CN101176786A

CN101176786A - Method and composition for increasing insulin sensibility

Info

Publication number: CN101176786A
Application number: CNA2006101180384A
Authority: CN
Inventors: 翟琦巍; 孙诚; 张芳; 史香林
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date: 2006-11-08
Filing date: 2006-11-08
Publication date: 2008-05-14
Also published as: WO2008055445A1

Abstract

The invention discloses the use of an SIRT1 protein or an SIRT1 agonist or an up regulation, which is used for the preparation of composition improving the sensitivity of insulin. The invention has the advantages of proving that the SIRT1 can be used to improve the sensitivity of insulin for the first time, revealing that the SIRT1 can low regulate the negative regulatory factor PTP-1B for insulin signal, and providing an effective new target for the prevention or treatment of the insulin sensitivity lowing or related diseases.

Description

Increase the method and composition of insulin sensitivity

Technical field

The invention belongs to biotechnology and pharmaceutical field, be specifically related to a kind of method and composition that increases insulin sensitivity.

Background technology

The number of whole world diabetes has increased to 1.7 hundred million at present, estimate to the year two thousand thirty this numeral will reach 3.6 hundred million, the serious threat human health.Discover that (Insulin Resistance IR) is the main pathological characters of type ii diabetes to insulin resistant, and its reason is due to insulin secretion relative deficiency and the insulin action link obstacle.So, by strengthening the glucose utilization of insulin stimulating, reduce the fatty acid oxidation metabolism, suppress glycogen output and the sensitivity that increases insulin is an effectively approach of treatment type ii diabetes.

At present, the drug main of enhancing insulin sensitivity will comprise thiazolidinediones, glucagon receptor antagonist and biguanides blood sugar lowering.Thiazolidinediones is a class novel insulin sensitizer of discovered in recent years, represents medicine that troglitazone (Troglitazone) is arranged, rosiglitazone (Rosiglitazone) and pioglitazone (Pioglitazone).The action target spot of such medicine is nuclear peroxidase-paraphyte activated receptor (PPAR γ).But this type of medicine at blood sugar lowering effectively, strengthen insulin sensitivity in, tend to bring out side effect (Yki-such as hypoglycemia, weight increase and liver function damage H.Thiazolidinediones.N Eng J Med 2004 351:1106-1118).The polypeptide that glucagon is made up of 29 aminoacid, physiological action is for promoting liver glycogen decomposition, heteroplasia and steatolysis, its the above-mentioned effect capable of blocking of its receptor antagonist, thereby strengthen insulin sensitivity (Oureshi SA etc., A novel glucagonsreceptor antagonist inhibits glucagons-mediated biological effects.Diabetes 200453:3267-3473).Discover that at present glucagon receptor antagonist is mainly vanadium compounds, but such medicine easily produces at skeleton, kidney and liver and accumulates, and cause vomiting, untoward reaction such as dehydration.The biguanides oral hypoglycemic mainly contains metformin, and phenformin and buformin, its mechanism of action mainly by strengthening the sensitivity of peripheral organization to insulin, increase the picked-up of peripheral organization to glucose, reduce gluconeogenesis in the liver.It is the main potential untoward reaction of biguanides that lactate is poisoned, and phenformin and buformin are exactly owing to this serious adverse effects stops to sell.

Therefore, this area also needs to seek the medicine of the new raising insulin sensitivity with higher biological safety.

Summary of the invention

The object of the present invention is to provide a kind of SIRT1 albumen or its agonist or go up the new purposes of adjusting.

In a first aspect of the present invention, a kind of SIRT1 albumen or its agonist are provided or go up the purposes of adjusting, it is characterized in that, be used to prepare the compositions that improves insulin sensitivity.

In another preference of the present invention, described SIRT1 albumen or its agonist or the compositions that is used to prepare raising insulin sensitivity under the insulin resistant situation of upward adjusting.

In another preference of the present invention, described SIRT1 albumen or its agonist or last adjustment also are used to prepare the compositions that Profilin tyrosine phosphatase-1B transcribes or expresses.

In another preference of the present invention, described compositions is used for the treatment of the disease that insulin sensitivity descends and is correlated with.

In another preference of the present invention, the relevant disease of described insulin sensitivity decline includes, but is not limited to: insulin resistant, type 2 diabetes mellitus, hyperinsulinemia, diabetic ketoacidosis, hyperosmolar nonketotic diabetic coma, lactic acidosis.

In another preference of the present invention, proteic agonist of described SIRT1 or last the adjustment are selected from: resveratrol or its analog, butein (Butein), isoliquiritigenin (Isoliquiritigenin), fisetin (Fisetin) or piceatannol (Piceatannol; 3,4,3, the 5-hydroxy styrenes).

In a second aspect of the present invention, provide a kind of screening to can be used for improving the method for the potential material of insulin sensitivity, described method comprises:

Candidate substances is contacted with expressing the proteic system of SIRT1, detect candidate substances the proteic influence of SIRT1; If described candidate substances can improve the proteic expression of SIRT1 or promote the proteic activity of SIRT1, show that then this candidate substances is the potential material that can be used for improving insulin sensitivity.

In another preference of the present invention, described method also comprises: the expression of Protein-tyrosine-phosphatase-1B or activity in the observation system, if the expression of Protein-tyrosine-phosphatase-1B or active the reduction show that then this candidate substances is the potential material that can be used for improving insulin sensitivity.

In another preference of the present invention, described system is selected from: solution system, subcellular fraction system, cell system, organizational framework, organ systems or animal system.

In another preference of the present invention, described method may further comprise the steps:

(a) in the test group, in can expressing or express the proteic system of SIRT1, add candidate substances, and detection proteic expression of SIRT1 or activity, and, in matched group, do not add described candidate substances, can express or express in the proteic system of SIRT1, detect proteic expression of SIRT1 or activity

(b) proteic expression of SIRT1 or activity in the proteic expression of SIRT1 in step (a) the test group or active and the matched group are compared,

(preferably be significantly higher than, if proteic expression of SIRT1 or activity are higher than statistically in the test group as high by 15%; Preferred, high by 30%) matched group, just show that this candidate substances is the potential material that can be used for improving insulin sensitivity.

In a third aspect of the present invention, provide a kind of material that can be used for improving insulin sensitivity that obtains by described method.

In a fourth aspect of the present invention, a kind of compositions is provided, described compositions contains:

(i) SIRT1 albumen or its agonist or the upward adjustment of effective dose (as 0.00001-0.1 gram/60 kg body weight/skies);

The (ii) material organized down of being selected from of effective dose (as 0.0005-0.1 gram/60 kg body weight/skies): biguanides diabetes medicament, sulfonylurea diabetes medicament, glucosidase inhibitor class medicine, insulin sensitivity enhancing class medicine, aldose reductase inhibitor class medicine, pancreotropic hormone release class medicine; And

(iii) acceptable carrier pharmaceutically or on the bromatology.

In another preference of the present invention, described biguanides diabetes medicament includes, but is not limited to: metformin or phenformin.

In another preference of the present invention, described sulfonylurea diabetes medicament includes, but is not limited to: glibenclamide, glipizide, Ge Lieqi hold, glibornuride, glimepiride or gliquidone.

In another preference of the present invention, described glucosidase inhibitor class medicine comprises (but being not limited to): acarbose (acarbose), Fu Gelibo sugar (vokibose) or miglitol (migkitok).

In another preference of the present invention, described insulin sensitivity enhancing class medicine comprises (but being not limited to): ciglitazone (cigktazone), troglitazone (trogkitazone), rosiglitazone (rosigkitazone) or pioglitazone (piogkitazone).

In another preference of the present invention, described aldose reductase inhibitor class medicine comprises (but being not limited to): alrestatin (akrestain), epalrestat (epakrestat), Bo Lasita (ponakrestat) or tolrestat (tokrestat).

In another preference of the present invention, described pancreotropic hormone discharges the class medicine and comprises (but being not limited to): repaglinide (repagkinide) or Nateglinide (nategkinide).

On the other hand, the present invention also provides a kind of method that improves insulin sensitivity, and described method comprises: raise the proteic activity of SIRT1 or the expression that (are more preferably in muscle, liver or the fat) in the subject.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

Figure 1A has shown that the C2C12 cell produces insulin resistant after Palmic acid is induced; Figure 1B has shown that SIRT1 albumen descends in the C2C12 of insulin resistant cell; Fig. 1 C is that B figure quantification is represented; Fig. 1 D has shown that the HepG2 cell produces insulin resistant after glucamine is induced; Fig. 1 E has shown that SIRT1 albumen descends in the HepG2 of insulin resistant cell; Fig. 1 F has shown that E figure quantification represents; ( ^*P＜0.05; ^*P＜0.01, Student ' s Test; NS represents not remarkable).

Fig. 2 A has shown that slow virus (Lentivirus) infects HepG2 cell photo; Fig. 2 B has shown that the SIRT1 of slow virus mediation expresses decline; Fig. 2 C has shown that SIRT1 expresses decline and causes the Insulin receptor INSR phosphorylation level to reduce; Fig. 2 D has shown that SIRT1 expresses decline and stoped insulin-induced glycogen synthetic; Fig. 2 E has shown that SIRT1 inhibitor Sirtinol has stoped insulin-induced glycogen synthetic.( ^*, ##p＜0.01, Student ' sTest; NS represents not remarkable).

Fig. 3 A has shown that raising the SIRT1 protein level under the normal condition takes in not influence to glucose; Fig. 3 B has shown under the insulin resistant situation, raises the absorption that the SIRT1 protein level can promote glucose; Fig. 3 C has shown that the SIRT1 protein level raises the influence to the insulin activation signal.( ^*P＜0.05 and does not add insulin and HSV-SIRT1 virus group and compares; #p＜0.05 and singly adds the insulin group and compares; Student ' s Test)

Fig. 4 A has shown resveratrol processing promotion glucose absorption under the normal condition; Fig. 4 B has shown that resveratrol is handled the absorption that has promoted glucose under the insulin resistant situation; Fig. 4 C has shown the influence of resveratrol processing to the insulin activation signal.( ^*P＜0.05 and does not add insulin and HSV-SIRT1 virus group and compares; #p＜0.05, ##p＜0.01 and singly adds the insulin group and compares.Student’s Test)。

Fig. 5 shown SIRT1RNAi virus can reduce the SIRT1 protein level ( ^*P＜0.05, ^*.Student ' s Test is compared with the no resveratrol processed group of contrast virus in p＜0.01).

Fig. 6 A has shown that the rise of SIRT1 protein level can reduce the PTP-1B protein level under the insulin resistant situation; Fig. 6 B has shown that the rise of SIRT1 protein level can reduce PTP-1B mRNA level under the insulin resistant situation; Fig. 6 C has shown resveratrol processing reduction PTP-1B protein level; Fig. 6 D has shown the mRNA level of resveratrol processing reduction PTP-1B; Fig. 6 E is the quantification to each PTP-1B mRNA test strip of Fig. 6 B; Fig. 6 F be to the quantification of each PTP-1B mRNA test strip of Fig. 6 D ( ^*P＜0.05; ^*P＜0.01 is compared with independent insulin processing.Student’s Test)。

Fig. 7 A has shown that the PTP-1B protein level of herpesvirus (HSV) mediation raises; Fig. 7 B has shown that the PTP-1B protein level raises and has reversed the SIRT1 protein level and raise the glucose that causes and take in and raise that (* p＜0.05 is compared with virus-free no insulin processed group; ##p＜0.01 is compared with SIRT1 virus treated group with insulin.Student’s Test)。

Fig. 8 A has shown that resveratrol can suppress the inductive hyperinsulinemia of high fat; Fig. 8 B has shown that resveratrol can improve the inductive glucose tolerance of high fat; Fig. 8 C has shown that resveratrol can improve the inductive insulin resistant of high fat; Fig. 8 D has shown that resveratrol can reduce the inductive total cholesterol level of high fat and raise; Fig. 8 E has shown that resveratrol can reduce the inductive low-density lipoprotein white level rising of high fat (* p＜0.05, * * p＜0.01 are compared with high fat group).

The specific embodiment

The inventor is through extensive and deep research, proved the sensitivity that SIRT1 (Sirtuin 1) can improve insulin first, it can be used for prevention or treatment and reduces the relevant disease that causes by Protein-tyrosine-phosphatase-1B abnormal expression (particularly express and raise) or active unusual (particularly active the raising) or insulin sensitivity.Finished the present invention based on this.

Particularly, the inventor finds that first SIRT1 can reduce the expression of Protein-tyrosine-phosphatase-1B (PTP-1B), and can improve insulin sensitivity.More particularly, the inventor finds that SIRT1 does not strengthen the insulin sensitivity under the normal condition, only just can increase the sensitivity of insulin when producing insulin resistant.By raising proteic level of SIRT1 or the active sensitivity that strengthens insulin, be difficult for producing the too high side effect such as hypoglycemia that cause of insulin sensitivity like this, therefore have higher biological safety and lower side effect.

Simultaneously, the inventor finds, SIRT1 protein agonist resveratrol (Resveratrol) not only can activate SIRT1 and also can raise the protein level of SIRT1.Zoopery simultaneously also shows the significantly symptom of diabetes-alleviating of resveratrol, comprises blood sugar lowering, too high insulin, cholesterol and the low-density lipoprotein white level of downward modulation.Resveratrol is the native compound that exists in a kind of food, and safety is higher, can directly be added in the Foods or drinks oral.And the inventor finds Research on dose, and the valid density that resveratrol reduces relevant disease for the control insulin sensitivity is significantly less than the concentration that resveratrol in the past is used for anti-curing oncoma and cardiovascular disease.The low of valid density reduced product cost on the one hand greatly, can increase security of products on the other hand.

Deep discovers, SIRT1 and resveratrol all have the effect of the sensitivity that strengthens insulin for main target tissue fat, muscle and the liver of insulin, and sphere of action is wider, the sensitivity of the insulin of more favourable enhancing different tissues.And for resveratrol, not only can weight increase when increasing insulin sensitivity, also have antiobesity action preferably on the contrary.

SIRT1(Sirtuin 1)

SIRT1 is that NAD is guarded, depended on to a kind of middle and high degree of organism that extensively is present in ⁺Histon deacetylase (HDAC).In the past, SIRT1 can prolong fruit bat because of having, the activity in nematicide life-span causes extensive concern (Blander, G. and Guarente, L.2004.THE SIR2FAMILY OF PROTEINDEACETYLASES.Annual Review of Biochemistry 73:417-435.).

In the present invention, used SIRT1 albumen can be naturally occurring, such as its can be separated or purification from mammal.In addition, described SIRT1 albumen also can be artificial preparation, such as producing reorganization SIRT1 albumen according to the genetic engineering recombinant technique of routine.Preferably, the present invention can adopt the SIRT1 albumen of reorganization.

Any suitable SIRT1 albumen all can be used for the present invention.Described SIRT1 albumen comprises SIRT1 albumen or its bioactive fragment of total length.Preferably, the proteic aminoacid sequence of described SIRT1 can be substantially the same with the sequence shown in GenBank accession number: the NM 012238 (PubMed).

The proteic aminoacid sequence of SIRT1 that passes through replacement, disappearance or the interpolation of one or more amino acid residues and form is also included among the present invention.SIRT1 albumen or its bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence of replacing through aminoacid does not influence its activity or kept the activity of its part.Suitably replacing aminoacid is technology well known in the art, and described technology can be implemented and guarantee not change the biological activity of gained molecule at an easy rate.These technology are recognized those skilled in the art, in general, can not change biological activity basically at the inessential area change single amino acids of a peptide species.See Molecular Biology of The Gene such as Watson, the 4th edition, 1987, The Benjamin/CummingsPub.Co.P224.

The proteic bioactive fragment of any SIRT1 can be applied among the present invention.Here, the implication of the proteic bioactive fragment of SIRT1 is meant that as a peptide species it still can keep the proteic all or part of function of SIRT1 of total length.Generally, described bioactive fragment keeps 50% the proteic activity of total length SIRT1 at least.Under preferred condition, described active fragment can keep proteic 60%, 70%, 80%, 90%, 95%, 99% or 100% the activity of total length SIRT1.

The present invention also can adopt SIRT1 albumen modified or improvement, such as, can adopt the SIRT1 albumen of being modified or improveing in order to promote its half-life, effectiveness, metabolism and/or proteic effectiveness.Described can be the proteic conjugate of a kind of SIRT1 through the SIRT1 albumen of modifying or improve, or it can comprise substituted or artificial aminoacid.Described can be to have less common ground with naturally occurring SIRT1 albumen through the SIRT1 albumen of modifying or improve, but also can improve mammiferous insulin sensitivity, and can not bring other harmful effect or toxicity.That is to say that any proteic bioactive version of SIRT1 that do not influence all can be used among the present invention.

The purposes of SIRT1

Based on the inventor's new discovery, the invention provides SIRT1 albumen or its agonist or go up the purposes of adjusting, be used to prepare the compositions that improves insulin sensitivity; Or be used to screen the material that improves insulin sensitivity.

Preferably, described SIRT1 albumen or its agonist or last adjustment also are used to prepare the compositions that Profilin tyrosine phosphatase-1B transcribes or expresses.

Preferably, described SIRT1 albumen, its agonist or go up is adjusted or the compositions that contains above-mentioned composition can be used for treating the insulin sensitivity relevant disease that descends.Preferred, the relevant disease of described insulin sensitivity decline comprises: other relevant disease that insulin resistant, type 2 diabetes mellitus, hyperinsulinemia and insulin resistant cause, as: diabetic ketoacidosis, hyperosmolar nonketotic diabetic coma, lactic acidosis.

For example, described SIRT1 albumen or its agonist or go up to adjust can be used for: (i) preparation reduces medicine or the food that Protein-tyrosine-phosphatase-1B expresses; (ii) preparation increases the medicine or the food (preferred, the medicine or the food of increase insulin sensitivity under the preparation insulin resistant situation) of insulin sensitivity; Or the (iii) medicine or the food of preparation prevention or treatment insulin resistant or insulin resistant associated metabolic disease.

In order to prove the such use of SIRT1, the inventor is that cell model is studied with C2C12 cell and HepG2 cell, finds 1. to reduce the generation that the SIRT1 level can cause insulin resistant; 2. raising the SIRT1 protein level does not have influence to glucose intake under the normal condition and insulin activation signal, but can significantly strengthen glucose absorption and insulin activation signal under the insulin resistant situation; 3. after handling (that is: making the active raising of SIRT1 or expressing increases) through resveratrol, promote the absorption of cell, and strengthened the insulin activation signal for glucose; 4. the synthetic participation that needs SIRT1 of resveratrol enhance hepatocyte glycogen.These results prove that all SIRT1 albumen can strengthen the sensitivity of insulin under the insulin resistant situation, thereby can be used for preventing or treating the disease that insulin sensitivity descends and is correlated with.

In addition, the inventor also finds, under the insulin resistant situation, raises SIRT1 protein level or resveratrol processing (that is: active raising of SIRT1 or expression being increased) and can reduce Protein-tyrosine-phosphatase-1B (PTP-1B) albumen and mRNA level.And PTP-1B itself is a kind of negativity regulatory factor of insulin signaling, with the morbidity of metabolism class diseases such as obesity and type 2 diabetes mellitus and develop in close relations, to studies show that of PTP-1B knock out mice, the insulin sensitivity of disappearance PTP-1B mice obviously increases.Therefore proof can be reduced proteic expression of PTP-1B or activity by adopting SIRT1 albumen, thereby reach the purpose that improves insulin sensitivity.

In addition, the inventor induces the plain opposing of C57/BL6 mouse islets model with high fat, and that studies resveratrol takes (that is: making the active raising of SIRT1 or expressing increases) for the related indication influence of diabetes such as insulin sensitivity.Found that taking of resveratrol can suppress the inductive hyperinsulinemia of high fat, the inductive glucose tolerance of the high fat of improvement, improves the inductive insulin resistant of high fat, reduces the inductive total cholesterol level rising of high fat and reduce the inductive low-density lipoprotein white level rising of high fat.These results all prove, resveratrol use or SIRT1 expression or active raising all can reach the related indication purposes of diabetes such as alleviating insulin sensitivity.

The agonist of SIRT1 or upward adjustment and uses thereof

The proteic activity of any SIRT1 of raising, keep the proteic stability of SIRT1, promote the proteic expression of SIRT1, prolong SIRT1 albumen effective acting time or promote the material of transcribing and translating of SIRT1 all to can be used for the present invention, as the active substance that can be used for improving insulin sensitivity.

Preferably, proteic agonist of described SIRT1 or last the adjustment include, but is not limited to: resveratrol and resveratrol analogs, as: butein (butein), isoliquiritigenin (isoliquiritigenin), fisetin (fisetin) or piceatannol (Piceatannol; 3,4,3, the 5-hydroxy styrenes).

Because the agonist of SIRT1 or last adjustment can promote the expression of SIRT1 and/or improve the activity of SIRT1, therefore, the agonist of described SIRT1 or last adjustment also can reach the purpose of prevention or treatment insulin sensitivity decline relevant disease by the sensitivity that insulin is regulated in the influence of SIRT1.

Compositions

The present invention also provides a kind of compositions, and it contains effective dose and (restrains/60 in the gram body weight/day as 0.00001-0.01; Preferably, be 0.0001-0.005 gram/60 kg body weight/skies) described SIRT1 albumen or its agonist (as resveratrol) or go up adjustment, and acceptable carrier pharmaceutically or on the bromatology.

Compositions of the present invention can be directly used in the prevention or the treatment of insulin sensitivity decline relevant disease.In addition, also can unite use with other therapeutic agent or adjuvant simultaneously.

Preferably, the SIRT1 albumen and the resveratrol that contain effective dose in the described compositions simultaneously.

Preferably, described compositions also contains effective dose (as 0.0005-0.1 gram/60 kg body weight/skies; Preferably, be 0.001-0.05 gram/60 kg body weight/skies) the material organized down of being selected from: biguanides diabetes medicament, sulfonylurea diabetes medicament, glucosidase inhibitor class medicine, insulin sensitivity enhancing class medicine, aldose reductase inhibitor class medicine, pancreotropic hormone release class medicine.

As optimal way, described biguanides diabetes medicament includes, but is not limited to: metformin or phenformin; Perhaps, described sulfonylurea diabetes medicament includes, but is not limited to: glibenclamide, glipizide, Ge Lieqi hold, glibornuride, glimepiride or gliquidone; Perhaps, described glucosidase inhibitor class medicine comprises (but being not limited to): acarbose (acarbose), Fu Gelibo sugar (vokibose) or miglitol (migkitok); Perhaps, described insulin sensitivity enhancing class medicine comprises (but being not limited to): ciglitazone (cigktazone), troglitazone (trogkitazone), rosiglitazone (rosigkitazone) or pioglitazone (piogkitazone) or, described aldose reductase inhibitor class medicine comprises (but being not limited to): alrestatin (akrestain), epalrestat (epakrestat), Bo Lasita (ponakrestat) or tolrestat (tokrestat); Perhaps, described pancreotropic hormone release class medicine comprises (but being not limited to): repaglinide (repagkinide) or Nateglinide (nategkinide).

Usually, these materials can be formulated in nontoxic, the inert and pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably, pH is about 6-8.

As used herein, term " contains " the various compositions of expression and can be applied to together in mixture of the present invention or the compositions.Therefore, term " mainly by ... form " and " by ... composition " be included in during term " contains ".As used herein, term " effective dose " or " effective dose " are meant and can produce function or amount active and that can be accepted by people and/or animal to people and/or animal.

As used herein, the composition of " pharmaceutically acceptable " is applicable to people and/or mammal and does not have excessive bad side reaction (as toxicity, stimulation and allergy), promptly has the material of rational benefit/risk ratio.Term " pharmaceutically acceptable carrier " refers to be used for the treatment of the carrier of agent administration, comprises various excipient and diluent.This term refers to some medicament carriers like this: they itself are not necessary active component, and do not have undue toxicity after using.Suitable carriers is well known to those of ordinary skill in the art.(Mack Pub.Co. can find proving absolutely about pharmaceutically acceptable carrier in N.J.1991) at Remington ' s Pharmaceutical Sciences.Acceptable carrier can contain liquid on combination of Chinese medicine is learned, as water, saline, glycerol and ethanol.In addition, also may there be complementary material in these carriers, as lubricant, fluidizer, wetting agent or emulsifying agent, pH buffer substance etc.

Compositions of the present invention contains the SIRT1 albumen and the pharmaceutically acceptable carrier of safe and effective amount.This class carrier comprises (but being not limited to): saline, buffer, glucose, water, glycerol, ethanol and combination thereof.Usually pharmaceutical preparation should be complementary with administering mode, and pharmaceutical composition of the present invention can be made into the injection form, for example with normal saline or contain glucose and the aqueous solution of other adjuvant is prepared by conventional method.Described pharmaceutical composition should be made under aseptic condition.The dosage of active component is the treatment effective dose.Pharmaceutical preparation of the present invention also can be made into slow releasing preparation.

Compositions of the present invention also can be used as a kind of food or dietary supplement, directly takes or adds in other food and take.Preferably, described " food go to school acceptable carrier " is selected from: filler, disintegrating agent, lubricant, fluidizer, effervescent, correctives, clad material, meals goods, excipient or slow/controlled releasing agent.

Improve the method and the administering mode of insulin sensitivity

The invention provides the method for a kind of raising insulin sensitivity (as prevention or treatment insulin sensitivity decline relevant disease), comprise that the SIRT1 albumen that gives experimenter's effective dose maybe can express the proteic system of SIRT1 (as cell or virus).When being used for the treatment of people's insulin sensitivity decline relevant disease, the preferred SIRT1 albumen that adopts reorganization.

Should be understood that the effective dose of used SIRT1 can change with the order of severity of object to be treated when being used for the treatment of mammal insulin sensitivity decline relevant disease.Concrete condition decides according to experimenter's individual instances, and this is in the scope that skilled practitioners or nutritionist can judge.

After the proteic purposes of the described SIRT1 of cicada, can adopt several different methods well known in the art that described SIRT1 albumen or its encoding gene or its pharmaceutical composition are delivered medicine to mammal.Preferably, can adopt the means of gene therapy to carry out, such as can be directly with SIRT1 albumen by delivering medicine to the experimenter such as methods such as injections; Perhaps, can will carry SIRT1 expression of gene unit (such as expression vector or virus etc.) by certain approach and be delivered on the target spot, and make it the SIRT1 albumen of expression activity.

As one embodiment of the present invention, described SIRT1 albumen directly can be delivered medicine to mammal (such as the people), perhaps, the proteic gene of coding SIRT1 can be cloned in the appropriate carriers (as conventional protokaryon or carrier for expression of eukaryon or viral vector such as herpesvirus vector or adenovirus vector) by the method for routine, described carrier imported to express in the proteic cell of described SIRT1, make described cellular expression SIRT1 albumen.Can realize the proteic expression of SIRT1 in the body by an amount of described cell being incorporated into the suitable position of body of mammals.

Preferably, the gene of coding SIRT1 or the carrier that the carries described gene method by routine can be incorporated into and realize the proteic expression of SIRT1 in target cell or the target tissue.Described target cell includes but not limited to: muscle cell, liver cell, adipose cell etc.; Described cell can be transferred in the suitable position of body of mammals.

Method well-known to those having ordinary skill in the art can be used to make up the sequence that contains the SIRT1 protein coding gene and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technique of body etc.Described DNA sequence can effectively be connected on the suitable promoter in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome binding site and the transcription terminator that translation initiation is used.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate dihydrofolate reductase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tetracycline or amicillin resistance.

Comprise the carrier of above-mentioned suitable gene order and suitable promoter or control sequence, can be used to transform appropriate host cell, so that it can marking protein.

Host cell can be a prokaryotic cell, as bacterial cell; Or eukaryotic cell such as low, as yeast cells; Or higher eucaryotic cells, as mammalian cell.Representative example has: escherichia coli, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Plant cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.

When described gene is expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhancer is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promoter transcribing with enhancing gene usually.

Persons skilled in the art all know how to select appropriate carriers, promoter, enhancer and host cell.

Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryote such as escherichia coli, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Another kind method is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.

The transformant that obtains can be cultivated with conventional method, expresses albumen of the present invention.According to used host cell, used culture medium can be selected from various conventional culture medium in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promoter of selection with suitable method (as temperature transition or chemical induction), cell is cultivated a period of time again.

The extracellular can be expressed or be secreted into to recombiant protein in the above methods in cell or on cell membrane.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel filtration), adsorption chromatography, ion-exchange chromatography, high performance liquid chroma-tography (HPLC) and other various liquid chromatography (LC) technology and these methods.

Screening improves the method for the potential material of insulin sensitivity

After getting the proteic purposes of the described SIRT1 of cicada, can adopt several different methods well known in the art to screen the material that improves insulin sensitivity.

In a kind of optimal way of the present invention, a kind of method of screening the material that improves insulin sensitivity is provided, described method comprises:

Candidate substances is contacted with expressing the proteic system of SIRT1, detect candidate substances the proteic influence of SIRT1; If described candidate substances can improve the proteic expression of SIRT1 or promote the proteic activity of SIRT1, show that then it is the potential material that can be used for improving insulin sensitivity.

Preferred, described method also comprises: the expression of Protein-tyrosine-phosphatase-1B or activity in the observation system, if the expression of Protein-tyrosine-phosphatase-1B or active the reduction show that then this candidate substances is the potential material that can be used for improving insulin sensitivity.

In the present invention, described system includes, but is not limited to: solution system, subcellular fraction system, cell system, organizational framework, organ systems or animal system.Can contain SIRT1 in the described system, be used for adding therein candidate substances, observe the influence of candidate substances SIRT1; Perhaps, can contain SIRT1 and PTP-1B simultaneously in the described system, be used for adding therein candidate substances, observe the influence of candidate substances simultaneously for SIRT1 and PTP-1B.

The material that these Preliminary screening go out can constitute a screening storehouse so that people finally can therefrom filter out can be for the useful material of sensitivity that improves insulin.

Therefore, the present invention also comprises the material that obtains by described screening technique, and described material can be used for improving the sensitivity of insulin.

Major advantage of the present invention is:

(1) the present invention has proved that first SIRT1 can be used for improving insulin sensitivity, has disclosed the negativity regulatory factor PTP-1B that SIRT1 can reduce insulin signaling, for the prevention or the treatment of insulin sensitivity decline relevant disease provides effective novel targets.

(2) the present invention also confirms, SIRT1 does not strengthen the insulin sensitivity under the normal condition, only just can increase the sensitivity of insulin when producing insulin resistant, therefore has higher biological safety and lower side effect.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition as " molecular cloning experiment guide " (J. Sa nurse Brooker, D.W. the Russell is outstanding, New York: the condition publishing house of cold spring harbor laboratory), the perhaps condition of advising according to manufacturer.

I. versatile material and method

1, cell culture

C2C12 cell (available from U.S. ATCC) is cultivated with DMEM culture medium (high sugar includes 10% hyclone), and condition of culture is 37 ℃, 5%CO ₂Kind plate when cell grows to 50-60% changes the DMEM culture medium that contains 2% horse serum and induces differentiation 4 days after covering with, promptly be divided into sophisticated muscle cell, is used for following experiment.

HepG2 cell (available from U.S. ATCC company) is cultivated with DMEM culture medium (high sugar includes 10% hyclone), and condition of culture is 37 ℃, 5%CO ₂, standby when growing to 70-80% with trypsinization kind plate.

2, insulin resistant is induced

The C2C12 cell is induced 18h with the high sugared DMEM culture fluid that includes Palmic acid (7.5mM), makes it to produce insulin resistant; The HepG2 cell is induced 16h with the low sugar serum-free medium that includes glucamine (18mM), makes it to produce insulin resistant.

3, glucose transport is measured

To break up good C2C12 cell culture in 24 orifice plates that contain low sugar serum-free DMEM culture fluid (available from U.S. Corning company), hungry 3h, 100nM insulin stimulating 20min, every hole adds 0.5 μ Ci ³The deoxyglucose of H labelling is hatched 5min, sops up culture fluid, cell plates is placed on ice PBS washing 3 times.

Every hole adds 200 μ l 0.2M NaOH, and the collecting cell lysate adopts liquid scintillation instrument to measure activity.

4, glycogen is synthetic measures

The HepG2 cell culture is in 24 orifice plates, and the hungry 16h of low sugar serum-free DMEM culture medium adds 100nM insulin and/or 0.5 μ Ci ³The glucose of H labelling is cultivated 3h, sops up culture fluid, PBS washing 2 times, and every hole adds 200 μ l 30%NaOH, and 80 ℃ of cracking 30min of collecting cell lysate are centrifugal, add the dehydrated alcohol of 2 times of volumes, mixing ,-20 ℃ of standing over night.

Leave standstill the back frozen centrifugation, abandon supernatant, add absolute ethanol washing, centrifugal, repeat secondary.To precipitate at last and dry, 0.1N HCl dissolution precipitation adopts liquid scintillation instrument to measure activity.

5, albumen Western trace

In Tissue Culture Plate, add an amount of lysate, 100 ℃ of cracking 5min, centrifugal standby.Get an amount of protein sample and carry out the SDS-PAGE protein isolate.And with the albumen electrotransfer to nitrocellulose filter, reuse contains the TBS sealing 1h of 5% defatted milk powder, add various corresponding antibodies (being respectively anti-Sirt1 antibody (available from U.S. Upstate company) and anti-Tubulin antibody (available from U.S. Sigma company)), 4 ℃ are spent the night, wash and add the two anti-of horseradish peroxidase-labeled behind the film, room temperature jog 1h, react 2min with chemiluminescence reaction test kit (available from U.S. PIERCE company) behind the thorough washing, at once with the exposure of X-ray sheet, quantitative analysis is carried out with laser scanner in the back of developing a film.

6, reverse transcriptional PCR (RT-PCR)

6.1 design of primers and synthetic: primer is given birth to worker bio-engineering corporation by Shanghai and is synthesized.

Actin (clip size is 444bp):

Normal chain: 5 ' ATCACTGCCACCCAGAAGAC ' 3 (SEQ ID NO:1),

Anti-chain: 5 ' ATGAGGCCACCACCCTG ' 3 (SEQ ID NO:2);

PTP-1B (clip size is 384bp):

Normal chain: 5 ' CTGACACCTGCCTCTTACTG ' 3 (SEQ ID NO:3),

Anti-chain: 5 ' CACTTGACTGGGCTCTGC ' 3 (SEQ ID NO:4).

6.2 extraction and the reverse transcription of total RNA: get an amount of cell and carry out total RNA extraction and reverse transcription with conventional Trizol Reagent.

6.3PCR amplification: reaction system is 50 μ l, 10mmol/L 1dNTP 1 μ l; 25mmol/L MgCl ₂4 μ l, 10x buffer 5 μ l, 3 ' primer, 0.5 μ l, 5 ' primer, 0.5 μ l, cDNA 4 μ l, Taq enzyme 2U, deionized water complement to 50 μ l, reaction condition: 95 ℃ of pre-degeneration 5min, enter circulation, (95 ℃ of degeneration 45s press PTP1B:65 ℃; Actin:57 ℃ annealing temperature 45s, 72 ℃ are extended 45s), wherein capable 30 circulations of PTP1B, capable 25 circulations of GAPDH.Amplified production is electrophoresis on 1.5% agarose gel, and ultraviolet transilluminator is observed the amplified production specific band down.Product carries out graphical analysis through gel imaging and analytical system, as internal reference, uses the absorbance and the relative level of Actin than its expression of value representation of PTP1B band with Actin.

7, SIRT1 and PTP-1B cross expression

7.1PTP-1B gene clone

The design primer:

Normal chain (SEQ ID NO:5):

5’GGATACGCGTATGGAGATGGAGAAGGAGTTCGAG 3’；

Anti-chain (SEQ ID NO:6):

5’GGAAGTCGACAGTGCTCCCAGTCTGTCAGTGAA 3’

Extraction and the reverse transcription of total RNA: get The addition of C 2C12 cell and carry out total RNA extraction and reverse transcription with Trizol Reagent.

Pcr amplification: reaction system is 50 μ l, 10mmol/L 1dNTP 1 μ l; 25mmol/L MgCl ₂4 μ l, 10x buffer 5 μ l, 3 ' primer, 0.5 μ l, 5 ' primer, 0.5 μ l, cDNA 4 μ l, Taq enzyme 2U, deionized water complement to 50 μ l, reaction condition: 95 ℃ of pre-degeneration 5min enter circulation, (72 ℃ are extended 45s for 95 ℃ of degeneration 45s, 60 ℃ of annealing 45s), 30 circulations.Amplified production is cut glue and is reclaimed, and through MluI and SalI enzyme action, is connected with the pHSVPrPUC carrier (available from U.S. Clontech company) of the same enzyme action of process, connects the product coated plate, and picking the clone identify.

7.2PTP-1B the packing of herpesvirus (HSV)

Virus packaging 2-2 cell (available from Harvard University's medical college) is finished, and process is as follows:

The carrier that contains PTP1B of getting an amount of 7.1 steps acquisition changes method (Lipofactamine 2000) with fat and imports the 2-2 cell, add the required helper virus helper (available from Harvard University's medical college) of virus packing after cultivating 24h, continue to cultivate, treat cell rounding, collect virus with hypotonic method, the virus of collecting is for the first time added the 2-2 cell amplification cultivate, collect virus (HSV-PTP-1B) with quadrat method,-80 ℃ frozen, standby.

7.3SIRT1 gene clone

SIRT1 cDNA fragment is to obtain through the BamHI enzyme action from plasmid pBabepuro-SIRT1 (available from Harvard University's medical college), and is inserted into the BamHI enzyme action position in pCMV-Tag 3A (available from the U.S. Stratagene company) plasmid.

7.4SIRT1 the packing of herpesvirus

The packaging process of SIRT1 herpes virus is identical with the packaging process of PTP-1B herpesvirus, the carrier that contains SIRT1 of getting an amount of 7.3 steps acquisition changes method (Lipofactamine 2000) with fat and imports the 2-2 cell, add the required helper virus helper of virus packing after cultivating 24h, continue to cultivate, treat cell rounding, collect virus with hypotonic method, the virus of collecting is for the first time added the 2-2 cell amplification cultivates, collect virus (HSV-SIRT) with quadrat method ,-80 ℃ frozen, standby.

7.5SIRT1 and PTP-1B crosses detection of expression

Above-mentioned HSV virus is joined the C2C12 cell, and 36h infects back Western and detected expression efficiency.

8, SIRT1RNA intervenes (RNAi)

The method that reference literature (Picard F et al.Sirt1 promotes fat mobilization in white adipocytesby repressing PPAR-gamma.Nature 200417:771-776) is provided, synthetic following two sections oligonucleotide are in order to prepare SIRT1 RNAi:

5’-GATCCGATGAAGTTGACCTCCTCATTCAAGAGATGAGGAGGTCAACTTCATCTT TTTTGGAAA-3’(SEQ ID NO：7)；

5’-AGCTTTTCCAAAAAAGATGAAGTTGACCTCCTCATCTCTTGAATGAGGAGGTCAACTTCATCG-3’(SEQ ID NO：8)。

Above two sections oligonucleotide are mixed the annealing back be connected (by BamHI and XhoI restriction enzyme site) with slow virus expression vector pLentiLox 3.7-H1 (available from Harvard University's medical college), the outer corotation of institute's plasmid that obtains and HIV-1 packaging plasmid Δ 8.9 and VSVG plasmid (all available from Harvard University's medical college) imports 293T cell (available from U.S. ATCC company), collect the supernatant that contains slow virus (lentivirus) behind the 48h,-80 ℃ frozen, standby.

As follows in order to plain ribozyme i (Luc RNAi) oligonucleotide sequence of preparation contrast FLuorescent:

5’-GATCCGTAGCGCGGTGTATTATACTTCAAGAGAGTATAATACACCGCGCTACTTTTTTGGAAG-3’(SEQ ID NO：9)；

5’-TCGACTTCCAAAAAAGTAGCGCGGTGTATTATACTCTCTTGAAGTATAATACACCGCGCTACG-3’(SEQ ID NO：10)。

Its packaging process is identical with SIRT1 RNAi process.

SIRT1 RNAi intervention experiment is finished at the HepG2 cell, and with above-mentioned prepared slow virus infection cell, Western detects.

9, the SIRT1 inhibitor is handled

SIRT1 inhibitor Sirtinol (50 μ M) handles HepG2 cell 12h, and it is synthetic to measure glycogen by aforesaid method.

10, zoopery

The C57/BL6 mice is induced the insulin resistant model modeling with high fat, resveratrol in the high lipid food of feeding (Resveratrol) administration (concentration is 2.5mg/kg/day).

Mice carbohydrate tolerance (GTT), insulin tolerance (ITT), serum total cholesterol (TC), triglyceride (TG) and low density lipoprotein, LDL (LDL) level are measured in the back all around.

II. embodiment

Embodiment 1 SIRT1 protein level reduces under the insulin resistant situation

1. with C2C12 cell model

According to preceding method, preparation produces the C2C12 cell of insulin resistant after Palmic acid is induced, measure the proteic expression of SIRT1 in the cell.The results are shown in Figure 1A-Fig. 1 C.

Figure 1A is for passing through aforesaid glucose transport assay method, measure the glucose transport situation (glucose intake relatively) of C2C12 cell, the result shows, the C2C12 cell after Palmic acid is induced, produce insulin resistant (that is: insulin do not exist and in the presence of, relatively the glucose intake changes not remarkable).

Figure 1B measures the result of SIRT1 protein expression situation for adopting aforesaid Western Blot method, and SIRT1 albumen descends in the C2C12 of insulin resistant cell; Fig. 1 C represents for the quantification of Figure 1B.Among the figure, tubulin (tubulin) is the contrast of electrophoresis applied sample amount.

Therefore as seen, SIRT1 albumen expression in the C2C12 of insulin resistant cell descends.

2. with HepG2 cell model

According to preceding method, preparation produces the HepG2 cell of insulin resistant after glucamine is induced, measure the proteic expression of SIRT1 in the cell.The results are shown in Figure 1D-1F.

Fig. 1 D measures the synthetic situation of glycogen of C2C12 cell for by the synthetic assay method of aforesaid glycogen, shown cell through glucamine is induced after, produces insulin resistant (that is: insulin do not exist and in the presence of, it is not remarkable that glycogen synthesizes variation).

Fig. 1 E shows for adopting aforesaid Western Blot method to measure the result of SIRT1 protein expression situation, has shown that SIRT1 albumen descends in the HepG2 of insulin resistant cell; Fig. 1 F represents for the quantification of Fig. 1 E.

Therefore as seen, SIRT1 albumen expression in the HepG2 of insulin resistant cell descends.

Embodiment 2 downward modulation SIRT1 can cause insulin resistant

According to preceding method, with the slow virus infection HepG2 cell of aforementioned preparation, the SIRT1 in the pair cell carries out RNA to be disturbed, thereby causes the SIRT1 protein expression to descend.

The HepG2 cell is carried out slow virus infection 72h, but therefore the equal express fluorescent protein of contrast virus and SIRT1 RNA viral interference judges used slow virus infection efficient by the expression of observing fluorescin.Fluorescence photo such as Fig. 2 A behind the slow virus infection HepG2 cell, result show that slow virus infection HepG2 cell efficient is very high, and contrast virus wherein is that Luc RNA disturbs.

Fig. 2 B disturbs the proteic Western Blot of SIRT1 testing result in the cell of back to RNA.By Fig. 2 B as can be known, the slow virus mediate rna disturbs and causes the SIRT1 protein expression to take place significantly to descend.

Fig. 2 C is a Western Blot testing result of RNA being disturbed back cells phosphorylation Insulin receptor INSR (antibody of the Insulin receptor INSR that this process adopts and the antibody of phosphorylation Insulin receptor INSR are all available from U.S. Cell Signaling company).The Western testing result shows that SIRT1 expresses to descend and causes the Insulin receptor INSR phosphorylation level to reduce.

By Fig. 2 D as can be known, SIRT1 expresses group of decreased and exists and do not exist under the situation the synthetic variation of glycogen not remarkable at insulin.Therefore, SIRT1 expresses to descend and has stoped insulin-induced glycogen synthetic (among Fig. 2 D, white cylinder represents not have the cell of processing, and the Lycoperdon polymorphum Vitt cylinder is represented the Luc-RNAi cell, and the black cylinder is represented the SIRT1-RNAi cell).

Then, use SIRT1 inhibitor Sirtinol (50 μ M) to handle HepG2 cell 12h, measure the synthetic situation of glycogen.Result such as Fig. 2 E, as seen adopt SIRT1 inhibitor Sirtinol to suppress SIRT1 after, stoped insulin-induced glycogen synthetic.

The above results illustrates that all SIRT1 descends and causes insulin sensitivity to descend.

Embodiment 3 raises the influence of SIRT1 protein level for glucose intake and insulin activation signal under normal and the insulin resistant situation

Prepare viral HSV-SIRT1 according to aforesaid method, handle the C2C12 cell with HSV-SIRT1, thereby in the C2C12 cell, raise the SIRT1 protein level, measure its influence for glucose intake and insulin activation signal under normal and the insulin resistant situation.The result is shown in Fig. 3 A-Fig. 3 C.

By Fig. 3 A as can be known, under normal circumstances, absorption does not have remarkable influence to glucose to raise the SIRT1 protein level.Among the figure, white cylinder represents not add insulin and HSV-SIRT1 group, and the black cylinder represents singly to add the insulin group, and the Lycoperdon polymorphum Vitt cylinder represents singly to add the HSV-SIRT1 group, and stain white background cylinder represents to add insulin and HSV-SIRT1 group.

By Fig. 3 B as can be known, under the insulin resistant situation, raise the absorption that the SIRT1 protein level can significantly promote glucose.Among the figure, white cylinder represents not add insulin and HSV-SIRT1 group, and the black cylinder represents singly to add the insulin group, and the Lycoperdon polymorphum Vitt cylinder represents singly to add the HSV-SIRT1 group, and stain white background cylinder represents to add insulin and HSV-SIRT1 group.

Fig. 3 C adopts conventional Western Blot method to detect the influence of SIRT1 protein level for some insulin activation signals.The insulin signaling pathway protein is carried out Western Blot detect, the result showed that expression SIRT1 albumen can promote the phosphorylation level (above Insulin receptor INSR or kinase whose corresponding antibody are all available from U.S. Cell signaling company) of Insulin receptor INSR under the insulin resistant situation, protein kinase B (Akt), glycogen synthase kinase 3 β (Gsk3 β) and phosphoinositide dependent kinases (PDK1).By Fig. 3 C as can be known, the SIRT1 protein level raises and can strengthen the insulin activation signal.

In summary, raise the SIRT1 protein level glucose intake under the normal condition and insulin activation signal are not had influence, but can significantly strengthen glucose absorption and insulin activation signal under the insulin resistant situation.

Embodiment 4 resveratrol are handled the influence for glucose absorption and insulin activation signal

Handle the C2C12 cell with resveratrol (concentration is respectively 0.01,0.1,1.0 μ M), thereby in the C2C12 cell, promote expression or the activity of SIRT1, measure its influence for glucose intake and insulin activation signal under normal and the insulin resistant situation.The result is shown in Fig. 4 A-Fig. 4 C.

By Fig. 4 A as seen, resveratrol processing promotion glucose absorption under the normal condition.Among the figure, white cylinder represents not add insulin and resveratrol group, and the black cylinder represents singly to add the insulin group, and the Lycoperdon polymorphum Vitt cylinder represents singly to add the resveratrol group, and stain white background cylinder represents to add insulin and resveratrol group.

By Fig. 4 B as seen, resveratrol is handled the absorption that has promoted glucose under the insulin resistant situation.Among the figure, white cylinder represents not add insulin and resveratrol group, and the black cylinder represents singly to add the insulin group, and the Lycoperdon polymorphum Vitt cylinder represents singly to add the resveratrol group, and stain white background cylinder represents to add insulin and resveratrol group.

By Fig. 4 C as seen, resveratrol is handled can strengthen the insulin activation signal, and resveratrol can significantly promote the proteic expression of SIRT1.The insulin signaling pathway protein is carried out Western Blot detect, the result showed the phosphorylation level (an above Insulin receptor INSR and a kinase whose corresponding antibody are all available from U.S. Cell signaling company) of resveratrol processing can promote normally to reach Insulin receptor INSR under the insulin resistant situation, protein kinase B (Akt), glycogen synthase kinase 3 β (Gsk3 β) and phosphoinositide dependent kinases (PDK1).

In summary, resveratrol (Resveratrol) is handled and all can be promoted glucose to take under normal and insulin resistant situation, strengthens the insulin activation signal.

But embodiment 5 resveratrols and SIRT1 enhance hepatocyte glycogen are synthetic

With slow virus infection (being Sirt RNAi virus) the HepG2 cell of aforementioned preparation, the SIRT1 in the pair cell carries out RNA to be disturbed, thereby causes the SIRT1 protein expression to descend.Contrast is infected the HepG2 cell for adopting Luc RNAi virus (i.e. contrast virus).

Adopt insulin and resveratrol to handle cell respectively.The results are shown in Figure 5.

By the result as seen, the synthetic participation that needs SIRT1 of resveratrol enhance hepatocyte glycogen.

Embodiment 6 rise SIRT1 protein levels or resveratrol are handled the influence for PTP-1B

According to aforesaid method, adopt HSV-SIRT1 to raise the SIRT1 protein level, adopt of the influence of Western Blot mensuration for PTP-1B albumen (PTP-1B antibody is available from U.S. Upstate company), be contrast with Tubulin; Adopting the described RT-PCR method mensuration of the 6th part PTP-1B mRNA level in previous materials and the method, is contrast with Actin.Result such as Fig. 6 A-Fig. 6 B.

As shown in Figure 6A, find under the insulin resistant situation that the SIRT1 protein level raises can reduce the PTP-1B protein level, and the SIRT1 protein level is high more, the PTP-1B protein level is low more.

Shown in Fig. 6 B, find that under the insulin resistant situation, the SIRT1 protein level raises the mRNA level that can reduce PTP-1B.Fig. 6 E is the quantification to each PTP-1B mRNA test strip of Fig. 6 B.

Then, the inventor also uses resveratrol (concentration is respectively 0.01,0.1 and 1.0 μ M) to handle cell, promotes activity and the expression of SIRT1 in the C2C12 cell, adopting Western Blot to measure for the proteic influence of PTP-1B, is contrast with Tubulin; Adopt the described RT-PCR method mensuration of the 6th part PTP-1B mRNA level in previous materials and the method.The result is shown in Fig. 6 C and Fig. 6 D.

Shown in Fig. 6 C, find that the resveratrol processing all can significantly reduce the PTP-1B protein level under normal and insulin resistant situation.

Shown in Fig. 6 D, find that the resveratrol processing all can significantly reduce the mRNA level of PTP-1B under normal and insulin resistant situation.Fig. 6 F is the quantification to each PTP-1B mRNA test strip of Fig. 6 D.

In summary, raising SIRT1 protein level (under the insulin resistant situation) or resveratrol handles (normal or insulin resistant situation under) and can reduce PTP-1B albumen and mRNA level.

Embodiment 7

The influence that the insulin sensitivity that rise PTP-1B protein level causes for rise SIRT1 raises

According to aforesaid method, in the C2C12 cell, adopt HSV-SIRT1 and HSV-PTP-1B to raise SIRT1 protein level and PTP-1B protein level respectively.

Adopt aforesaid Western Blot method to detect, the PTP-1B of HSV mediation and SIRT1 protein level raise situation shown in Fig. 7 A.

Shown in Fig. 7 B, the PTP-1B protein level raises and has reversed the glucose absorption rising that the rise of SIRT1 protein level causes.Under the situation that does not raise the PTP-1B protein level, the SIRT1 protein level raises and causes glucose to take in rising, and under the situation that raises the PTP-1B protein level gradually, the SIRT1 protein level raises and causes the glucose absorption to descend gradually.Wherein, white cylinder is represented not add insulin and is not raised SIRT1 and PTP-1B, and the black cylinder is represented to add insulin and raised SIRT1 and do not raise PTP-1B, and the Lycoperdon polymorphum Vitt cylinder is represented to add insulin and raised SIRT1 and raise PTP-1B.

Therefore as seen, raise the PTP-1B protein level and can reverse the insulin sensitivity rising that rise SIRT1 causes, illustrate that the effect of the SIRT1 raising insulin sensitivity of finding among the present invention realizes by suppressing PTP-1B.

Embodiment 8 resveratrols are for the related indication influence of diabetes such as insulin sensitivity

Method is induced the plain opposing of C57/BL6 mouse islets model, resveratrol in the high lipid food of feeding (Resveratrol) administration (2.5mg/kg/d) with high fat as described above.All around, adopt blood glucose meter to measure mice carbohydrate tolerance (GTT), insulin tolerance (ITT), adopt automatic biochemistry analyzer to measure serum total cholesterol (TC), triglyceride (TG) and low density lipoprotein, LDL (LDL) level, adopt the serum measured by radioimmunoassay insulin level.The result is shown in Fig. 8 A-Fig. 8 E.

By Fig. 8 A as can be known, in the low fat group, the intravital serum insulin levels of animal is lower; In high fat group, the intravital serum insulin levels of animal is very high; And after high fat group gave resveratrol, serum insulin levels significantly was lower than high fat group.Therefore as seen, resveratrol can suppress the inductive hyperinsulinemia of high fat.

To the spend the night glucose of injected in mice doses of hunger, measure mouse blood sugar concentration (GTT) in different time points then.By Fig. 8 B as can be known, in each time period, the blood sugar level of high fat group is apparently higher than low fat group and high fat+resveratrol group.Therefore as seen, resveratrol can improve the inductive glucose tolerance of high fat.

To the spend the night insulin of injected in mice doses of hunger, measure mouse blood sugar concentration (ITT) in different time points then.By Fig. 8 C as can be known, in each time period, the blood sugar level of high fat group is apparently higher than low fat group and high fat+resveratrol group.Therefore as seen, resveratrol can improve the inductive insulin resistant of high fat.

By Fig. 8 D as can be known, in the low fat group, the intravital total cholesterol level of animal is lower; In high fat group, the intravital total cholesterol level of animal is very high; And after high fat group gave resveratrol, total cholesterol level was lower than high fat group.Therefore as seen, resveratrol can reduce the inductive total cholesterol level rising of high fat.

By Fig. 8 E as can be known, in the low fat group, the intravital low density lipoprotein, LDL content of animal is lower; In high fat group, the intravital low density lipoprotein, LDL content of animal is very high; And after high fat group gave resveratrol, low density lipoprotein, LDL content was lower than high fat group.Therefore as seen, resveratrol can reduce the inductive low-density lipoprotein white level rising of high fat.

To sum up, resveratrol can improve diabetes related symptoms such as insulin sensitivity, reduces T-CHOL and low density lipoprotein, LDL content in the high fat diet mice body.

The method of the embodiment 9 screenings raising the potential material of insulin sensitivity

Method 1:

With SIRT1 albumen is target spot, utilizes the muscle cell (C2C12 as used in the present invention) of insulin response or the potential material of hepatocyte (as the HepG2 cell) screening raising insulin sensitivity.

Test group: in aforesaid insulin response cell, add candidate substances.

Matched group: in aforesaid insulin response cell, do not add candidate substances.

Detect SIRT1 protein active or expression in the test group cell, and compare with SIRT1 protein active or expression in the cellular control unit, if SIRT1 protein active or express is higher than statistically in the test group (as high 20% or more than) matched group, just show that this material standed for is the material that can be used for improving insulin sensitivity.

Method 2:

With PTP-1B is target spot, utilizes the muscle cell (C2C12 as used in the present invention) of insulin response or the potential material of hepatocyte (as the HepG2 cell) screening raising insulin sensitivity.

Test group: in aforesaid insulin response cell, add candidate substances.

Detect protein expression situation or the mRNA level of the PTP-1B in the test group cell, and compare with protein expression situation or the mRNA level of PTP-1B in the cellular control unit, if the protein expression situation of PTP-1B or mRNA level are lower than statistically in the test group (as high 20% or more than) matched group, just show that this material standed for is the material that can be used for improving insulin sensitivity.

Embodiment 10 contains an amount of SIRT1 albumen or its agonist or goes up the compositions of adjusting

The prescription such as the table 1 of described food composition:

Table 1

Functional drinks 1 (grams per liter)	Resveratrol 0.002, oligosaccharide 10, citric acid 1.8, Fructus Citri Limoniae essence 1, sodium chloride 0.6, potassium chloride 0.1, sodium dihydrogen phosphate 0.1, sodium bicarbonate 0.1
Functional drinks 1 (grams per liter)		Functional drinks 2 (wt%)	Resveratrol 0.02, mandarin orange 16, pureed apricot 8, Fructus Persicae mud 8, banana puree 6
Functional drinks 3 (wt%)	Butein 0.1, white sugar 6, cyclamate 0.06, citric acid 0.16, sodium citrate 0.03, Sal 0.02, sodium benzoate 0.02	Functional drinks 2 (wt%)
Functional drinks 3 (wt%)		Functional cookies	Resveratrol 0.002g/kg; Butter 150g/kg; Butter 100g/kg; White sugar 120g/kg; Salt 10g/kg; 1 in egg; Self-raising flour 360g/kg; Milk 25ml
Functional cookies	Isoliquiritigenin 0.1g/kg; Butter 170g/kg; Butter 80g/kg; White sugar 100 g/kg; Salt 7g/kg; 1 in egg; Self-raising flour 250g/kg; Gluten flour 60g/kg; Milk 40ml	Functional cookies

The high fat of above-mentioned various functional food feedings is induced the C57/BL6 mice of insulin resistant, and test is for the influence of the plain sensitivity of mouse islets.After taking the regular period, mice is detected, found that, find that these food all are significantly improved for indexs such as the inductive hyperinsulinemia of high fat, the inductive glucose tolerances of high fat.

Embodiment 11 pharmaceutical compositions

Described pharmaceutical composition is prepared as table 2:

Table 2

Pharmaceutical composition 1	Every dose of 100mg wherein contains resveratrol 5mg, rosiglitazone 2mg
Pharmaceutical composition 1		Pharmaceutical composition 2	Every dose of 80mg wherein contains resveratrol 2mg, glibenclamide 2.5mg, glipizide 2mg, glibornuride 2mg
Pharmaceutical composition 3	Every dose of 1000mg wherein contains resveratrol 1mg, metformin 500mg, phenformin 25mg	Pharmaceutical composition 2
Pharmaceutical composition 3		Pharmaceutical composition 4	Every dose of 200mg wherein contains resveratrol 50mg, acarbose 50mg, miglitol 20mg

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉method and composition of increase insulin sensitivity

<130>065774

<160>10

<170>PatentIn version 3.3

<210>1

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>1

atcactgcca cccagaagac 20

<210>2

<211>17

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>2

atgaggccac caccctg 17

<210>3

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>3

ctgacacctg cctcttactg 20

<210>4

<211>18

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>4

cacttgactg ggctctgc 18

<210>5

<211>34

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>5

ggatacgcgt atggagatgg agaaggagtt cgag 34

<210>6

<211>33

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>6

ggaagtcgac agtgctccca gtctgtcagt gaa 33

<210>7

<211>63

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>7

gatccgatga agttgacctc ctcattcaag agatgaggag gtcaacttca tcttttttgg 60

aaa 63

<210>8

<211>63

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>8

agcttttcca aaaaagatga agttgacctc ctcatctctt gaatgaggag gtcaacttca 60

tcg 63

<210>9

<211>63

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>9

gatccgtagc gcggtgtatt atacttcaag agagtataat acaccgcgct acttttttgg 60

aag 63

<210>10

<211>63

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>10

tcgacttcca aaaaagtagc gcggtgtatt atactctctt gaagtataat acaccgcgct 60

acg 63

Claims

1. a SIRT1 albumen or its agonist or the upward purposes of adjustment is characterized in that, are used to prepare the compositions that improves insulin sensitivity.

2. purposes as claimed in claim 1 is characterized in that, described SIRT1 albumen or its agonist or last adjustment also are used to prepare the compositions that Profilin tyrosine phosphatase-1B transcribes or expresses.

3. purposes as claimed in claim 1 is characterized in that, described compositions is used for the treatment of the disease that insulin sensitivity descends and is correlated with.

4. purposes as claimed in claim 3, it is characterized in that the relevant disease of described insulin sensitivity decline comprises: insulin resistant, type 2 diabetes mellitus, hyperinsulinemia, diabetic ketoacidosis, hyperosmolar nonketotic diabetic coma, lactic acidosis.

5. purposes as claimed in claim 1 is characterized in that, proteic agonist of described SIRT1 or last the adjustment are selected from: resveratrol, butein, isoliquiritigenin, fisetin or piceatannol.

6. a screening can be used for improving the method for the potential material of insulin sensitivity, it is characterized in that described method comprises:

7. method as claimed in claim 6 is characterized in that, also comprises:

The expression of Protein-tyrosine-phosphatase-1B or activity in the observation system,

If the expression of Protein-tyrosine-phosphatase-1B or active the reduction show that then this candidate substances is the potential material that can be used for improving insulin sensitivity.

8. method as claimed in claim 6 is characterized in that, described system is selected from: solution system, subcellular fraction system, cell system, organizational framework, organ systems or animal system.

9. material that can be used for improving insulin sensitivity that obtains by the described method of claim 6.

10. a compositions is characterized in that, described compositions contains:

(i) the SIRT1 albumen of effective dose or its agonist or upward adjustment;

The (ii) material of group under being selected from of effective dose: biguanides diabetes medicament, sulfonylurea diabetes medicament, glucosidase inhibitor class medicine, insulin sensitivity enhancing class medicine, aldose reductase inhibitor class medicine, pancreotropic hormone discharge the class medicine; And

(iii) acceptable carrier pharmaceutically or on the bromatology.