteen ninety-five, (Umethara Y, Inagaki A such as Umethara, Tanou H, YasukochiY, Nagamura Y, Saji S, Otsuki Y, Fujimura T, Kurata N, Minobe Y, Construction and characterization of rice YAC library for physicalmapping.Molecular Breeding, 1995,1,79-89) with the physical map of cDNA as probe structure rice chromosome, this mark is a kind of EST mark.Calendar year 2001, (SchubertR such as Schubert, Starck GM, Riegel R (2001) Development of EST-PCR markers andmonitoring their intra populational genetic variation in Picea abies (L.) Karst.Theoretical and Applied Genetics, 103,1223-1231) use the EST-PCR molecule marker and carried out the research of European spruce genovariation.But the conservative property of the height of EST causes its polymorphism extremely low, is difficult to widely apply.1996, the scientist Lander of U.S. MIT (LanderE S.The new genomics:Global views of biology.Science, 1996,274:536～539) SNP (single nucleotide polymorphism, single nucleotide polymorphism) has been proposed.The SNP numbers of poles is many, and its genetic stability can be carried out quick, mass-producing examination far above SSR, is easy to gene type.The same with SSR, SNP also needs the previous work basis, and making a SNP figure needs a plurality of SNP, and is difficult to determine which SNP makes mistakes, and data are effectively analyzed.Calendar year 2001, the Li of California, USA university and Quiros (Li G, Quiros C F.Sequence--related amplifiedpolymorphism (SRAP), A new marker system based on a simple PCRreaction:its application to mapping and gene tagging in Brassica.TheorAppl Genet, 2001,103:455～461) delivered a kind of novel molecular mark SRAP (sequence-related amplified polymorphism, SRAP), be SBAPsequence-based amplified polymorphism again, based on sequence amplification polymorphism).2003, north crop science laboratory Hu of U.S. farming portion and Vick (Hu J, Vick BA.Targetregion amplification polymorphism, a novel marker technique for plantgenotyping.Plant Mol Biol Rep.2003,21,289-294) proposed the TRAP molecule marker again on the basis of SRAP, the primer of TRAP is directly used SRAP, and another designs according to EST.The advantage of TRAP and SRAP be easy and simple to handle, output is medium, band is easy to separate and can check order, operating process is simple, must not use isotropic substance.But these two kinds of technology exist the initial annealing temperature of common defects a: PCR low excessively, and false positive rate is too high.Except that first molecule marker RFLP is based on DNA Southern hybridization technique, Fa Zhan molecule marker PCR-based technology afterwards, their technological core is a primer design.

Can see that from above-mentioned situation Study on Molecular Marker has constantly had since the bibliographical information, the particularly nineties, develop very rapid.In general, research has afterwards all absorbed the former advantage and has overcome their deficiency, make it to continue to optimize, but existing molecular marking technique defective is still fairly obvious.Therefore, exploitation recruit's labeling technique easier, practical, good reproducibility is very necessary.

Summary of the invention

The objective of the invention is to overcome the deficiencies in the prior art, provide easy and simple to handle, output is medium, stability is high, a kind of conserved sequence amplified polymorphic molecular marker and the analytical procedure thereof of good reproducibility.

The present invention is achieved through the following technical solutions:

A kind of conserved sequence amplified polymorphic molecular marker is the pcr amplification product according to the conserved sequence design primer of expressed sequence tag EST and intron.

And described primer comprises immobilized primer and random primer, and this immobilized primer is according to target EST design, and the core sequence of this random primer is CACGC.

And its sequence of described immobilized primer is as follows:

E1：5’ATTCAGCCGATTGCA AGAGA 3’/CV171606

E2：5’TATCTTGACCAGGCGAGACCT 3’/CV171904。

And the sequence of described random primer is as follows:

C1：5’GACTGCGTACGCACGCTGA 3’

C2：5’GACTGCGTACGCACGCTGA 3’

C3：5’GACTGCGTACGCACGC AAC3’。

A kind of analytical procedure of conserved sequence amplified polymorphic molecular marker, its analytical procedure may further comprise the steps:

(1). designs fix primer and random primer;

(2). synthetic primer: use the synthetic primer that designs of dna synthesizer;

(3) .DNA extracts;

(4) .PCR amplification: utilize the primer of design and the DN template of extraction, selective reaction condition and reaction system are carried out PCR;

(5). the detection of amplified production: pcr amplification product carries out polyacrylamide gel electrophoresis;

(6). the collection of data and analysis: non-fluorescent label primer silver dyes to show amplified band, and band is added up, and is used for data analysis; Data analysis is carried out in directly scanning detection on the confocal fluorescent scanner of fluorescent dye primer.

And, being combined as of described random primer and immobilized primer:

C1/E1，C1/E2；C2/E1，C2/E2；C3/E1，C3/E2。

And described random primer and immobilized primer can be used fluorescent mark.

Beneficial effect of the present invention and advantage are:

1. molecule marker CRAP of the present invention is simple efficiently, the amplified band amount is medium; Simultaneously, because the annealing temperature of CRAP is always the normal temps of PCR, its reliability and repeatability increase than the former two.Because the core sequence of CRAP is the high conservative zone of intron, the matching rate in itself and intron site improves.And used the coding region design primer of specific gene, can directly study polymorphism in the gene.

2. the present invention passes through design of primers, the molecule marker SRAP of above-mentioned up-to-date formation and the advantage of TRAP technology have been kept, overcome their defective, remove possess easy and simple to handle, output is medium, band is easy to separate and can check order, must not use outside the advantage such as isotropic substance, have also that stability is high, the characteristics of good reproducibility.Can be used for studying analysis of genetic polymorphisms, germ plasm resource evaluation, the assignment of genes gene mapping, sibship analysis and molecular marker assisted selection breeding of plant, animal, the mankind and microorganism or the like.

Embodiment

The present invention is described in further detail by following examples, and following embodiment is illustrative, is not determinate, can not limit protection scope of the present invention with following embodiment.

Genetic identity between the red sage root population of the different places of production and genetic distance research

1. experiment material: the root of Henan, Sichuan, Shaanxi and the Jiangsu red sage root.

2. laboratory apparatus: low-temperature and high-speed whizzer (SIGMA 3K30), Ultralow Temperature Freezer (SANYO UltraLow), water bath (RB-200 type), Bechtop (Tianjin medicine treating plant factory), 752 spectrophotometers (Shanghai the 3rd analytical instrument factory), electrophoresis apparatus (Model 4000 Power supply LifeTechenologies Ins USA), electrophoresis ias (Kodak EDAS290), DNA cloning instrument (PE 9600), vortex mixer, the miniature high-speed whizzer, the horizontal strip electrophoresis instrument

3. reagent: CTAB, Tris-HCL (PH 8.0), EDTA, beta-mercaptoethanol, NaCL, NH4Ac, (packing of Promega Corp. couple stars company), chloroform, Virahol, dehydrated alcohol, agarose, the saturated phenol of Tris, RNA enzyme, glacial acetic acid, Spfu-DNA Polymerase (match Parkson company).Plant genome DNA rapid extraction test kit (ancient cooking vessel state company), dNTPS, Acrylamiole, bis, 10 * TBE, TEMED, 10%Ammonium Persulfate

4. experimental technique

4.1 DNA extraction

(1). preparation work: constant water bath box is adjusted to 65 ℃ of preheatings, the low-temperature and high-speed whizzer is adjusted to 4 ℃ of precoolings, and the small food processing machine takes out connects power supply, and it is ground cup together with base-20 ℃ precooling 10min.

(2). open liquid nitrogen container, take out earlier the minute quantity liquid nitrogen put into grind cup once more precooling make its temperature lower.Take out red sage root then, place immediately and grind cup, add a small amount of liquid nitrogen again, tighten base (the base explosive of screwing on too early when liquid nitrogen is evaporated completely soon rapidly! ), be placed on the main frame, firmly one to press, main frame rotates, and smashes red sage root sample.

(3). the little spoon with precooling changes the red sage root sample of smashing in the homogenizer over to, adds the CTAB extracting solution rapidly, homogenate.

(4). change in the 1.5ml eppendorf pipe every pipe 800ul after the homogenate over to.Place 65 ℃ of water baths, cracking 30min.

(5). take out and be cooled to room temperature, add the saturated phenol of Tris: chloroform (1: 1) 800ul, mixing, room temperature is placed 5min.

(6) .12000gpm, centrifugal 15min.

(7). get supernatant, add chloroform 600ul mixing, 12000gpm, centrifugal 10min.

(8). get supernatant, add Virahol 700ul mixing ,-20 ℃, precipitation 30min.

(9) .12000g centrifugal 15 minutes, discards Virahol.Of short duration centrifugal, micropipet is drawn residue Virahol, airing.

(10). add TE 50ul, RNAse 3ul, piping and druming mixing, 37 ℃, digestion 1h.

(11). add the 300ul dehydrated alcohol ,-20 ℃, precipitation 5min, 12000g, centrifugal 10min discards ethanol.

(12). add 75% ethanol 800ul, 12000g, centrifugal 3min discards ethanol.Of short duration more centrifugal, draw residue ethanol, airing with micropipet.

(13). add the TE30ul dissolving DNA.

(14). detect its integrity and purity.

4.2 design of primers

(1). it is CV171606 and CV171904 that the design of immobilized primer: a. finds relevant phenylpropyl alcohol (phenylpropanol) the pathways metabolism target sequence of Salvianic acidA biosynthesizing at the est database of the red sage root; B. these 2 sequences are called in PCR primer-design software oligo6.0; C. according to software prompt, parameter is set respectively; D. from the primer that software produces, optional 1 primer is as immobilized primer.Its sequence and the NCBI number of landing are as follows:

E1：5’ATTCAGCCGATTGCAAGAGA 3’/CV171606

E2：5’TATCTTGACCAGGCGAGACCT 3’/CV171904

(2). the design of random primer: random primer comprises 3 part core sequences, preamble sequence and back preamble sequence, core sequence is one section intron conserved sequence " CACGC ".Preamble sequence and back preamble sequence are from SRAP and TRAP.Its sequence is as follows:

C1：5’GACTGCGTACGCACGCTGA 3’

C2：5’GACTGCGTACGCACGCTGA 3’

C3：5’GACTGCGTACGCACGC AAC3’

(3). the combination of random primer and immobilized primer is as follows:

C1/E1，C1/E2；C2/E1，C2/E2；C3/E1，C3/E2。

4.3.PCR amplification

(1). reaction system:

Template DNA (25ng) 2ul

10×PCR Buffer 2μl

dNTPS(10mM each) 0.5ul

At random and each 1ul of immobilized primer (30pmol)

S-pfu archaeal dna polymerase (2.5U) 0.5ul

Deionized water adds to 20 μ l

After adding all ingredients, cover tight thin-walled tube lid, of short duration centrifugal mixing.In the PCR thin-walled tube of needs dropping paraffin oil, drip paraffin oil 30ul, put in the pcr amplification instrument.

(2) reaction tubes is placed on the PCR instrument, presses the surface temperature operation:

i 94℃ 4mi

ii 35cycle： 94℃ 45sec

52℃ 1min

72℃ 1min30sec

iii 72℃ 10min

4 ℃ of terminations of iv

Take out the sample of amplification, 4 ℃ of preservations.

4.4 denaturing polyacrylamide gel electrophoresis analysis

4.4.1 prepare glue glass plate

(1). liquid detergent cleans big or small sheet glass, tap water flushing several times, distilled water flushing 3 times, airing.The size sheet glass cleans must be clean, otherwise influence the back encapsulating.Carry out mark to distinguish undressed one side with the colourful transparent adhesive plaster before washing.

(2) .95% ethanol cleans big or small sheet glass.

(3). handle little glass plate: in little glass plate, toilet paper evenly spreads upon whole surface with it to spray an amount of " rain enemy ".Drying at room temperature 10 minutes is wiped unnecessary " rain enemy " gently.

(4). handle big glass plate: prepare Bind-Silane in stink cupboard, with 150 μ l Bind Silane, the 150ul Glacial acetic acid is added in 95% ethanol of 1.2ml, and thorough mixing all is added on the big glass plate, and toilet paper is evenly smeared whole surface.Room temperature 10 minutes is wiped unnecessary Bind-Silane gently.

(5). cleaning shop parting bead, application of sample comb, the big glass plate of handling well is placed on the horizontal glue mould, place spacer bar, press little glass plate alignment, clip the long-tail clip, prepare glue.

(6). denaturing polyacrylamide gel 60ml adds rapidly:

TEMED 60ul

10％Ammonium persulfate 240ul

Mixing gently

(7). carefully draw the gel mixed solution with the 20ml syringe, add between two blocks of glass plates, allow liquid flow downward from the top and arrive glass plate bottom up to liquid level, injection process can be beaten vibrations glass plate with fist, so that the gel mixed solution flows as the case may be gently.Injection process should be continuous, avoids bubble to produce.In case have edge to produce bubble, insert with filament immediately it is drawn.If a large amount of bubbles of middle generation can only be discarded again from new encapsulating.

(8). after the encapsulating success, insert application of sample comb (on the teeth directional) rapidly between the two glass plates of top, and decide the top with the long-tail clamping.

(9). polymerized at room temperature is more than 1 hour.

4.4.2. prerunning

(1). after gel polymerisation is good, remove the long-tail folder, place gel slab on the vertical electrophoresis groove, tighten retaining screw after the alignment.

(2). in the groove up and down of vertical electrophoresis groove, add about 500ml 1 * tbe buffer liquid respectively.

(3). carefully remove the application of sample comb, with little suction pipe flushing loading slot.

(4). connect power supply, regulating voltage, constant voltage 85v prerunning 0.5 hour.

4.4.3. electrophoresis

(1). amplified production 10ul adds the 5ul sample-loading buffer.

(2) .95 ℃ of sex change is 10 minutes, takes out immediately and places cooled on ice.

(3). the gel prerunning is cut off the electricity supply after finishing.Wash loading slot once more, blow away bubble.

(4). carefully insert comb (under the teeth directional), wash two times.Successively sample and DNAmarker are added the gel loading slot from left to right then.

(5). constant voltage 100v electrophoresis 1.5 hours.

4.4.4. silver dyes

(1). electrophoresis is opened retaining screw after finishing, and takes off gel glass plate from electrophoresis chamber and places on the horizontal glue mould.Pull out comb, loosening spacer bar carefully removes little sheet glass, and gel sticks on the big glass plate.

(2). big glass plate is put into 2000ml stationary liquid box gently, open rotary shaker and slowly shake fixedly 20min.

(3). distilled water washing 2 times, each 5min.

(4). change in the 2000ml silver dye liquor box, rotary shaker slowly shakes silver and dyes 30min.

(5). washing 10s.

(6). change over to rapidly in the 2000ml developing solution box, rotary shaker slowly shakes until bands of a spectrum and shows, and develops a moment again.

(7). in developing solution, when treating that band is clear slightly, directly change in the stationary liquid photographic fixing 5min over to.

(8). washing 5min.

(9). take out gel, seasoning.

4.4.5. the collection of data and analysis

According to the requirement of Computer Analysis, data matrix is added up and converted to the band that occurs on the TRAP polyacrylamide gel.Each band is considered as a site, and it is 1 (strong band and the equal assignment of weak band are 1) that the band assignment is arranged, and the assignment of not having band is 0, obtains 1,0 data matrix, with this matrix input computer.For pleomorphism site, repeat all can stablize more than 3 times the difference band that occurs and be used for data analysis.Use the POPGENE32 analysis software and calculate the genetic identity and the genetic distance of the different places of production red sage root, and set up cluster branch of system dendrogram.

4.4.6. genetic identity between the red sage root 4 populations and genetic distance analysis

Genetic identity and genetic distance are the important parameters of weighing the population genetic diversity.The soft PopGene32 of utilization population genetic analysis calculates genetic identity and the genetic distance (table) between the red sage root 4 populations.

Genetic identity (upper right) between 4 kinds of red sage root populations of table 1 and genetic distance (lower-left) table

Population	Henan	Sichuan	Shaanxi	Jiangsu
					Jiangsu, Shaanxi, Sichuan, Henan	**** 0.0267 0.0740 0.0529	0.9737 **** 0.0789 0.0257	0.9287 0.9242 **** 0.0840	0.9485 0.9746 0.9194 ****

As can be seen from the above table, Shanglou, Shaanxi red sage root and Jiangsu sun horse red sage root genetic identity minimum are 0.9194, the genetic identity of Jiang Dancan and the Jiangsu sun horse red sage root is 0.9746 to the maximum in the Sichuan, the genetic distance of Shanglou, the Shaanxi red sage root and the Jiangsu sun horse red sage root is 0.0840 to the maximum, and the genetic distance minimum of Jiang Dancan and the Jiangsu sun horse red sage root is 0.0257 in the Sichuan.Various places are for the genetic identity average out to 0.9245 of examination storeroom, and genetic distance average out to 0.0788 shows that red sage root germplasm sibship is very near, illustrate in the different population of the red sage root not only to have contained heritable variation but also kept higher genetic stability.

Claims (7)

1. a conserved sequence amplified polymorphic molecular marker is characterized in that: be the pcr amplification product according to the conserved sequence design primer of expressed sequence tag EST and intron.

2. conserved sequence amplified polymorphic molecular marker according to claim 1 is characterized in that: described primer comprises immobilized primer and random primer, and this immobilized primer is according to target EST design, and the core sequence of this random primer is CACGC.

3. conserved sequence amplified polymorphic molecular marker according to claim 2 is characterized in that: the sequence of described immobilized primer is as follows:

E1：5’ATTCAGCCGATTGCAAGAGA 3’/CV171606

E2：5’TATCTTGACCAGGCGAGACCT 3’/CV171904。

4. conserved sequence amplified polymorphic molecular marker according to claim 2 is characterized in that: the sequence of described random primer is as follows:

C1：5’GACTGCGTACGCACGCTGA 3’

C2：5’GACTGCGTACGCACGCTGA 3’

C3：5’GACTGCGTACGCACGC AAC3’。

5. the analytical procedure of a conserved sequence amplified polymorphic molecular marker as claimed in claim 1, it is characterized in that: analytical procedure may further comprise the steps:

(1). designs fix primer and random primer;

(2). synthetic primer: use the synthetic primer that designs of dna synthesizer;

(3) .DNA extracts;

(4) .PCR amplification: utilize the primer of design and the DN template of extraction, selective reaction condition and reaction system are carried out PCR;

(5). the detection of amplified production: pcr amplification product carries out polyacrylamide gel electrophoresis;

(6). the collection of data and analysis: non-fluorescent label primer silver dyes to show amplified band, and band is added up, and is used for data analysis; Data analysis is carried out in directly scanning detection on the confocal fluorescent scanner of fluorescent dye primer.

6. the analytical procedure of conserved sequence amplified polymorphic molecular marker according to claim 5 is characterized in that: being combined as of described random primer and immobilized primer:

C1/E1，C1/E2；C2/E1，C2/E2；C3/E1，C3/E2。

7. the analytical procedure of conserved sequence amplified polymorphic molecular marker according to claim 5, it is characterized in that: described immobilized primer and random primer can be used fluorescent mark.