CN101220361A - Representation method for recombinant american cockroaches allergen protein - Google Patents
Representation method for recombinant american cockroaches allergen protein Download PDFInfo
- Publication number
- CN101220361A CN101220361A CNA2008100084590A CN200810008459A CN101220361A CN 101220361 A CN101220361 A CN 101220361A CN A2008100084590 A CNA2008100084590 A CN A2008100084590A CN 200810008459 A CN200810008459 A CN 200810008459A CN 101220361 A CN101220361 A CN 101220361A
- Authority
- CN
- China
- Prior art keywords
- per
- periplaneta americana
- recombinant
- protein
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to the field of biotechnology and discloses an expression method of a recombinant periplaneta Americana allergen protein. The invention aims at solving the shortcoming of the immune tolerance therapy of cockroach allergen leaching liquor, total RNA is extracted from common cockroach species periplaneta Americana tissues for obtaining the coding genes of major allergen genes of Per a 1.0101, Per a 1.0102, Per a 1.0104 and Per a 7.01 of the periplaneta Americana by amplification, the low-temperature induction expression of the recombinant cockroach allergen protein in escherichia coli by adopting genetic engineering means can be used for the diagnosis and the treatment of hypersensitivity diseases which are caused by cockroaches and can avoid the obstacles of the non-single property and the difficult standardization of natural extracts.
Description
The application is that title is the expression method of recombinant Periplaneta americana allergen protein, and the applying date is on July 21st, 2006, and application number is 200610036646.0 divides an application
Technical field
The present invention relates to biological technical field, specifically, relate to a kind of Recombinant Protein Expression method.
Background technology
Allergic disease is classified as one of three big diseases of 21 century keypoint control by the World Health Organization.The generation of allergic disease is very extensive, and the whole world has 1/3 population to suffer from allergic disease.In allergic disease, bronchial asthma (abbreviation asthma) accounts for 1/4 of whole cases.2004, the World Health Organization announced that there are 300,000,000 asthmatic patients in the whole world in " report of global asthma burden ".China's pathogenesis of asthma rate is 0.5~1.5%, and there is asthmatic patient about 2,000 ten thousand in the whole nation.Although the asthma prevalence of China is starkly lower than western developed country, the mortality ratio of China's asthmatic patient occupies the whole world first up to 36.7/10 ten thousand.Asthma can be caused by multiple factor, anaphylactogen wherein, and especially indoor anaphylactogen has a very important role.Indoor anaphylactogen mainly comprises animal scurf, dirt mite and cockroach etc.Cockroach can cause that the report of asthma appears at the sixties in last century the earliest.But up in recent years, the effect of cockroach in the asthma morbidity just is subjected to people's attention gradually.This is because a large amount of uses of conditioning unit and the improvement of warming installation, for the relatively poor cockroach of cold hardiness provides suitable living environment, add the of a great variety of cockroach, reproductivity is extremely strong, characteristics such as easy-clear not, make cockroach pollution level aggravation in the room, the level of cockroach allergen generally improves, and cockroach incidence hypersensitive is also significantly risen.In the U.S., the irritated rate of cockroach is 27.5~42% in the asthmatic patient, and Europe is 3.9~24.5%, and Africa is 30~44.6%, and the irritated rate of childhood asthma patient's cockroach is 27.8~43.8% in the big cities such as China Beijing, Shanghai.Therefore, cockroach has become one of primary hazard factor of bringing out asthma.The effect of cockroach in allergic diseases such as asthma is subjected to people and more and more pays close attention to.
Periplaneta americana is the main kind of China southern area cockroach, and is almost ubiquitous.As the American cockroach allergen protein of main indoor anaphylactogen, not only the harm of itself is that people can't evade, and exists cross reaction between the anaphylactogen of American cockroach allergen and other type, very easily causes irritated crowd and anaphylaxis occurs.
The best approach of allergy treatment is to use specific antigens to carry out processing immune tolerant treatment.What traditional immunotherapy was used is the cockroach extractive substance, contain multiple antigenic component, there are notable difference in its relative potency and specific antigens level, and it is quantitative to be difficult to carry out stdn, cause that easily the therapeutic anaphylaxis appears in the patient, therefore limited the application of immunotherapy.And the proteic output height of recombinant allergens, working condition is constant, helps carrying out the stdn of anaphylactogen, is more suitable for carrying out clinical diagnosis and treatment.
Summary of the invention
The objective of the invention is to carry out the deficiency of processing immune tolerant treatment at the cockroach allergen vat liquor, from common cockroach kind periplaneta americana tissue, extract total RNA, amplify the encoding gene of the main allergen protein Per of periplaneta americana a1.0101, Per a 1.0102, Per a 1.0104, Per a 7.01, pass through genetic engineering means, low temperature induction express recombinant cockroach allergen albumen in intestinal bacteria, can be used for the diagnosis and the treatment of the hypersensitivity disorders that cockroach causes, avoided the non-singularity of natural extract and the obstacle of stdn difficulty.
The expression method of recombinant Periplaneta americana allergen protein Per a 1.0101, Per a 1.0102, Per a1.0104 or the Per a 7.01 that the present invention relates to comprises the steps:
(1) from the periplaneta americana tissue, extracts total RNA;
(2) synthetic primer:
pET-Per?a?1.0101-P1?CATATGGAGTTCCAGAGCATTATCTCAAC
pET-Per?a?1.0101-P2?AAGCTTTCAGGGCAGGCCGAACAAG
pET-Per?a?1.0102-P1?CATATGAGCATTATCTCAACTCTAAATGCCATGCC
pET-Per?a?1.0102-P2?AAGCTTTCAGGGCAGGCCGAACAAGCTGC
pET-Per?a?1.0104-P1?CATATGGTTGGTGTCGATGGTCTCATAGAC
pET-Per?a?1.0104-P2?AAGCTTTCAGGGCAGGCCGAACCAG
pET-Per?a?7.01-P1 GAATTCGACGCGATCAAGAAGAAGATG
pET-Per?a?7.01-P2 GCGGCCGCGTTGCCAATAAGTTCGGTGAAAG
(3) be template with total RNA, obtain American cockroach allergen protein encoding gene fragment by RT-PCR;
(4) encoding gene is cloned in the prokaryotic expression carrier, transforms the host bacterium, cultivate the gained recombinant bacterial strain, induce it to express target protein then;
(5) adopt the affinity chromatography method that target protein is carried out purifying, thereby obtain recombinant Periplaneta americana allergen protein Per a 1.0101, Per a 1.0102, Per a 1.0104 or the Per a 7.01 of purifying.
In above-mentioned expression method, the described RT-PCR reaction conditions of step (3) is 94 ℃, 3min; 94 ℃, 30S; 60 ℃, 45S; 72 ℃, 1min; 30 circulations, 72 ℃ are extended 10min.
In above-mentioned expression method, the described prokaryotic expression carrier pET-28a of step (4).
In above-mentioned expression method, the described host bacterium of step (4) is e. coli bl21 (DE3).
In above-mentioned expression method, the substratum of the described cultivation of step (4) is the LB liquid nutrient medium, and culture temperature is 20~37 ℃, incubation time 6~16 hours.
In above-mentioned expression method, the described inductive inductor of step (4) is IPTG, and concentration is 0.2~1.0mM, and inducing temperature is 16 ℃~30 ℃.
In above-mentioned expression method, the method for the described purifying of step (5) is: American cockroach allergen protein is expressed engineering bacteria cultivated centrifugal collection thalline, freeze overnight 16 hours at 24 ℃; Thalline is placed thawing on ice, then add bacterial lysate, the weight in wet base thalline; Fully after the cracking, centrifugal at ambient temperature, then get under supernatant liquor and the 50%Ni-NTA agarose resin room temperature and mix, be loaded into chromatography column and carry out chromatography; The back is washed with isopyknic washing lotion, uses the elutriant wash-out of 1/2 volume at last; The freeze-drying after dialysing of albumen behind the purifying is preserved.Described bacterial lysate is 50mM NaH
2PO
4, 300mM NaCl, 10mM imdazole, pH 8.0; Described washing lotion 50mM NaH
2PO
4, 300mM NaCl, 20mM imdazole, pH 8.0; Described elutriant is 50mM NaH
2PO
4, 300mM NaCl, 250mM imdazole, pH 8.0.
Compared with prior art, the present invention has following beneficial effect: the present invention extracts total RNA from common cockroach kind periplaneta americana tissue, amplify the main allergen protein Per of periplaneta americana a 1.0101, Per a1.0102, Per a 1.0104, the encoding gene of Per a 7.01, pass through genetic engineering means, low temperature induction solubility expression reorganization cockroach allergen albumen in intestinal bacteria, the reorganization cockroach allergen albumen that is obtained has kept biologic activity, can be used for the diagnosis and the treatment of the anaphylactic disease that cockroach causes, avoided the non-singularity of natural extract and the obstacle of stdn difficulty.
Description of drawings
Fig. 1 is the total RNA electrophorogram that extracts from the periplaneta americana tissue;
The American cockroach allergen protein gene fragment electrophorogram that Fig. 2 obtains for RT-PCR;
Fig. 3 is that the PCR of cloned plasmids pMD-Per a identifies electrophorogram;
Fig. 4 is that the double digestion of cloned plasmids pMD-Per a is identified electrophorogram;
Fig. 5 is that the PCR of expression plasmid pET-Per a identifies electrophorogram;
Fig. 6 is that the double digestion of expression plasmid pET-Pera is identified electrophorogram;
Fig. 7-A is that American cockroach allergen protein P1.0101 SDS-PAGE detects electrophorogram;
Fig. 7-B is that American cockroach allergen protein P1.0102 SDS-PAGE detects electrophorogram;
Fig. 7-C is that American cockroach allergen protein P1.0104 SDS-PAGE detects electrophorogram;
Fig. 7-D is that American cockroach allergen protein P7.01 SDS-PAGE detects electrophorogram;
Fig. 8 is the solubility expression electrophorogram of low temperature induction;
Fig. 9-A is the P1.0101 protein electrophoresis figure of purifying;
Fig. 9-B is the P1.0102 protein electrophoresis figure of purifying;
Fig. 9-C is the P1.0101 protein electrophoresis figure of purifying;
Fig. 9-D is the P1.0101 protein electrophoresis figure of purifying;
Figure 10 is that the immune marking of recombinant Periplaneta americana allergen detects figure;
Wherein, among Fig. 2,1,2:Per a1.0101; 3,4:Per a1.0102; 5,6:Per a1.0104; 7,8:Per a7.01; M:DL2000 DNA marker.Among Fig. 3,1,2:Per a1.0101; 3,4:Per a1.0102; 5,6:Peral.0104; 7,8:Pera7.01; M:DL2000DNA marker.Among Fig. 4,1:Pera1.0101; 2:Per a1.0102; 3:Per a1.0104; 4:Per a7.01; M:DL2000 DNA marker.Among Fig. 5,1,2:Per a1.0101; 3,4:Per a1.0102; 5,6:Per a1.0104; 7,8:Pera7.01; M:DL2000 DNA marker.Among Fig. 6,1:Per a1.0101; 2:Per a1.0102; 3:Per a1.0104; 4:Per a7.01; M:DL2000 DNA marker.Among Fig. 7-A, 1-8: the target protein of expression; M: lower molecular weight standard protein; C: induce preceding contrast.Among Fig. 7-B, 1-8: the target protein of expression; M: lower molecular weight standard protein; C: induce preceding contrast.Among Fig. 7-C, 1-7: the target protein of expression; M: lower molecular weight standard protein; C: induce preceding contrast.Among Fig. 7-D, 1-7: the target protein of expression; M: lower molecular weight standard protein; C: induce preceding contrast.Among Fig. 8, M: lower molecular weight standard protein; 1, the last cleer and peaceful precipitation of 2:P1.0101; 3, the last cleer and peaceful precipitation of 4:P1.0102; 5, the last cleer and peaceful precipitation of 6:P1.0104; 5, the last cleer and peaceful precipitation of 6:P7.01.Among Fig. 9-A, M: lower molecular weight standard protein; 1-9 is the albumen that contains in the different elutriants.Among Fig. 9-B, M: lower molecular weight standard protein; 1-10 is the albumen that contains in the different elutriants.Among Fig. 9-C, M: lower molecular weight standard protein; 1-8 is the albumen that contains in the different elutriants.Among Fig. 9-C, M: lower molecular weight standard protein; 1-8 is the albumen that contains in the different elutriants.Among Fig. 9-D, M: lower molecular weight standard protein; 1-6 is the albumen that contains in the different elutriants.
Among Figure 10,1:P1.0101; 2:P1.0102; 3:P1.0104; 4:P7.01.
Embodiment
1 materials and methods
1.1 material
1.1.1 periplaneta americana
Adult bombay canary is taken from Shantou City's local-style dwelling houses, fresh sampling, and liquid nitrogen freezing, the back moves into-70 ℃ of preservations.
1.1.2 bacterial strain and carrier
E. coli jm109, BL21 (DE3) bacterial strain, pET-28a expression vector are that transformation reactions institute of University Of Shantou preserves, and the pMD18-T cloning vector is available from the precious biotechnology (Dalian) of TAKARA company limited.
1.1.3 main enzyme and reagent
Ex Taq enzyme (TaKaRa), DNA reclaim test kit, plasmid extraction agent box (QIAGEN), restriction enzyme (NEB) in a small amount fast; T
4Dna ligase, ImProm-II
TMReverse transcription test kit, agarose (Promega company); TRIZOL Reagent (GIBCO BRL company); The sheep anti human IgE (ε) of peroxidase labelling (KPL); Liquid D AB+ substrate luminescent system (DAKO); All the other conventional reagent of His Bind protein purification test kit (Novagen) are the former installed reagents of import.
1.1.4 serum specimen
Serum picks up from Chaoyang, Shantou transformation reactions section of hospital, the asthmatic patient that the cockroach allergen skin test is positive clinically.Then use Parmacia CAP anaphylactogen automatic checkout system, determine the positive serum of Groton bug anaphylactogen crude extract specific IgE Ab>2.Be stored in-70 ℃ standby, control serum picks up from the health adult of no allergies.
1.1.5 key instrument
Pcr amplification instrument (GeneAmp PCR System 9 600, the U.S.); High speed freezing centrifuge (Japan);-70 ℃ of Ultralow Temperature Freezers (SANYO); DYY-III type electrophoresis apparatus (Liuyi Instruments Plant, Beijing); TGL-16G high speed tabletop centrifuge (Shanghai medical analytical instrument factory); DNA/RNA calculator (Pharmaciabiotech); SDS-PAGE electrophoresis equipment (BIO-RAD); Gel imaging system (sky, Shanghai energy company); TH2-82 type constant temperature oscillator (Shanghai make a leapleap forward medical apparatus and instruments factory); Constant incubator (Shanghai make a leapleap forward instrument plant).
1.2 method
1.2.1 the extraction (Trizol method) of total RNA
Adopt TRIZOL Reagent test kit to extract total RNA: get frozen periplaneta americana, shred, liquid nitrogen grinding adds Trizol reagent, total amount 10ml by 200~300mg tissue/ml Trizol.Leave standstill 10min, then press 300ul/ml Trizol and add chloroform, mixing leaves standstill 20min, and 4 ℃, the centrifugal 15min of 12000g.Get supernatant, press 500ul/ml Trizol and add Virahol, mixing leaves standstill 10min.4 ℃, the centrifugal 10min of 12000g abandons supernatant, and pipe end precipitation is RNA.Add 75% ethanol suspension precipitation, 4 ℃, the centrifugal 5min of 12000g abandons supernatant.Drying at room temperature 5 minutes adds the distilled water dissolving that 50ul does not have Rnase.
1.2.2.RT-PCR amplification American cockroach allergen protein gene
Adopt ImProm-II
TMThe reverse transcription test kit is a template with the total RNA of periplaneta americana that extracts, and is that primer (working concentration is 10 pmol/ μ l) carries out the RT reaction with Oligo-dT.Obtain the sequence of American cockroach allergen Per a 1.0101, Per a1.0102, Per a 1.0104, Per a 7.01 from GenBank (http://www.ncbi.nlm.nih.gov) database of NCBI, the design primer is as follows:
pET-Per?a?1.0101?sense 5′CATATGGAGTTCCAGAGCATTATCTCAAC?3′
pET-Per?a?1.0101?antisense 5′AAGCTTTCAGGGCAGGCCGAACAAG 3′
pET-Per?a?1.0102?sense 5′CATATGAGCATTATCTCAACTCTAAATGCCATGCC?3′
pET-Per?a?1.0102?antisense 5′AAGCTTTCAGGGCAGGCCGAACAAGCTGC?3′
pET-Per?a?1.0104?sense 5′CATATGGTTGGTGTCGATGGTCTCATAGAC?3′
pET-Per?a?1.0104?antisense 5′AAGCTTTCAGGGCAGGCCGAACCAG 3′
pET-Per?a?7.01 sense 5′GAATTCGACGCGATCAAGAAGAAGATG?3′
pET-Per?a?7.01 antisense 5′GCGGCCGCGTTGCCAATAAGTTCGGTGAAAG?3′
Wherein 5 of Per a 1.0101, Per a 1.0102, Per a 1.0104 ' end adds Nde I restriction enzyme site, 3 ' end adds Hind III restriction enzyme site, the fragment that is increased is respectively 693bp, 684bp and 822bp, and encoded protein is 26.23kDa, 25.8kDa and 31.15kDa; 5 of Per a 7.01 ' end and 3 ' end are respectively EcoR I and Not I restriction enzyme site, and the fragment that is increased is 852bp, and encoded protein is 32.78kDa.All primer is synthetic by the handsome Bioisystech Co., Ltd in Shanghai.
CDNA is a template with the reverse transcription synthetic, uses above-mentioned primer to carry out pcr amplification respectively.The PCR reaction conditions is 94 ℃, 3min; 94 ℃, 30S; 60 ℃, 45S; 72 ℃, 1min; 30 circulations, 72 ℃ are extended 10min.Use the sepharose recovery test kit of QIAGEN to carry out the recovery of PCR product.
1.2.3 the clone of American cockroach allergen protein gene
The PCR product that is recovered to is connected with the pMD18-T carrier respectively, and 16 ℃ of connections are spent the night.Be built into recombinant clone plasmid pMD-Per a 1.Use CaCl
2Legal system is equipped with E.coli JM109 competent cell, the E.coli JMl09 competent cell that product transforms prepared fresh will be connected, adopt the plasmid a small amount of extraction agent box of QIAGEN company to extract recombinant plasmid dna, after PCR and double digestion are identified correctly, with positive bacterium colony incubated overnight, make glycerol stock, serve extra large handsome Bioisystech Co., Ltd and carry out sequencing.
1.2.4 the structure of American cockroach allergen protein gene prokaryotic carrier
American cockroach allergen protein gene clone plasmid pMD-Per a that order-checking is correct and prokaryotic expression carrier pET-28a use the corresponding nucleic acids restriction endonuclease to carry out enzyme respectively and cut, be connected after the big fragment of target gene fragment and carrier reclaims, make up American cockroach allergen gene prokaryotic plasmid pET-Per a.Connect product Transformed E .coli JM109 competent cell, adopt the method for PCR and double digestion that recombinant expression plasmid is identified.
1.2.3 the abduction delivering in the comfortable Bacillus coli cells of recombinant Periplaneta americana allergen egg
To identify that correct pET-Per a expression plasmid is transformed into E.coli BL21 (DE3) competent cell, make up people's American cockroach allergen protein Per a and express engineering bacteria pET-Per a-BL21 (DE3).Extract plasmid, after double digestion is identified correctly, positive reorganization bacterium is carried out abduction delivering.(1) positive expression bacterial strain pETPer a-BL21 (DE3) is inoculated in the LB liquid nutrient medium that contains Kan 37 ℃ of overnight incubation; (2) by the thousandth amount, above-mentioned expression bacterium liquid is inoculated in the LB substratum that contains Kana, 37 ℃ of 200rpm shaking culture are to OD
600=0.4~1 (approximately 3h); (3) take out 1ml bacterium liquid and give over to contrast (0h), add IPTG to final concentration be 1mmol/L, continue inducing culture, collection bacterium liquid in 1,2,3,4, behind the 5h.(4) centrifugal collection thalline is washed bacterial sediment once with 100mmol/L Tris (pH 8.0), and ice-bath ultrasonic is transparent to suspension.
1.2.4 the polyacrylamide gel electrophoresis of expression product (SDS-PAGE) detects
Get cellular lysate thing 1.0ml, 10 000 leave the heart, abandon supernatant; TE 100 μ l and 3 times of sample-loading buffer 50 μ l of in cellular lysate thing precipitation, adding pH8.0; Boil 2~5min, the centrifugal 5min of 10 000rpm; Record 12% separation gel and 5% spacer gel.Sample 10 μ l on every hole, Marker all goes up sample, does discontinuous vertical electrophoresis.Electrophoresis finishes the back and dyes with Xylene Brilliant Cyanine G R-250.
1.2.5 the low temperature induction of recombinant Periplaneta americana allergen protein in Bacillus coli cells expressed and the optimization of expression condition
To identify that correct expression strain carries out low temperature induction between 16 ℃-30 ℃, adjust the concentration and the induction time of inductor simultaneously, purpose is to reduce the formation of inclusion body to greatest extent, realizes the solubility expression of target protein, obtains to have bioactive recombinant Periplaneta americana allergen protein.Determine at last at 24 ℃, 16h, IPTG concentration is to realize the solubility expression of recombinant Periplaneta americana allergen protein under the condition of 0.6mM.
1.2.6 the purifying of recombinant Periplaneta americana allergen protein
By the Ni-NTA agarose is the purifying that solid phase affinity chromatography system carries out target protein.The concrete operations step is as follows: American cockroach allergen protein is expressed engineering bacteria cultivate 16h at 24 ℃, 4000g collected thalline ,-20 ℃ of freeze overnight in centrifugal 20 minutes.Thalline is placed thawing on ice, then add bacterial lysate (50mM NaH
2PO
4, 300mM NaCl, 10mM imdazole, pH 8.0), 5ml/g weight in wet base thalline.After the complete at ambient temperature cracking, 10000g/min carries out centrifugal, then gets supernatant liquor and mixes with 50%Ni-NTA agarose resin (4: 1), in conjunction with 1h, is loaded into chromatography column and carries out chromatography under the room temperature.Then use isopyknic washing lotion (50mMNaH
2PO
4, 300mMNaCl, 20mM imdazole, pH 8.0) wash 2 times, use elutriant (the 50mM NaH of 1/2 volume at last
2PO
4, 300mM NaCl, 250mM imdazole, pH 8.0) and wash-out 4 times.The freeze-drying after dialysing of albumen behind the purifying is preserved.
1.2.7 the immune marking of recombinant allergens detects
Expression product is through the 10%SDS2PAGE electrophoretic separation, then with the protein electrotransfer to nitrocellulose filter, with 37 ℃ of sealings of the TBST that contains the 20gPL bovin serum albumin, 2 h; Wash 4 ℃ of overnight incubation of the irritated patient's positive serum of cockroach of back and dilution in 1: 5, add through TBST after washing and dilute (1: 1 000) biotin labeled anti human IgE antibody, hatch 1h for 37 ℃; After washing, add Streptavidin, hatch 1h for 37 ℃ through the HRP mark of TBST dilution (1: 1 000); Behind thorough washing, diaphragm is put into freshly prepared diaminobenzidine (DAB) substrate solution, fully manifest to brown district band in the room temperature jolting, film is put in the redistilled water and is washed, the color development stopping reaction.
2 results
2.1 the extraction of the total RNA of periplaneta americana
Utilize the Trizol method from the total RNA of people periplaneta americana tissue extraction.Carry out electrophoresis in 1% sepharose of denaturing formaldehyde, ultraviolet lamp is observed down, can see 2 electrophoretic bands clearly, is respectively 28S and 18S, illustrates that RNA extracts successful (see figure 1).
2.2 the pcr amplification of American cockroach allergen protein Per a gene
With reverse transcription synthetic cDNA is that template is carried out pcr amplification, reaction finishes back with 1% agarose gel electrophoresis analysis, with DL-2 000 is DNA Marker, the result can see specific DNA cloning band in the corresponding position of each goal gene, conform to intended purposes band size, the American cockroach allergen protein Per a (see figure 2) that successfully increased is described.
2.3 the evaluation of recombinant plasmid pMD-Per a
Goal gene is connected with the pMD18-T carrier, makes up the cloning vector of American cockroach allergen gene.Connect product Transformed E .coli JM 109 competent cells.Extract plasmid, identify recombinant plasmid with PCR and double digestion respectively, the results are shown in Figure 3 and 4.As can be seen, no matter be pcr amplification among the figure, or the double digestion evaluation, all can see the clear electrophoretic band that conforms to purpose band size, show successfully to have made up recombinant Periplaneta americana allergen protein Per a gene clone plasmid pMD-Per a.
2.4 the sequencing of American cockroach allergen protein Per a gene
To identify that correct reorganization bacterium serves extra large handsome Bioisystech Co., Ltd and carry out sequencing through PCR and double digestion.Use DNAsis software, the sequence of measuring American cockroach allergen protein Per a 1.0101, Per a 1.0102, Per a 1.0104 and Per a 7.01 genes delivered among sequence and the GenBank is compared, and the size of the periplaneta americana allergen protein Pera 1.0101 that this experiment obtained, Per a 1.0102, Per a 1.0104 and Per a 7.01 is respectively 696 bp, 687bp, 825bp and 855bp (including terminator codon).Wherein Pera 1.0101 genes have 8 bases to undergo mutation, Per a 1.0102 and Per a 1.0104 genes all have 28 bases to undergo mutation, Per a 7.01 has 1 base to undergo mutation, with the periplaneta americana allergen protein Pera of delivering among the GenBank 1.0101, Per a 1.0102, the homology of Per a 1.0104 and Per a 7.01 is respectively 98%, 95%, 96% and 99%, show that this experiment correctly cloned periplaneta americana allergen protein Pera 1.0101, Per a 1.0102, the gene of Per a 1.0104 and Per a 7.01 conforms to expected results.The sudden change of gene may be relevant with the different sources of selected periplaneta americana.
2.5 the structure of American cockroach allergen protein Per a prokaryotic expression plasmid pET-Per a
Order-checking is identified that correct cloned plasmids pMD-Per a and expression vector pET-28a carries out the big fragment that purpose fragment and carrier were cut and reclaimed to enzyme respectively, the purpose fragment is connected with expression vector pET-28a fragment, makes up the expression plasmid pET-Per a of American cockroach allergen protein Per a.Connect product transformed into escherichia coli JM109 competent cell, extract plasmid, carry out PCR and double digestion and identify, the results are shown in Figure 5 and 6.
2.6 the expression of periplaneta americana gene in E.coli BL21 (DE3) cell
With prokaryotic expression plasmid pET-Per a Transformed E .coli BL21 (DE3) competent cell that builds, use 1.0mM IPTG under 37 ℃, to carry out abduction delivering, induction time is 5h.Tropina is carried out the 10%SDS-PAGE electrophoresis detection.The result conforms to the expection molecular weight seeing target protein band (Fig. 7) clearly with the corresponding position of target protein size approximately.
2.7 the low temperature induction of recombinant Periplaneta americana allergen protein in Bacillus coli cells expressed and the optimization of expression condition
By adjusting the concentration and the induction time of inducing temperature, inductor, at last at 24 ℃, 16h, IPTG concentration is to have realized the solubility expression of recombinant Periplaneta americana allergen protein under the condition of 0.6mM, the results are shown in Figure 8.
2.8 the purifying of recombinant Periplaneta americana allergen protein
By the Ni-NTA agarose is the purifying that solid phase affinity chromatography system carries out target protein, the results are shown in Figure 9.
2.9 the immune marking of recombinant Periplaneta americana allergen detects
Use periplaneta americana allergy patient's serum that purified product is carried out Western blot detection.The result shows that the cockroach allergen albumen behind the purifying can specific immune response take place with the patients serum.The albumen that proof is obtained is cockroach allergen albumen.The results are shown in Figure 10.
A kind of expression method sequence table of recombinant Periplaneta americana allergen protein
SEQUENCE?LISTING
<110〉Medical College of Shantou University
<120〉a kind of expression method of recombinant Periplaneta americana allergen protein
<130>
<160>4
<170>PatentIn?version?3.2
<210>1
<211>
<212>DNA
<213〉artificial primer
<400>1
pET-Per?a?1.0101-P1 CATATGGAGTTCCAGAGCATTATCTCAAC
pET-Per?a?1.0101-P2 AAGCTTTCAGGGCAGGCCGAACAAG
<210>2
<211>
<212>DNA
<213〉artificial primer
<400>2
pET-Per?a?1.0102?P1 CATATGAGCATTATCTCAACTCTAAATGCCATGCC
pET?Per?a?1.0102-P2 AAGCTTTCAGGGCAGGCCGAACAAGCTGC
<210>3
<211>
<212>DNA
<213〉artificial primer
<400>3
pET-Per?a?1.0104-P1 CATATGGTTGGTGTCGATGGTCTCATAGAC
pET-Per?a?1.0104-P2 AAGCTTTCAGGGCAGGCCGAACCAG
<210>4
<211>
<212>DNA
<213〉artificial primer
<400>4
pET-Per?a?7.01-P1 GAATTCGACGCGATCAAGAAGAAGATG
pET-Per?a?7.01-P2 GCGGCCGCGTTGCCAATAAGTTCGGTGAAAG
Claims (8)
1. the expression method of a recombinant Periplaneta americana allergen protein Per a 1.0104 is characterized in that comprising the steps:
(1) from the periplaneta americana tissue, extracts total RNA;
(2) synthetic primer:
pET-Per?a?1.0104-P1 CATATGGTTGGTGTCGATGGTCTCATAGAC
pET-Per?a?1.0104-P2 AAGCTTTCAGGGCAGGCCGAACCAG
(3) be template with total RNA, obtain American cockroach allergen protein encoding gene fragment by RT-PCR;
(4) encoding gene is cloned in the prokaryotic expression carrier, transforms the host bacterium, cultivate the gained recombinant bacterial strain, induce it to express target protein then;
(5) adopt the affinity chromatography method that target protein is carried out purifying, thereby obtain recombinant Periplaneta americana allergen protein Per a 1.0104.
2. expression method as claimed in claim 1 is characterized in that, the described RT-PCR reaction conditions of step (3) is 94 ℃, 3 minutes; 94 ℃, 30 seconds; 60 ℃, 45 seconds; 72 ℃, 1 minute; 30 circulations, 72 ℃ were extended 10 minutes.
3. expression method as claimed in claim 1 is characterized in that, the described prokaryotic expression carrier pET-28a of step (4).
4. expression method as claimed in claim 1 is characterized in that, the described host bacterium of step (4) is an e. coli bl21.
5. expression method as claimed in claim 1 is characterized in that, the substratum of the described cultivation of step (4) is the LB liquid nutrient medium, and culture temperature is 20~37 ℃, incubation time 6~16 hours.
6. expression method as claimed in claim 1 is characterized in that, the described inductive inductor of step (4) is IPTG, and concentration is 0.2~1.0mM, and inducing temperature is 16 ℃~30 ℃.
7. expression method as claimed in claim 1 is characterized in that, the method for the described purifying of step (5) is: American cockroach allergen protein is expressed engineering bacteria cultivated centrifugal collection thalline, freeze overnight 16 hours at 24 ℃; Thalline is placed thawing on ice, then add bacterial lysate; Fully after the cracking, centrifugal at ambient temperature, then get under supernatant liquor and the 50%Ni-NTA agarose resin room temperature and mix, be loaded into chromatography column and carry out chromatography; The back is washed with isopyknic washing lotion, uses the elutriant wash-out of 1/2 volume at last; The freeze-drying after dialysing of albumen behind the purifying is preserved.
8. expression method as claimed in claim 7 is characterized in that, described bacterial lysate is 50mMNaH
2PO
4, 300mM NaCl, the 10mM imidazoles, pH 8.0; Described washing lotion 50mM NaH
2PO
4, 300mM NaCl, the 20mM imidazoles, pH 8.0; Described elutriant is 50mM NaH
2PO
4, 300mM NaCl, the 250mM imidazoles, pH 8.0.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA2008100084590A CN101220361A (en) | 2006-07-21 | 2006-07-21 | Representation method for recombinant american cockroaches allergen protein |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA2008100084590A CN101220361A (en) | 2006-07-21 | 2006-07-21 | Representation method for recombinant american cockroaches allergen protein |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB2006100366460A Division CN100441685C (en) | 2006-07-21 | 2006-07-21 | Expression method of recombinant Periplaneta americana allergen protein |
Publications (1)
Publication Number | Publication Date |
---|---|
CN101220361A true CN101220361A (en) | 2008-07-16 |
Family
ID=39630439
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA2008100084590A Pending CN101220361A (en) | 2006-07-21 | 2006-07-21 | Representation method for recombinant american cockroaches allergen protein |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101220361A (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101619325B (en) * | 2009-07-02 | 2011-05-11 | 江苏省人民医院 | Method for producing periplaneta americana allergen protein Per a 5 in baculovirus-insect expression system |
CN103436511A (en) * | 2013-06-28 | 2013-12-11 | 国家海洋局第三海洋研究所 | High temperature alkaline protease and preparation method thereof |
CN103913578A (en) * | 2014-03-11 | 2014-07-09 | 安徽润敏江生物科技有限公司 | Method for controlling quality of cockroach allergen preparation |
CN103920147A (en) * | 2014-03-11 | 2014-07-16 | 安徽润敏江生物科技有限公司 | Periplaneta americana allergen preparation production method |
CN107759677A (en) * | 2016-12-22 | 2018-03-06 | 四川好医生攀西药业有限责任公司 | A kind of American cockroach allergen protein BA2 and its expression |
CN107759684A (en) * | 2016-12-09 | 2018-03-06 | 四川好医生攀西药业有限责任公司 | A kind of recombinant Periplaneta americana thymus gland fibroin PaTHY1 and its expression |
-
2006
- 2006-07-21 CN CNA2008100084590A patent/CN101220361A/en active Pending
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101619325B (en) * | 2009-07-02 | 2011-05-11 | 江苏省人民医院 | Method for producing periplaneta americana allergen protein Per a 5 in baculovirus-insect expression system |
CN103436511A (en) * | 2013-06-28 | 2013-12-11 | 国家海洋局第三海洋研究所 | High temperature alkaline protease and preparation method thereof |
CN103913578A (en) * | 2014-03-11 | 2014-07-09 | 安徽润敏江生物科技有限公司 | Method for controlling quality of cockroach allergen preparation |
CN103920147A (en) * | 2014-03-11 | 2014-07-16 | 安徽润敏江生物科技有限公司 | Periplaneta americana allergen preparation production method |
CN103913578B (en) * | 2014-03-11 | 2016-01-20 | 安徽润敏江生物科技有限公司 | A kind of method of quality control of cockroach allergen preparation |
CN103920147B (en) * | 2014-03-11 | 2016-08-17 | 何韶衡 | A kind of preparation method of American cockroach allergen preparation |
CN107759684A (en) * | 2016-12-09 | 2018-03-06 | 四川好医生攀西药业有限责任公司 | A kind of recombinant Periplaneta americana thymus gland fibroin PaTHY1 and its expression |
CN107759684B (en) * | 2016-12-09 | 2021-04-20 | 四川好医生攀西药业有限责任公司 | Recombinant periplaneta americana thymosin protein PaTHY1 and expression method thereof |
CN107759677A (en) * | 2016-12-22 | 2018-03-06 | 四川好医生攀西药业有限责任公司 | A kind of American cockroach allergen protein BA2 and its expression |
CN107759677B (en) * | 2016-12-22 | 2021-04-20 | 四川好医生攀西药业有限责任公司 | American cockroach allergen protein BA2 and expression method thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101220361A (en) | Representation method for recombinant american cockroaches allergen protein | |
CN102286513B (en) | Tibetan sheep myostatin recombinant expression protein | |
CN102634486A (en) | GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof | |
JPH11503610A (en) | A novel chemokine expressed in eosinophils | |
CN103102404B (en) | Schistosoma japonicum SjSap recombinant antigen protein and its production and use | |
CN106811470A (en) | A kind of preparation method of dog relaxation precipitinogen recombinant protein and dog relaxation precipitinogen polyclonal antibody | |
CN100441685C (en) | Expression method of recombinant Periplaneta americana allergen protein | |
CN102634487A (en) | GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof | |
CN103059117A (en) | High throughput screening of important schistosoma japonicum antigens and application of antigens in schistosomiasis diagnosis | |
CN103205444A (en) | Preparation method of human active granzyme K recombinant proteins | |
CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
CN101870974A (en) | Preparation method of proteinase activated receptors agonist and use thereof | |
CN110272499A (en) | Clonorchis sinensis recombinant protein c sHscB and its application in enteritis treatment drug | |
KR102007587B1 (en) | Novel dermatophagoides farinae protein | |
CN103509100A (en) | Interleukin-1acceptor antagonist mutant | |
CN101298611B (en) | Active fragment of chlamydia proteasome sample active factor and expression method thereof | |
CN102181400A (en) | Hybridoma cell strain and anti-HCCLM-6 (Human Hepatoma Cell Line) cell secretory protein monoclonal antibody | |
CN101691580B (en) | Novel fusion protein for human HMGB1 A box and acidic tail and use thereof | |
CN109852629A (en) | A kind of expression and purification method of recombined human sex hormone binding globulin N-terminal 51-218aa | |
CN103382481B (en) | The expression vector of people source stromal cell derived factor 1α, construction process and application | |
CN103409453A (en) | Preparation method of recombinant panda IL-6 immunological adjuvant | |
CN103436552A (en) | Production method and application of human-derived annexin A2 | |
CN104561022B (en) | Construction of domestic porcine tumor necrosis factor mutant and protein expression purification method | |
CN104342423A (en) | High activity recombinant human chymotrypsin preparation method and application thereof | |
CN104491858A (en) | Stable liquid pharmaceutical composition containing animal fur dander allergen |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080716 |