CN101191129A - Gene engineering domestic silkworm antibiotic peptide and its preparation method and application - Google Patents
Gene engineering domestic silkworm antibiotic peptide and its preparation method and application Download PDFInfo
- Publication number
- CN101191129A CN101191129A CNA200610125184XA CN200610125184A CN101191129A CN 101191129 A CN101191129 A CN 101191129A CN A200610125184X A CNA200610125184X A CN A200610125184XA CN 200610125184 A CN200610125184 A CN 200610125184A CN 101191129 A CN101191129 A CN 101191129A
- Authority
- CN
- China
- Prior art keywords
- peptide
- gene
- silkworm
- cdm
- pet32a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a genetic engineering domestic silkworm antibacterial peptide and a preparation method and application. The antibacterial peptide consists of 36 amino acid residues and contains an amino acid sequence shown in a sequence table (SEQ ID): firstly, extraction of overall RNA of domestic silkworm fat bodies; secondly, amplification of domestic silkworm antibacterial peptide genes; thirdly, construction of PET32a recombinant expression plasmid; fourthly, filtration of positive clone of converted E.coli BL21. The invention has the advantages of bacteriostasis of broad spectrum, bacteriostatic activity on Gram-negative bacteria and Gram-positive bacteria, function of resisting domestic silkworm virus infection, and capability of being taken as substitution of antibiotics and being widely applied in development of medicine, veterinary drug and marine product medicine and also being used for virus biological control in domestic silkworm cultivation.
Description
Technical field
The present invention relates to a kind of genetically engineered Study of Insect Antibacterial Peptides Cecropin D, this polypeptide has the bacteriostatic action of wide spectrum, Gram-negative and gram positive bacterium all had bacteriostatic activity, and has an effect that anti-silkworm virus (BmNPV) infects, the preparation method who also relates to antibacterial peptide simultaneously, this antibacterial peptide is widely used in the development of Medicine, veterinary drug, aquatic products medication, and the viral organism control in the silkworm breed.
Background technology
Insect antimicrobial peptide (Insect antibacterial peptides) be insect when being subjected to infected by microbes or unexpected injury, a class polypeptide that produces in hemolymph and digestive tube has that molecular weight is little, thermostability is strong, the characteristics of good water solubility.Studies show that insect antimicrobial peptide has broad spectrum antibacterial, Resistant strain there is tangible lethal effect, cell to organism does not have destructiveness simultaneously, non-immunogenicity, its generation and release are the integral parts of body inflammatory reaction, be the important barrier of pathogenic micro-organism invasions such as host defense bacterium, fungi, application prospect is very wide.
Since Boman in 1972 etc. isolated the first routine antibacterial peptide from the hemolymph of sky silkworm chrysalis, up to now, the antibacterial peptide of finding in insect had reached kind more than 200.Mainly concentrate on lepidopteran (Lepidoptera), Coleoptera (Coleoptera), Diptera (Diptera), Hymenoptera (Hymenoptera), also have Hemiptera (Hemiptera), Isoptera (Isoptera), Homoptera (Homoptera) and dragonfly Yan order (Odonata).The antimicrobial substance that exists in the different insects is different, and their primary structure difference is very big, is made up of 13-50 amino acid, and molecular weight is less than 5kDa, owing to be rich in positively charged residues such as arginine or Methionin in the peptide chain, so mostly be cationic.Antibacterial peptide forms according to its amino acid and the molecular structure characteristics are divided into 4 classes:
(1) cecropin class (Cecropins): cecropin is the antibacterial peptide of finding the earliest.Cecropin family antibacterial peptide is the cationic peptide of about 4KD, is made up of 31～40 amino-acid residues, and intramolecularly seldom has cysteine residues, and molecule is mainly helical conformation, contains two both sexes α spirals and is positioned at N-end and C-end.At present, isolated more than 20 kind of cecropin analogue from lepidopteran and dipteral insect, the antimicrobial spectrum of cecropin class comprises resisting gram-positive bacteria and Gram-negative bacteria, and is wherein stronger to the Gram-negative bacteria anti-microbial activity.Be difficult for by trypsinase, stomach en-degraded.
(2) insect defensin (Insect defensins): insect defensin contains 3 or 4 intramolecular disulfide bonds, 3 different structural domains that 6 Cys form: an amino-terminal end ring, an amphiphilic α spiral and an anti-phase parallel βZhe Die of carboxyl terminal.Intramolecular disulfide bond plays an important role aspect the alexinic activity in vivo keeping.At present, from Diptera, Coleoptera and tens kinds of insects of Hemiptera, all found alexin, the alexin molecular structure of different sorts insect has higher homology, and such antibacterial peptide antimicrobial spectrum is narrower, mainly gram-positive microorganisms such as streptococcus aureus is had stronger anti-microbial activity.
(3) proline rich or arginic antibacterial peptide (Prolinerich peptides): this class antibacterial peptide separates in Diptera, Hymenoptera, Hemiptera, coleopteron and obtains, they have very high similarity, contain 15～39 amino-acid residues, proline content is greater than 25% in the molecule, it has very strong activity to Gram-negative bacteria, and inoperative to gram positive organism.
(4) be rich in the antibacterial peptide (Glycine-rich peptides) of glycine: this class antibacterial peptide finds that from sky fly, sarcophagid its common feature is to be rich in glycine in the primary structure, and molecular weight is bigger, is 8-30kDa.Such antibacterial peptide Cys content is few or do not contain Cys, does not form intramolecular disulfide bond, does not also have modification group on the amino-acid residue.At present, all found this type of antibacterial peptide in lepidopteran, Diptera, Hemiptera, Coleoptera and hymenopteran, the Gly that content is very high in this type of antibacterial peptide may play an important role to the elasticity that improves peptide chain and broad-spectrum antimicrobial etc.
The mechanism of action of relevant antibacterial peptide, there is different binding modes in different antibacterial peptides, but its have only near or just form the higher structure of its performance function during in conjunction with cytolemma, and in the aqueous solution, do not have stable conformation, this may be its heat stable reason.The mechanism of action to insect antimicrobial peptide has several main theories at present
(1) ionic channel theory: the amino acid that constitutes the antibacterial peptide molecule is most of positively charged, molecule forms electrostatic adhesion by the negative charge on positive charge and the bacterium endochylema phospholipid molecule and is combined on the lipid film, hydrophobic side in the molecule is inserted in the plasma membrane by the molecule chain flexibility then, and then draw whole molecule and advance people's plasma membrane, upset protein and the original arrangement order of lipid on the plasma membrane, polymerization forms and strides the film ionic channel by the intermolecular mutual displacement of antibacterial peptide again, the interior ion of cell is run off in a large number, and final cell can not keep its normal osmotic pressure and death.
(2) cellular respiration suppresses theory: insect defensin class thanatin comes sterilization by suppressing cellular respiration.
(3) the inhibition epicyte is proteic synthetic, thereby causes the permeability of cytolemma to increase, and the growth of bacterium is suppressed.
(4) formation of inhibition cell walls makes bacterium can not keep normal cellular form and growth retardation, but the cell walls that has formed is not had effect.
Insect antimicrobial peptide has that molecular weight is little, material source is abundant and the characteristics of has a broad antifungal spectrum, and wide application prospect is arranged on medicine industry.Along with tradition is antibiotic extensively and secular application, many pathogeny bacterium have produced resistance to them, and the obvious tool clear superiority in this respect the applied research of the antibacterial peptide that has broad-spectrum antimicrobial and unique antibacterial mechanisms arranged.In the world, antibacterial peptide has been used for the clinical treatment of cerebrospinal meningitis, Helicobacter pylori infection and anti-fungal infection etc.The pharmaceutical use of insect antimicrobial peptide is on the books very early in China's Chinese materia medica, becomes the medicament with treatment infectious diseases with other Chinese medicines preparations after Musca domestica larva is cleaned and dried.
Insect antimicrobial peptide can not only press down various bacteria and fungi extremely, but also can kill some parasite (as plasmodium), multiple cancer cells and animal solid tumor also there is tangible lethal effect, even the virus (as hiv virus, simplexvirus) that contains coating also there is effect, and harmless to normal cell, this is relevant with the composition of film fat in their cytolemma.Bacterial cell membrane film fat is made up of the phosphatide group of a large amount of band anionic charges, and bacteria cell wall has electronegative peptidoglycan or lipopolysaccharides, and eukaryotic cell membrane is rich in cholesterol, and is made up of uncharged film fat more than the eukaryotic cell membrane, and some electronegative phosphatide groups are towards tenuigenin.In addition, there is highly developed cytoskeleton system in higher animal, also has the effect of opposing antibacterial peptide, and the cytoskeleton system of cancer cells is compared undeveloped with normal cell, and this is that antibacterial peptide produces one of inhibiting reason to it.
Antibacterial peptide also has wide application prospect as additive in feed processing industry, foodstuff additive and culture fishery, is considered to the most promising green feed additive.Usually, the use havoc of Antibiotic Additive the microbial balance of animal intestinal, and easily residual in animal body, had a strong impact on the quality and the human beings'health of livestock product.Studies show that antibacterial peptide tool broad-spectrum antibacterial action, simultaneously poultry, fowl had the function that promotes growth, health care and treatment disease, belong to have no side effect, a class environment-friendly type preparation that noresidue, nothing cause bacterial drug resistance
In addition, the antibacterial peptide research that is applied to genetically modified animals and plants of success.By engineered method, antibacterial peptide gene changed over to obtain disease-resistant variety in the plant, become a kind of novel genetic engineering breeding strategy.Jaynes etc. change the Shiva-1 gene over to tobacco and potato.Wherein the morbidity of transgene tobacco bacterial wilt obviously postpones, and disease index is low, and the plant mortality ratio reduces.Grice diarrhoea, mammitis of cow and various virus disease such as swine fever, newcastle disease etc. are thorny diseases always, be unfavorable for Developing of Animal Industry, special antibacterial peptide gene is changed over to the livestock and poultry specific cells expresses by it, thereby the generation disease-resistant varieties be can yet be regarded as one and is developed the new approaches that herding is produced.
Because the source of natural antibacterial peptide is very limited, the chemosynthesis antibacterial peptide costs an arm and a leg, and therefore obtaining antibacterial peptide by genetic engineering technique becomes prefered method.Because antibacterial peptide itself has anti-microbial activity, and the host bacterium is had lethal effect, it directly expresses difficulty.At present, the expression in protokaryon often adopts the amalgamation and expression mode to carry out to antibacterial peptide.Xie etc. are according to the aminoacid sequence of cultivated silkworm antimicrobial peptide CMIV, utilize the codon of E.coli preference to design and synthesize its mutant DNA, be cloned into fusion expression vector pEZZ318, in E.coli, obtain the albumen of ZZ-CMIV amalgamation and expression, fusion rotein is after affinity chromatography, use the CNBr cracking, obtain having the mutant antibacterial peptide CMIV of anti-microbial activity, but the not high (XieW of productive rate, et al., Biochem Mol Biol Int, 1996,39:487-492.).For improving productive rate, Li Xiulan etc. have maximally utilised the codon of intestinal bacteria preferences, designed and synthesized new antibacterial peptide gene CMIV fragment, the sequencing vector of recombinating, the efficient fusion expression carrier pET28 that this fragment is recombinated to and had the His purification tag again, fusion rotein is after nickel metal ion glue affinity chromatography, use the CNBr cracking, final product has the biological activity identical with natural antibacterial peptide, and productive rate doubles (Li Xiulan etc., Chinese biological chemistry and molecular biosciences journal, 1999,15:387～391).
Though prokaryotic expression system is easy and simple to handle, because antibacterial peptide gene is an eukaryotic gene, the albumen that part antibacterial peptide genoid is expressed in prokaryotic system can not effectively, correctly fold and lack signal peptide excision and posttranslational modification.Therefore, become the research focus with the eukaryotic cell expression antibacterial peptide.Chen Haixu etc. have synthesized the antibacterial peptide magainin gene segment of encoding with the yeast preference codon with chemical synthesis, adopt Pichia pastoris system successfully to express magainin (Chen Haixu etc., Chinese biological chemistry and molecular biosciences journal, 2002,18:461-464).But yeast expression system not only culture density is low, and the expression amount of antibacterial peptide is limited, and the peptide expression amidation is incomplete, influences its fungicidal activity.Hellers etc. will encode the fragment cloning of the former precursor of cecropin peptide to the downstream of the polygonal viral promotors of clover twill moth, made up the insect viruses expression system (Hellers Metal, Biochem J, 1991,199:435-439.).Xu Jianhua etc. have made up antibacterial peptide Cecropin gene eukaryotic expression vector, and it has can provide the CMV that efficiently expresses promotor, can express at various mammalian cell stability and high efficiencies (Xu Jianhua etc., biotechnology, 2005,15:3～6.).About cultivated silkworm antimicrobial peptide (CecropinD), yet there are no report at present both at home and abroad in eucaryon and prokaryotic expression system clone and expression.
Summary of the invention
The object of the present invention is to provide a kind of gene engineering domestic silkworm antibiotic peptide Cecropin D, this polypeptide has the bacteriostatic action of wide spectrum, Gram-negative and gram positive bacterium are all had bacteriostatic activity, can be widely used in the development of Medicine, veterinary drug, aquaculture medication as antibiotic replacement product.
Another object of the present invention is to provide the preparation method of a kind of genetically engineered Study of Insect Antibacterial Peptides Cecropin D, and this method is as the host with E.coli.
The invention still further relates to gene engineering domestic silkworm (insect) antibacterial peptide CecropinD in preparation treatment or prevent application in the medicine that anti-silkworm virus disease (BmNPV) infects.
The invention still further relates to the application of gene engineering domestic silkworm antibiotic peptide in the medicine of preparation treatment or prevention Gram-positive gram negative bacterium property (being included in medicine, veterinary drug and agricultural chemicals).
The invention still further relates to the application of gene engineering domestic silkworm antibiotic peptide in the medicine of preparation treatment or the breed of prevention silkworm.
One of technical essential of the present invention is to provide a kind of method of expressing the Study of Insect Antibacterial Peptides Cecropin D gene of biologically active with the E.coli expression system.
Cultivated silkworm antimicrobial peptide Cecropion D (hereinafter to be referred as CD) separates the high-efficiency antimicrobial peptide that obtains the earliest from silkworm immunity hemolymph, form by 62 amino acid, through posttranslational modification, remove signal section and C-terminal acid amides after, become the mature peptide (36aa) of biologically active.Because escherichia expression system lacks the C-terminal amide transferase, therefore the genetic engineering antibiotic peptides of expressing with the enterobacteria expression system does not much have activity.In one embodiment of the invention, provide a kind of expression to have the method for the active genetic engineering antibiotic peptides of antibacterial peptide, this method has been added a l-asparagine by the method for PCR at the end of mature peptide gene, to guarantee to express the amidation of back albumen end.
Two of technical essential of the present invention is to provide a kind of method of expressing the Study of Insect Antibacterial Peptides Cecropin D gene of solubility with the E.coli expression system.
People have been developed multiple protokaryon, eukaryotic expression system production external source recombinant protein, up to now, intestinal bacteria with its easy handling, genetic background is clear, fermentation costs is low etc., and advantage still is the first-selected system that recombinant protein is produced.But recombinant protein can not correctly fold sometimes during escherichia coli expression albumen, and often forms the inclusion body of non-activity, and because the modification after some translations of expression system shortage itself, some does not have activity expressed albumen.Discover, if being closed fusion, the purpose egg is easy to efficiently express C end with " merging head " (the fusion partner) of purifying at some, amalgamation and expression often can obtain efficiently expressing of foreign gene, and can reduce the degraded of proteolytic enzyme, and special, simple purification process is provided.By the proteolytic enzyme cutting site or the chemical reagent broken site of artificial design, can obtain and the on all four recombinant protein of native protein " merging head " of external removal fusion rotein N end.What is more important, the albumen of this amalgamation and expression has solubility preferably usually, is not easy to form inclusion body, has better biological function.Such as, Genetics company has developed Trx TrxA amalgamation and expression system, after cytokine and TrxA fusion, all can obtain to efficiently express through inducing, and exist with soluble form mostly.
A kind of method of expressing solubility Study of Insect Antibacterial Peptides Cecropin D gene is provided in one embodiment of the invention, this method is to utilize Trx TrxA amalgamation and expression system, fusion protein expression is high and be solubility, is beneficial to suitability for industrialized production from now on.
Three of technical essential of the present invention is to provide a kind of method of expressing the functional insect antimicrobial peptide Cec ropinD gene of different purposes with the Ecoli expression system.
Because antibacterial peptide itself can not directly be expressed for the toxicity of host cell.Can be by the strategy of amalgamation and expression, with antibacterial peptide gene and other gene fusion expression, by method chemistry or physics, release insect antibacterial peptide mature peptide fragment is carried out separation and purification then and is obtained and the identical antimicrobial peptide protein of native protein then.In one embodiment of the invention, a kind of method of amalgamation and expression Study of Insect Antibacterial Peptides Cecropin D gene is provided, this method is the mature peptide upstream region of gene adding enteropeptidase cleavage site with antibacterial peptide, then with fusion gene cloning to pET32a expression vector (Invitrogen company product) and be transformed in the e. coli bl21 (DE3) (Invitrogen company product), induce by IPTG then and realized efficiently expressing of antibacterial peptide fusion protein.This fusion rotein is mainly used in the oral or externally applied agent of medicine, veterinary drug and aquatic products.Fusion rotein discharges antibacterial peptide CecropinD mature peptide by the enteropeptidase cutting, and this mature peptide is mainly used in medicine and veterinary drug injecting drug use.A kind of separation of gene engineering domestic silkworm antibiotic peptide, its sequence are the aminoacid sequence shown in nucleotide sequence shown in the SEQ ID NO:1 and the SEQ ID NO:2.
For achieving the above object, the technical solution used in the present invention is as follows:
A kind of step for preparing engineering strain is:
The extraction of A, the total RNA of silkworm fatty body:
Get the silkworm of 5-10 bar after e. coli jm109 is induced 24h, after cleaning up with DEPC water (aqueous solution of 0.1% diethylpyrocarbonate), cut the abdominal cavity, with fat carry extrude collection after, in liquid nitrogen, be ground into powder, according to the total RNA of process specifications extraction fatty body of RNeasyR Kit.The total RNA that extracts is through UV spectrophotometer measuring, and the ratio of its OD260/OD280 illustrates that total RNA does not have protein contamination between 1.8-2.0.With the total RNA that extracts be dissolved in contain 0.5%SDS in the water that DEPC handles, get 20ul and carry out the denaturing formaldehyde agarose gel electrophoresis, the clear band of visible 28S rRNA and 18S rRNA shows that RNA is complete, does not have degraded.
B, cultivated silkworm antimicrobial peptide CecropinD Cloning of Entire Gene:
According to Reverse Transcription System test kit specification sheets, be synthetic cDNA first chain of primer with Oligo (dT) 20.Reacted product is stored in-20 ℃ with the template as the goal gene clone.
The amplification of CD full-length gene:
According to the cultivated silkworm antimicrobial peptide CecropinD cDNA sequence of having delivered among the GenBank, design PCR primer after the analysis-by-synthesis.Upstream primer P1:ATGAAATTCTCGAAAA TTTTCGTT, downstream primer P2:TCCTTGTCCGAGAGCTTTTGC.With cDNA first chain is template, uses the form of landing-type PCR and reacts, and its reaction parameter is: 95 ℃ of pre-sex change 4min, and 94 ℃ of sex change 30sec, 60-50 ℃ of annealing 30min, 72 ℃ are extended 1min, 20 circulations; 94 ℃ of sex change 30sec, 50 ℃ of annealing 30sec .2 ℃ is extended 1 min, 1O circulation, 72 ℃ are extended 1O min again.Get 10 1PCR products respectively and carry out 1% agarose gel electrophoresis, can see one 190 band about bp, conform to, reclaim the PCR product, and it is cloned among the carrier pUCm-T recombinant vectors pUCm-T-CD Transformed E .coli JMl09 with the segmental size of expection.
The structure of C, pET32a recombinant expression plasmid, Transformed E .coli BL21 screening positive clone:
Synthesized three PCR primers according to polyclone restriction enzyme site on the pET32a expression vector and the design of CD mature peptide gene order:
P3:
GGCAACTTCTTCAAGGATCTT-3 ' (underscore is to be the enteropeptidase cleavage site in the EcoRI square frame);
P4:5 '-
CTCGAGCTAGTTTTGTCCGAGAG
TTG-3 ' (underscore is XhoI, and black matrix is encoded to the Asn l-asparagine for the base of sudden change);
P5:5 '-
CTCGAGCTAGTTTTGTCCGAGAG
TTG-3 ' (underscore is XhoI).
P3 and P4 are used to make up the recombinant plasmid pET32a-CDm of ripe peptidyl because of the end sudden change, and P3 and P5 are used to make up ripe peptidyl does not have sudden change because of end recombinant plasmid pET32a-CD.
With the recombinant plasmid pUCm-T-CD that contains the CD full-length gene is template, carries out the PCR reaction with primer P1+P2 and P1+P3 respectively, obtains the single specific band that two sizes are about 120bp, conforms to the expection size.The PCR product reclaims with PCR and is connected with the pGEM-T carrier respectively after the test kit purifying reclaims, connect product Transformed E .coliJMl09 competent cell, behind PCR and restriction enzyme digestion reaction evaluation positive recombinant, the 20ul alkaline lysis method of extracting obtains pGEM-T-CD and pGEM-T-CDm recombinant plasmid.Respectively to pGEM-T-CD, pGEM-T-CDm and pET32a carry out EcoRI and Xho I double digestion according to the restriction enzyme site that designs.Reclaim test kit purifying recovery corresponding target segment respectively with glue.Enzyme cut obtain CD and be connected with carrier, obtain recombinant expression plasmid pET32a-CD and pET32a-CDm with the CDm segment, Transformed E .coli BL21 (DE3) competent cell then, with EcoR I and xho 1 respectively double digestion identify positive colony.Obtain engineering strain Ecoli BL21 (pET32a-CDm) then, the preservation of this bacterial strain, depositary institution: Chinese typical culture collection center, address: China. Wuhan. Wuhan University, postcode: 430072, preservation date: on November 21st, 2006, deposit number: CCTCC No.M206129, classification name: Escherichia.coliBL21/pET32a-CDm).
Provide a kind of in one embodiment of the invention by extracting the total RNA of silkworm fatty body, carry out the method for RT-PCR clone cultivated silkworm antimicrobial peptide CecropinD full-length gene then, the method that obtains cultivated silkworm antimicrobial peptide CecropinD full-length gene includes but are not limited to: (1) subclone: with gene fragment involved in the present invention is template, be template perhaps with the recombinant plasmid pET32a-cDm that contains gene fragment involved in the present invention, be template perhaps with engineering strain E.coliBL21 (pET32a-CDm) DNA that contains gene fragment involved in the present invention, by conventional molecular biology working method (as PCR), subclone obtains corresponding gene fragment CDm, these fragments can comprise gene order involved in the present invention whole or part, these fragments can be on bacterium, yeast, animal and plant cells or other eucaryon, express in the prokaryotic organism, obtain protein or polypeptide fragment, these protein or polypeptide fragment have identical biological function with protein involved in the present invention; (2) synthetic: according to amino acid involved in the present invention or nucleotide sequence, can be by the method synthetic DNA fragment of chemosynthesis, these fragments can comprise gene order involved in the present invention whole or part, can be cloned in the corresponding carrier and express, expressed protein or polypeptide have identical biological function with protein involved in the present invention.
Gene fragment involved in the present invention can be modified, and such as some nucleotide sequence of mutator gene, but does not influence its encoded protein matter aminoacid sequence; Can increase, lack amino acid involved in the present invention or nucleotide sequence, these are modified can not influence proteinic biochemical characteristic, higher structure and proteinic biological function, such as: can add secreting signal peptide at protein or polypeptide N-end or C-end, can also add that suitable joint (as 6 Histidines) is convenient to proteins extraction, purifying.
The gene engineering expression of cultivated silkworm antimicrobial peptide CecropinD, purifying
Gene involved in the present invention with can be cloned among the corresponding host after carrier is connected so that the preservation of gene, amplification and expression.Be applied to cloning vector of the present invention include but are not limited to following carrier: pBR322, pBR325, pACYC177, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKC101, SV40, pBluescript II SK+/-, pQE, pGEM-T, pET serial carrier." the molecular cloning laboratory manual " that carrier feature and cloning process can be write referring to cold spring harbor laboratory.Be applied to host-vector system of the present invention and include but are not limited to following system: bacterium-phage system, bacterium-plasmid vector system, yeast-yeast vector system, Mammals-viral system (vaccinia virus, adenovirus etc.), insect cell-rhabdovirus system.
Provide a kind of pET32a of utilization expression vector in e. coli bl21 (DE3), to efficiently express the method for cultivated silkworm antimicrobial peptide CecropinD gene in one embodiment of the invention.Utilize the engineered protein of this vector expression to be fusion rotein, contain cultivated silkworm antimicrobial peptide CecropinD aminoacid sequence, enteropeptidase recognition site and 6 successive His labels, the fusion rotein that obtains passes through Ni
2+Post affinity chromatography purifying carries out enzyme with enteropeptidase then and cuts the antibacterial peptide CecropinD mature peptide that obtains biologically active.This fusion rotein can pass through Ni
2+Post affinity chromatography purifying carries out enzyme with enteropeptidase then and cuts, and can obtain the mature peptide with the on all four antibacterial peptide CecropinD of native protein sequence.Escherichia expression system lacks the C-terminal amide transferase, and antibacterial peptide must just have activity through C-terminal amidation modification, in one embodiment of the invention, provide a kind of method to modify by PCR, end at cultivated silkworm antimicrobial peptide CecropinD mature peptide gene has added a l-asparagine, expresses the amidation of back albumen end and has biological function with assurance.
The method that can be used for genetic engineering antibiotic peptides CecropinD separation, purifying includes but are not limited to following method: Ni column chromatography, ion exchange chromatography, affinity chromatography, gel-filtration chromatography, electrophoresis absorption method, ultrafiltration process, ammonium sulfate precipitation method etc.
A kind of separation, the proteic method of purifying gene engineering antibacterial peptide CecropinD are provided in an embodiment of the present invention.At first be the Ni column chromatography purification, genetic engineering antibiotic peptides CecropinD albumen has 6 successive histidine residues, they can and Ni
2+In conjunction with engineered protein is combined on the fixed metal ion post, and other foreign protein can not combine with the metal ion post and directly eluted, thereby target protein matter eluted the purpose that reaches protein purification with suitable elutriant at last.Ni column chromatography purification product adds the interior enteropeptidase of interior enteropeptidase of highly purified ox or reorganization, carries out DeR, can cut the alpha-non-natural amino acid residue in the fusion rotein, obtains forming identical engineered protein with native protein amino acid.
The biological activity determination of gene engineering domestic silkworm antibiotic peptide fusion rotein TrxA-CDm
Will be through the purifying TrxA-CDm of dialysis treatment as liquid to be measured, as experimental strain, measure the anti-microbial activity of TrxA-CDm with intestinal bacteria JM 109 and streptococcus aureus.Distinguish the single colony inoculation of picking intestinal bacteria and streptococcus aureus in 20ml LB liquid nutrient medium, 37 ℃, the 250rpm incubated overnight.After next day the bacterium liquid of cultivating being diluted 1000 times, evenly coat on the LB agar plate with the 1ml/200ml ratio, treat to stick aseptic drug sensitive test paper after the drying a little, testing sample TrxA-CDm (15 μ l), 10mM PBS (15 μ l) and penbritin Amp (20mg/ml, 5 μ l) are added on the scraps of paper respectively.Observe inhibition zone (accompanying drawing 5) after hatching 12h for 37 ℃.
The biological activity determination of gene engineering domestic silkworm antibiotic peptide CecropinD
(1) inhibition zone forms experiment:
With staphylococcus aureus (Staphylococcus aureus), subtilis (Bacillussubtilis) and intestinal bacteria (E.coli) JM109 evenly coat respectively on the LB agar plate, and the paper gasket of sterilizing is attached on the agar plate.Get the fusion rotein TrxA-CD of the equimolar amount (0.2nmol) of purifying, the CDm of recombinant mature peptide CD and terminal sudden change respectively with elution buffer solution with contain the negative and positive control of equimolar amount ammonia benzyl mould solution, does the inhibition zone experiment.Respectively application of sample is in each paper gasket, after putting into 37 ℃ of incubators behind the mark and cultivating 16h, observes dull and stereotyped growing state, to determine whether albumen has bacteriostatic activity.
(2) mensuration of recombinant mature peptide CDm minimal inhibitory concentration MIC
Measure minimal inhibitory concentration by CFU (colony-forming unit) method, get the solution of quantitative concentrated recombinant protein (about 300 μ g/ml), get original content and 2 times, 4 times, 8 times, 16 times, 32 times each 20 μ l of diluted sample respectively, the negative contrast of sterilized water is with quantitative thalline (10
5CFU/ml) LB substratum equal-volume mixes, after room temperature (20-25 ℃) acts on 12h down, mixed solution evenly is coated with LB agar culture plate, observe colony forming single-digit after cultivating 12h, the flat board that does not form bacterium colony illustrates that promptly protein concentration has reached inhibition concentration, repeatedly repeats to determine its minimum inhibition concentration.
In one embodiment of the invention, also provide a kind of antagonistic action that proves gene engineering domestic silkworm antibiotic peptide CeeropinD to the silkworm virus infection.
The present invention compared with prior art, have the following advantages and effect: engineered protein involved in the present invention has purposes widely in the research and development field of Medicine, veterinary drug, aquaculture, can be used as a kind of antibiotic substitute, have vast market prospect.In addition, this albumen can also be used for the biological control of silkworm virus disease.
The invention will be further described below in conjunction with drawings and Examples, but not as the restriction to interest field of the present invention.
Description of drawings
Fig. 1 cuts evaluation figure for a kind of pET32a-CDm PCR and enzyme
The pcr amplification of the mature peptide CD of swimming lane 3 terminal sudden changes
The pcr amplification of swimming lane 4 CD full-length peptide
Fig. 2 is that the SDS-PAGE that a kind of antibacterial peptide fusion protein Trx-CDm expresses detects figure
Precipitation after the positive bacteria fragmentation of swimming lane 1 after IPTG induces 4h;
Supernatant after the positive bacteria fragmentation of swimming lane 2 after IPTG induces 4h;
Fig. 3 is the ni-sepharose purification figure as a result of a kind of antibacterial peptide fusion protein TrxA-CDm
The sample that swimming lane 2-6 Ni column purification stepwise elution is collected
Fig. 4 cuts and the SDS-PA GE detection figure of separation and purification for a kind of recombinant mature peptide CDm enzyme
The fusion rotein TrxA-CDm of swimming lane 1 purifying
Swimming lane 2T rxA-CDm cleavage map
The mature peptide C Dm of swimming lane 3 purifying
Fig. 5 surveys slip-knot for the inhibition zone of a kind of TrxA-CDm and really schemes
A TrxA-CDm surveys the slip-knot fruit for the inhibition zone of streptococcus aureus
1：TrxA-CDm
2: ammonia benzyl mould solution
B TrxA-CDm surveys the slip-knot fruit for colibacillary inhibition zone
1：TrxA-CDm
2：PBS
3: ammonia benzyl mould solution
Fig. 6 surveys slip-knot for the inhibition zone of a kind of mature peptide CDm and really schemes
A mature peptide CDm surveys the slip-knot fruit for the inhibition zone of e. coli jm109
2，CDm
3, ammonia benzyl mould solution
4, elution buffer solution
B mature peptide CDm surveys the slip-knot fruit for the inhibition zone of staphylococcus aureus
1, ammonia benzyl mould solution
2, elution buffer solution
3，CDm
C mature peptide CDm surveys the slip-knot fruit for the inhibition zone of subtilis
1，CDm
2, elution buffer solution
3, ammonia benzyl mould solution
Fig. 7 is for respectively organizing the cumulative mortality graphic representation of silkworm behind a kind of BmNPV of infection
1, group I, the virus of directly throwing something and feeding;
2, group II throws something and feeds after Trx-CDm and the viral mixing effect again;
3, group III is for throwing something and feeding after mature peptide CDm and the viral mixing effect;
4, group IV, mature peptide CDm. again throws something and feeds behind the virus of throwing something and feeding the earlier back 12h
Embodiment
Substratum among all embodiment and molecular biology working method are familiar with by these those skilled in the art, can be with reference to " molecular cloning " (laboratory manuals such as Sambrook, the cold spring port, 1989) reach " fine works molecular biology experiment guide " (work such as U.S./F. Ao Sibai, Yan Ziying etc. translate, Beijing, Science Press, 1998).
Embodiment 1: cultivated silkworm antimicrobial peptide CecropinD Cloning of Entire Gene
(1) extraction of the total RNA of silkworm fatty body:
Get the silkworm of 5-10 bar after intestinal bacteria J M109 induces 24h, after cleaning up with DEPC water (aqueous solution of 0.1% diethylpyrocarbonate), cut the abdominal cavity, with fat carry extrude collection after, in liquid nitrogen, be ground into powder, according to RNeasy
RThe process specifications of Kit extracts the total RNA of fatty body.The total RNA that extracts is through UV spectrophotometer measuring, and the ratio of its OD260/OD280 illustrates that total RNA does not have protein contamination between 1.8-2.0.With the total RNA that extracts be dissolved in contain 0.5%SDS in the water that DEPC handles, get 20ul and carry out the denaturing formaldehyde agarose gel electrophoresis, the clear band of visible 28S rRNA and 18S rRNA shows that RNA is complete, does not have degraded.
(2) article one chain of synthetic CecropinD cDNA:
According to Reverse Transc ription System test kit specification sheets, be synthetic cDNA first chain of primer with Oligo (dT) 20.Reacted product is stored in-20 ℃ with the template as the goal gene clone.
(3) amplification of CD full-length gene:
According to the cultivated silkworm antimicrobial peptide CecropinD cDNA sequence of having delivered among the GenBank, design PCR primer after the analysis-by-synthesis.Upstream primer P 1:A TGAAATTCTCGAAAATTTTCGTT, downstream primer P2:TCCTTGTCCGAGAGCTTTTGC.With cDNA first chain is template, uses the form of landing-type PCR and reacts, and its reaction parameter is: 95 ℃ of pre-sex change 4min, and 94 ℃ of sex change 30sec, 60-50 ℃ of annealing 30mi n, 72 ℃ are extended 1min, 20 circulations; 94 ℃ of sex change 30sec, 50 ℃ of annealing 30sec, 72 ℃ are extended 1min, 10 circulations, 72 ℃ are extended 10min again.Get 10 μ l PCR products respectively and carry out 1% agarose gel electrophoresis, can see a band about 190bp, conform to the segmental size of expection, with receiving PC R product, and it is cloned among the carrier pUCm-T, recombinant vectors pUCm-T-CD Transformed E .coli JM109 is convenient to the preservation and the amplification of gene.
(4) sequential analysis of the anti-mattress peptide of silkworm cDNA:
The anti-mattress peptide of the silkworm cDNA that amplification is obtained carries out sequencing, utilizes related tool Blast etc. to carry out sequential analysis on Genbank the sequence that records.The result shows that it is in full accord that institute's cloned genes and Genbank go up the cultivated silkworm antimicrobial peptide CecropinD (ACCESSION:Ab010825) that logins, and coded slices length is 186bp, 62 amino acid of encoding altogether.Conservative property is very high during evolution for antibacterial peptide gene between this explanation different genera silkworm.
Embodiment 2: expression, the purifying of cultivated silkworm antimicrobial peptide CecropinD mature peptide gene in E.coli
(1) structure of recombinant expression plasmid
Three PCR primer: P3:GAATTCIGACGACGACGACAAAACTTCTTCAAGGATCTT (containing EcoRI site and enteropeptidase cleavage site) have been synthesized according to polyclone restriction enzyme site on the pET32a expression vector and the design of CD mature peptide gene order; P4:CTCGAGCTAGTTTTGTCCGAGAGCTTTTG (the part base mutation increases a l-asparagine codon); P5:CTCGAGCTAGTTTTGTCCGAGAGGGCTTG (containing the XhoI site).P1 and P2 are used to make up the recombinant plasmid pET32a-CDm of ripe peptidyl because of the end sudden change, and P1 and P3 are used to make up ripe peptidyl does not have sudden change because of end recombinant plasmid pET32a-CD.
With the recombinant plasmid pUCm-T-CD that contains the CD full-length gene is template, carries out the PCR reaction with primer P1+P2 and P1+P3 respectively, obtains the single specific band that two sizes are about 120bp, conforms to the expection size.The PCR product reclaims the test kit purifying with PCR and is connected with the pGEM-T carrier respectively after receiving, connect product Transformed E .coli JM109 competent cell, behind PCR and restriction enzyme digestion reaction evaluation positive recombinant, alkaline lysis method of extracting obtains pGEM-T-CD and pGEM-T-CDm recombinant plasmid in a small amount.Respectively to pGEM-T-CD, pGEM-T-CDm and pET32a carry out EcoRI and Xho I double digestion according to the restriction enzyme site that designs.Reclaim test kit purifying recovery corresponding target segment respectively with glue.Enzyme cut obtain CD and be connected with carrier with the CDm segment, obtain recombinant expression plasmid pET32a-CD and pET32a-CDm, Transformed E .coli BL21 (DE3) competent cell is identified positive colony with EcoR I and Xho 1 difference double digestion then. its result is as shown in Figure 1.
(2) expression of antibacterial peptide fusion protein, the thick extraction:
The positive recombinant that identifies is inserted in the 20ml LB substratum (Amp+), 37 ℃ of following overnight incubation, second day the switching 500 μ l to another 20ml 2 * YT substratum (every liter contains 16g peptone, 10g yeast powder, 5g NaCl) (Amp+) in, be cultured to 0D600 be approximately at 0.6 o'clock and add IPTG to final concentration be 0.6mM, induce the expression of target protein.Cultivate centrifugal collection thalline behind the 4h, it is resuspended to add PBS in the thalline of collecting, behind the multigelation 2 times, use the ultrasonic disruption thalline (pending sample to be placed mixture of ice and water, handle each 6 * 30sec) continuously 3 times again, treat that bacterium liquid becomes limpid, shows that then most thalline break.4000rpm, 4 ℃ of centrifugal bacterium liquid 15-20min.Collect respectively after centrifugal and obtain thalline residue and supernatant liquor, 12000rpm, 4 ℃ are continued centrifuged supernatant 15min.Collect cleer and peaceful precipitation on the two times centrifugal gained, get 20 μ l respectively and add 2 * SDS-PAGE sample loading buffer, behind boiling water bath 10min, carry out electrophoresis detection with SDS-PAGE, SDS-PAGE electrophoretic analysis result shows that target protein efficiently expresses with soluble form, the about 23kDa of size conforms to the re-set target size, as shown in Figure 2.Through computer software bandscan analytical electrophoresis collection of illustrative plates, measure expression amount and account for 30% of total protein of cell.
Embodiment 3:Ni
2+Post affinity chromatography purification of soluble antibacterial peptide fusion protein TrxA-CD and TrxA-CDm
(1) preparation of sample
Reorganization bacterium pET32a-CD/BL21 (DE3) and pET32a-CDm/BL21 (DE3) are in 1L 2 * YT substratum as stated above behind abduction delivering TrxA-CD and the TrxA-CDm, with 4000g, 4 ℃ of centrifugal 30min collect thalline, Binding buffer (8 * Binding Buffer:40mM imidazoles with 100ml, 4M NaCl, 160mM Tris-HCl) resuspended thalline.Sample freezes molten being placed on ice repeatedly, and the ultrasonic disruption bacterial cell (after 10 * 30sec), with 12,000g, 4 ℃ of centrifugal 15min collect cleer and peaceful precipitation respectively.Supernatant is with 0.45 μ m membrane filtration, as the Ni under the non-denatured state
2+The sample of post affinity chromatography.
(2) chromatography process
1) with the sterile water wash of 10 times of column volumes (CV) the glass column post bed of His-bind filler is housed after, use 1 * Charge Buffer (8 * Charge Buffer:400mM NiSO of 10CV again
4) make filler and Ni
2+1 * Binding Buffer balance filler of 10CV is used in fully combination again, prepares chromatography sample to be purified.
2) sample to be purified slowly flows through in the good affinity column of balance with certain flow velocity (1ml/5min) by peristaltic pump, make have the His6 label sample fully and the Ni on the filler
2+In conjunction with, double flow through the post bed after, collect and Ni
2+Reacted sample (being leakage liquid).
3) with 1 * Binding Buffer of 20CV flushing post bed, with flushing stay in the chromatography column on a small quantity not with filler on Ni
2+Bonded albumen.
4) continue flushing post bed with the washing buffe r that contains the 10mM imidazoles, with the Ni on wash-out and the filler
2+(effluent volume and concentration are looked Ni on total protein content and non-target protein and the filler to the weak albumen of non-specific binding and binding ability
2+Binding ability change flexibly).
5) (80mMTris-HCl) target protein of elution of bound on filler is unit fraction collection elutriant with 1ml for 4 * Elution Buffer:4M imidazoles, 2M NaCl with 1 * Elution Buffer.
6) be each pipe elutriant of 12%SDS-PAGE electrophoretic analysis fraction collection with resolving gel concentration, with the distribution of true fusion rotein in elutriant.
7) continue to wash the post bed with 1 * Elution Buffer, washing the whole residual proteins in the post bed off, and then with 1 * Strip Buffer (4 * Strip Buffer:400mM EDTA, 2M NaCl, 80mMTris-HCl) in the flush away pillar with filler bonded Ni
2+Ion.
Fusion rotein is after the Ni post affinity chromatography under the non-denatured state, elution samples SDS-PAGE electrophoretic analysis, its result shows a band that is about 23kDa all as shown in Figure 3, its size conforms to theoretical value, shows and utilizes affinity chromatography can make target protein obtain effective purifying.
(3) enzyme of fusion rotein is cut the purifying with recombinant antibacterial peptide
Fusion rotein is released to TrxA (18kDa) and CD (5kDa) behind 16 ℃ of cuttings of enteropeptidase 16h.Reaction solution after enzyme is cut separates the pure product of mature peptide (5kDa) that obtain recombinant antibacterial peptide through following steps:
A) reaction solution is transferred to ultrafiltration pipe (aperture is 10kDa), and centrifugal (4000g, 10min), collects centrifuge tube and sees through liquid by 4 ℃.
B) liquid of collecting in (a) is transferred to other ultrafiltration pipe (aperture is 3kDa), centrifugal (4000g, 10min), abandons through liquid by 4 ℃.With PB S (pH7.4) wash-out ultrafiltration pipe again (aperture is 3kDa) film, blow outstandingly gently with pipettor, collect suspension.
C) repeat above (a) for 2 times (b) after the step, with suspension with ultrafiltration pipe (aperture is 3kDa) recentrifuge (4000g, 4 ℃, 10min), to improve target protein concentration
D) 18%SDS-PAGE detects and shows that 5kDa has the single specificity protein band, shows that recombinant mature peptide CDm obtains effective purifying, as shown in Figure 4.
Embodiment 4: the biological activity determination of gene engineering domestic silkworm antibiotic peptide fusion rotein TrxA-CDm
Experimental strain comprises: intestinal bacteria (Escherichiacoli) JM 109 strains, streptococcus aureus (Staphylococcusaureus) ATCC 25923 strains.
Will be through the purifying TrxA-CDm of dialysis treatment as liquid to be measured, as experimental strain, measure the anti-microbial activity of TrxA-CDm with e. coli jm109 and streptococcus aureus.Distinguish the single colony inoculation of picking intestinal bacteria and streptococcus aureus in 20ml LB liquid nutrient medium, 37 ℃, the 250rpm incubated overnight.After next day the bacterium liquid of cultivating being diluted 1000 times, evenly coat on the LB agar plate with the 1ml/200ml ratio, treat to stick aseptic drug sensitive test paper after the drying a little, testing sample TrxA-CDm (15 μ l), 10mM PBS (15 μ l) and penbritin Amp (20mg/ml, 5 μ l) are added on the scraps of paper respectively.Observe inhibition zone after hatching 12h for 37 ℃, test-results is seen accompanying drawing 5.The result shows that cultivated silkworm antimicrobial peptide TrxA-CDm all has tangible anti-microbial activity to intestinal bacteria with to the insensitive streptococcus aureus of Amp.
Embodiment 5: the biological activity determination of gene engineering domestic silkworm antibiotic peptide CeeropinD
(1) inhibition zone forms experiment
Experimental strain comprises: intestinal bacteria (Escherichia coli) JM109 strain, streptococcus aureus (Staphylococcus aureus) ATCC 25923 strains, subtilis (Bacillus megaterium) ATCC6633 strain.
With staphylococcus aureus, subtilis and e. coli jm109 are evenly coated respectively on the LB agar plate, and the paper gasket of sterilizing is attached on the agar plate.Get the fusion rotein TrxA-CD of the equimolar amount (0.2nmol) of purifying, the CDm of recombinant mature peptide CD and terminal sudden change respectively with elutionbuffer solution with contain the negative and positive control of equimolar amount ammonia benzyl mould solution, does the inhibition zone experiment.Respectively application of sample is in each paper gasket, after putting into 37 ℃ of incubators behind the mark and cultivating 16h, observes dull and stereotyped growing state, to determine whether albumen has bacteriostatic activity.Experimental result see Table 1 and accompanying drawing 6) show that recombinant mature peptide CDm has the obvious suppression effect for gram-positive microorganism staphylococcus aureus and subtilis and Gram-negative bacteria intestinal bacteria.
Table 1 inhibition zone forms experimental result
+ expression forms inhibition zone-expression and does not form inhibition zone
Above experimental result is all the triplicate gained.
(2) mensuration of recombinant mature peptide CDm minimal inhibitory concentration MIC
Measure minimal inhibitory concentration by CFU (colony-forming unit) method, get the solution of quantitative concentrated recombinant protein (about 300 μ g/ml), get original content and 2 times, 4 times, 8 times, 16 times, 32 times each 20 μ l of diluted sample respectively, the negative contrast of sterilized water is with quantitative thalline (10
5CFU/ml) LB substratum equal-volume mixes, behind the effect 12h, mixed solution evenly is coated with LB agar culture plate under the room temperature, observes colony forming single-digit behind the cultivation 12h, the flat board that does not form bacterium colony illustrates that promptly protein concentration has reached inhibition concentration, repeats to determine its minimum inhibition concentration through 3 times.Experimental result shows (table 2), and recombinant protein (CDm) all has bacteriostatic activity to Gram-negative and gram positive bacterium.
Table 2 recombinant mature peptide CDm minimal inhibitory concentration MIC value
| Minimal inhibitory concentration(μg/m l) | |
| Gram-negative bacterial | |
| E.coilJM109 | 65 |
| Gram-negative | |
| Staphylococcus aureus | |
| 70 | |
| |
80 |
Embodiment 6: gene engineering domestic silkworm antibiotic peptide CeeropinD mature peptide is to the restraining effect of BmNPV infected silkworm
As shown in Figure 7, culturing the result under 25 ℃ of room temperature conditions shows: group I, cumulative mortality is 98% behind the viral 15d that directly throws something and feeds.Group II, the cumulative mortality behind the 15d that throws something and feeds after Trx-CDm and the viral mixing effect is 96%, with not significantly difference of positive control.Group III, the 15d cumulative mortality of throwing something and feeding after mature peptide CDm and the viral mixing effect is 48%, and the effect of tangible reduction virus infection is arranged.Group IV, cumulative mortality is 92% behind the mature peptide CDm 15d that throws something and feeds again behind the virus of throwing something and feeding the earlier back 12h, does not have the significant virus infection effect that reduces.
Sequence table (SEQUENCE LISTING)
＜110〉Wuhan University
＜120〉gene engineering domestic silkworm antibiotic peptide and preparation method and application
＜130〉cultivated silkworm antimicrobial peptide Cecropion D nucleotide sequence
<160>2
<170>PatentIn version 3.1
<210>1
<211>108
<212>DNA
<213>Bombyx mori
<220>
<221>CDS
<222>(1)..(108)
<223>
<400>1
ggc aac ttc ttc aag gat ctt gaa aaa atg ggt cag agg gtt cga gac 48
Gly Asn Phe Phe Lys Asp Leu Glu Lys Met Gly Gln Arg Val Arg Asp
1 5 10 15
gcc gtc atc agc gcg gct cca gca gtc gac acc ctg gca aaa gca aaa 96
Ala Val Ile Ser Ala Ala Pro Ala Val Asp Thr Leu Ala Lys Ala Lys
20 25 30
gct ctc gga caa 108
Ala Leu Gly Gln
35
<210> 2
<211> 36
<212> PRT
<213> Bombyx mori
<400> 2
Gly Asn Phe Phe Lys Asp Leu Glu Lys Met Gly Gln Arg Val Arg Asp
1 5 10 15
Ala Val Ile Ser Ala Ala Pro Ala Val Asp Thr Leu Ala Lys Ala Lys
20 25 30
Ala Leu Gly Gln
35
Claims (10)
1. gene engineering domestic silkworm antibiotic peptide, its sequence is the nucleotide sequence shown in the SEQ ID NO:1.
2. gene engineering domestic silkworm antibiotic peptide, its sequence is the aminoacid sequence shown in the SEQ ID NO:2.
3. an engineering strain is characterized in that, this bacterial strain is E.coli BL21/pET32a-CDm, CCTCCNo:M206129.
4. preparation method who is used for the described engineering strain of claim 2, it comprises the following steps:
The extraction of A, the total RNA of silkworm fatty body;
B, cultivated silkworm antimicrobial peptide CecropinD Cloning of Entire Gene;
The structure of C, pET32a recombinant expression plasmid, synthesized three PCR primers according to polyclone restriction enzyme site on the pET32a expression vector and the design of CD mature peptide gene order:
P3：5’-GAATTCGACGACGACGACAAGGGCAACTTCTTCAAGGATCTT-3’；
P4：5’-CTCGAGCTAGTTTTGTCCGAGAGCTTTTG-3’；
P5：5’-CTCGAGCTAGTTTTGTCCGAGAGGGCTTG-3’，
P3 and P4 are used to make up the recombinant plasmid pET32a-CDm of ripe peptidyl because of the end sudden change, and P3 and P5 are used to make up ripe peptidyl does not have sudden change because of end recombinant plasmid pET32a-CD;
D, Transformed E .coli BL21 screening positive clone obtain the engineered protein that bacterial strain is expressed.
5. the preparation method of engineering strain according to claim 4 is characterized in that, has added a l-asparagine at the end of cultivated silkworm antimicrobial peptide CecropinD mature peptide gene, with the amidation of the engineered protein end after guaranteeing to express.
6. the preparation method of engineering strain according to claim 4 is characterized in that, engineered protein is a fusion rotein, contains cultivated silkworm antimicrobial peptide CecropinD aminoacid sequence, enteropeptidase recognition site and 6 successive His labels.
7. fusion rotein according to claim 6 is characterized in that, this fusion rotein carries out enzyme with enteropeptidase then and cuts by Ni post affinity chromatography purifying, obtains and the on all four antibacterial peptide CecropinD of native protein sequence mature peptide.
8. the application of gene engineering domestic silkworm antibiotic peptide in the medicine of preparation treatment or the infection of prevention silkworm virus disease.
9. the application of gene engineering domestic silkworm antibiotic peptide in the medicine of preparation treatment or prevention gram positive bacterium property.
10. the application of gene engineering domestic silkworm antibiotic peptide in the medicine of preparation treatment or prevention gram negative bacterium property.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200610125184XA CN101191129A (en) | 2006-11-28 | 2006-11-28 | Gene engineering domestic silkworm antibiotic peptide and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200610125184XA CN101191129A (en) | 2006-11-28 | 2006-11-28 | Gene engineering domestic silkworm antibiotic peptide and its preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101191129A true CN101191129A (en) | 2008-06-04 |
Family
ID=39486330
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA200610125184XA Pending CN101191129A (en) | 2006-11-28 | 2006-11-28 | Gene engineering domestic silkworm antibiotic peptide and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101191129A (en) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140130A (en) * | 2010-11-12 | 2011-08-03 | 中国科学院海洋研究所 | Antibacterial peptide and use thereof |
| CN102504019A (en) * | 2011-12-01 | 2012-06-20 | 北京龙科方舟生物工程技术中心 | Method for separating cecropin antimicrobial peptides |
| CN103484466A (en) * | 2013-09-11 | 2014-01-01 | 华南农业大学 | Diamondback moth antibacterial peptide moricin, preparation method and application thereof |
| CN104212805A (en) * | 2013-06-04 | 2014-12-17 | 香港理工大学 | Bombyx mori antibacterial peptide attacin2 and heterogenous expression and application thereof |
| CN104447976A (en) * | 2014-12-13 | 2015-03-25 | 青岛宏昊生物科技有限公司 | Swine-derived antibacterial peptide cecropin P1 mutant as well as preparation method and application of swine-derived antibacterial peptide cecropin P1 mutant |
| CN107502981A (en) * | 2017-08-24 | 2017-12-22 | 海盐派特普科技有限公司 | A kind of processing technology of down jackets antibacterial protection against the tide eider down |
| CN107630363A (en) * | 2017-08-24 | 2018-01-26 | 海盐派特普科技有限公司 | A kind of down jackets Vermins-proof mildew-proof eider down |
| CN107675509A (en) * | 2017-08-24 | 2018-02-09 | 兰溪市拜瑞珂科技服务有限公司 | A kind of antistatic antibiotic hair neck |
| CN107779473A (en) * | 2017-10-23 | 2018-03-09 | 安徽科技学院 | Silkworm hemolymph with anti Helicobacter pylori activity and its production and use |
| CN111035752A (en) * | 2019-12-05 | 2020-04-21 | 江苏科技大学 | Application of silkworm antibacterial peptide Cecropin A in treatment of esophageal cancer |
| CN115323023A (en) * | 2021-12-17 | 2022-11-11 | 河南牧业经济学院 | Preparation method of medicine for treating cow mastitis |
| CN115721726A (en) * | 2022-07-27 | 2023-03-03 | 江苏长泰药业有限公司 | Nasal cavity product for preventing or relieving cold symptoms and preparation method thereof |
-
2006
- 2006-11-28 CN CNA200610125184XA patent/CN101191129A/en active Pending
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140130A (en) * | 2010-11-12 | 2011-08-03 | 中国科学院海洋研究所 | Antibacterial peptide and use thereof |
| CN102140130B (en) * | 2010-11-12 | 2013-03-27 | 中国科学院海洋研究所 | Antibacterial peptide and use thereof |
| CN102504019A (en) * | 2011-12-01 | 2012-06-20 | 北京龙科方舟生物工程技术中心 | Method for separating cecropin antimicrobial peptides |
| CN102504019B (en) * | 2011-12-01 | 2014-04-23 | 北京龙科方舟生物工程技术有限公司 | Method for separating cecropin antimicrobial peptides |
| CN104212805A (en) * | 2013-06-04 | 2014-12-17 | 香港理工大学 | Bombyx mori antibacterial peptide attacin2 and heterogenous expression and application thereof |
| CN103484466A (en) * | 2013-09-11 | 2014-01-01 | 华南农业大学 | Diamondback moth antibacterial peptide moricin, preparation method and application thereof |
| CN103484466B (en) * | 2013-09-11 | 2016-06-29 | 华南农业大学 | A kind of Diamond back moth antibacterial peptide moricin and preparation method thereof and application |
| CN104447976A (en) * | 2014-12-13 | 2015-03-25 | 青岛宏昊生物科技有限公司 | Swine-derived antibacterial peptide cecropin P1 mutant as well as preparation method and application of swine-derived antibacterial peptide cecropin P1 mutant |
| CN107502981A (en) * | 2017-08-24 | 2017-12-22 | 海盐派特普科技有限公司 | A kind of processing technology of down jackets antibacterial protection against the tide eider down |
| CN107630363A (en) * | 2017-08-24 | 2018-01-26 | 海盐派特普科技有限公司 | A kind of down jackets Vermins-proof mildew-proof eider down |
| CN107675509A (en) * | 2017-08-24 | 2018-02-09 | 兰溪市拜瑞珂科技服务有限公司 | A kind of antistatic antibiotic hair neck |
| CN107779473A (en) * | 2017-10-23 | 2018-03-09 | 安徽科技学院 | Silkworm hemolymph with anti Helicobacter pylori activity and its production and use |
| CN111035752A (en) * | 2019-12-05 | 2020-04-21 | 江苏科技大学 | Application of silkworm antibacterial peptide Cecropin A in treatment of esophageal cancer |
| CN111035752B (en) * | 2019-12-05 | 2023-02-28 | 江苏科技大学 | Application of silkworm antibacterial peptide Cecropin A in treatment of esophageal cancer |
| CN115323023A (en) * | 2021-12-17 | 2022-11-11 | 河南牧业经济学院 | Preparation method of medicine for treating cow mastitis |
| CN115323023B (en) * | 2021-12-17 | 2024-05-03 | 河南牧业经济学院 | Preparation method of medicine for treating cow mastitis |
| CN115721726A (en) * | 2022-07-27 | 2023-03-03 | 江苏长泰药业有限公司 | Nasal cavity product for preventing or relieving cold symptoms and preparation method thereof |
| CN115721726B (en) * | 2022-07-27 | 2023-10-17 | 江苏长泰药业股份有限公司 | Nasal product for preventing or relieving cold symptoms and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101191129A (en) | Gene engineering domestic silkworm antibiotic peptide and its preparation method and application | |
| Kang et al. | Characterization and expression of a new subfamily member of penaeidin antimicrobial peptides (penaeidin 5) from Fenneropenaeus chinensis | |
| Meng et al. | Research advances of antimicrobial peptides and applications in food industry and agriculture | |
| AU664075B2 (en) | Insecticidally effective peptides | |
| CN111205359A (en) | Scyreproxcin as antibacterial peptide of scylla paramamosain and application thereof | |
| CN101173004A (en) | Insect antimicrobial peptide Thanatin and method for producing deletion mutant thereof | |
| CN103789317A (en) | Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application | |
| CN101250222A (en) | Ascidian antibacterial peptide, precursor peptide, coding gene and use thereof | |
| CN100595278C (en) | Genic engineering strain of expression recombinant prawn peptide Pen24 and its use | |
| CN101775068A (en) | Novel natural antibacterial peptides, and coding sequence and uses thereof | |
| CN101550183B (en) | Antibacterial peptide and construction and application thereof | |
| CN102417539A (en) | Antibacterial protein and its coding gene, expression system, refolding system and application | |
| CN1936000A (en) | Fennero penaeus chinensis antibacterial protein gene and recombinant expression and use | |
| CN102603885A (en) | Alexin and application thereof to preparation of antibacterial medicament | |
| CN104263709A (en) | Egg-white lysozyme and preparation method thereof | |
| CN116063440B (en) | Antibacterial peptide of delicious euglena and application thereof | |
| CN112321697B (en) | Hermetia illucens antibacterial peptide Cecropin-alpha and application thereof | |
| CN101705231A (en) | Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof | |
| CN102199215B (en) | MAPWA fusion antibacterial peptide, preparation method and application thereof | |
| CN102242138B (en) | Recombination expression of cynoglossus semilaevis antibacterial peptide hepcidin and application thereof | |
| CN100352841C (en) | Antibiotic peptide and its coding sequence and uses | |
| CN107540735B (en) | Antibacterial protein, isolated nucleic acid, antibacterial drug and application | |
| CN101565462A (en) | Large yellow croaker BPI-BN protein, primer and applications thereof in preparing antibiotic drugs | |
| CN100402552C (en) | Antibiotic peptide and its code sequence and use | |
| CN105102476A (en) | Polypeptides against plant pathogenic fungi |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080604 |