CN101175770A

CN101175770A - Polypeptides having antimicrobial activity and polynucleotides encoding same

Info

Publication number: CN101175770A
Application number: CNA2006800166725A
Authority: CN
Inventors: 尼古拉吉·斯波德斯伯格; 柯克·M·施努尔
Original assignee: Novo Nordisk AS
Current assignee: Novozymes Biopharma DK AS
Priority date: 2005-03-18
Filing date: 2006-03-20
Publication date: 2008-05-07
Also published as: ZA200707264B

Abstract

The present invention relates to isolated polypeptides having antimicrobial activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using polypeptides.

Description

Have the polypeptide of antimicrobial acivity and the polynucleotide of this polypeptide of coding

Invention field

The present invention relates to have the isolated polypeptide of antimicrobial acivity and the isolating polynucleotide of this polypeptide of coding.The invention still further relates to the nucleic acid construct, carrier and the host cell that comprise described polynucleotide, and the method that is used to produce and use described polypeptide.

Background of invention

The purpose of this invention is to provide polypeptide with antimicrobial acivity and the polynucleotide of encoding this polypeptide.

The invention summary

The present invention relates to have the polypeptide of antimicrobial acivity, described polypeptide comprises by C-x (3)-C-x (7,9)-C-C; C-C-x (8)-C-x-C or the aminoacid sequence that C-x-C-x (8,11)-C represents.

In embodiments, described polypeptide is a defensin.

In other embodiments, described polypeptide is selected from down group:

(a) polypeptide, aminoacid sequence that it has and following sequence have at least 60% identity:

SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, the amino acid/11 to 49 of SEQ ID NO:8 or SEQ IDNO:10;

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28.

(b) by nucleotide sequence coded polypeptide, described nucleotides sequence is listed under the middle at least stringent condition and following (i) or (ii) hybridization:

(i) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, the Nucleotide 151 to 297 of SEQ IDNO:9;

SEQ ID NO:11, the Nucleotide 118 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 112 to 255 of SEQ ID NO:19;

The Nucleotide 118 to 252 of SEQ ID NO:21;

The Nucleotide 151 to 297 of SEQ ID NO:23;

The Nucleotide 121 to 252 of SEQ ID NO:25; Or

The Nucleotide 145 to 321 of SEQ ID NO:27;

(ii) with (i) complementary chain; With

(c) comprise the conservative variant that replaces, lacks and/or insert one or more amino acid whose following sequences:

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28.

The invention still further relates to isolating polynucleotide, its coding has the polypeptide of antimicrobial acivity, and described isolating polynucleotide are selected from down group:

(a) polynucleotide of coded polypeptide, aminoacid sequence that described polypeptide has and following sequence have at least 60% identity:

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28.

(b) polynucleotide that have at least 60% identity with following sequence:

SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, the Nucleotide 151 to 297 of SEQ ID NO:9;

SEQ ID NO:11, the Nucleotide 118 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 112 to 255 of SEQ ID NO:19;

The Nucleotide 11 8 to 252 of SEQ ID NO:21;

The Nucleotide 151 to 297 of SEQ ID NO:23;

The Nucleotide 121 to 252 of SEQ ID NO:25; Or

The Nucleotide 145 to 321 of SEQ ID NO:27; With

(c) at least under the stringent condition with following (i) or (ii) hybridization polynucleotide:

SEQ ID NO:11, the Nucleotide 118 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 112 to 255 of SEQ ID NO:19;

The Nucleotide 118 to 252 of SEQ ID NO:21;

The Nucleotide 151 to 297 of SEQ ID NO:23;

The Nucleotide 121 to 252 of SEQ ID NO:25; Or

The Nucleotide 145 to 321 of SEQ ID NO:27; Perhaps

(ii) with (i) complementary chain.

The invention still further relates to the nucleic acid construct, recombinant expression vector and the recombinant host cell that comprise described polynucleotide.

The invention still further relates to and be used to produce the method that these have the polypeptide of antimicrobial acivity, it comprises that recombinant host cell that (a) will comprise nucleic acid construct cultivates being of value under the condition that produces this polypeptide, and described nucleic acid construct comprises the polynucleotide of coding said polypeptide; (b) reclaim described polypeptide.

The invention still further relates to the method for using polypeptide of the present invention and polynucleotide.

Definition

Antimicrobial acivity: term " antimicrobial acivity " is defined as the activity that can kill or suppress the microorganism cells growth in this article.In the context of the present invention, the meaning of term " antimicrobial " refers to there be Bactericidal (bactericidal) and/or presses down (bacteriostatic) and/or mycocidal (fungicidal) and/or mycostatic (fungistatic) effect and/or the viricidal effect of bacterium that wherein term " Bactericidal " should be interpreted as can the killing bacteria cell.Term " should be pressed down bacterium " and be interpreted as can bacteria growing inhibiting,, suppresses the bacterial cell of growth that is.Term " mycocidal " should be interpreted as can the kill fungi cell.Term " mycostatic " should be interpreted as and suppress fungal growth, that is, suppress the fungal cell of growth.Term " viricidal " should be interpreted as can make virally inactivated.Bacterium or fungal cell's (comprising yeast) represented in term " microorganism cells ".

In the context of the present invention, the meaning phalangeal cell that term " suppresses the growth of microorganism cells " is in the state of non-growth, that is, they can not be bred.

For the present invention, can be according to Lehrer et al., J.Immunol.Methods, 137 (2): the described method of 167-174 (1991) is measured antimicrobial acivity.Selectively, antimicrobial acivity can be according to CLSI (clinical and laboratory standards institute (Clinical and Laboratory Standards Institute); Before be called the clinical and laboratory standard council (National committee for Clinical and LaboratoryStandards) of country) the NCCLS criterion measure.

In 25% (w/w) aqueous solution of the polypeptide with antimicrobial acivity, preferably in the aqueous solution of 10% (w/w), more preferably in the aqueous solution of 5% (w/w), even more preferably in the aqueous solution of 1% (w/w), most preferably in the aqueous solution of 0.5% (w/w), and particularly in the aqueous solution of 0.1% (w/w), after 20 ℃ of incubations 8 hours (after preferred 4 hours, more preferably after 2 hours, most preferably after 1 hour, and particularly after 30 minutes), the polypeptide with antimicrobial acivity may be able to be reduced to 1/100 with the viable count of intestinal bacteria (DSM 1576).

When adding with the concentration of 1000ppm, preferably when adding with the concentration of 500ppm, more preferably when adding with the concentration of 250ppm, even more preferably when adding with the concentration of 100ppm, most preferably when adding with the concentration of 50ppm, and particularly when adding with the concentration of 25ppm, the polypeptide with antimicrobial acivity may suppress the outgrowths (outgrowth) of intestinal bacteria (DSM 1576) 24 hours in microbial growth substrate (growth substrate) in 25 ℃.

In 25% (w/w) aqueous solution of the polypeptide with antimicrobial acivity, preferably in the aqueous solution of 10% (w/w), more preferably in the aqueous solution of 5% (w/w), even more preferably in the aqueous solution of 1% (w/w), most preferably in the aqueous solution of 0.5% (w/w), and particularly in the aqueous solution of 0.1% (w/w), after 20 ℃ of incubations 8 hours (after preferred 4 hours, more preferably after 2 hours, most preferably after 1 hour, and particularly after 30 minutes), the polypeptide with antimicrobial acivity may be able to be reduced to 1/100 with the viable count of subtilis (Bacillus subtilis) (ATCC 6633).

When adding with the concentration of 1000ppm, preferably when adding with the concentration of 500ppm, more preferably when adding with the concentration of 250ppm, even more preferably when adding with the concentration of 100ppm, most preferably when adding with the concentration of 50ppm, and particularly when adding with the concentration of 25ppm, the polypeptide with antimicrobial acivity may suppress the outgrowth of subtilis (ATCC 6633) 24 hours in the microbial growth substrate in 25 ℃.

At least 20% of the antimicrobial acivity of the polypeptide that the antimicrobial acivity that polypeptide of the present invention has is made up of aminoacid sequence shown below, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 100%:

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28.

Defensin: term " defensin " is used for the polypeptide that this paper middle finger those skilled in the art generally acknowledge the defensin class that belongs to antimicrobial peptide.Whether in order to measure polypeptide is defensin of the present invention, preferably by using the HMMER software package that freely to obtain, the hidden Markov model preface type (hidden markov model profile) (HMM preface type) of aminoacid sequence and PFAM database is compared (referring to embodiment 6).

Described PFAM defensin family comprises defensin 1 or " Mammals defensin " (accession number: PF00323), defensin _ 2 or " arthropods defensin " (accession number: PF01097), defensin _ β or " β defensin " (accession number: PF00711), defensin _ propep or " defensin propetide " (accession number: PF00879) and γ-thionine or " γ-thionine family " (accession number: PF00304).

Defensin can belong to α-defensin class, beta-defensin class, θ-defensin class, insect or arthropods defensin class, or the plain class of plant defense.

In embodiments, the aminoacid sequence of defensin of the present invention comprises 4,5,6,7,8,9 or 10 cysteine residues, preferred 6,7,8,9 or 10 cysteine residues, more preferably 6,8 or 10 cysteine residues, most preferably 6 or 8 cysteine residues.

Defensin can also be a synthetic defensin of sharing the specific characteristic of any defensin class.

The example of defensin includes but not limited to, α-defensin HNP-1 (people's neutrophilic granulocyte peptide), HNP-2 and HNP-3; Beta-defensin-12, fruit bat defensin (Drosomycin), extra large sharp defensin (Heliomicin), γ 1-purothionine (purothionin), insect defensin A and be disclosed in PCT application WO 99/53053, WO 02/085934, WO 03/044049, the defensin among PCT/DK2005/000725 and the PCT/DK2005/000735.

Isolated polypeptide: term " isolated polypeptide " is used for this paper middle finger, as measuring by SDS-PAGE, it is pure at least 20%, preferably at least 40% is pure, more preferably at least 60% is pure, even more preferably at least 80% pure, most preferably at least 90% is pure, and even at least 95% pure polypeptide most preferably.

Basically pure polypeptide: term " pure basically polypeptide " is represented the polypeptide prepared product at this paper, described polypeptide prepared product contains at the most 10% by weight, preferably at the most 8%, more preferably at the most 6%, more preferably at the most 5%, more preferably at the most 4%, at the most 3%, even more preferably at the most 2%, most preferably at the most 1%, and even other polypeptide material of 0.5% bonded natural (associated) at the most most preferably with it.Therefore, preferred described pure basically polypeptide is pure by the weight at least 92% that is present in the whole polypeptide materials in the prepared product, preferably at least 94% is pure, and more preferably at least 95% is pure, and more preferably at least 96% is pure, more preferably at least 96% is pure, more preferably at least 97% is pure, and more preferably at least 98% is pure, even more preferably at least 99% pure, most preferably at least 99.5% is pure, and even most preferably 100% pure.

The form that polypeptide of the present invention is preferably pure basically.Particularly, preferred described polypeptide is " (essentially) pure form basically ", that is, described polypeptide prepared product is substantially free of other polypeptide material of bonded natural with it.This can realize by the following method, for example, prepares polypeptide by known recombination method or by classical purification process.

In this article, term " pure basically polypeptide " and term " isolated polypeptide " and " polypeptide of unpack format " synonym.

Identity: parameter " identity " describe between two aminoacid sequences or two nucleotide sequences between dependency.

For the present invention, identity degree between two aminoacid sequences is included in program FASTA among the FASTA routine package version 2.0x (referring to W.R.Pearson and D.J.Lipman (1988) by use, " Improved Tools for Biological Sequence Analysis ", PNAS85:2444-2448; And W.R.Pearson (1990) " Rapid and Sensitive SequenceComparison with FASTP and FASTA ", Methods in Enzymology 183:63-98) measure.Employed score matrix is BLOSUM50, and breach point penalty (gap penalty) is-12, and breach extension point penalty (gap extension penalty) is-2.

Identity degree between two nucleotide sequences uses algorithm and software package same as described above to measure.Employed score matrix is the identity matrix, and the breach point penalty is-16, and breach extension point penalty is-4.

Alternative is that the comparison of two aminoacid sequences is measured by the Needle program of using EMBOSS software package (http://emboss.org) version 2.8.0.The Needle program is carried out overall alignment algorithm, and described arthmetic statement is in Needleman S.B.and Wunsch C.D. (1970), among the J.Mol.Biol.48:443-453.Employed substitution matrix is BLOSUM62, and it is 10 that breach is opened point penalty (gapopening penalty), and breach extension point penalty is 0.5.

Aminoacid sequence of the present invention (" sequence of the present invention ", for example, the amino acid/11 to 49 of SEQ ID NO:2) and the identity degree between the different aminoacid sequence (" exogenous array "), be with the accurate number of coupling in two sequence alignments overlapping, the shortest one is calculated in the length divided by the length of " sequence of the present invention " and " exogenous array ".The result represents with per-cent identity.

When " sequence of the present invention " had identical amino-acid residue with " exogenous array " in the eclipsed same position, accurately coupling appearred.The length of sequence is the number (for example, the length of the amino acid/11 to 49 of SEQID NO:2 is 49) of amino-acid residue in the sequence.

Polypeptide fragment: term " polypeptide fragment " is defined as the NO:2 from SEQ ID, SEQ IDNO:4, SEQ ID NO:6 in this article, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ IDNO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ IDNO:24, the amino of SEQ ID NO:26 or SEQ ID NO:28 and/or the one or more amino acid whose polypeptide of carboxyl-terminal deletion; Or its homologous sequence; Wherein said fragment has antimicrobial acivity.

Subsequence: term " subsequence (subsequence) " is defined as the NO:1 from SEQ ID, SEQ ID NO:3, SEQ ID NO:5 in this article, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQID NO:23, the nucleotide sequence of the one or more Nucleotide of 5 ' and/or 3 ' end disappearance of SEQ ID NO:25 or SEQ ID NO:27; Or its homologous sequence; Wherein said subsequence coding has the polypeptide fragment of antimicrobial acivity.

Allelic variant (allelic variant): any two or more optional form of the gene of phase syntenic genes seat represented to occupy in this article in term " allelic variant ".Allelic variation takes place natively by sudden change, and can cause the polymorphism in the population.Transgenation can be reticent (no change in encoded polypeptides) maybe can the encode polypeptide of aminoacid sequence with change.The allelic variant of polypeptide is the allelic variant encoded polypeptides by gene.

Basically pure polynucleotide: term " pure basically polynucleotide " is used for the polynucleotide prepared product that this paper refers to not have other Nucleotide external or that do not expect, and described polynucleotide prepared product is in is suitable for the form used in the protein generation system of genetic engineering.Therefore, basically pure polynucleotide contain at the most 10% by weight, preferably at the most 8%, more preferably at the most 6%, more preferably at the most 5%, more preferably at the most 4%, more preferably at the most 3%, even more preferably at the most 2%, most preferably at the most 1%, and even other polynucleotide material of 0.5% bonded natural at the most most preferably with it.Yet pure basically polynucleotide can comprise naturally occurring 5 ' and 3 ' non-translational region, for example promotor and terminator.It is at least 90% pure that preferred pure basically polynucleotide are by weight, preferably at least 92% is pure, more preferably at least 94% is pure, more preferably at least 95% is pure, more preferably at least 96% is pure, and more preferably at least 97% is pure, even more preferably at least 98% pure, most preferably at least 99%, and even it is most preferably at least 99.5% pure.Polynucleotide of the present invention are preferably pure basically form.Particularly, preferably at polynucleotide disclosed herein be " pure basically form ", that is, described polynucleotide prepared product is substantially free of other polynucleotide material of bonded natural with it.In this article, term " pure basically polynucleotide " and term " isolating polynucleotide " and " polynucleotide of unpack format " synonym.Described polynucleotide can be genomic, cDNA, RNA, semisynthetic, synthetic source, or their any combination.

CDNA: term " cDNA " is defined as in this article can be by reverse transcription from deriving from the dna molecular of eukaryotic mRNA molecule preparation sophisticated, montage.CDNA lacks the intron sequences that is present in usually among the corresponding gene group DNA.Initial (initial), primary rna transcription thing are the precursors of mRNA, and it occurs as the mRNA of sophisticated montage then by a series of step processing.These steps comprise by the process that is called montage removes intron sequences.Be derived from the cDNA of mRNA thereby without any intron sequences.

Nucleic acid construct: term " nucleic acid construct " is used for this paper and refers to strand or double-stranded nucleic acid molecule, described nucleic acid molecule separates from naturally occurring gene, or described nucleic acid molecule is modified to contain the fragment of nucleic acid in the mode that was not present in (nototherwise exist) occurring in nature originally.When described nucleic acid construct contains encoding sequence of the present invention and expresses required regulating and controlling sequence, term nucleic acid construct and term " expression cassette " synonym.

Regulating and controlling sequence (control sequence): term " regulating and controlling sequence " is defined as at this paper and comprises that it is essential or favourable all the components that the polynucleotide of code book invention polypeptide are expressed.Various regulating and controlling sequences can be natural or external sources for the nucleotide sequence of coding said polypeptide.These regulating and controlling sequences include but not limited to leader sequence, polyadenylation sequence, propeptide sequence, promotor, signal peptide sequence and transcription terminator.Minimum situation, regulating and controlling sequence comprise promotor and the termination signal of transcribing and translating.Regulating and controlling sequence can provide together with the joint that is used to introduce the specificity restriction site, and described specificity restriction site promotes being connected of nucleotide sequence coded district of regulating and controlling sequence and coded polypeptide.

Be operably connected: term " is operably connected " and represents such configuration at this paper, wherein regulating and controlling sequence is placed the correct position with respect to the encoding sequence of polynucleotide sequence, makes regulating and controlling sequence instruct the expression of polypeptid coding sequence.

Encoding sequence: the meaning of term when being used for this paper " encoding sequence " is the nucleotide sequence of directly specifying the aminoacid sequence of its protein.The border of encoding sequence is usually by opening frame decision, describedly opens frame for example GTG and TTG begin with ATG initiator codon or alternative initiator codon usually.Encoding sequence can be DNA, cDNA or recombinant nucleotide sequence.

Express: term " expressions " comprises any any step that relates to the polypeptide generation, and it includes but not limited to transcribe, post transcriptional modificaiton, translation, posttranslational modification and secretion.

Expression vector: term " expression vector " is defined as linear or Circular DNA molecular structure at this paper, and it comprises the polynucleotide of code book invention polypeptide, and described polynucleotide are operably connected with the extra Nucleotide that is provided for its expression.

Host cell: term " host cell " comprises any cell type as used herein, and conversion, transfection, transduction that described cell type comprises the nucleic acid construct of polynucleotide of the present invention for use etc. is (susceptible) of susceptible.

Modify: any chemically modified of the polypeptide that term " modification " is made up of following sequence in the meaning of this paper:

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28;

And to the genetic manipulation of the DNA of this peptide species of encoding.Described modification can be to replace, lack and/or insert one or more amino acid and replace one or more amino acid side chains; Or in aminoacid sequence, use alpha-non-natural amino acid with similar characteristics.Particularly described modification can be amidation, for example the amidation of C-terminal.

Artificial variant: when being used in this paper, the meaning of term " artificial variant " is the polypeptide with antimicrobial acivity, described polypeptide is by expressing SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, the organism of the modified nucleotide sequences of SEQ ID NO:25 or SEQ ID NO:27 produces.Described modified nucleotide sequences is disclosed in SEQ ID NO:1 by human intervention (human intervention) by modification, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, the nucleotide sequence of SEQ ID NO:25 or SEQ ID NO:27 obtains.

Detailed Description Of The Invention

Polypeptide with antimicrobial acivity

Aspect first, the present invention relates to have the polypeptide of antimicrobial acivity, described polypeptide comprises by C-x (3)-C-x (7,9)-C-C; C-C-x (8)-C-x-C or the aminoacid sequence that C-x-C-x (8,11)-C represents.

In embodiments, described polypeptide comprises the aminoacid sequence by following expression:

C-x (3)-C-x (7,9)-C-C and C-C-x (8)-C-x-C; Or

C-C-x (8)-C-x-C and C-x-C-x (8,11)-C; Or

C-x (3)-C-x (7,9)-C-C and C-x-C-x (8,11)-C; Or

C-x (3)-C-x (7,9)-C-C and C-C-x (8)-C-x-C and C-x-C-x (8,11)-C.

Pattern (pattern) C-x (3)-C-x (7,9)-C-C; C-C-x (8)-C-x-C and C-x-C-x (8,11)-C should use PROSITE ( Www.expasy.org/prosite/) mode-definition form (pattern definitionformat) illustrates:

-be used for amino acid whose standard I UPAC single-letter code (one-letter code);

-symbol " x " is used for accepting any amino acid whose position;

Each element in the-pattern is by " " being adjacent element separately; And

The repeating of the element of-pattern represented by the numerical value that has after this element or the digital scope between bracket.For example: x (3) is equivalent to x-x-x, and x (2,4) is equivalent to x-x or x-x-x or x-x-x-x.

About the more information of PROSITE methodology purposes, please refer to Sigrist et al.PROSITE:adocumented database using patterns and profiles as motif descriptors.BriefBioinform.3:265-274 (2002).

Aspect second, it can be the embodiment of first aspect, the present invention relates to polypeptide, described polypeptide comprise with

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28 (promptly, mature polypeptide) has at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, and even the aminoacid sequence of at least 97% identity degree most preferably, described polypeptide has antimicrobial acivity (hereinafter " homeopeptide ").Aspect preferred, described homeopeptide has aminoacid sequence, described aminoacid sequence with

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28 differs 10 amino acid, preferred 5 amino acid, more preferably 4 amino acid, even more preferably 3 amino acid, 2 amino acid most preferably, and even 1 amino acid most preferably.

Polypeptide of the present invention preferably comprises NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, the aminoacid sequence of SEQ ID NO:26 or SEQ IDNO:28, or its allele variant; Or their fragment with antimicrobial acivity.Aspect preferred, polypeptide comprises NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, the aminoacid sequence of SEQ ID NO:26 or SEQ IDNO:28.Other preferred aspect, polypeptide comprises SEQ ID NO:2, SEQ IDNO:4, SEQ ID NO:6, the amino acid/11 to 49 of SEQ ID NO:8 or SEQ ID NO:10;

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28, or its allele variant; Or their fragment with antimicrobial acivity.Other preferred aspect, polypeptide comprises

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28.

Other preferred aspect, polypeptide is by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, aminoacid sequence or its allele variant of SEQ ID NO:26 or SEQ ID NO:28; Or their fragment with antimicrobial acivity is formed.Other preferred aspect, polypeptide is by SEQ ID NO:2, SEQ ID NO:4, SEQID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, the aminoacid sequence of SEQID NO:26 or SEQ ID NO:28 is formed.Other preferred aspect, polypeptide is by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, the amino acid/11 to 49 of SEQ ID NO:8 or SEQ ID NO:10;

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28 or its allele variant; Or their fragment with antimicrobial acivity is formed.Other preferred aspect, polypeptide by

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28 is formed.

Aspect second, the present invention relates to have the isolated polypeptide of antimicrobial acivity, described isolated polypeptide is by polynucleotide encoding, described polynucleotide are under very low stringent condition, under the preferred low stringent condition, under the more preferably middle stringent condition, more preferably-the Gao stringent condition under, even under the more preferably high stringent condition, and most preferably very high stringent condition is following and following sequence hybridization: (i) SEQ ID NO:1, SEQID NO:3, SEQ ID NO:5, SEQ ID NO:7, the Nucleotide 151 to 297 of SEQ ID NO:9;

SEQ ID NO:11, the Nucleotide 118 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 112 to 255 of SEQ ID NO:19;

The Nucleotide 118 to 252 of SEQ ID NO:21;

The Nucleotide 151 to 297 of SEQ ID NO:23;

The Nucleotide 121 to 252 of SEQ ID NO:25; Or

The Nucleotide 145 to 321 of SEQ ID NO:27;

(ii) cDNA sequence, it is contained in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, the Nucleotide 1 to 297 of SEQ ID NO:9;

SEQ ID NO:11, the Nucleotide 1 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 1 to 255 of SEQ ID NO:19;

The Nucleotide 1 to 252 of SEQ ID NO:21;

The Nucleotide 1 to 297 of SEQ ID NO:23;

The Nucleotide 1 to 252 of SEQ ID NO:25; Or

The Nucleotide 1 to 321 of SEQ ID NO:27;

(iii) (i) or subsequence (ii), or (iv) (i), (ii) or complementary strand (J.Sambrook (iii), E.F.Fritsch, and T.Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2dedition, Cold Spring Harbor, New York).SEQ ID NO:1, SEQ ID NO:3, SEQ IDNO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ IDNO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, the subsequence of SEQ IDNO:25 or SEQ ID NO:27 contain at least 100 successive Nucleotide or preferred at least 200 successive Nucleotide.In addition, described subsequence codified has the polypeptide fragment of antimicrobial acivity.

SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, the nucleotide sequence of SEQ ID NO:25 or SEQ ID NO:27; Or its subsequence; And SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ IDNO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ IDNO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, the aminoacid sequence of SEQ ID NO:26 or SEQID NO:28; Or its fragment; Can be used for the designing nucleic acid probe, the DNA of the polypeptide that has antimicrobial acivity with the identification of strains that never belongs to together and plant according to method well known in the art and clones coding.Particularly,, these probes can be used for and the genome of interested genus or kind or cDNA hybridization, to identify and to separate wherein gene accordingly according to the Southern trace method of standard.These probes can be significantly shorter than complete sequence, but should be at least 14 on the length, and preferably at least 25, more preferably at least 35, and at least 70 Nucleotide most preferably.Yet preferred described nucleic acid probe is at least 100 length of nucleotides.For example, described nucleic acid probe can be at least 200 Nucleotide, preferably at least 250 Nucleotide.The two all can use DNA and rna probe.Usually probe mark (for example, is used to survey corresponding gene ³²P, ³H, ³⁵S, vitamin H or avidin (avidin) mark).These probes are contained among the present invention.

Thereby, can be from by screening DNA the genomic dna of these other organisms preparation or the cDNA library, described DNA and above-mentioned probe hybridization and coding have the polypeptide of antimicrobial acivity.Can pass through agarose or polyacrylamide gel electrophoresis, or by genome or other DNA of other isolation technique separation from these other organisms.Can will be transferred to soluble cotton (nitrocellulose) or other suitable carriers material from the DNA in library or separated DNA and be fixed thereon.In order to identify the NO:1 with SEQ ID, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27; Or its subsequence homologous clone or DNA, described solid support material is used in the Sounthern trace.

For the present invention, hybridization expression nucleotides sequence is listed in the nucleic acid probe that is low to moderate very much under the very high stringent condition with mark; Its complementary strand; Or their subsequence hybridization, described nucleic acid probe is corresponding to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQID NO:21, SEQ ID NO:23, nucleotide sequence shown in SEQ ID NO:25 or the SEQ ID NO:27.Can use X ray sheet (X-ray film) to detect under these conditions molecule with nucleic acid probe hybridization.

Aspect preferred, nucleic acid probe is a polynucleotide sequence, described polynucleotide sequence coding SEQID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ IDNO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ IDNO:22, SEQ ID NO:24, the polypeptide of SEQ ID NO:26 or SEQ ID NO:28; Or its subsequence.Other preferred aspect, nucleic acid probe is SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27.Other preferred aspect, nucleic acid probe is SEQ ID NO:1, SEQ IDNO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ IDNO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ IDNO:23, the mature polypeptide encoded district of SEQ ID NO:25 or SEQ ID NO:27.

Long probe at least 100 Nucleotide of length, be defined as at 42 ℃ being low to moderate very much very high stringent condition, 5X SSPE, 0.3%SDS, 200 μ g/ml sheared and the salmon sperm DNA of sex change in prehybridization and hybridization, and for very low and low stringency be 25% methane amide, in the neutralization-the Gao stringency is 35% methane amide or is 50% methane amide for high and very high stringency, carries out the best processing in 12 to 24 hours according to the Southern blotting of standard.

For length is the long probe of at least 100 Nucleotide, use 2X SSC, 0.2%SDS preferably at least at 45 ℃ (very low stringencies), more preferably at least at 50 ℃ (low stringencies), more preferably at least at 55 ℃ (middle stringencies), more preferably at least 60 ℃ (in-Gao stringency), even more preferably at least at 65 ℃ (high stringencies), and most preferably at 70 ℃ (very high stringencies) solid support material is finally washed three times each 15 minutes at least.

For the short probe of about 15 Nucleotide of length to about 70 Nucleotide, stringent condition is defined as than using the T that draws according to Bolton and McCarthy computing method (1962, Proceedings of the NationalAcademy of Sciences USA 48:1390) _mLow about 5 ℃ to about 10 ℃, at 0.9 MNaCl, 0.09 M Tris-HCl pH 7.6,6 mM EDTA, 0.5%NP-40,1 * Denhardt solution, 1mM trisodium phosphate (sodium pyrophosphate), 1mM SODIUM PHOSPHATE, MONOBASIC (sodium monobasicphosphate) in the yeast rna of 0.1 mM ATP and the every ml of 0.2mg, is carried out prehybridization, hybridization and post-hybridization washing according to the Southern trace step of standard.

To the short probe of about 70 Nucleotide, described solid support material was added among the 0.1%SDS washing one time 15 minutes at 6 * SSC for about 15 Nucleotide of length, and with 6 * SSC at T than calculating _mWashed twice under low 5 ℃ to 10 ℃ the temperature, each 15 minutes.

Aspect the 3rd, the present invention relates to artificial variant, described artificial variant comprises conservative one or more amino acid whose SEQ ID NO:2 that replace, lack and/or insert, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28; Or its mature polypeptide.It is unessential (of aminor nature) that preferred amino acid changes character, i.e. Bao Shou aminoacid replacement or insertion, its not remarkably influenced Protein Folding and/or activity; Be generally 1 to about 30 amino acid whose little disappearances; Little amino or C-terminal extend, for example the N-terminal methionine residues; The little joint peptide of the about 20-25 residue of as many as; Or by changing net charge or other function, for example polyhistidine sequence (poly histidine tract), epitope (antigenicepitope) or promote the little extension of purifying in conjunction with the territory.

The conservative example that replaces is within following group: basic aminoacids group (arginine, Methionin and Histidine), acidic amino acid group (L-glutamic acid and aspartic acid), polare Aminosaeren group (glutamine and l-asparagine), hydrophobic amino acid group (leucine, Isoleucine and Xie Ansuan), aromatic amino acid group (phenylalanine, tryptophane and tyrosine) and p1 amino acid group (glycine, L-Ala, Serine, Threonine and methionine(Met)).Usually the aminoacid replacement that does not change specific activity (specific activity) is known in the art, and by for example H.Neurath and R.L.Hill, 1979, In, The Proteins, Academic Press, New York describes.The most generally the exchange of Fa Shenging is Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly.

Except 20 primary amino acids, non-primary amino acid (for example 4-Hydroxyproline, 6-N-methyllysine, 2-aminoisobutyric acid, isovaline and Alpha-Methyl Serine) can replace the amino-acid residue of wild type peptide.The non-conserved amino acid of limited quantity, can't help genetic code amino acids coding and alpha-non-natural amino acid can the substituted amino acid residue." alpha-non-natural amino acid " is modified behind protein synthesis, and/or has the chemical structure that is different from primary amino acid at their side chain.Alpha-non-natural amino acid can chemically synthesize, and preferably commercial can obtain, comprise pipecolic acid (pipecolic acid), thiazolidine carboxylic acid (thiazolidine carboxylic acid), dehydroproline, 3-and 4-methylproline, with 3,3-dimethyl proline(Pro).

Alternative is that amino acid change has such character so that the physicochemical property of polypeptide change.For example, amino acid change can improve the thermostability of polypeptide, changes substrate specificity, changes optimal pH etc.

Can be according to methods known in the art, for example site-directed mutagenesis or L-Ala subregion mutagenesis (Cunningham and Wells, 1989, Science 244:1081-1085) are identified the indispensable amino acid in parent's polypeptide.In one technology of back, single alanine mutation is incorporated into each residue in the molecule, and the biological activity (that is antimicrobial acivity) of test gained mutating molecule is to identify the active crucial amino-acid residue for described molecule.Equally referring to Hilton et al., 1996, J.Biol.Chem.271:4699-4708.The reactive site of enzyme or other biological interaction also can be measured by the physical analysis of structure, as by following these technology:, measure together with the amino acid whose sudden change in contact site of inferring as nucleus magnetic resonance, crystallography, electron diffraction or photoaffinity labeling.Referring to for example de Vos et al., 1992, Science 255:306-312; Smith et al., 1992, J.Mol.Biol.224:899-904; Wlodaver etal., 1992, FEBS Lett.309:59-64.The identity of indispensable amino acid also can be from inferring that with the identity analysis of polypeptide described polypeptide is relevant with polypeptide according to the present invention.

Can use known mutagenesis, reorganization and/or reorganization (shuffling) method, be relevant screening method then, and for example those are by Reidhaar-Olson and Sauer, 1988, Science 241:53-57; Bowieand Sauer, 1989, Proc.Natl.Acad.Sci.USA 86:2152-2156; WO 95/17413; Or WO 95/22625 those disclosed method is carried out and is tested single or multiple aminoacid replacement.Other method that can use comprises fallibility PCR, phage display (for example, Lowman et al., 1991, Biochem.30:10832-10837; U.S. Patent number 5,223,409; WO 92/06204) and directed mutagenesis (Derbyshire et al., 1986, the Gene 46:145 in zone; Ner et al., 1988, DNA 7:127).

Mutagenesis/reorganization method can make up with the screening method of high-throughput, automatization to detect the activity (Ness et al., 1999, Nature Biotechnology 17:893-896) by the polypeptide clone, mutagenesis of host cell expression.Can reclaim the dna molecular of the mutagenesis of coding active polypeptide from host cell, and use this area internal standard method to check order fast.These methods allow the importance of independent amino-acid residue in the interested polypeptide of rapid determination, and can be applied to the polypeptide of unknown structure.

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The sum of aminoacid replacement, disappearance and/or the insertion of the amino acid/11 to 59 of SEQ ID NO:28 is 10, and is preferred 9, more preferably 8, more preferably 7, more preferably at the most 6, more preferably at the most 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.

In preferred embodiments, polypeptide of the present invention is the defensin polypeptide.

N-is terminal to be extended

The terminal extension of the N-of polypeptide of the present invention can be suitably by 1-50 amino acid, preferred 2-20 amino acid, and special 3-15 amino acid is formed.In one embodiment, the extension of N-terminal peptide does not contain Arg (R).In other embodiments, the terminal extension of N-comprises kex2 or the kex2-sample cleavage site that further defines hereinafter.In preferred embodiments, the terminal extension of N-is peptide, and it comprises at least two Glu (E) and/or Asp (D) amino-acid residue, for example comprises terminal extension of N-of one of following sequence: EAE, EE, DE and DD.

The Kex2 site

The Kex2 site is (referring to for example, Methods in Enzymology Vol 185, ed.D.Goeddel, Academic Press Inc. (1990), San Diego, CA, " Gene Expression Technology ") and kex2-sample site be present in some proteinic before binary (di-basic) recognition site (that is cleavage site) between peptide-coding region and the maturation zone.

The insertion in kex2 site or kex2-sample site shows that having improved the endopeptidase correct at propetide cleavage site place processes, and causes the protein secreting level that increases in some cases.

In the context of the present invention, the insertion in kex2 site or kex2-sample site causes obtaining at the terminal specific position that extends of N-the possibility of cutting, and described cutting causes comparing the antimicrobial polypeptide that obtains extending with mature polypeptide shown below:

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28.

Fusion polypeptide

Polypeptide of the present invention also comprises the fusion polypeptide that fusion polypeptide maybe can be cut, and wherein other polypeptide is merged at polypeptide of the present invention or its segmental N-end or C-end.Nucleotide sequence (or its part) fusion to nucleotide sequence of the present invention (or its part) by the other polypeptide of will encoding produces fusion polypeptide.The technology that produces fusion polypeptide is known in the art, comprises the encoding sequence that connects coded polypeptide so that they in the reading frame, and make under the control that is expressed in identical promoters and terminator of fusion polypeptide.

Source with polypeptide of antimicrobial acivity

Polypeptide of the present invention can obtain the microorganism from any genus.For the present invention, be used for this paper term relevant with given source and " obtain certainly ", the meaning is that nucleotide sequence coded polypeptide is produced by described source, or by the bacterial strain generation of wherein having inserted from the nucleotide sequence in described source.Aspect preferred, the described polypeptide that obtains from given source is an exocytosis.

Polypeptide of the present invention can be a bacterial peptide.For example, described polypeptide can be for example bacillus (Bacillus) polypeptide of gram positive bacterium polypeptide, for example Alkaliphilic bacillus (Bacillus alkalophilus), bacillus amyloliquefaciens (Bacillus amyloliquefaciens), bacillus brevis (Bacillus brevis), Bacillus circulans (Bacillus circulans), Bacillus coagulans (Bacillus coagulans), bacillus lautus (Bacillus lautus), bacillus lentus (Bacillus lentus), Bacillus licheniformis (Bacilluslicheniformis), bacillus megaterium (Bacillus megaterium), bacstearothermophilus (Bacillusstearothermophilus), subtilis (Bacillus subtilis) or bacillus thuringiensis (Bacillus thuringiensis) polypeptide; Or streptomyces (Streptomyces) polypeptide, for example, shallow Streptomyces glaucoviolaceus (Streptomyces lividans) or mouse ash streptomycete (Streptomyces murinus) polypeptide; Or the gram negative bacterium polypeptide, for example, intestinal bacteria or Rhodopseudomonas bacterial classification (Pseudomonas sp.) polypeptide.

Polypeptide of the present invention also can be the fungi polypeptide, and more preferably for example Candida (Candida), genus kluyveromyces (Kluyveromyces), Pichia (Pichia), yeast belong (Saccharomyces), Schizosaccharomyces (Schizosaccharomyces) or the mould genus of Western alpine yarrow (Yarrowia) polypeptide of yeast polypeptides; Or more preferably the filamentous fungus polypeptide for example the branch the mould genus of top spore (Acremonium), Aspergillus (Aspergillus), aureobasidium genus (Aureobasidium), genera cryptococcus (Cryptococcus), Filibasidium, fusarium (Fusarium), Humicola (Humicola), Magnaporthe, Mucor (Mucor), myceliophthora (Myceliophthora), Neocallimastix, Neurospora (Neurospora), paecilomyces (Paecilomyces), Penicillium (Penicillium), Piromyces, Schizophyllum (Schizophyllum), Talaromyces (Talaromyces), heater capsule Pseudomonas (Thermoascus), Thielavia (Thielavia), Tolypocladium or Trichoderma (Trichoderma) polypeptide.

Aspect preferred, described polypeptide is saccharomyces carlsbergensis (Saccharomycescarlsbergensis) with antimicrobial acivity, yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), saccharomyces diastaticus (Saccharomycesdiastaticus), Doug Laplace yeast (Saccharomyces douglasii), Crewe not yeast (Saccharomyces kluyveri), promise ground yeast (Saccharomyces norbensis) or ellipsoideus yeast (Saccharomyces oviformis) polypeptide.

Other preferred aspect, described polypeptide is microorganism Aspergillus aculeatus (Aspergillus aculeatus), Aspergillus awamori (Aspergillus awamori), Aspergillus fumigatus (Aspergillus fumigatus), smelly aspergillus (Aspergillusfoetidus), aspergillus japonicus (Aspergillus japonicus), Aspergillus nidulans (Aspergillus nidulans), aspergillus niger (Aspergillus niger), aspergillus oryzae (Aspergillus oryzae), bar spore shape sickle spore (Fusariumbactridioides), F.graminearum schw (Fusarium cerealis), storehouse prestige sickle spore (Fusariumcrookwellense), machete sickle spore (Fusarium culmorum), fusarium graminaria (Fusariumgraminearum), the red sickle spore of standing grain (Fusarium graminum), different spore sickle spore (Fusariumheterosporum), albizzia sickle spore (Fusarium negundi), point sickle spore (Fusarium oxysporum), racemosus sickle spore (Fusarium reticulatum), pink sickle spore (Fusarium roseum), Williams Elder Twig sickle spore (Fusarium sambucinum), colour of skin sickle spore (Fusarium sarcochroum), intend branch spore sickle spore (Fusarium sporotrichioides), sulphur look sickle spore bag (Fusarium sulphureum), circle sickle spore (Fusariumtorulosum), intend silk spore sickle spore (Fusarium trichothecioides), empiecement sickle spore (Fusariumvenenatum), special humicola lanuginosa (Humicola insolens), dredge cotton shape humicola lanuginosa (Humicolalanuginosa), rice black wool mould (Mucor miehei), the thermophilic silk mould (Myceliophthorathermophila) of ruining, Neuraspora crassa (Neurospora crassa), penicillium purpurogenum (Penicilliumpurpurogenum), trichoderma harziarum (Trichoderma harzianum), healthy and free from worry wood mould (Trichodermakoningii), long shoot wood mould (Trichoderma longibrachiatum), Trichodermareesei (Trichodermareesei) or viride (Trichoderma viride) polypeptide.

Other preferred aspect, described polypeptide is lugworm (Arenicola marina) polypeptide, for example, SEQID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ IDNO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ IDNO:22, SEQ ID NO:24, the polypeptide of SEQ ID NO:26 or SEQ ID NO:28.

Will be understood that for aforesaid kind, the present invention comprises fully and two kinds of imperfect states (perfect andimperfect states), with other taxonomic equivalent (equivalent), anamorph (anamorph) for example, no matter their known generic names.Those skilled in the art will discern the identity of suitable equivalent easily.

The bacterial strain of these kinds can be obtained for the public easily at many culture collections center, described preservation center such as American type culture collection (the American Type Culture Collection) (ATCC), Germany microorganism and cell culture preservation center (Deutsche Sammiung vonMikroorganismen und Zellkulturen GmbH) are (DSM), fungi strain preservation center (Centraalbureau Voor Schimmelcultures) (CBS) and research centre, North Area, agricultural research institute preservation center (Agricultural Research Service Patent Culture Collection, NorthernRegional Research Center) (NRRL).

In addition, can use above-mentioned probe to originate, comprise from the isolating microorganism identification of nature (for example, soil, compost, water etc.) and these polypeptide of acquisition from other.It is well known in the art being used for from the technology of natural habitat (habitat) separate microorganism.Can obtain described polynucleotide by the genome or the cDNA library of similarly screening other microorganism subsequently.In case with described probe in detecting to the polynucleotide sequence of coded polypeptide, the technology that just can use those of ordinary skills to know described polynucleotide are separated or clone (referring to, for example, Sambrook et al. 1989, sees above).

Polypeptide of the present invention also comprises the fusion polypeptide that fusion polypeptide maybe can be cut, and wherein other polypeptide is fused to described polypeptide or its segmental N-terminal or C-terminal.Nucleotide sequence (or its part) by the another kind of polypeptide of will encoding is blended in nucleotide sequence of the present invention (or its part) and produces the polypeptide of fusion.The technology that produces fusion polypeptide is known in the art, comprises the encoding sequence that connects coded polypeptide so that they are in the reading frame, and under the control that is expressed in identical promoters and terminator of fusion polypeptide.

Polynucleotide

The invention still further relates to isolating polynucleotide, described isolating polynucleotide have the nucleotide sequence of code book invention polypeptide.Aspect preferred, described nucleotides sequence is shown in SEQ ID NO:1, SEQ IDNO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ IDNO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ IDNO:23, SEQ ID NO:25 or SEQ ID NO:27.Other preferred aspect, described nucleotide sequence is SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, the mature polypeptide encoded district of SEQ ID NO:25 or SEQ ID NO:27.The present invention also comprises the nucleotide sequence of coded polypeptide, and described polypeptide has SEQ ID NO:2, SEQID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ IDNO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ IDNO:24, the aminoacid sequence of SEQ ID NO:26 or SEQ ID NO:28 or its mature polypeptide, because it is different from SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 the degeneracy of genetic code, SEQ IDNO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ IDNO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQID NO:27.The invention still further relates to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ IDNO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ IDNO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, the subsequence of SEQ ID NO:25 or SEQID NO:27, its coding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, the fragment of SEQ ID NO:26 or SEQ ID NO:28 with antimicrobial acivity.

The invention still further relates to the sudden change polynucleotide, described sudden change polynucleotide are at SEQ ID NO:1, SEQ IDNO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ IDNO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ IDNO:23, comprise at least one sudden change in the mature polypeptide encoded sequence of SEQ ID NO:25 or SEQ ID NO:27, the nucleotide sequence coded polypeptide of wherein said sudden change is made up of following sequence:

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28.

Be used to separate or the technology of the polynucleotide of clones coding polypeptide is known in the art, comprise from genomic dna and separating, from the cDNA preparation, or its combination.Can have the cloned DNA fragment of apokoinou construction characteristic with detection by for example using the polymerase chain reaction (PCR) know or the antibody screening of expression library, thereby realize from this genomic dna cloning polynucleotide of the present invention.Referring to, for example, Innis et al., 1990, PCR:A Guide to Methods and Application, Academic Press, New York.Can use other nucleic acid amplification method, for example (ligated activated transcription is transcribed in ligase chain reaction (LCR) (LCR), connection activation; LAT) with based on the amplification (NASBA) of nucleotide sequence.Can be from the bacterial strain of Aspergillus, or from other or relevant organism clone polynucleotide, and therefore can be the allele variant of for example polypeptid coding area of described nucleotide sequence or plant variant (species variant).

The invention still further relates to the polynucleotide of nucleotide sequence: with SEQ ID NO:1 with following sequence, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQID NO:23, mature polypeptide encoded sequence (that is SEQ IDNO:1, of SEQ ID NO:25 or SEQ ID NO:27, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, the Nucleotide 151 to 297 of SEQ ID NO:9; SEQ ID NO:11, the Nucleotide 118 to 255 of SEQ ID NO:13; SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 112 to 255 of SEQ ID NO:19; The Nucleotide 118 to 252 of SEQ ID NO:21; The Nucleotide 151 to 297 of SEQ ID NO:23; The Nucleotide 121 to 252 of SEQ ID NO:25; Or the Nucleotide 145 to 321 of SEQ ID NO:27) have at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, and the nucleotide sequence of at least 97% identity degree most preferably, described nucleotide sequence coded active polypeptide.

The nucleotide sequence of modifying code book invention polypeptide may be essential for the similar basically polypeptide of synthetic and described polypeptide.Term refers to the form that the non-natural of polypeptide exists to described polypeptide " similar basically ".These polypeptide may be different from from its natural origin isolated polypeptide in some engineered modes, for example, and the different artificial variants in aspect such as specific activity, thermostability, optimal pH.Can be as SEQID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ IDNO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ IDNO:21, SEQ ID NO:23, the nucleotide sequence that the polypeptid coding area of SEQ ID NO:25 or SEQ ID NO:27 exists, for example on the basis of its subsequence, and/or replace and make up the variant sequence by introducing following Nucleotide: described replacement does not produce the other aminoacid sequence by nucleotide sequence coded polypeptide, but the codon that meets the host organisms that is intended to produce enzyme is selected; Perhaps described replacement can produce different aminoacid sequences.About the general introduction of Nucleotide replacement, referring to, for example, Ford et al., 1991, ProteinExpression and Purification 2:95-107.

It will be apparent to one skilled in the art that these replacements can carry out outside the zone important for molecular function, and still produce active polypeptide.For the polypeptide active key and amino-acid residue that therefore preferably do not replace by isolating polynucleotide encoding of the present invention, can be according to method well known in the art, for example site-directed mutagenesis or L-Ala subregion mutagenesis (referring to, for example, Cunninghamand Wells, 1989, Science 244:1081-1085) identify.In one the technology of back, sudden change is incorporated into each positive electricity residue place in the molecule, and the antimicrobial acivity of test gained mutating molecule, to identify active crucial amino-acid residue for described molecule.The analyzing three-dimensional structure determination also can be passed through in the site of substrate-enzyme interacting, by the technology as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling measure (referring to, for example, de Vos et al., 1992, Science 255:306-312; Smith et al., 1992, Journal of Molecular Biology 224:899-904; Wlodaver et al., 1992, FEBSLetters 309:59-64).

The invention still further relates to the isolating polynucleotide of code book invention polypeptide, described isolating polynucleotide are under low stringent condition, more preferably medium stringent condition, more preferably-the Gao stringent condition, even more preferably high stringent condition, and under the most preferably very high stringent condition, and following sequence hybridization:

SEQ ID NO:11, the Nucleotide 118 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 112 to 255 of SEQ ID NO:19;

The Nucleotide 118 to 252 of SEQ ID NO:21;

The Nucleotide 151 to 297 of SEQ ID NO:23;

The Nucleotide 121 to 252 of SEQ ID NO:25; Or

The Nucleotide 145 to 321 of SEQ ID NO:27;

The cDNA sequence that comprises in the (ii) following sequence:

SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, the Nucleotide 1 to 297 of SEQ ID NO:9;

SEQ ID NO:11, the Nucleotide 1 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 1 to 255 of SEQ ID NO:19;

The Nucleotide 1 to 252 of SEQ ID NO:21;

The Nucleotide 1 to 297 of SEQ ID NO:23;

The Nucleotide 1 to 252 of SEQ ID NO:25; Or

The Nucleotide 1 to 321 of SEQ ID NO:27; Or

(iii) with (i) or (ii) complementary chain; Or their allelic variant or subsequence (Sambrook et al., 1989, see above), as herein defined.

The invention still further relates to isolating polynucleotide, described isolating polynucleotide obtain by the following method:

(a) low, in, in-Gao, height or very high stringent condition under, with colony and the following sequence hybridization of DNA:

SEQ ID NO:11, the Nucleotide 118 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 112 to 255 of SEQ ID NO:19;

The Nucleotide 118 to 252 of SEQ ID NO:21;

The Nucleotide 151 to 297 of SEQ ID NO:23;

The Nucleotide 121 to 252 of SEQ ID NO:25; Or

The Nucleotide 145 to 321 of SEQ ID NO:27;

The cDNA sequence that comprises in the (ii) following sequence:

SEQ ID NO:11, the Nucleotide 1 to 255 of SEQ ID NO:13;

SEQ ID NO:15, SEQ ID NO:17, the Nucleotide 1 to 255 of SEQ ID NO:19;

The Nucleotide 1 to 252 of SEQ ID NO:21;

The Nucleotide 1 to 297 of SEQ ID NO:23;

The Nucleotide 1 to 252 of SEQ ID NO:25; Or

The Nucleotide 1 to 321 of SEQ ID NO:27; Or

(iii) with (i) or (ii) complementary chain; (b) separate the polynucleotide of hybridizing, its coding has the polypeptide of antimicrobial acivity.

Nucleic acid construct

The invention still further relates to the nucleic acid construct that comprises isolating polynucleotide of the present invention, described isolating polynucleotide are operably connected with one or more regulating and controlling sequences, and described regulating and controlling sequence instructs the expression of encoding sequence under the condition compatible with this regulating and controlling sequence in proper host cell.

Can operate the isolating polynucleotide of code book invention polypeptide so that polypeptide expression to be provided with many modes.Depend on expression vector, operating on it before the sequence insertion vector with polynucleotide may be ideal or essential.The technology of using recombinant DNA method to modify polynucleotide sequence is well known in the art.

Regulating and controlling sequence can be suitable promoter sequence, and it is the nucleotide sequence by the host cell identification of the polynucleotide that are used to express code book invention polypeptide.Promoter sequence contains the transcription regulating nucleotide sequence that mediates polypeptide expression.Promotor can be any nucleotide sequence that shows transcriptional activity in selected host cell, comprises sudden change, that block and promotor heterozygosis, and can be from coding and host cell homology or allogenic born of the same parents gene acquisition outer or polypeptide in the born of the same parents.

Be used to instruct nucleic acid construct of the present invention to transcribe, the example of the suitable promotor of particularly transcribing in bacterial host cell is the promotor from following acquisition: intestinal bacteria lac operon, streptomyces coelicolor (Streptomyces coelicolor) gelase gene (dagA), subtilis type froctosan saccharase gene (sacB), bacillus licheniformis alpha-amylase gene (amyL), bacstearothermophilus produces malt amylase gene (amyM), bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), subtilis xylA and xylB gene and protokaryon β-Nei Xiananmei gene (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of SciencesUSA 75:3727-3731), and tac promotor (DeBoer et al., 1983, Proceedings of theNational Academy of Sciences USA 80:21-25).Other promotor is at " Useful proteinsfrom recombinant bacteria " in Scientific American, and 1980, among the 242:74-94; With at Sambrook et al., 1989, describe to some extent in seeing above.

The example that is used for instructing the suitable promotor that nucleic acid construct of the present invention transcribes at filamentous fungal host cell is the promotor that the gene from following enzyme obtains: aspergillus oryzae TAKA amylase, Man Hegen Mucor (Rhizomucor miehei) aspartate protease, the neutral α-Dian Fenmei of aspergillus niger, aspergillus niger acid acceptance α-Dian Fenmei, aspergillus niger or Aspergillus awamori glucoamylase (glaA), the Man Hegen miehei lipase, the aspergillus oryzae Sumizyme MP, the aspergillus oryzae triose-phosphate isomerase, the Aspergillus nidulans acetamidase, empiecement sickle spore amyloglucosidase (WO 00/56900), empiecement sickle spore Daria (WO 00/56900), empiecement sickle spore Quinn (WO00/56900), point sickle spore trypsin-like proteolytic enzyme (WO 96/00787), the Trichodermareesei beta-glucosidase enzyme, Trichodermareesei cellobiohydrolase I, trichoderma reesei endoglucanase I, trichoderma reesei endoglucanase II, trichoderma reesei endoglucanase III, trichoderma reesei endoglucanase IV, trichoderma reesei endoglucanase V, the Trichodermareesei xylanase I, Trichodermareesei xylanase I I, Trichodermareesei xylobiase, and NA2-tpi promotor (from the heterozygote of the promotor of neutral alpha-amylase gene of aspergillus niger and aspergillus oryzae triose-phosphate isomerase gene); With their sudden change, that block and promotor heterozygosis.

In yeast host, useful promotor obtains from the gene of following enzyme: and yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae galactokinase (GAL1), yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), yeast saccharomyces cerevisiae triose-phosphate isomerase (TPI), brewing yeast metallothionein (CUP1) and yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase.For other useful promotor of yeast host cell by Romanos et al., 1992, Yeast 8:423-488 describes.

Regulating and controlling sequence also can be suitable Transcription Termination subsequence, is by the sequence of host cell identification to stop transcribing.Described terminator sequence is operably connected with 3 ' end of the nucleotide sequence of coding said polypeptide.Can will any terminator of function be arranged in selected host cell with in the present invention.

Obtain for the gene of the preferred terminator of filamentous fungal host cell: aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger alpha-glucosidase and sharp sickle spore trypsin-like proteolytic enzyme from following enzyme.

Obtain for the gene of the preferred terminator of yeast host cell: yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate, brewing yeast cell pigment C (CYC1) and yeast saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase from following enzyme.For other useful terminator of yeast host cell by Romanos et al., 1992, description sees above.

Regulating and controlling sequence can also be suitable leader sequence, and it is for the important mRNA non-translational region of the translation of host cell.Leader sequence is operably connected to 5 '-end of the nucleotide sequence of coded polypeptide.Can will any leader sequence of function be arranged in selected host cell with in the present invention.

Obtain for the gene of the preferred leader sequence of filamentous fungal host cell: aspergillus oryzae TAKA amylase and Aspergillus nidulans triose-phosphate isomerase from following enzyme.

Obtain for the gene of the suitable leader sequence of yeast host cell: yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase, yeast saccharomyces cerevisiae alpha factor and yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP) from following enzyme.

Regulating and controlling sequence also can be the polyadenylation sequence, and it is the sequence that is operably connected with 3 ' end of nucleotide sequence, and when transcribing, host cell is identified as the signal that poly-adenosine residue is added into the mRNA that transcribes with it.Can will in selected host cell, there be any polyadenylation sequence of function to use in the present invention.

Obtain for the gene of the preferred polyadenylation sequence of filamentous fungal host cell: aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, sharp sickle spore trypsin-like proteolytic enzyme and aspergillus niger alpha-glucosidase from following enzyme.

For the useful polyadenylation sequence of yeast host cell by Guo and Sherman, 1995, Molecular Cellular Biology 15:5983-5990 describes.

Regulating and controlling sequence can also be a signal peptide coding region, the aminoacid sequence that the N-terminal of its coding and polypeptide links, and instruct encoded polypeptides to enter the emiocytosis approach.Encoding sequence 5 ' the end of nucleotide sequence can comprise signal peptide coding region inherently, and its coding region fragment with the coding secrete polypeptide is connected translation natively and reads in the frame.Alternative is that it is allogenic signal peptide coding region that encoding sequence 5 ' end can contain for described encoding sequence.The allos signal peptide coding region may be essential when encoding sequence does not contain signal peptide coding region natively.Perhaps, the external source signal peptide coding region can replace the natural signals peptide-coding region simply to strengthen the secretion of polypeptide.Yet any signal peptide coding region that instructs polypeptide expressed to enter the Secretory Pathway of selected host cell can use in the present invention.

For the effective signal peptide coding region of bacterial host cell is the signal peptide coding region that obtains from the gene of following enzyme: bacillus NCIB 11837 produces maltogenic amylases, bacstearothermophilus α-Dian Fenmei, Bacillus licheniformis subtilisin (subtilisin), Bacillus licheniformis β-Nei Xiananmei, bacstearothermophilus neutral protease (nprT, nprS is nprM) with subtilis prsA.Other signal peptide is by Simonen and Palva, and 1993, Microbiological Reviews 57:109-137 describes.

For the effective signal peptide coding region of filamentous fungal host cell is the signal peptide coding region that obtains from the gene of following enzyme: aspergillus oryzae TAKA amylase, aspergillus niger neutral starch enzyme, aspergillus niger glucoamylase, Man Hegen Mucor aspartate protease, special humicola lanuginosa cellulase and dredge cotton shape humicola lanuginosa lipase.

Aspect preferred, signal peptide coding region is: SEQ ID NO:1, SEQ ID NO:3, SEQ IDNO:5, the Nucleotide 1 to 57 of SEQ ID NO:7 or SEQ ID NO:9, its coding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, the amino acid-50 of SEQ ID NO:8 or SEQ ID NO:10 is to-32; The Nucleotide 1 to 63 of SEQ ID NO:11 or SEQ ID NO:13, the amino acid-39 of its coding SEQ ID NO:12 or SEQ ID NO:14 is to-19; SEQ ID NO:15, the Nucleotide 1 to 63 of SEQ ID NO:17 or SEQ IDNO:19, its coding SEQ ID NO:16, the amino acid-37 of SEQ ID NO:18 or SEQ IDNO:20 is to-17; The Nucleotide 1 to 63 of SEQ ID NO:21, the amino acid-39 of its coding SEQ IDNO:22 is to-19; The Nucleotide 1 to 57 of SEQ ID NO:23, the amino acid-50 of its coding SEQ IDNO:24 is to-32; The Nucleotide 1 to 63 of SEQ ID NO:25, the amino acid-40 of its coding SEQ IDNO:26 is to-20; Or the Nucleotide 1 to 66 of SEQ ID NO:27, the amino acid-48 of its coding SEQ IDNO:28 is to-27.

Obtain for the gene of the useful signal peptide of yeast host cell from yeast saccharomyces cerevisiae alpha factor and yeast saccharomyces cerevisiae saccharase.Other useful signal peptide coding region is by Romanos et al., and 1992, see above, describe.

Regulating and controlling sequence can also be preceding peptide-coding region, and its coding is positioned at the aminoterminal aminoacid sequence of polypeptide.The gained polypeptide is called proenzyme (proenzyme) or preceding polypeptide (propolypeptide) (or being called proenzyme (zymogen) in some cases).Before normally non-activity and the catalysis can be by propetide of polypeptide or autocatalysis cutting in the past polypeptide change into ripe active polypeptide.Peptide-coding region before can obtaining from the gene of bacillus subtilis alkali proteinase (aprE), subtilis neutral protease (nprT), yeast saccharomyces cerevisiae alpha factor, Man Hegen Mucor aspartate protease and thermophilic rMtL (WO 95/33836).

Aspect preferred, preceding peptide-coding region is: SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, the Nucleotide 58 to 150 of SEQ ID NO:7 or SEQ ID NO:9, its coding SEQ ID NO:2, SEQID NO:4, SEQ ID NO:6, the amino acid-31 of SEQ ID NO:8 or SEQ ID NO:10 is to-1; The Nucleotide 64 to 117 of SEQID NO:11 or SEQ ID NO:13, the amino acid-18 of its coding SEQ ID NO:12 or SEQID NO:14 is to-1; SEQ ID NO:15, the Nucleotide 64 to 111 of SEQ ID NO:17 or SEQ ID NO:19, its coding SEQ ID NO:16, the amino acid-16 of SEQ ID NO:18 or SEQ ID NO:20 is to-1; The Nucleotide 64 to 117 of SEQ ID NO:21, the amino acid-18 of its coding SEQ ID NO:22 is to-1; The Nucleotide 58 to 150 of SEQ ID NO:23, the amino acid-31 of its coding SEQ ID NO:24 is to-1; The Nucleotide 64 to 120 of SEQ ID NO:25, the amino acid-19 of its coding SEQ ID NO:26 is to-1; Or the Nucleotide 67 to 144 of SEQ ID NO:27, the amino acid-26 of its coding SEQ ID NO:28 is to-1.

When the two all appears at the N-terminal of polypeptide when signal peptide and propetide district, and then the propetide district is placed (next to) polypeptide N-terminal, and the signal peptide district is placed the and then N-terminal in propetide district.

It is desirable to equally add and regulate sequence, its permission is regulated polypeptide expression with respect to the growth of host cell.The example of regulation system is to cause genetic expression response chemistry or physical stimulation thing, comprises the existence of regulating compound and those systems of opening or closing.Regulation system in the prokaryotic system comprises lac, tac and trp operator gene system.In yeast, can use ADH2 system or GAL1 system.In filamentous fungus, can use TAKA α-Dian Fenmei promotor, aspergillus niger glucoamylase promotor and aspergillus oryzae glucoamylase promotor as regulating sequence.Other example of regulating sequence is those sequences that allow gene amplification.In eukaryotic system, these sequences are included in methotrexate (methotrexate) and have the dihydrofolate reductase gene of amplification down and the metallothionein gene that increases with heavy metal (with heavy metal).In these cases, the nucleotide sequence of coded polypeptide will be operably connected with the adjusting sequence.

Expression vector

The invention still further relates to recombinant expression vector, described recombinant expression vector comprises polynucleotide of the present invention, promotor and transcribes and the translation termination signal.Above-mentioned multiple nucleic acid and regulating and controlling sequence can combine to produce recombinant expression vector, and described expression vector can comprise that one or more restriction sites easily are to allow to insert or replace in these sites the nucleotide sequence of coded polypeptide.Alternative is to express nucleotide sequence of the present invention by inserting the nucleotide sequence or the nucleic acid construct that comprise described sequence at the suitable carrier that is used for expressing.In the process of preparation expression vector, encoding sequence is placed carrier, thereby this encoding sequence is operably connected with suitable expression regulation sequence.

Recombinant expression vector can be any carrier (for example, plasmid or virus), and it can carry out recombinant DNA step and the expression that can produce nucleotide sequence easily.The selection of carrier will depend on carrier and the consistency that will introduce the host cell of this carrier usually.Carrier can be wire or closed hoop plasmid.

Carrier can be an autonomously replicationg vector, that is, as the carrier that the outer entity (entity) of karyomit(e) exists, it duplicates and is independent of chromosome duplication, for example, and plasmid, extra-chromosomal element, minichromosome (minichromosome) or artificial chromosome.Carrier can contain any means (means) that are used to guarantee self replication.Perhaps, carrier can be a kind of in being introduced into host cell the time, the carrier that is incorporated in the genome and duplicates with the karyomit(e) of having integrated this carrier.In addition, can use independent carrier or plasmid or two or more carriers or plasmid, it contains the global DNA (total DNA) that remains to be introduced the host cell gene group jointly, maybe can use transposon (transposon).

Carrier of the present invention preferably contains one or more selected markers, and it allows the simple cell transformed of selecting.Selected marker is a gene, and its product provides biocide or virus resistance, to the resistance of heavy metal, to auxotrophic prototrophy (prototrophy to auxotrophs) etc.

The example of bacterium selected marker is the dal gene from subtilis or Bacillus licheniformis, or gives the mark of antibiotics resistance, and described antibiotics resistance is penbritin, kantlex, paraxin or tetracyclin resistance for example.For the suitable mark of yeast host cell is ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3.The selected marker that is used for filamentous fungal host cell includes but not limited to amdS (acetamidase); argB (ornithine transcarbamylase); bar (careless ammonium phosphine (phosphinothricin) Transacetylase); hph (hygromix phosphotransferase); niaD (nitrate reductase) (nitrate reductase); pyrG (Orotidine-5 '-'-phosphate decarboxylase) (orotidine-5 '-phosphatedecarboxylase); sC (sulfate adenylyl transferase) and trpC (o-amino benzoyl acid synthase (anthranilatesynthase)) and their Equivalent.Preferably be used in the Aspergillus cell is the amdS of Aspergillus nidulans or aspergillus oryzae and the bar gene of pyrG gene and streptomyces hygroscopicus (Streptomyces hygroscopicus).

Carrier of the present invention preferably contains element, and it allows vector integration to go into the host cell gene group or carrier is independent of genomic self-replicating in cell.

In order to be integrated into the host cell gene group, the sequence of the polynucleotide of the responsible coded polypeptide of carrier or be used for going into genomic any other carrier element by homology or non-homogeneous recombination and integration.Perhaps, carrier can contain extra nucleotide sequence, is used in reference to conducting and crosses homologous recombination and be integrated into exact position in the host cell gene group chromosome.In order to be increased in the possibility that the exact position is integrated, integrated element should preferably contain the nucleic acid of sufficient amount, as 100 to 10,000 base pair, preferred 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pair, it has height identity to strengthen the probability of homologous recombination with corresponding target sequence.Integrated element can be any sequence, the target sequence homology in itself and the host cell gene group.In addition, integrated element can be non-coding or nucleotide sequence coding.On the other hand, can with carrier by non-homogeneous recombination and integration in the host cell gene group.

For self-replicating, carrier can further comprise replication orgin, and it can independently duplicate carrier in described host cell.Replication orgin can be any plasmid replicon (replicator) of mediation self-replicating, and it brings into play function in cell.Term " replication orgin " or " plasmid replicon " are defined as at this paper can make the nucleotide sequence that duplicates in plasmid or the carrier body.

The example of bacterium replication orgin is to allow the replication orgin of plasmid pBR322, pUC19, pACYC177 and the pACYC184 duplicate and the replication orgin of plasmid pUB110, the pE194, pTA1060 and the pAM β 1 that allow to duplicate in bacillus in intestinal bacteria.

The example that is used for the replication orgin of yeast host cell is 2 microns replication orgin, ARS1, ARS4, the combination of the combination of ARS1 and CEN3 and ARS4 and CEN6.

The example of useful replication orgin is AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67 in filamentous fungal cells; Cullen et al., 1987, Nucleic Acids Research 15:9163-9175; WO 00/24883).Separation of AM A1 gene and structure comprise the plasmid or the carrier of this gene can be finished according to the method that is disclosed among the WO 00/24883.

Polynucleotide of the present invention more than a copy can be inserted host cell to increase the generation of gene product.The increase of polynucleotide copies number can obtain by the following method: the sequence of at least one additional copy is integrated into the host cell gene group, or comprise the selected marker who increases with polynucleotide, wherein cell contains the copy of selected marker's amplification, and can select the additional copy of polynucleotide thus by culturing cell in the presence of suitable selective agent (selectable agent).

Be used to connect said elements with the method that makes up recombinant expression vector of the present invention be well known to those skilled in the art (referring to, for example, Sambrook et al. 1989, sees above).

Host cell

The invention still further relates to recombinant host cell, described recombinant host cell comprises polynucleotide of the present invention, during its reorganization that is advantageously used in polypeptide is produced.The carrier that will comprise polynucleotide of the present invention is introduced in the host cell, thereby this carrier is kept as chromosomal integration body (chromosomal integrant) or as the outer carrier of the karyomit(e) of aforesaid self replication.Term " host cell " comprises any filial generation of parental cell, and it is inequality with parental cell owing to the sudden change that takes place in the reproduction process.The selection of host cell will largely depend on the gene of coded polypeptide and its source.

Host cell can be a unicellular microorganism, for example, and prokaryotic organism, or non-unicellular microorganism, for example, eukaryote.

Useful unicellular microorganism is a bacterial cell, gram positive bacterium for example, include but not limited to, bacillus cell, for example, Alkaliphilic bacillus, bacillus amyloliquefaciens, bacillus brevis, Bacillus circulans, gram Lloyd's genus bacillus (Bacillus clausii), Bacillus coagulans, bacillus lautus, bacillus lentus, Bacillus licheniformis, bacillus megaterium, bacstearothermophilus, subtilis and bacillus thuringiensis; Or the streptomyces cell, for example, shallow Streptomyces glaucoviolaceus and mouse ash streptomycete, or gram negative bacterium for example intestinal bacteria and Rhodopseudomonas bacterial classification.Aspect preferred, bacterial host cell is bacillus lentus, Bacillus licheniformis, bacstearothermophilus or bacillus subtilis mycetocyte.Aspect in addition preferred, bacillus cell is the bacillus of having a liking for alkali.

Can realize by the following method carrier is incorporated into bacterial host cell: for example protoplast transformation (referring to, for example, Chang and Cohen, 1979, Molecular General Genetics 168:111-115), use experience attitude cell (referring to, for example, Young and Spizizen, 1961, Journal of Bacteriology81:823-829 or Dubnau and Davidoff-Abelson, 1971, Journal of MolecularBiology 56:209-221), electroporation (referring to, for example, Shigekawa and Dower, 1988, Biotechniques 6:742-751) or engage (referring to, for example, Koehler and Thorne, 1987, Journalof Bacteriology 169:5771-5278).

Host cell can also be an eukaryote, for example Mammals, insect, plant or fungal cell.

Aspect preferred, host cell is the fungal cell." fungi " is used in this paper and comprises with the Xiamen: Ascomycota (Ascomycota), Basidiomycota (Basidiomycota), chytrid door (Chytridiomycota) and Zygomycota (Zygomycota) are (as by Hawksworth et al., In, Ainsworth and Bisby ' sDictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK defines) and oomycetes door (Oomycota) (as Hawksworth et al., 1995, on seeing, institute quotes in 171 pages) and all mitospore fungies (mitosporic fungi) (Hawksworthet al., 1995, on seeing).

Aspect preferred, fungal host cells is a yeast cell." yeast " is used in the yeast that this paper comprises ascosporogenous yeast (ascosporogenous yeast) (Endomycetale (Endomycetales)), product load yeast (basidiosporogenous yeast) and belongs to imperfect fungi (Fungi Imperfecti) (gemma guiding principle (Blastomycetes)).Because zymic is sorted in and may changes future, for the present invention, yeast is defined as (Skinner, F.A., Passmore as Biology and Activities of Yeast, S.M., and Davenport, R.R., eds, Soc.App.Bacteriol.Symposium Series No.9,1980) described in.

Aspect being more preferably, yeast host cell is Candida, Hansenula (Hansenula), genus kluyveromyces, Pichia, yeast belong, Schizosaccharomyces or the mould genus cell of Western alpine yarrow.

Aspect most preferred, yeast host cell is a saccharomyces carlsbergensis, yeast saccharomyces cerevisiae, and saccharomyces diastaticus, Doug Laplace yeast, Crewe is yeast not, promise ground yeast or ellipsoideus yeast cell.Other most preferred aspect, yeast host cell is Kluyveromyces lactis (Kluyveromyces lactis) cell.Other most preferred aspect, yeast host cell is a Yarrowia lipolytica cell.

Other preferred aspect, fungal host cells is a filamentous fungal cells." filamentous fungus " comprise Mycophyta (Eumycota) and oomycetes door subphylum (as by Hawksworth et al., 1995, see above, define) all thread forms.The common mycelia body wall of forming by chitin (chitin), Mierocrystalline cellulose, dextran, chitosan (chitosan), mannosans and other complicated polysaccharide that is characterised in that of filamentous fungus.It is long to extend into the field headquarters health by mycelia, and carbon katabolism is obligate aerobic.On the contrary, the yeast for example gemmation (budding) of nourishing and growing by unicellular thalline of yeast saccharomyces cerevisiae carries out, and carbon katabolism can ferment.

In addition preferred aspect, filamentous fungal host cell is a mould genus of top spore, Aspergillus, aureobasidium genus, the mould genus of smoke pipe (Bjerkandera), Ceriporiopsis, Coprinus (Coprinus), Coriolus Qu61 (Coriolus), genera cryptococcus, Filibasidium, fusarium, Humicola, Magnaporthe grisea belongs to (Magnaporthe), Mucor, myceliophthora, the mould genus of Xin Kaoma fat (Neocallimastix), Neurospora, paecilomyces, Penicillium, flat lead fungi belongs to (Phanerochaete), penetrate arteries and veins Pseudomonas (Phlebia), cud Chytridium (Piromyces), pleurotus (Pleurotus), Schizophyllum, Talaromyces, thermophilic ascomycete belongs to, Thielavia, the curved mould genus of neck (Tolypocladium), trametes (Trametes) or Trichoderma cell.

Aspect most preferred, filamentous fungal host cell is Aspergillus awamori, Aspergillus fumigatus, smelly aspergillus, aspergillus japonicus, Aspergillus nidulans, aspergillus niger or aspergillus oryzae cell.Other most preferably aspect, filamentous fungal host cell is bar spore shape sickle spore, F.graminearum schw, storehouse prestige sickle spore, machete sickle spore, fusarium graminaria, the red sickle spore of standing grain, different spore sickle spore, albizzia sickle spore, sharp sickle spore, racemosus sickle spore, pink sickle spore, Williams Elder Twig sickle spore, colour of skin sickle spore, intends branch spore sickle spore, sulphur look sickle spore, circle sickle spore, intends silk spore sickle spore or empiecement sickle spore cell.Other most preferred aspect, filamentous fungal host cell is black thorn smoke pipe bacterium (Bjerkanderaadusta), Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporipsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Coprinus cinereus (Coprinuscinereus), hairy fungus (Coriolus hirsutus), special humicola lanuginosa, dredge cotton shape humicola lanuginosa, the conspicuous Mucor of rice, thermophilic ruin the silk mould, Neuraspora crassa, penicillium purpurogenum, the yellow flat lead fungi of spore (Phanerochaetechrysosporium), arteries and veins bacterium (Phlebia radiata) is penetrated in radiation, Pleurotus eryngii, autochthonal shuttle spore is mould, Trametes villosa, Trametes versicolor, trichoderma harziarum, healthy and free from worry wood is mould, long shoot wood is mould, Trichodermareesei or viride bacterial strain cell.

The fungal cell can be transformed in known mode own by the method that relates to protoplastis formation, protoplast transformation and cell walls reconstruction.The appropriate method that is used to transform Aspergillus and Trichoderma host cell is at EP 238 023 and Yelton et al., and 1984, describe among the Proceedings of the National Academy ofSciences USA 81:1470-1474.The appropriate method that is used to transform the fusarium bacterial classification is by Malardier et al., and 1989, Gene 78:147-156 and WO 96/00787 describe.Can use method transformed yeast: Becker and Guarente by following document description, In Abelson, J.N.and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods inEnzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153:163; With Hinnen et al., 1978, Proceedings of theNational Academy of Sciences USA 75:1920.

Production method

The invention still further relates to the method that is used to produce polypeptide of the present invention, it comprises: (a) be of value to culturing cell under the condition that produces polypeptide, described cell can produce described polypeptide with its wild-type form; (b) reclaim described polypeptide.Preferably, described cell is lugworm (Arenicola) cell, and more preferably lugworm.

The invention still further relates to the method that is used to produce polypeptide of the present invention, it comprises: (a) cultivate host cell being of value under the condition that produces polypeptide; (b) reclaim described polypeptide.

The invention still further relates to the method that is used to produce polypeptide of the present invention, comprise: (a) cultivate host cell being of value under the condition that produces polypeptide, wherein said host cell comprises the sudden change nucleotide sequence, it is at SEQID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ IDNO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ IDNO:21, SEQ ID NO:23, have at least one sudden change in the mature polypeptide encoded district of SEQ ID NO:25 or SEQ ID NO:27, wherein said sudden change nucleotide sequence coded polypeptide, described polypeptide is made up of following sequence:

The amino acid/11 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

SEQ ID NO:16, the amino acid/11 to 48 of SEQ ID NO:18 or SEQ ID NO:20;

The amino acid/11 to 45 of SEQ ID NO:22;

The amino acid/11 to 49 of SEQ ID NO:24;

The amino acid/11 to 44 of SEQ ID NO:26; Or

The amino acid/11 to 59 of SEQ ID NO:28; (b) reclaim described polypeptide.

In production method of the present invention, use method well known in the art culturing cell in being suitable for producing the nutritional medium of described polypeptide.For example; can by in suitable culture medium with allow to express and/or separate the shake-flask culture that carries out under the condition of described polypeptide and the small-scale in laboratory or the industrial fermentation jar or large scale fermentation (comprise continuously, in batches, fed-batch or solid state fermentation) and come culturing cell.Use methods known in the art to cultivate in suitable nutritional medium, described nutritional medium comprises carbon source and nitrogenous source and inorganic salt.Suitable medium can or can prepare (for example, in the catalogue of American type culture collection) according to the composition of announcing from the commercial supplier acquisition.If polypeptide is secreted in the nutritional medium, this polypeptide can directly reclaim from described substratum.If polypeptide is not secreted in the substratum, it can reclaim from cell lysate (lysate).

Can use known in the art is that specific method detects polypeptide for described polypeptide.These detection methods comprise the use of specific antibody.For example, antimicrobial acivity test (antimicrobialactivity assay) can be used for measuring the activity of polypeptide as described herein.

The gained polypeptide can use methods known in the art to reclaim.For example, polypeptide can reclaim from nutritional medium by ordinary method, and that described ordinary method includes but not limited to is centrifugal, filtration, extraction, spraying drying, evaporation or precipitation.

Polypeptide of the present invention can be by multiple methods known in the art purifying, described method includes but not limited to that chromatography (for example, ion-exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoresis method (for example, preparation type (preparative) isoelectrofocusing), differential solubleness (for example, SDS-PAGE or extraction ammonium sulfate precipitation), (referring to, for example, Protein Purification, J.-C.Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Plant

The invention still further relates to transgenic plant, plant part or vegetable cell, its nucleotide sequence with the coding polypeptide with antimicrobial acivity of the present invention is transformed, thereby reach and produce described polypeptide with callable scale.Polypeptide can reclaim from plant or plant part.Perhaps, plant or the plant part that contains this recombinant polypeptide can be used to improve food or quality of the fodder equally, for example, improve nutritive value, palatability (palatability) and rheological property (rheological properties), or be used to destroy antinutritional factor.

Transgenic plant can be dicots (dicotyledonss) or monocotyledonous (monocotyledons).Monocotyledonous example is a grass (grasses), as English grass (meadow grass) (bluegrass (blue grass), annual bluegrass belongs to (Poa)); Forage grass (forage grass) is as festuca (Festuca), lolium (Lolium); Cold ground type herbage (temperate grass) is as Agrostis; And cereal, for example, wheat, oat, rye, barley, rice (rice), Chinese sorghum and Zea mays (maize) (corn).

The example of dicotyledons is tobacco (tobacco), beans (legumes), as lupine (lupins), potato, sugar beet (sugar beet), pea, (cruciferous) plant of beans (bean) and soybean (soybean) and Cruciferae (Cruciferae (family Brassicaceae)), as Cauliflower (cauliflower), Semen Brassicae campestris (rape seed) and the model organism Arabidopis thaliana (Arabidopsis thaliana) that is closely related.

The example of plant part is stem (stem), callus (callus), leaf (leaf), root (root), fruit (fruit), seed (seed) and stem tuber (tuber), and the independent body that comprises these parts, for example, epidermis (epidermis), mesophyll (mesophyll), parenchyma (parenchyma), vascular tissue (vasculartissue), meristematic tissue (meristem).Concrete vegetable cell compartment (compartments) also is considered to plant part as chloroplast(id) (chloroplast), apoplast (apoplast), plastosome (mitochondria), vacuole (vacuole), peroxysome (peroxisome) and tenuigenin (cytoplasm).In addition, any vegetable cell, whatsoever tissue-derived, all be considered to plant part.Similarly, plant part also is considered to plant part as separating with concrete tissue and the cell that promotes application of the present invention, for example embryo (embryo), endosperm (endosperm), aleuron (aleurone) and kind skin (seed coat).

Be contained in the filial generation that also has these plants, plant part and vegetable cell in the scope of the invention equally.

The transgenic plant or the vegetable cell of expressing polypeptide of the present invention can make up according to means known in the art.In brief, make up described plant or vegetable cell by the following method: incorporate one or more expression construct of code book invention polypeptide into the plant host genome, and the modified plant or the vegetable cell of breeding gained become transgenic plant or vegetable cell.

Expression vector is the nucleic acid construct that comprises the polynucleotide of code book invention polypeptide expediently, and described polynucleotide are operably connected with the necessary suitable adjusting sequence of this polynucleotide sequence of expression in plant of selecting or plant part.In addition, expression construct can comprise for identifying the useful selected marker of host cell, has integrated expression construct and this construct is incorporated into necessary dna sequence dna in the described plant (latter depends on the DNA introducing method of use) in described host cell.

Regulate the selection of sequence, for example promotor and terminator sequence and the randomly selection of signal or transit sequence, for instance, based on when, where expecting and express polypeptide and determining how.For example, the expression of gene of code book invention polypeptide can be composing type or induction type, maybe can be growth, stage or tissue-specific, and can the target specific tissue of gene product or plant part for example seed or leaf.Regulate sequence by for example Tague et al., 1988, Plant Physiology 86:506 is described.

For the constructive expression, can use 35S-CaMV, corn ubiquitin 1 and rice Actin muscle 1 promotor (Franck et al., 1980, Cell 21:285-294, Christensen et al., 1992, Plant Mo.Biol.18:675-689; Zhang et al., 1991, Plant Cell 3:1155-1165).Organ specific promoters can be for example from storage tissue (the storage sink tissue) promotor of seed, potato tuber and fruit (Edwards ﹠amp for example; Coruzzi, 1990, Ann.Rev.Genet.24:275-303), or from for example merismatic promotor of metabolic pool tissue (metabolic sink tissue) (Ito et al., 1994, PlantMol.Biol.24:863-878), seed specific promoters is such as the gluten (glutelin) from rice, prolamine (prolamin), sphaeroprotein (globulin) or albumin (albumin) promotor (Wu etc., 1998, Plant and Cell Physiology 39:885-889), broad bean promotor (Conrad etc. from the seed protein gene of the unknown of legumin (legumin) B4 and broad bean (Vicia faba), 1998, Journal ofPlant Physiology 152:708-711), promotor (Chen etc. from seed oil body protein (oil body protein), 1998, Plant and Cell Physiology 39:935-941), storage protein napA promotor from colea (Brassicanapus), or the promotor of any other seed-specific well-known in the art, for example, described in the WO 91/14772.In addition, promotor can be the specific promotor of leaf, as rbcs promotor (Kyozuka etc. from rice or tomato, 1993, Plant Physiology 102:991-1000), chlorella virus (chlorella virus) VITAMIN B4 methyltransgerase (adeninemethyltransferase) gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology26:85-93), or from the aldP gene promoter (Kagaya etc. of rice, 1995, Molecular andgeneral genetics 248:668-674), or wound inductive promotor, as potato pin2 promotor (Xu etc., 1993, Plant Molecular Biology 22:573-588).Similarly, described promotor can be induced by abiotic processing, described abiotic processing such as temperature, arid or salinity change, or the material of the described promotor of activation by exogenous application induces, and for example ethanol, oestrogenic hormon (oestrogens), plant hormone (plant hormones) are as ethene, dormin (abscisic acid), gibberic acid (gibberellic acid) and/or heavy metal.

The promotor enhancer element also can be used for realizing polypeptide of the present invention plant than high expression level.For example, the promotor enhancer element can be an intron, is placed between the nucleotide sequence of promotor and code book invention polypeptide.Xu et al. for example, 1993, on seeing, disclose first intron that uses rice Actin muscle 1 gene and expressed to strengthen.

Any other parts of selected marker and expression construct can be selected from this area available those.

Incorporate nucleic acid construct into Plant Genome according to routine techniques known in the art, described routine techniques comprises that the conversion of Agrobacterium (Agrobacterium) mediation, virus-mediated conversion, microinjection (microinjection), particle bombardment, biological projectile transform and electroporation (Gasser et al., 1990, Science244:1293; Potrykus, 1990, Bio/Technology 8:535; Shimamoto et al., 1989, Nature338:274).

At present, the transgenosis (genetransfer) of Agrobacterium tumefaciens (Agrobacterium tumefaciens) mediation, be to produce the preferred method of transgenosis dicotyledons (for reference, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19:15-38), and it also can be used for transforming monocots, though use always for other method for transformation of these plants.At present, produce the monocotyledonous preferable methods of transgenosis, be with particle (gold or tungsten particle of the microcosmic that applies with transfering DNA) bombardment embryo callus (embryonic calli) or developmental embryo (developing embryos) (Christou, 1992, Plant Journal 2:275-281; Shimamoto, 1994, Current OpinionBiotechnology 5:158-162; Vasil et al., 1992, Bio/Technology 10:667-674).Alternative method of transforming monocots is based on protoplast transformation, as by Omirulleh etc., and 1993, Plant Molecular Biology 21:415-428 is described.

After the conversion, transformant and the regeneration selecting to have the expression construct of incorporating into according to method well known in the art become complete plant.Usually the design method for transformation is used for eliminating at regeneration period or in follow-up generation selectivity by the following method selecting gene: for example, use have two kinds independently the T-DNA construct cotransformation or select gene by the excision of specificity recombinase-site specific ground.

The invention still further relates to the method that is used to produce polypeptide of the present invention, it comprises: (a) be of value to cultivation transgenic plant or vegetable cell under the condition that produces polypeptide, it comprises the polynucleotide that the code book invention has the polypeptide of antimicrobial acivity; (b) reclaim described polypeptide.

Composition

The invention still further relates to the composition that comprises polypeptide of the present invention, for example medicinal compositions (pharmaceutical composition).Preferably, described composition is rich in this peptide species.Term " is rich in " the antimicrobial acivity increase that expression makes described composition, and for example, the concentrational factor with at least 1.1 (enrichment factor) increases.

Described composition can further comprise other medical active agent, and for example other biocide (biocidal agent) for example shows the other antimicrobial polypeptide of antimicrobial acivity as defined above.Biocide can be a microbiotic, as known in the art.Antibiotic kind comprises penicillin, for example penicillin G, penicillin v, Staphcillin (methicillin), Oxazacillin (oxacillin), Pyocianil (carbenicillin), nafcillin (nafcillin), penbritin (ampicillin) etc.; Penicillin combination beta-lactamase inhibitor, cynnematin, for example cefaclor (cefaclor), Kefzol (cefazolin), ceftizoxime (cefuroxime), Latamoxef acid amides (moxalactam) etc.; Carbapenem (carbapenems); Monobactam; Aminoglycoside; Tsiklomitsin; Macrolide; Lincomycin (lincomycins); Polymyxin (polymyxins); Sulfanilamide (SN) (sulfonamides); Quinolone (quinolones); Paraxin (cloramphenical); Metronidazole (metronidazole); Spectinomycin (spectinomycin); Trimethoprim BP (trimethoprim); Vancomycin (vancomycin) etc.Described biocide also can be anti-mycotic agent (anti-mycotic agent), comprises the polyenoid class, amphotericin B (amphotericin B) for example, nystatin (nystatin); The 5-fluorine is (5-flucosyn) newly; With azoles system (azoles), for example mould anti-azoles (miconazol), KETOKONAZOL (ketoconazol), itraconazole (itraconazol) and fluconazole (fluconazol).

In embodiments, biocide is non-enzymatic chemical agent.In other embodiments, biocide is non-chemiluminescent polypeptide agent.

Composition can comprise the suitable carriers material.Composition also can comprise suitable delivery vehicle (delivery vehicle), and when described composition was used as medicine, this delivery vehicle can be delivered to antimicrobial polypeptide of the present invention the position of expectation.

Described peptide composition can prepare according to means known in the art, can be the form of liquid or dry composition.For example, described peptide composition can be the form of particulate state (granulate) or fine granularity (microgranulate).Polypeptide in composition to be included can be stablized with methods known in the art.

At the embodiment that provides the preferable use of peptide composition of the present invention down.Other condition of the dosage of peptide composition of the present invention and the described composition of use can decide based on methods known in the art.

Method and purposes

The invention still further relates to the method for using polypeptide with antimicrobial acivity.Described antimicrobial polypeptide all is useful in any position that suffers bacterium, fungi, yeast or algae pollution usually.Usually, described position is in aqueous system, and described aqueous system is cooling water system, rinsing clothes water (laundryrinse water) for example; Oil system, for example machining oil, lubricant, oil field etc. wherein need microorganism is killed maybe essential their growth of control.Yet; it is during useful all are used, for example to protect timber, latex (latex), tackiness agent, glue, paper, cardboard (cardboard), textiles, leather, plastics, pointing (caulking) and feed to it that the present invention also can be used on the known antimicrobial composition.

Other purposes comprises preservation food, beverage, makeup are emulsion (lotion), emulsifiable paste (cream), gel (gel), ointment (ointment), soap (soap), shampoo (shampoo), conditioning agent (conditioner), antiperspirant (antiperspirant), reodorant (deodorant), mouth wash shua (mouth wash), contact lens products for example, enzyme formulation (enzyme formulation) or food ingredient.

Therefore, antimicrobial polypeptide of the present invention can be used as sterilizing agent and uses, for example, be used in handle eye or mouthful infection, skin infections in; In antiperspirant or reodorant; Be used for cleaning and disinfection contact lens and tooth (mouth care).

Generally speaking, expection is used for antimicrobial polypeptide of the present invention cleaning, sterilizes or suppresses any lip-deep microorganism growth.The example on the surface that can advantageously contact with the antimicrobial polypeptide of invention is the surface of treatment facility, and described treatment facility is used for for example Milk Products Plant, chemistry or pharmaceutical processing factory, water hygiene system (water sanitation system), refinery (oil processing plant), paper pulp source mill (paperpulp processing plant), water treatment plant and cooling tower.Antimicrobial polypeptide of the present invention should use with effective cleaning, sterilization or the amount that suppresses microorganism growth on the described surface.

The zone that antimicrobial polypeptide of the present invention also can be used for food processing plant and any preparation or supplying food in addition is the clean surface and the cooking utensil in hospital, sanatorium and restaurant for example.

Antimicrobial polypeptide of the present invention also can be used as preservatives or sterilizing agent in the coating (paint) based on water.

The invention still further relates to antimicrobial polypeptide of the present invention or composition purposes as medicine.In addition, antimicrobial polypeptide of the present invention or composition also can be used for production control or resist the medicine of microorganism, and described microorganism is fungal organism or bacterium for example, preferred gram positive bacterium.

Composition of the present invention and antimicrobial polypeptide also can be used as antimicrobial (veterinarian) for animals or technology personal care agent or preventive to be used.Therefore, composition of the present invention and antimicrobial polypeptide can be used in the preparation of for animals or technology personal care agent or the preventive of handling infected by microbes, and described infected by microbes is bacterium or fungi infestation for example, preferred gram positive bacterial infection.Particularly described infected by microbes can be relevant with tuberculosis and sexually transmitted disease (STD), and described tuberculosis includes but not limited to tuberculosis, pneumonia and cystic fibrosis (cystic fibrosis); Described sexually transmitted disease (STD) includes but not limited to gonorrhoea and chlamydozoan.

Composition of the present invention comprises the antimicrobial polypeptide of the present invention of significant quantity.

Term " significant quantity " is when being used for herein, and the meaning refers to that the amount of antimicrobial polypeptide of the present invention enough suppresses described microbial growth.

The invention still further relates to for example bandage, medical supply conduit for example of wound healing composition (wound healing composition) or product, and further relate to the hair product of anti-dandruff, for example shampoo.

The formulation of antimicrobial polypeptide of the present invention is applied to just suffers infected by microbes or the host of infected by microbes susceptible.Using and depend on specific microorganism can be partial (topical), localized (localized) or whole body, and preferred described using localize.Usually the dosage of antimicrobial polypeptide of the present invention will be enough to by killing about at least 50%, at least 1 logarithm (1 log) usually, and can be 2 or more logarithms microbial population is reduced.Compound of the present invention is used by the dosage that the minimizing microbial population minimizes any side effect simultaneously.Expect that described composition will obtain and be used in purposes in the body under doctor's guidance.Antimicrobial polypeptide of the present invention is specifically used for killing gram negative bacterium, comprises pseudomonas aeruginosa (Pseudomonas aeruginosa) and chlamydia trachomatis (Chlamydia trachomatis); And gram positive bacterium, comprise for example streptococcus pneumoniae (Streptococcus pneumonia) of suis (streptococci), streptococcus uberis (S.uberis), S.hyointestinalis, streptococcus pyogenes (S.pyogenes) and S.agalactiae; And staphylococcus (streptococci) streptococcus aureus (Staphylococcus aureus) for example, staphylococcus epidermidis (S.epidermidis), imitation staphylococcus (S.simulans), staphylococcus xylosus (S.xylosus) and Staphylococcus carnosus (S.carnosus).

The formulation of antimicrobial polypeptide of the present invention can be applied to just suffer or susceptible in the pulmonary infection of the microorganism host of pneumonia for example; Be applied to just suffer or susceptible in the microorganism wound infection host of bacterium wound infection for example.

Also the formulation of antimicrobial polypeptide of the present invention can be applied to just suffer or susceptible in the host of skin infections, described skin infections is acne, atopic dermatitis or seborrheic dermatitis for example; Preferred described skin infections is the bacterium skin infections, for example the bacterium skin infections that is caused by staphylococcus epidermidis, streptococcus aureus, Propionibacterium (Propionibacterium acnes), Pityrosporum ovale or Malassezia furfur.

Antimicrobial polypeptide of the present invention also is used for the external formulation of kill microorganisms, particularly is used in not wish to introduce the antibiotic situation of wide variety of conventional.For example, antimicrobial polypeptide of the present invention can be added in animal and/or people's the food products preparation thing; Maybe they can be comprised the additive of cultivating as cells in vitro, to prevent the hypertrophy of microorganism in the tissue culture.

Concrete microorganism is seen experimental section for details to measuring by vitro test with the lethal susceptibility of antimicrobial polypeptide of the present invention.Usually the culture of microorganism and the antimicrobial polypeptide of different concns are made up one period that is enough to make described protein effect, usually between about one hour and one day.Subsequently live microorganism is counted, and measured the level of causing death.

Interested microorganism includes but not limited to, gram negative bacterium, for example: Citrobacter bacterial classification (Citrobacter sp.); Enterobacter bacterial classification (Enterobacter sp.); Escherichia bacterial classification (Escherichia sp.), for example intestinal bacteria; Klebsiella bacterial classification (Klebsiella sp.); Morganella morganii belongs to bacterial classification (Morganella sp.); Proteus bacterial classification (Proteus sp.); Providencia bacterial classification (Providencia sp.); Salmonella bacterial classification (Salmonella sp.), salmonella typhi (S.typhi) for example, Salmonella typhimurium (S.typhimurium); Serratia bacterial classification (Serratia sp.); Shigella bacterial classification (Shigella sp.); Rhodopseudomonas bacterial classification (Pseudomonas sp.), for example Pseudomonas aeruginosa; Yersinia bacterial classification (Yersinia sp.), for example Yersinia pestis (Y.pestis), artificial tuberculosis yersinia genus (Y.pseudotuberculosis), yersinia entero-colitica (Y.enterocolitica); Frances Bordetella bacterial classification (Franciscella sp.); Pasteurella bacterial classification (Pasturella sp.); Vibrio bacterial classification (Vibrio sp.), for example vibrio cholerae (V.cholerae), Vibrio parahaemolyticus (V.parahemolyticus); Campylobacter bacterial classification (Campylobacter sp.), for example campylobacter jejuni (C.jejuni); Haemophilus spp bacterial classification (Haemophilus sp.), for example Haemophilus influenzae (H.influenzae), Ducrey bacillus (H.ducreyi); Bordetella bacterial classification (Bordetella sp.), for example Bordetella pertussis belongs to (B.pertussis), bordetella bronchiseptica (B.bronchiseptica), Bordetella parapertussis (B.parapertussis); Brucella bacterial classification (Brucellas p.); Neisseria bacterial classification (Neisseria sp.), for example Diplococcus gonorrhoeae (N.gonorrhoeae), Neisseria meningitidis (N.meningitidis) etc.Other interested bacterium comprises legionella bacterial classification (Legionella sp.), for example invades lung legionella (L.pneumophila); Listera belongs to bacterial classification (Listeriasp.), for example Listeria monocytogenes (L.monocytogenes); Mycoplasma bacterial classification (Mycoplasma sp.), for example human-type mycoplasma (M.hominis), Mycoplasma pneumoniae (M.pneumoniae); Mycobacterium bacterial classification (Mycobacterium sp.), for example mycobacterium tuberculosis (M.tuberculosis), Mycobacterium leprae (M.leprae); Treponema bacterial classification (Treponema sp.), for example Treponema pallidum (T.pallidum); Borrelia bacterial classification (Borrelia sp.), for example B. burgdorferi (B.burgdorferi); Leptospira (Leptospirae sp.); Dermacentroxenus bacterial classification (Rickettsiasp.), for example Rickettsia rickettsii (R.rickettsii), rickettsia typhi (R.typhi); Chlamydiaceae bacterial classification (Chlamydia sp.), for example chlamydia trachomatis, Chlamydia pneumoniae (C.pneumoniae), chlamydia psittaci (C.psittaci); Helicobacterium bacterial classification (Helicobacter sp.), for example helicobacter pylori (H.pylori) etc.

Interested non-bacterial pathogens comprises fungi and protozoon pathogenic agent, for example plasmodium kind (Plasmodia sp.), for example plasmodium falciparum (P.Falciparum); Trypanosoma kind (Trypanosoma sp.), for example trypanosoma bocagei (T.brucei); Shistosomes; Entamoeba kind (Entaemoeba sp.); Genera cryptococcus bacterial classification (Cryptococcus sp.); Candida bacterial classification (Candida sp.), for example Candida albicans (C.albicans) etc.

Can adopt multiple application process.Can be with described polypeptide formulation orally give, or intravascular injection, subcutaneous injection, peritoneal injection, by aerosol injection, ophthalmology (opthalmically) injection, intravesical injection, local (topically) injection etc.For example, be well known in the art by the application process that sucks.The dosage of described treatment formulation will depend on the character of specific antimicrobial polypeptide to be administered, disease, the frequency of using, the mode of using, medicament to be changed widely from host's clearance rate (clearance) etc.Initial dosage can be bigger, then is less maintenance dose (maintenance dose).Described dosage can not used once in a week or biweekly continually, or be divided into less dosage once a day or every day several times, half cycle once or half cycle use several times etc., to keep the effective dose level.In many cases, Orally administered will than intravenously use need be higher dosage.Higher stability when Orally administered can be modified amido linkage and aminoterminal and carboxyl terminal.For example, can be with the carboxyl terminal amidation.

Formulation

Compound of the present invention can be incorporated into the multiple formulation of using that is used for the treatment of.More specifically, can be with compound of the present invention by with suitable, pharmaceutically useful carrier or thinner formulated in combination patent medicine composition, and can be mixed with solid, semi-solid, the prepared product of liquid or gas form, for example tablet (tablet), capsule (capsule), pulvis (powder), granule (granule), ointment (ointment), emulsifiable paste (cream), foam (foam), solution, suppository (suppository), injection (injection), inhalation (inhalant), gel (gel), microsphere (microsphere), lotion (lotion) and aerosol.Similarly, can several different methods finish using of described compound, comprise in oral, cheek, rectum, parenteral, intraperitoneal, intradermal, transdermal, the tracheae that (intracheal) etc. uses.Antimicrobial polypeptide of the present invention can be whole body after using, or by using implant or playing a role to keep other formulation of active dose at implantation site, can be with antimicrobial polypeptide of the present invention location.

In one embodiment, the local formulation of (topical use) of using comprises the reduction divalent cation, especially the sequestrant of the effective concentration of calcium and magnesium.For example, can comprise reagent for example Citrate trianion (citrate), EGTA or EDTA, wherein Citrate trianion is preferred.The concentration of Citrate trianion incites somebody to action normally about 1 to 10mM.

Compound of the present invention can be used separately, and combination with one another is used, or they can be used in combination with other compound known (for example, perforin (perforin), anti-inflammatory agent, microbiotic etc.).In pharmaceutical dosage forms, described compound can be used by their pharmaceutically useful salt forms.Following method and vehicle only as exemplary and absolutely not in order to the restriction.

For oral prepared product, described compound can use separately or use with suitable additive combination, to make tablet, pulvis, granule or capsule, for example, is used in combination with conventional additives, for example lactose, N.F,USP MANNITOL, W-Gum or yam starch; Use with binder combination, for example crystalloid Mierocrystalline cellulose (crystalline cellulose), derivatived cellulose, gum arabic, W-Gum or gelatin; Be used in combination with collapsing powder (disintegrator), for example W-Gum, yam starch or Xylo-Mucine (sodium carboxymethylcellulose); Be used in combination with lubricant, for example talcum or Magnesium Stearate; And be used in combination if necessary, with thinner, buffer reagent, wetting agent, sanitas and seasonings.

Described compound can be mixed with the prepared product that is used to inject, by their are dissolved, suspend or are emulsified in the solvent of moisture or non-water, described solvent is the similar oil of vegetalitas or other for example, synthetic glycerin fatty acid ester, the ester class of propylene glycol or higher fatty acid; And if necessary, with conventional additives for example solubilizing agent, isotonic agent, suspension agent, emulsifying agent, stablizer and sanitas.

Described compound can be used in the aerosol dosage forms of using by suction.But compound of the present invention can be allocated in supercharging propelling agent (pressurized acceptable propellant), for example Refrigerant 12, propane, nitrogen etc.

By with conventional additives for example solubilizing agent, isotonic agent, suspension agent, emulsifying agent, stablizer and sanitas prepare, can for example prevent the lotion of burn infection with described compound as lotion.

In addition, described compound can by with various substrates (bases) for example at the bottom of the emulsified base (emulsifyingbase) or water-soluble substrate (water-soluble base) be mixed and made into suppository.Compound of the present invention can pass through the suppository rectal administration.Described suppository can be included in melt at body heat and at the vehicle (vehicle) of self-vulcanizing for example theobroma oil, carbowax and polyoxyethylene glycol.

For example syrup, elixir (elixir) and the outstanding agent of unit dosage (unit dosage form) of oral or rectal administration can be provided, wherein every dose unit for example one (teaspoonful), a ladle (tablespoonful), tablet or suppository contains the composition of the amount of pre-determining, and comprises one or more compounds of the present invention in the said composition.Similarly, be used for injecting or unit dosage that intravenously is used can be included in the compound of the present invention of composition, described composition is as the solution in sterilized water, physiological saline or other pharmaceutically acceptable carrier.

The implant of sustained release forms (implants for sustained release formulations) is well known in the art.Implant is mixed with microsphere (microsphere), plate (slab) etc. with biodegradable or biological nondegradable polymkeric substance.For example, the well tolerable erodible polymkeric substance (erodible polymer) of the polymer formation host of lactic acid and/or oxyacetic acid.The implant that will contain antimicrobial polypeptide of the present invention places near the sites of infection place, thereby the partial concn of the promoting agent other parts with respect to health are increased.

Term " unit dosage " is used for the discrete unit physically (physically discrete unit) that this paper refers to be suitable as humans and animals experimenter unitary dose, per unit contains the The compounds of this invention of predetermined amount, and the amount of being calculated is enough to make compound of the present invention and acceptable diluents, carrier or vehicle to be united to produce desired effects.Specification (specifications) to unit dosage of the present invention depends on the particular compound that is adopted, effect to be reached, with pharmacokinetics relevant with described compound in the host.

Pharmaceutically useful vehicle such as vehicle, adjuvant, carrier or thinner, is easy to obtain for the public.In addition, pharmaceutically useful auxiliary substance (auxiliary substance) such as pH regulator and buffer reagent, osmotic pressure conditioning agent (tonicity adjusting agent), stablizer, wetting agent etc., is easy to obtain for the public.

Common dosage range for systemic administration is to use from 00 milligram every kilogram experimenter's weight of 0.1 pik to 1 at every turn.Usually dosage can be to take a tablet 2 to 6 times every day, or takes one once a day and contain the time-delay of higher proportion active component content and discharge (time-release) capsule or tablet.Described time-delay releasing effect can be by at different pH value dissolved gum capsule materials, obtain by the capsule that slowly discharges according to osmotic pressure or the method by any other known sustained release.

Those skilled in the art are understandable to be, dosage level can be used as the seriousness of specific compound, symptom and experimenter to the function of the susceptibility of side effect and change.Some specific compound is more effective than other compound.For the preferred dose of appointed compound, those skilled in the art can easily determine by the whole bag of tricks.Preferable methods is the physiology of measuring appointed compound tire (physiologicalpotency).

Using liposome is a kind of interested method as delivery vehicle.The cytogamy of liposome and target site, and in cell, send the content of chamber (lumen).Liposome is kept and one period of enough merging of cells contacting, make in all sorts of ways, for example separation, wedding agent etc. to keep in touch.In one aspect of the invention, liposome is designed to the aerosolized pulmonary administration that is used for.Purifying protein or peptide that liposome can merge with the mediation film, for example celestial platform (Sendai) virus or influenza virus etc. prepare together.Lipid can be any useful combination that forms the known liposome of lipid, comprises positively charged ion or zwitterionic lipid, for example phosphatidylcholine.Remaining lipid will be neutral or acid lipid, for example cholesterol, phosphatidyl silk amino acid, phosphatidyl glycerol etc. usually.

For the preparation liposome, can use the method for describing by Kato et al. (1991) J.Biol.Chem.266:3361.In brief, the chamber composition and the lipid that will comprise peptide make up in suitable water-bearing media, are brine media easily, and wherein total solids will be in the scope of about 1-10 weight percent.After one period short period of time (about 5-60 second), test tube is placed warm water bath (about 25-40 ℃) in vigorous stirring, and repeat about 5-10 time of this circulation.Then with composition supersound process one suitable period (generally about 1-10 second), and can further stir by the vortex concussion.Then by adding the water-bearing media bulked volume, general about 1-2 times volume that increases shakes then and cools off.This method makes high molecular weight molecules incorporate into to chamber.

Formulation with other promoting agent

In order to be used for method of the present invention, antimicrobial polypeptide of the present invention can be prepared with other promoting agent pharmaceutically, particularly, prepare with other biocide.Interested other agent comprises various microbiotic known in the art.Antibiotic kind comprises penicillin, for example penicillin G, penicillin v, Staphcillin, Oxazacillin, Pyocianil, nafcillin, penbritin etc.; Penicillin combination beta-lactamase inhibitor, cynnematin, for example cefaclor, Kefzol, ceftizoxime, Latamoxef acid amides etc.; Carbapenem; Monobactam; Aminoglycoside; Tsiklomitsin; Macrolide; Lincomycin; Polymyxin; Sulfanilamide (SN); Quinolone; Cloramphenical; Metronidazole; Spectinomycin; Trimethoprim BP; Vancomycin etc.

Anti-mycotic agent also is useful, comprises the polyenoid class, for example amphotericin B, nystatin; The 5-fluorine can be new; With azoles system, for example mould anti-azoles, KETOKONAZOL, itraconazole and fluconazole.Antitubercular agent comprises vazadrine, Tibutol, Streptomycin sulphate and Rifampin.Also cytokine can be included in the antimicrobial polypeptide formulation of the present invention, for example interferon-gamma, tumor necrosis factor alpha, interleukin 12 etc.

External synthetic

Antimicrobial peptide of the present invention can use ordinary method known in the art by external synthetic preparation.Can use multiple commercial synthesis device, Applied Biosystems Inc. for example, the automatic DNA synthesizer DNA of Beckman etc.By using synthesizer, naturally occurring amino acid can be replaced with alpha-non-natural amino acid, for example D-L-Ala and D-Isoleucine, non-corresponding isomer, side chain with different lengths or functionality (functionality) wait and replace particularly to use D-isomer (or D type).The concrete sequence and the mode of preparation will be decided by simplicity, economy, required purity etc.

Chemistry can be connected provides to multiple peptide or protein, and it comprises the functionality of being convenient to bonding, for example is used for acid amides or substitutional amine-group and forms, for example the amino of reduction amination; Be used for the thiol group that thioether or disulphide form; Be used for the carboxyl of acid amides formation etc.

If desired, can between synthesis phase or during expressing multiple group be introduced in the peptide, it allows the connection to other molecule or surface.Therefore, halfcystine can be used for preparing thioether, the Histidine that is used to be connected to the metal ion complex body; Be used to form the carboxyl of acid amides or ester; Be used to form the amino of acid amides etc.

Also polypeptide can be separated and purifying according to the ordinary method that is re-combined into.The lysate that can prepare expressive host, and use HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography or other purification technique to come the described lysate of purifying.Largely, compare with the pollutent that relates to product preparation method and purifying thereof, composition therefor will comprise at least 20% expected product by weight, situation more generally is to comprise about at least 75% expected product by weight, preferably comprise about at least 95% expected product by weight, and comprise about at least 99.5% expected product by weight usually for therapeutic purpose.Usually, described percentage ratio will be based on gross protein.

Animal-feed

The invention still further relates to the polypeptide that is used for having antimicrobial acivity and be used for the method for animal-feed, and the feed composition and the fodder additives that comprise antimicrobial polypeptide of the present invention.

Term " animal " comprises all animals, comprises the mankind.The example of animal is non-ruminant animal and ruminating animal, for example ox, Yang Hema.In specific embodiment, animal is the Nonruminantia animal.The Nonruminantia animal comprises monogastric animal, for example pig (pig) or pig (swine) (including but not limited to pig (growing pig) and sow (sows) in piggy, the growth); Poultry is turkey and chicken (including but not limited to chick (broiler chick), laying hen (layer)) for example; Calf (young calves); And fish (including but not limited to salmon).

The meaning of term " feed " or " feed composition " is to be suitable for any compound, prepared product, mixture or the composition that the animal absorption was taken in or be intended to supply with to animal.

In purposes according to the present invention, can be before diet, side by side feed afterwards or with it to animal with antimicrobial polypeptide.The latter is preferred.

In specific embodiment, the antimicrobial polypeptide when being added into the antimicrobial polypeptide of the form in the feed or being included in the feed additive is well-defined.Definition clear-cut means that it is at least 50% pure (referring to the embodiment 12 of WO 01/58275) that described antimicrobial polypeptide prepared product is measured by size exclusion chromatography.In other specific embodiments, the antimicrobial polypeptide prepared product thus method to measure be at least 60,70,80,85,88,90,92,94 or at least 95% pure.

Well-defined antimicrobial polypeptide prepared product is favourable.For example, correctly dosed administration is much easier in feed with being substantially free of other interference or polluting the antimicrobial polypeptide of antimicrobial polypeptide.Term " dosed administration correctly " particularly refers to obtain the consistent and purpose constant result and based on the ability of desired effects optimum dose.

Yet for the purposes in animal-feed, antimicrobial polypeptide does not need so pure; For example antimicrobial polypeptide can comprise other enzyme, can be called the antimicrobial polypeptide prepared product in this case.

The antimicrobial polypeptide prepared product can (a) be added directly to feed (or directly using in the treating processes of vegetable-protein), or (b) it can be used in and produces one or more midbody composites, the fodder additives or the premix (premix) of for example follow-up join in the feed (or using in treating processes).Aforesaid purity refers to the purity of original antimicrobial polypeptide prepared product, no matter is used for as above (a) or (b).

The antimicrobial polypeptide prepared product of this order of magnitude purity particularly can use the reorganization production method to obtain, and they are not easy to obtain, and when producing described antimicrobial polypeptide, also to stand more serious batch variation (batch-to-batch variation) by the traditional zymotic method.

Certainly, this antimicrobial polypeptide prepared product can be mixed with other enzyme.

Term " vegetable-protein " is used for this paper and refers to any compound, composition, prepared product or mixture, it comprises at least a derived from (derived from) or originate from the protein of (originating from) plant, comprises the protein and the protein derivatives of modification.In specific embodiment, the protein content of vegetable-protein is at least 10,20,30,40,50 or 60% (w/w).

Vegetable-protein can plant-derived dietary protein origin, such as beans and cereal, for example from pulse family (Fabaceae) (pulse family (Leguminosae)), Cruciferae (Cruciferaceae), Chenopodiaceae (Chenopodiaceae) and Gramineae (Poaceae) plant, such as soyflour, feather fan bean powder and canola.

In specific embodiment, the vegetable-protein source is the material from one or more plants of pulse family, for example soybean, lupine, pea or beans.

In other specific embodiments, the vegetable-protein source is the material from one or more plants of Chenopodiaceae, for example beet (beet), sugar beet (sugar beet), spinach (spinach) or goosefoot (quinoa).

Other example in vegetable-protein source is Semen Brassicae campestris and wild cabbage.

Soybean is preferred vegetable-protein source.

Other example in vegetable-protein source is cereal such as barley, wheat, rye, oat, Zea mays (corn), rice and Chinese sorghum.

Antimicrobial polypeptide can be added into feed in any form, and it is as pure relatively antimicrobial polypeptide, or mixes with other composition of having a mind to be added into animal-feed, promptly with the form of animal feedstuff additive, and the premix of so-called animal-feed for example.

Aspect other, the composition that the present invention relates in animal-feed, use, for example animal-feed and animal feedstuff additive, for example premix.

Except antimicrobial polypeptide of the present invention, animal feedstuff additive of the present invention comprises at least a liposoluble vitamin, and/or at least a water-soluble vitamins, and/or at least a trace minerals, and/or at least a a large amount of mineral substance (macro mineral).

In addition, optional fodder additives composition is tinting material (coloring agents), aromatic compound (aroma compounds), stablizer and/or at least a other enzyme, and described enzyme is selected from phytase EC 3.1.3.8 or 3.1.3.26; Zytase EC 3.2.1.8; Galactanase EC 3.2.1.89; And/or beta-glucanase EC 3.2.1.4.

In specific embodiment, these other enzyme is clearly defined the definition of antimicrobial preparations (as above for).

The example of other antimicrobial peptide (AMPs) is that for example Novispirin (RobertLehrer, 2000) and their keep the variant or the fragment of antimicrobial acivity for CAP18, Leucocin A, Tritrpticin, Protegrin-1, Thanatin, defensin (Defensin), Ovispirin.

The example of other anti-fungus polypeptide (AFPs) is huge aspergillus (Aspergillus giganteus) and aspergillus niger peptide, and the variant and the fragment of their reservation anti-mycotic activities, as disclosed among WO 94/01459 and the WO02/090384.

Usually fat and water-soluble vitamins and trace minerals form and have a mind to be added into the so-called premix part of feed, and usually a large amount of mineral substance separately are added into feed.In these types of compositions any all is animal feedstuff additive of the present invention during with antimicrobial polypeptide enrichment of the present invention (enrich).

In specific embodiment, be intended to animal feedstuff additive of the present invention with 0.01 to 10.0%; More specifically 0.05 to 5.0%; Or the level of 0.2 to 1.0% (% means gram additive/100 gram feeds) is included in (or be defined as and must be included in) animal diet followed or the feed.Especially for premix.

Below be the indefiniteness tabulation of these composition examples:

The example of liposoluble vitamin is vitamin A, Vitamin D3 500,000 I.U/GM, vitamin-E and vitamin K, for example vitamin K3.

The example of water-soluble vitamins is vitamin B12, vitamin H and choline, VITMAIN B1, Wei ShengsuB2, vitamin B6, nicotinic acid, folic acid and pantothenate (panthothenate), for example D-calcium pantothenate (Ca-D-panthothenate).

The example of trace minerals is manganese, zinc, iron, copper, iodine, selenium and cobalt.

The example of a large amount of mineral substance is calcium, phosphorus and sodium.

The nutritional needs (with poultry and piggy/pig example) of these compositions is listed in the Table A of WO 01/58275.The meaning of nutritional needs is that these compositions should provide in diet with the concentration of explanation.

Alternatively be that animal feedstuff additive of the present invention comprises specified separate constituent in the Table A of at least a WO 01/58275.At least a meaning is any, one or more, all components separately in 15 of all 13 kinds of as many as of a kind of or two kinds or three kinds or four kinds or the like or as many as.More specifically, at least a so independent component is included in the additive of the present invention, the amount of described component provides within the scope that concentration in its feed (in-feed-concentration) illustrates in Table A the 4th hurdle, the 5th hurdle or the 6th hurdle.

The invention still further relates to animal feedstuff compositions.Animal feedstuff compositions or diet have high relatively protein content.The feature of poultry and pig diet is illustrated in can the 2-3 hurdle as WO 01/58275 table B.The feature of fish diet can so be shown in the 4th hurdle of B illustrated.In addition, these fish diet have the crude fat content of 200-310g/kg usually.

Animal feedstuff compositions according to the present invention has the crude protein content of 50-800g/kg, and further comprises at least a as desired antimicrobial polypeptide herein.

In addition, or alternative be (for above-mentioned crude protein content), but animal feedstuff compositions of the present invention has metabolisable energy (metabolisable energy) content of 10-30 MJ/kg; And/or the calcium contents of 0.1-200g/kg; And/or the available phosphorus content of 0.1-200g/kg; And/or the methionine(Met) content of 0.1-100g/kg; And/or the methionine(Met) of 0.1-150g/kg adds cysteine content; And/or the lysine content of 0.5-50g/kg.

In specific embodiment, but the content that metabolisable energy, crude protein, calcium, phosphorus, methionine(Met), methionine(Met) add halfcystine and/or Methionin is in the arbitrary scope of WO 01/58275 (R.2-5) table B scope 2,3,4 or 5.

Crude protein is calculated as nitrogen (N) multiply by the factor 6.25, be i.e. crude protein (g/kg)=N (g/kg) x6.25.Nitrogen content is measured by Kjeldahl method (A.O.A.C., 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).

But metabolisable energy can be based on the NRC publication Nutrient requirements in swine, ninth revised edition 1988, subcommittee on swine nutrition, committee on animalnutrition, board of agriculture, national research council calculates.NationalAcademy Press，Washington，D.C.，pp.2-6，and the European Table of EnergyValues for Poultry Feed-stuffs，Spelderholt centre for poultry research andextension，7361 DA Beekbergen，The Netherlands.Grafisch bedrijf Ponsen &looijen bv，Wageningen.ISBN 90-71463-12-5。

Calcium, available phosphorus and amino acid whose diet content calculate based on the feed table in the animal diet followed fully, for example Veevoedertabel 1997, gegevens over chemische samenstelling, verteerbaarheiden voederwaarde van voedermiddelen, Central Veevoederbureau, Runderweg 6,8219 pk Lelystad.ISBN 90-72839-13-7.

In specific embodiment, animal feedstuff compositions of the present invention comprises at least a vegetable-protein as defined above or protein source.

In other specific embodiments, animal feedstuff compositions of the present invention comprises the 0-80% corn; And/or 0-80% Chinese sorghum; And/or 0-70% wheat; And/or 0-70% barley; And/or 0-30% oat; And/or 0-40% soyflour; And/or 0-10% fish meal; And/or 0-20% whey.Animal diet followed can be manufactured for example mash feed (mash feed) (on-granulated (non pelleted)) or granular fodder.Usually, the feed that grinds is mixed, and add the essential vitamin and the mineral substance of q.s according to the specific requirement of described species.Enzyme can be added as solid or liquid enzymes formulation.For example, solid enzyme formulation usually before the mixing step or during add; The liquid enzymes formulation is added after granulation step usually.Also enzyme can be incorporated into fodder additives or premix.

Final enzyme concn in the diet is in the scope of 0.01-200 milligram zymoprotein/kilogram diet, for example in the scope of 5-30 milligram zymoprotein/kilogram animal diet followed.

Antimicrobial polypeptide can be used by one or more of following amount (dosage range): 0.01-200; Or 0.01-100; Or 0.05-100; Or 0.05-50; Or the unit of all these scopes of 0.10-10--is a milligram antimicrobial polypeptide albumen/kilogram of feed (ppm).

In order to measure a milligram antimicrobial polypeptide albumen/kilogram of feed, with antimicrobial polypeptide purifying from feed composition, and the ratio that uses relevant test (referring to antimicrobial acivity, substrate and test) to measure the antimicrobial polypeptide of purifying is lived.The antimicrobial acivity of feed composition equally also uses identical test to measure, and based on these two kinds of mensuration, calculates the dosage of representing with milligram antimicrobial polypeptide albumen/kilogram of feed.

Same principle is applied to measure the milligram antimicrobial polypeptide albumen in the fodder additives.Certainly, can use if be used to prepare the sample of the antimicrobial polypeptide of fodder additives or feed, then from then on sample determination than live (need not the described antimicrobial polypeptide of purifying from feed composition or additive).

Signal peptide and propetide

The invention still further relates to nucleic acid construct, described nucleic acid construct comprises the gene of coded protein, and it is operably connected with first nucleotide sequence and second nucleotide sequence one or both of; Described first nucleotide sequence is made up of following sequence: coding is by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, the amino acid-50 of SEQ ID NO:8 or SEQ ID NO:10 is to the SEQ IDNO:1 of-32 signal peptides of forming, SEQ ID NO:3, SEQ ID NO:5, the Nucleotide 1 to 57 of SEQ ID NO:7 or SEQ ID NO:9; Coding by the amino acid-39 of SEQ ID NO:12 or SEQ ID NO:14 to the SEQ ID NO:11 of-19 signal peptides of forming or the Nucleotide 1 to 63 of SEQ ID NO:13; Coding is by SEQ IDNO:16, and the amino acid-37 of SEQ ID NO:18 or SEQ ID NO:20 is to the SEQ ID NO:15 of-17 signal peptides of forming, the Nucleotide 1 to 63 of SEQ ID NO:17 or SEQ ID NO:19; Coding is by the amino acid-39 of the SEQID NO:22 Nucleotide 1 to 63 to the SEQ ID NO:21 of-19 signal peptides of forming; Coding is by the amino acid-50 of the SEQ ID NO:24 Nucleotide 1 to 57 to the SEQ ID NO:23 of-32 signal peptides of forming; Coding is by the amino acid-40 of the SEQ ID NO:26 Nucleotide 1 to 63 to the SEQID NO:25 of-20 signal peptides of forming; Or coding is by the amino acid-48 of the SEQ ID NO:28 Nucleotide 1 to 66 to the SEQ ID NO:27 of-27 signal peptides of forming; With

Described second nucleotide sequence is made up of following sequence: coding is by SEQ ID NO:2, SEQ IDNO:4, SEQ ID NO:6, the amino acid-31 of SEQ ID NO:8 or SEQ ID NO:10 is to the SEQ ID NO:1 of-1 propetide of forming, SEQ ID NO:3, SEQ ID NO:5, the Nucleotide 58 to 150 of SEQ ID NO:7 or SEQ IDNO:9; Coding by the amino acid-18 of SEQ ID NO:12 or SEQ ID NO:14 to the SEQ ID NO:11 of-1 propetide of forming or the Nucleotide 64 to 117 of SEQ ID NO:13; Coding is by SEQ ID NO:16, and the amino acid-16 of SEQ ID NO:18 or SEQ ID NO:20 is to the SEQ ID NO:15 of-1 propetide of forming, the Nucleotide 64 to 111 of SEQ ID NO:17 or SEQ ID NO:19; Coding is by the amino acid-18 of the SEQ ID NO:22 Nucleotide 64 to 117 to the SEQ ID NO:21 of-1 propetide of forming; Coding is by the amino acid-31 of the SEQ ID NO:24 Nucleotide 58 to 150 to the SEQ IDNO:23 of-1 propetide of forming; Coding is by the amino acid-19 of the SEQ ID NO:26 Nucleotide 64 to 120 to the SEQ ID NO:25 of-1 propetide of forming; Or coding is by the amino acid-26 of the SEQ ID NO:28 Nucleotide 67 to 144 to the SEQ ID NO:27 of-1 propetide of forming; Wherein said gene is external sources for first and second nucleotide sequences.

The invention still further relates to the recombinant expression vector and the recombinant host cell that comprise these nucleic acid constructs.

The invention still further relates to and be used to produce method of protein, it comprises that (a) cultivates so recombinant expressed cell being of value to producing under the described proteinic condition; (b) reclaim described protein.

First and second nucleotide sequences operationally can be connected with foreign gene together with other regulating and controlling sequence individually or in combination.These other regulating and controlling sequences as mentioned above.As described in the early time, when the two all is present in proteinic N-terminal when signal peptide and propetide district, the and then proteinic N-terminal of propetide zone position, and the signal peptide zone position N-terminal in propetide district and then.

Described protein can be natural or allogenic for host cell.Term " protein " does not mean the coded product of length-specific at this paper, and therefore comprises peptide, oligopeptides and protein.Term " protein " also comprises combination to form the two or more polypeptide of coded product.Protein also comprises hybrid polypeptide, and it comprises from the combination of the part or all of peptide sequence of two kinds of different proteins acquisitions at least, and wherein one or more protein can be allogenic or natural for host cell.Protein further comprises the naturally occurring allelic variation and the engineering variation of above-mentioned protein and hybrid protein.

Preferably, described protein is hormone or its variant, enzyme, acceptor or its part, antibody or its part or reporter molecules (reporter).Aspect preferred, protein is oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase or ligase enzyme.In addition preferred aspect, protein is aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at (cutinase), Maltose 4-glucosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, saccharase, laccase, lipase, mannosidase, mutant enzyme (mutanase), oxydase, pectin decomposing enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic ferment, rnase, trans-glutaminases or zytase.

Described gene can obtain from any protokaryon, eucaryon with other source.

The present invention further describes by following examples, and it should be interpreted as limitation of the scope of the invention.

Embodiment

As the pharmaceutical chemicals of damping fluid and substrate is the commerical prod of SILVER REAGENT at least.

Embodiment 1

The preparation in lugworm cDNA library

Digestive tube (gut) preparation cDNA library from lugworm.To be rich in the RNA purifying of PolyA, synthesize cDNA, and prepare the library according to the standard molecular biology method.Embodiment about the visible International Patent Application WO 01/12794 of the detailed protocol of general method.The carrier that is used to clone is pMHAs7i.Plasmid pMHAs7i is the derivative of pMhas5 (referring to WO 03/044049), and the adaptive cDNA of SfiI (adapted cDNA) that wherein produces in SfiI cloning site and the SMART scheme is complementary.In brief, with EcoRI-NotI people's zymohexase cDNA fragment cloning of lambdaTriplX2 (Clontech) in the Eco-RI cloning site of pMHas5.Gained plasmid pMHas7i comprises people's zymohexase cDNA, and described people's zymohexase cDNA flank is the required suitable SfiI site of the clone adaptive cDNA of SMART.

Preparation is used for cDNA clone's pMHas7i: with carrier SfiI restriction enzyme digestion, and by agarose gel electrophoresis with plasmid gel-purified from zymohexase insertion fragment.The band that will contain the restriction enzyme digestion plasmid is handled purifying (GE Healthcare) by GFX.

Embodiment 2

Find Marinasin peptide family by the signal capture in lugworm cDNA library

20,000 transformant altogether that connect from original cDNA-pMHas5 carrier prepare cDNA plasmid pond (cDNA plasmid pool), and as WO 01/,773 15 described in lock-on signal, this produces 381 sequences folded section (sequence contig) in flakes.

All 381 folded sections are in flakes carried out the blast search independently, and analytical results.A folded section (ZY151351) in flakes has some amino acid identity with known antimicrobial polypeptide (defensin sample polypeptide).With polypeptides derived called after Marinasin 1A (SEQ ID NO:6).

Check once more after 381 folded sections in flakes by carry out blast search with Marinasin 1A peptide sequence, identify several other " Marinasins " (SEQ ID NO:8, SEQ ID NO:10, SEQ IDNO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ IDNO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28).

Embodiment 3

Make up the Aspergillus expression vector for Marinasins

Prediction maturation zone (amino acid/11 to 49 of SEQ ID NO:8) with coding Marinasin 1B, the prediction maturation zone of Marinasin 2A (amino acid/11 to 46 of SEQ ID NO:12), the prediction maturation zone of Marinasin 3B (amino acid/11 to 48 of SEQ ID NO:18), the prediction maturation zone of Marinasin 4 (amino acid/11 to 45 of SEQ ID NO:22), the prediction maturation zone of Marinasin 5 (amino acid/11 to 49 of SEQ ID NO:24), the cDNA of the prediction maturation zone (amino acid/11 to 59 of SEQ ID NO:28) of the prediction maturation zone of Marinasin 6 (amino acid/11 to 44 of SEQ ID NO:26) and Marinasin 7 is from lugworm digestive tube cDNA amplified library and merge dna fragmentation to the Plectasin Qian Yuan district (pre-proregion) of encoding in the following manner: the template that 10 nanogram cDNA are reacted as the PCR that uses the listed oligonucleotide of table 1.

Table 1

Marinasin1B-F	5’GGATGCGAACCAACTTCAGAAACGTAGCTGGCTATGTAACTGGTTGGGC 3′
Marinasin1B-F	5’GGATGCGAACCAACTTCAGAAACGTAGCTGGCTATGTAACTGGTTGGGC 3′	Marinasin1B-R	5’CCCAAGCTTCACATGGTGTATGGTTGATCTCTCC 3’
Marinasin2A-F	5′GGATGCGAACCAACTTCAGAAACGTGGTTGGTGCTGGCAGTGGACATGT 3′	Marinasin1B-R	5’CCCAAGCTTCACATGGTGTATGGTTGATCTCTCC 3’
Marinasin2A-F	5′GGATGCGAACCAACTTCAGAAACGTGGTTGGTGCTGGCAGTGGACATGT 3′	Marinasin2B-R	5’CCCAAGCTTGCCCTTCTAGCGTTCAGCTCTT 3’
Marinasin3B-F	5’GGATGCGAACCAACTTCAGAAACGTCATTGGTGTTTCGAGTGGTCATGT 3’	Marinasin2B-R	5’CCCAAGCTTGCCCTTCTAGCGTTCAGCTCTT 3’
Marinasin3B-F	5’GGATGCGAACCAACTTCAGAAACGTCATTGGTGTTTCGAGTGGTCATGT 3’	Marinasin3B-R	5’CCCAAGCTTTCAGTGGAGAACCGTTACAGCA 3’
Marinasin4-F	5′GGATGCGAACCAACTTCAGAAACGTATCCCCTGTTGGACTCCGACATGT 3′	Marinasin3B-R	5’CCCAAGCTTTCAGTGGAGAACCGTTACAGCA 3’
Marinasin4-F	5′GGATGCGAACCAACTTCAGAAACGTATCCCCTGTTGGACTCCGACATGT 3′	Marinasin4-R	5′CCCAAGCTTAGCCCAGTATGCTCTGCACGT 3′
Marinasin5-F	5′GGATGCGAACCAACTTCAGAAACGTGGGGGCCGGCCCTGTCATAGGCAT 3′	Marinasin4-R	5′CCCAAGCTTAGCCCAGTATGCTCTGCACGT 3′
Marinasin5-F	5′GGATGCGAACCAACTTCAGAAACGTGGGGGCCGGCCCTGTCATAGGCAT 3′	Marinasin5-R	5’CCCAAGCTTAGTTGTTCGCTCCATTAGCACCT 3’
Marinasin6-F	5′ACCAACTTCAGAAACGTGGCAGGTCGTGTAATTTCTGGTT 3′	Marinasin5-R	5’CCCAAGCTTAGTTGTTCGCTCCATTAGCACCT 3’
Marinasin6-F	5′ACCAACTTCAGAAACGTGGCAGGTCGTGTAATTTCTGGTT 3′	Marinasin6-R	5′CCCAAGCTTTGGGCGATTCTATCTGCCTCTTA 3′
Marinasin7-F	5′ACCAACTTCAGAAACGTGGTGGGATGTGTGGTGACGA 3′	Marinasin6-R	5′CCCAAGCTTTGGGCGATTCTATCTGCCTCTTA 3′
Marinasin7-F	5′ACCAACTTCAGAAACGTGGTGGGATGTGTGGTGACGA 3′	Marinasin7-R	5′CCCAAGCTTGCACATCGTTTCCACCGCAA 3′

The primers F and the R (for example Marinasin1B-F and Marinasin1B-R) of each 5 picomole are used in the 25 μ l reaction volumes with Expand High Fidelity PCR System (Roche).After 94 ℃ of sex change 2 minutes, use following program to carry out 35 round-robin PCR:94 ℃ and continued 15 seconds and 60 ℃ lasting 60 seconds.

The Plectasin Qian Yuan district listed oligonucleotide of (referring to the embodiment of WO 03/044049) use table 2 that will comprise 58 bp introns increases from plasmid template.

Table 2

PlecBHI-F	5’CGCGGATCCCACCATGCAATTTACCACCATCCTCTC 3’
PlecBHI-F	5’CGCGGATCCCACCATGCAATTTACCACCATCCTCTC 3’	Plec-Mar1B-R	5′GCCCAACCAGTTACATAGCCAGCTACGTTTCTGAAGTTGGTTCGCATCC 3′
Plec-Mar2A-R	5′ACATGTCCACTGCCAGCACCAACCA CGTTTCTGAAGTTGGTTCGCATCC 3′	Plec-Mar1B-R	5′GCCCAACCAGTTACATAGCCAGCTACGTTTCTGAAGTTGGTTCGCATCC 3′
Plec-Mar2A-R	5′ACATGTCCACTGCCAGCACCAACCA CGTTTCTGAAGTTGGTTCGCATCC 3′	Plec-Mar3B-R	5′ACATGACCACTCGAAACACCAATGACGTTTCTGAAGTTGGTTCGCATCC 3′
Plec-Mar4-R	5′TCCAACAGGGGATACGTTTCTGAAGTTGGTTCGCATCC 3′	Plec-Mar3B-R	5′ACATGACCACTCGAAACACCAATGACGTTTCTGAAGTTGGTTCGCATCC 3′
Plec-Mar4-R	5′TCCAACAGGGGATACGTTTCTGAAGTTGGTTCGCATCC 3′	Plec-Mar5-R	5′ATGCCTATGACAGGGCCGGCCCCCACGTTTCTGAAGTTGGTTCGCATCC 3′
Plec-Mar6-R	5′AAATTACACGACCTGCCACGTTTCTGAAGTTGGTTCGCATCC 3′	Plec-Mar5-R	5′ATGCCTATGACAGGGCCGGCCCCCACGTTTCTGAAGTTGGTTCGCATCC 3′
Plec-Mar6-R	5′AAATTACACGACCTGCCACGTTTCTGAAGTTGGTTCGCATCC 3′	Plec-Mar7-R	5′CACACATCCCACCACGTTTCTGAAGTTGGTTCGCATCC 3′

The primers F and the R (for example PlecBHI-F and Marinasin1B-R) of each 5 picomole are used in the 25 μ l reaction volumes with Expand High Fidelity PCR System (Roche).After 94 ℃ of sex change 2 minutes, use following program to carry out 35 round-robin PCR:94 ℃ and continued 15 seconds and 60 ℃ lasting 60 seconds.

On 2% sepharose, separate described PCR reaction.Will be for Marinasin cDNAs and Plectasin Qian Yuan district the two band with expectation size use GFX DNA purification kit (Amersham) to separate according to the scheme of manufacturers.With the material of purifying 1/50 as the template that merges PCR, described fusion PCR uses Plectasin forward primer and Marinasin reverse primer (for example for Marinasin 1B: the product of Marinasin 1B-F and Marinasin 1B-R and the product of PlecBHI-F and Plec-Mar1B-R are made up as template, use PlecBHI-F and Marinasin1B-R as primer).The primers F and the R (for example Marinasin1B-F and Marinasin1B-R) of each 5 picomole are used in the 25 μ l reaction volumes with Expand High Fidelity PCR System (Roche).After 94 ℃ of sex change 2 minutes, use following program to carry out 25 round-robin PCR:94 ℃ and continued 15 seconds and 60 ℃ lasting 60 seconds.On 2% sepharose, separate described PCR reaction.Use GFX DNA purification kit (Amersham) to separate the band of the expectation size of coding Plectasin/Marinasin fusion constructs according to the scheme of manufacturers.Use BamHI and HindIII to digest fragment, the overhang that their cuttings are introduced by the PCR primer.The fragment of digestion separated and be cloned into (referring to the embodiment of WO 2005/042735) among the expression plasmid pDAu109.

Embodiment 4

The expression of Marinasins in Aspergillus

To be transformed into based on the Marinasin expression plasmid of pDAu109 among the aspergillus oryzae strain BECh2 (referring to WO 00/393229).Under selectivity and non-inductive condition, on Cove minimum medium, 10 to 20 transformant of each bacterial strain are separated (re-isolate) twice again with sucrose and ethanamide.In order to test the expression of Marinasins, transformant was cultivated 3 days in 26 degrees centigrade of test tubes with 10 milliliters of Dap2C-1 (referring to " substratum " among the embodiment of WO 2004/032648).Check expression by Maldi-TOF with as the SDS-page of the culture supernatants of (Invitrogen) on NuPage 16%Tricine sds gel that manufacturers is recommended.

Embodiment 5

Antimicrobial acivity by radial diffusion assay mensuration

Supernatant liquor scheme (Lehrer et al., (1991) Ultra sensitive assays forendogenous antimicrobial polypeptides J Immunol Methods 137:167-173) according to following previous disclosed detection antimicrobial acivity in radial diffusion assay is as described in example 4 above analyzed.With target bacteria (10 ⁶Colony-forming unit (CFU)) is added into 10ml place mat agarose (underlayagarose) (1% low electroendosmosis agarose, 0.03%Trypticase soy broth, 10mM sodium phosphate, 7.4,37 degrees centigrade of pH).(Becton Dickinson Labware NJ) goes up curing at INTEGRID Petri Dish with suspension.3 millimeters Gel Puncher are used in place mat agarose (Amersham PharmaciaBiotech, Sweden) upward drilling.Sample is added into the hole and 37 degrees centigrade of incubations 3 hours.Coverture (overlay) is poured over the top and flat board is incubated overnight (LB substratum, 7.5% agar).Antimicrobial acivity is considered as hole bacterium settling section (bacterial clearing zone) on every side.(3-(4 by adding 10ml, 0.2mM MTT with viable cell, 5-dimethylthiazole-2-yl)-2,5-phenylbenzene tetrazolium bromide tetrazolium bromide (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide Thiazolylblue)) counterstaining.All standard schemes are described (Sambrook, Fritsch, andManiatis, 1989) to some extent in the elsewhere.Obtain electronic image.Bacterial growth suppresses to observe as settling section, measures described settling section to immediate 0.1mm and deducts the diameter in hole.At following a series of test strain, the result is shown as the inhibitory area (table 3) of intrinsic sample (native sample) and the inhibitory area (table 4) of concentrating sample:

A：Staphylococcus simulans(ATCC11631)

B：Staphylococcus carnosus(ATCC51365)

C：Streptococcus hyointestinalis(ATCC49169)

D: subtilis (ATCC23857)

E：Enterococcus saccharolyticus(ATCC43076)

F: intestinal bacteria (ATCC10536)

G：Acinetobacter anitratus(ATCC17903)

H：Erwinia chrysanthemi(ATCC11663)

J：Pseudomonas boreopolis(ATCC15452)

The concentrated following of sample carries out: the 45ml culture supernatants is used 2.5ml 100%TCA precipitation, and granular sludge is resuspended in the resuspended damping fluid of 450 μ l (100mM Tris pH 8,100mM NaCl).

Table 3

Express the reorganization aspergillus oryzae clone's of Marinasins intrinsic culture supernatants radial diffusion assay result.10 units in the radial diffusion assay are equivalent to 3mm sample well 1mm diameter settling section on every side.

Table 4

Express the sedimentary culture supernatants radial diffusion assay of the reorganization aspergillus oryzae clone TCA result (100x concentrates) of Marinasins.10 units in the radial diffusion assay are equivalent to 3mm sample well 1mm diameter settling section on every side.

Embodiment 6

Use is identified defensin from the HMM file of PFAM database

Use the sequential analysis of hidden Markov model preface type (HMM preface type) can be, or use the software package HMMER of known free acquisition on local computer, to carry out online carrying out on the Internet.Present version is HMMER 2.3.2 (from October, 2003).

HMM preface type can obtain from the PFAM database of knowing.Present version is PFAM 16.0 (from November, 2004).The two all can be from for example Washington University in St.Louis (USA) to can be used for the HMMER of all computer platforms and PFAM, School of Medicine ( Http:// pfam.wustl.eduWith Http:// hmmer.wustl.edu) obtain.

If aminoacid sequence or its fragment of inquiry belong to one of following five kinds of PFAM families, described aminoacid sequence is according to defensin of the present invention:

Defensin _ β or " β defensin ", accession number: PF00711;

Defensin _ propetide or " defensin propetide ", accession number: PF00879;

Defensin _ 1 or " Mammals defensin ", accession number: PF00323;

Defensin _ 2 or " arthropods defensin ", accession number: PF01097;

γ-thionine or " γ-thionine family ", accession number: PF00304.

When online use PFAM database, or when local when using hmmpfam program (from the HMMER software package), produce greater than 0.1 E value with more than or equal to zero score (score) according to the aminoacid sequence that the invention belongs to PFAM family.

When using the hmmpfam program to carry out sequential analysis, must obtain (download) HMM preface type from the PFAM database in this locality.There are two kinds of preface types for each family; " xxx_ls.hmm " is used for global search and is used for " xxx_fs.hmm " of Local Search (" xxx " is the title of family).This makes and has 10 kinds of preface types altogether for aforesaid five families.

These 10 kinds of preface types can use separately, or in conjunction with (add) to an independent preface type (use document editor--described preface type is an ascii text file), can be with described independent preface type called after defensin.hmm for example.The inquiry aminoacid sequence can be assessed by using following order line subsequently:

hmmpfam-E 0.1 defensin.hmm sequence_file

-wherein " sequence_file " be file with inquiry aminoacid sequence, with any form by HMMER software package identification.

If score is more than or equal to zero (0.0), and the E value is greater than 0.1, and the aminoacid sequence of inquiring about is according to defensin of the present invention.

The PFAM database is at Bateman et al. (2004) " The Pfam Protein FamiliesDatabase ", and Nuleic Acids Research has further description among Vol.32 (Database Issue) pp.D138-D141.

Sequence table

＜110〉Novozymes Company (Novozymes A/S)

＜120〉has the polypeptide (Polypeptides Having Antimicrobial Activity) of antimicrobial acivity

<130>10803.204-WO

<160>50

<170>PatentIn version 3.3

<210>1

<211>297

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(297)

<220>

＜221〉signal peptide

<222>(1)..(57)

<220>

＜221〉mature peptide

<222>(151)..(297)

<400>1

atg aag ttt ttc tta ccg att atg atc gcc ttg gca ttt gct gcc gtc 48

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

gcc atg gca act tct gat act gag ccc gtt gaa ccg gaa gag gaa ctt 96

Ala Met Ala Thr Ser Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

tcc atc atg cta ccg ttt gty gaa gat gac ttg ctg gag aaa cct atc 144

Ser Ile Met Leu Pro Phe Xaa Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

ccc cgg agc tgg cta tgt aac tgg ttg ggc cat gac wtc ggc tgt ata 192

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Xaa Gly Cys Ile

-1 1 5 10

rct tat tgc aag ctg ttg ggt aac agc cga ggt ggt tgc tgt gct ggg 240

Xaa Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

grc gac tgg aas ggr tac tgt tac tgc cac gac ggt mgc agc ccw acc 288

Xaa Asp Trp Xaa Xaa Tyr Cys Tyr Cys His Asp Gly Xaa Ser Xaa Thr

35 40 45

gat agg tgt 297

Asp Arg Cys

<210>2

<211>99

<212>PRT

＜213〉lugworm (Arenicola marina)

<220>

<221>misc_feature

<222>(-12)..(-12)

＜223〉position-12 ' Xaa ' represents Val.

<220>

<221>misc_feature

<222>(11)..(11)

＜223〉position 11 ' Xaa ' represents Ile or Phe.

<220>

<221>misc_feature

<222>(15)..(15)

＜223〉position 15 ' Xaa ' represents Ala or Thr.

<220>

<221>misc_feature

<222>(31)..(31)

＜223〉position 31 ' Xaa ' represents Gly or Asp.

<220>

<221>misc_feature

<222>(34)..(34)

＜223〉position 34 ' Xaa ' represents Lys or Asn.

<220>

<221>misc_feature

<222>(35)..(35)

＜223〉position 35 ' Xaa ' represents Gly.

<220>

<221>misc_feature

<222>(43)..(43)

＜223〉position 43 ' Xaa ' represents Ser or Arg.

<220>

<221>misc_feature

<222>(45)..(45)

＜223〉position 45 ' Xaa ' represents Pro.

<400>2

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

Ala Met Ala Thr Ser Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

Ser Ile Met Leu Pro Phe Xaa Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Xaa Gly Cys Ile

-1 1 5 10

Xaa Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

Xaa Asp Trp Xaa Xaa Tyr Cys Tyr Cys His Asp Gly Xaa Ser Xaa Thr

35 40 45

Asp Arg Cys

<210>3

<211>297

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(297)

<220>

＜221〉signal peptide

<222>(1)..(57)

<220>

＜221〉mature peptide

<222>(151)..(297)

<400>3

atg aag ttt ttc tta ccg att atg atc gcc ttg gca ttt gct gcc gtc 48

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

gcc atg gca act tct gat act gag ccc gtt gaa ccg gaa gag gaa ctt 96

Ala Met Ala Thr Ser Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

tcc atc atg cta ccg ttt gtt gaa gat gac ttg ctg gag aaa cct atc 144

Ser Ile Met Leu Pro Phe Val Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

ccc cgg agc tgg cta tgt aac tgg ttg ggc cat gac ttc ggc tgt ata 192

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Phe Gly Cys Ile

-1 1 5 10

act tat tgc aag ctg ttg ggt aac agc cga ggt ggt tgc tgt gct ggg 240

Thr Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

ggc gac tgg aag gga tac tgt tac tgc cac gac ggt cgc agc cca acc 288

Gly Asp Trp Lys Gly Tyr Cys Tyr Cys His Asp Gly Arg Ser Pro Thr

35 40 45

gat agg tgt 297

Asp Arg Cys

<210>4

<211>99

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>4

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

Ala Met Ala Thr Ser Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

Ser Ile Met Leu Pro Phe Val Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Phe Gly Cys Ile

-1 1 5 10

Thr Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

Gly Asp Trp Lys Gly Tyr Cys Tyr Cys His Asp Gly Arg Ser Pro Thr

35 40 45

Asp Arg Cys

<210>5

<211>297

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(297)

<220>

＜221〉signal peptide

<222>(1)..(57)

<220>

＜221〉mature peptide

<222>(151)..(297)

<400>5

atg aag ttt ttc tta ccg att atg atc gcc ttg gca ttt gct gcc gtc 48

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

gcc atg gca act gct gat act gag ccc gtt gaa ccg gaa gag gaa ctt 96

Ala Met Ala Thr Ala Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

tcc atc atg cta ccg ttt gtt gaa gat gac ttg ctg gag aaa cct atc 144

Ser Ile Met Leu Pro Phe Val Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

ccc cgg agc tgg cta tgt aac tgg ttg ggc cat gac ttc ggc tgt ata 192

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Phe Gly Cys Ile

-1 1 5 10

act tat tgc aag ctg ttg ggt aac agc cga ggt ggt tgc tgt gct ggg 240

Thr Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

gac gac tgg aag gga tac tgt tac tgc cac gac ggt agc agc cct acc 288

Asp Asp Trp Lys Gly Tyr Cys Tyr Cys His Asp Gly Ser Ser Pro Thr

35 40 45

gat agg tgt 297

Asp Arg Cys

<210>6

<211>99

<212>PRT

＜213〉lugworm (Arenicola marina)

<400> 6

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

Ala Met Ala Thr Ala Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

Ser Ile Met Leu Pro Phe Val Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Phe Gly Cys Ile

-1 1 5 10

Thr Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

Asp Asp Trp Lys Gly Tyr Cys Tyr Cys His Asp Gly Ser Ser Pro Thr

35 40 45

Asp Arg Cys

<210>7

<211>297

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(297)

<220>

＜221〉signal peptide

<222>(1).(57)

<220>

＜221〉mature peptide

<222>(151)..(297)

<400>7

atg aag ttt ttc tta ccg att atg atc gcc ttg gca ttt gct gcc gtc 48

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

gcc atg gca act gct gat act gag ccc gtt gaa ccg gaa gag gaa ctt 96

Ala Met Ala Thr Ala Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

tcc atc atg cta ccg ttt gtt gaa gat gac ttg ctg gag aaa cct atc 144

Ser Ile Met Leu Pro Phe Val Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

ccc cgg agc tgg cta tgt aac tgg ttg ggc cat gac ttc ggc tgt ata 192

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Phe Gly Cys Ile

-1 1 5 10

act tat tgc aag ctg ttg ggt aac agc cga ggt ggt tgc tgt gct ggg 240

Thr Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

ggc gac tgg aac ggg tac tgt tac tgc cac gac ggt cgc agc cca acc 288

Gly Asp Trp Asn Gly Tyr Cys Tyr Cys His Asp Gly Arg Ser Pro Thr

35 40 45

gat agg tgt 297

Asp Arg Cys

<210>8

<211>99

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>8

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

Ala Met Ala Thr Ala Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

Ser Ile Met Leu Pro Phe Val Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Phe Gly Cys Ile

-1 1 5 10

Thr Tyr Cys Lys Leu Leu Gly Asn Sar Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

Gly Asp Trp Asn Gly Tyr Cys Tyr Cys His Asp Gly Arg Ser Pro Thr

35 40 45

Asp Arg Cys

<210>9

<211>297

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(297)

<220>

＜221〉signal peptide

<222>(1)..(57)

<220>

＜221〉mature peptide

<222>(151)..(297)

<400>9

atg aag ttt ttc tta ccg att atg atc gcc ttg gca ttt gct gcc gtc 48

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

gcc atg gca act gct gat act gag ccc gtt gaa ccg gaa gag gaa ctt 96

Ala Met Ala Thr Ala Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

tcc atc atg cta ccg ttt gtc gaa gat gac ttg ctg gag aaa cct atc 144

Ser Ile Met Leu Pro Phe Val Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

ccc cgg agc tgg cta tgt aac tgg ttg ggc cat gac atc ggc tgt ata 192

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Ile Gly Cys Ile

-1 1 5 10

gct tat tgc aag ctg ttg ggt aac agc cga ggt ggt tgc tgt gct ggg 240

Ala Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

ggc gac tgg aag gga tac tgt tac tgc cac gac ggt cgc agc cct acc 288

Gly Asp Trp Lys Gly Tyr Cys Tyr Cys His Asp Gly Arg Ser Pro Thr

35 40 45

gat agg tgt 297

Asp Arg Cys

<210>10

<211>99

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>10

Met Lys Phe Phe Leu Pro Ile Met Ile Ala Leu Ala Phe Ala Ala Val

-50 -45 -40 -35

Ala Met Ala Thr Ala Asp Thr Glu Pro Val Glu Pro Glu Glu Glu Leu

-30 -25 -20

Ser Ile Met Leu Pro Phe Val Glu Asp Asp Leu Leu Glu Lys Pro Ile

-15 -10 -5

Pro Arg Ser Trp Leu Cys Asn Trp Leu Gly His Asp Ile Gly Cys Ile

-1 1 5 10

Ala Tyr Cys Lys Leu Leu Gly Asn Ser Arg Gly Gly Cys Cys Ala Gly

15 20 25 30

Gly Asp Trp Lys Gly Tyr Cys Tyr Cys His Asp Gly Arg Ser Pro Thr

35 40 45

Asp Arg Cys

<210>11

<211>255

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(255)

<220>

＜221〉signal peptide

<222>(1)..(63)

<220>

＜221〉mature peptide

<222>(118)..(255)

<400>11

atg aac caa atc aca ttg ctg atg ttg cta gtc gcc gtc gct gtc atg 48

Met Asn Gln Ile Thr Leu Leu Met Leu Leu Val Ala Val Ala Val Met

-35 -30 -25

gca acc gtt acg gga caa tct ctg gat gac gaa agc gat gtt gaa aac 96

Ala Thr Val Thr Gly Gln Ser Leu Asp Asp Glu Ser Asp Val Glu Asn

-20 -15 -10

gtt tcc caa cct gaa cag cgc ggt tgg tgc tgg cag tgg aca tgt gat 144

Val Ser Gln Pro Glu Gln Arg Gly Trp Cys Trp Gln Trp Thr Cys Asp

-5 -1 1 5

gcc cac tgc tat ctc aag cag tat gac agg ggc tgc tgt ggt gtt gga 192

Ala His Cys Tyr Leu Lys Gln Tyr Asp Arg Gly Cys Cys Gly Val Gly

10 15 20 25

gaa cac agc ggt aaa tgc ctt tgc tac gac cat ggt ggc ccc ctc gcc 240

Glu His Ser Gly Lys Cys Leu Cys Tyr Asp His Gly Gly Pro Leu Ala

30 35 40

gat ggc tgc aag agc 255

Asp Gly Cys Lys Ser

45

<210>12

<211>85

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>12

Met Asn Gln Ile Thr Leu Leu Met Leu Leu Val Ala Val Ala Val Met

-35 -30 -25

Ala Thr Val Thr Gly Gln Ser Leu Asp Asp Glu Ser Asp Val Glu Asn

-20 -15 -10

Val Ser Gln Pro Glu Gln Arg Gly Trp Cys Trp Gln Trp Thr Cys Asp

-5 -1 1 5

Ala His Cys Tyr Leu Lys Gln Tyr Asp Arg Gly Cys Cys Gly Val Gly

10 15 20 25

Glu His Ser Gly Lys Cys Leu Cys Tyr Asp His Gly Gly Pro Leu Ala

30 35 40

Asp Gly Cys Lys Ser

45

<210>13

<211>255

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(255)

<220>

＜221〉signal peptide

<222>(1)..(63)

<220>

＜221〉mature peptide

<222>(118)..(255)

<400>13

atg aag caa ctc atc ttg ctg atg ttg ctg gtc gcc atc gct gtc atg 48

Met Lys Gln Leu Ile Leu Leu Met Leu Leu Val Ala Ile Ala Val Met

-35 -30 -25

gca aca gtt acg gca cag tcc ctg gat gac gaa agc gat gtt gat atc 96

Ala Thr Val Thr Ala Gln Ser Leu Asp Asp Glu Ser Asp Val Asp Ile

-20 -15 -10

gtt tcc caa tct gaa cag cgc cag tgg tgc tgg gag tgg tca tgt gat 144

Val Ser Gln Ser Glu Gln Arg Gln Trp Cys Trp Glu Trp Ser Cys Asp

-5 -1 1 5

gcc aac tgc ttt ttc aag cag ttt gat aac ggc tgc tgt ggt gtt ggg 192

Ala Asn Cys Phe Phe Lys Gln Phe Asp Asn Gly Cys Cys Gly Val Gly

10 15 20 25

gaa cac agc ggt aaa tgc ctt tgc tac gac cat gga ggc ccc ctc gcc 240

Glu His Ser Gly Lys Cys Leu Cys Tyr Asp His Gly Gly Pro Leu Ala

30 35 40

gcc ggc tgc acg cgc 255

Ala Gly Cys Thr Arg

45

<210>14

<211>85

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>14

Met Lys Gln Leu Ile Leu Leu Met Leu Leu Val Ala Ile Ala Val Met

-35 -30 -25

Ala Thr Val Thr Ala Gln Ser Leu Asp Asp Glu Ser Asp Val Asp Ile

-20 -15 -10

Val Ser Gln Ser Glu Gln Arg Gln Trp Cys Trp Glu Trp Ser Cys Asp

-5 -1 1 5

Ala Asn Cys Phe Phe Lys Gln Phe Asp Asn Gly Cys Cys Gly Val Gly

10 15 20 25

Glu His Ser Gly Lys Cys Leu Cys Tyr Asp His Gly Gly Pro Leu Ala

30 35 40

Ala Gly Cys Thr Arg

45

<210>15

<211>255

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(255)

<220>

＜221〉signal peptide

<222>(1)..(63)

<220>

＜221〉mature peptide

<222>(112)..(255)

<400>15

atg aaa aac ata aca ttg ctg atg ctg ctg gtt gcc gtc ttc gtc atg 48

Met Lys Asn Ile Thr Leu Leu Met Leu Leu Val Ala Val Phe Val Met

-35 -30 -25

gca acc gtt atg gca acg cct cta gat ggc gat att gaa gcc gtt tcc 96

Ala Thr Val Met Ala Thr Pro Leu Asp Gly Asp Ile Glu Ala Val Ser

-20 -15 -10

cag cca gag cag cgg ctt tgg tgt ttc gag tgg tca tgt gat gtc aga 144

Gln Pro Glu Gln Arg Leu Trp Cys Phe Glu Trp Ser Cys Asp Val Arg

-5 -1 1 5 10

tgc tgg tgg tcg cat cag aac ggc tgt tgt ggc gtt ggc gaa aac aaa 192

Cys Trp Trp Ser His Gln Asn Gly Cys Cys Gly Val Gly Glu Asn Lys

15 20 25

cat aaa tgc ctc tgc tat gtg agt ggt ggc ccc ctc gcc gct ggc tgc 240

His Lys Cys Leu Cys Tyr Val Ser Gly Gly Pro Leu Ala Ala Gly Cys

30 35 40

att agg gaa gtg ctg 255

Ile Arg Glu Val Leu

45

<210>16

<211>85

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>16

Met Lys Asn Ile Thr Leu Leu Met Leu Leu Val Ala Val Phe Val Met

-35 -30 -25

Ala Thr Val Met Ala Thr Pro Leu Asp Gly Asp Ile Glu Ala Val Ser

-20 -15 -10

Gln Pro Glu Gln Arg Leu Trp Cys Phe Glu Trp Ser Cys Asp Val Arg

-5 -1 1 5 10

Cys Trp Trp Ser His Gln Asn Gly Cys Cys Gly Val Gly Glu Asn Lys

15 20 25

His Lys Cys Leu Cys Tyr Val Ser Gly Gly Pro Leu Ala Ala Gly Cys

30 35 40

Ile Arg Glu Val Leu

45

<210>17

<211>255

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(255)

<220>

＜221〉signal peptide

<222>(1)..(63)

<220>

＜221〉mature peptide

<222>(112)..(255)

<400>17

atg aag aac ata acg ttg ctg atg ctg ctg gtt gcc gtc gtc gtc atg 48

Met Lys Asn Ile Thr Leu Leu Met Leu Leu Val Ala Val Val Val Met

-35 -30 -25

gca acc gtt atg gca acg cct cta gat ggc gat att gaa gcc gtt tcc 96

Ala Thr Val Met Ala Thr Pro Leu Asp Gly Asp Ile Glu Ala Val Ser

-20 -15 -10

cag cca gag cag cgt cat tgg tgt ttc gag tgg tca tgt gat gtc aaa 144

Gln Pro Glu Gln Arg His Trp Cys Phe Glu Trp Ser Cys Asp Val Lys

-5 -1 1 5 10

tgc tgg tgg tcg cat cag aac ggc tgt tgt ggc gtt ggc gaa aac aaa 192

Cys Trp Trp Ser His Gln Asn Gly Cys Cys Gly Val Gly Glu Asn Lys

15 20 25

cat aac tgc ctc tgc tat gag agt ggt ggc ccc ctc gcc gct ggc tgc 240

His Asn Cys Leu Cys Tyr Glu Ser Gly Gly Pro Leu Ala Ala Gly Cys

30 35 40

att agg gaa gtg ctg 255

Ile Arg Glu Val Leu

45

<210>18

<211>85

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>18

Met Lys Asn Ile Thr Leu Leu Met Leu Leu Val Ala Val Val Val Met

-35 -30 -25

Ala Thr Val Met Ala Thr Pro Leu Asp Gly Asp Ile Glu Ala Val Ser

-20 -15 -10

Gln Pro Glu Gln Arg His Trp Cys Phe Glu Trp Ser Cys Asp Val Lys

-5 -1 1 5 10

Cys Trp Trp Ser His Gln Asn Gly Cys Cys Gly Val Gly Glu Asn Lys

15 20 25

His Asn Cys Leu Cys Tyr Glu Ser Gly Gly Pro Leu Ala Ala Gly Cys

30 35 40

Ile Arg Glu Val Leu

45

<210>19

<211>255

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(255)

<220>

＜221〉signal peptide

<222>(1)..(63)

<220>

＜221〉mature peptide

<222>(112)..(255)

<400>19

atg aag aat ata aca atg ctg atg ctg ctg gtt gcc gtc gtc gtc atg 48

Met Lys Asn Ile Thr Met Leu Met Leu Leu Val Ala Val Val Val Met

-35 -30 -25

gca acc gtt atg gca acg cct cta gat ggc gat att gaa gcc gtt tac 96

Ala Thr Val Met Ala Thr Pro Leu Asp Gly Asp Ile Glu Ala Val Tyr

-20 -15 -10

cag ccg gag cag cgt cat tgg tgt tgg gaa tgg aca tgt gat gtc aga 144

Gln Pro Glu Gln Arg His Trp Cys Trp Glu Trp Thr Cys Asp Val Arg

-5 -1 1 5 10

tgc tgg tgg tcg cat cgg gat ggc tgt tgt ggc gtt ggc gaa aac aaa 192

Cys Trp Trp Ser His Arg Asp Gly Cys Cys Gly Val Gly Glu Asn Lys

15 20 25

aat aac tgc ctc tgc tat gag agt ggt ggc ccc ctc gcc gat ggc tgc 240

Asn Asn Cys Leu Cys Tyr Glu Ser Gly Gly Pro Leu Ala Asp Gly Cys

30 35 40

att agc aaa gtg ctg 255

Ile Ser Lys Val Leu

45

<210>20

<211>85

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>20

Met Lys Asn Ile Thr Met Leu Met Leu Leu Val Ala Val Val Val Met

-35 -30 -25

Ala Thr Val Met Ala Thr Pro Leu Asp Gly Asp Ile Glu Ala Val Tyr

-20 -15 -10

Gln Pro Glu Gln Arg His Trp Cys Trp Glu Trp Thr Cys Asp Val Arg

-5 -1 1 5 10

Cys Trp Trp Ser His Arg Asp Gly Cys Cys Gly Val Gly Glu Asn Lys

15 20 25

Asn Asn Cys Leu Cys Tyr Glu Ser Gly Gly Pro Leu Ala Asp Gly Cys

30 35 40

Ile Ser Lys Val Leu

45

<210>21

<211>252

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(252)

<220>

＜221〉signal peptide

<222>(1)..(63)

<220>

＜221〉mature peptide

<222>(118).(252)

<400>21

atg aag cca atc ata ttg ctg atg ctg ctg gtc gcc gtt gtc gtc atg 48

Met Lys Pro Ile Ile Leu Leu Met Leu Leu Val Ala Val Val Val Met

-35 -30 -25

gca aca gtt acg gca gag ccc ctg gat gaa gaa agc gat gtt gaa ata 96

Ala Thr Val Thr Ala Glu Pro Leu Asp Glu Glu Ser Asp Val Glu Ile

-20 -15 -10

gtt tcc cag cct gaa cag cgc atc ccc t gt tgg act ccg aca tgt agc 144

Val Ser Gln Pro Glu Gln Arg Ile Pro Cys Trp Thr Pro Thr Cys Ser

-5 -1 1 5

aca cgc tgc tgg tgg aag ggc aag agc ggc tgt tgt ggc gtt aaa gaa 192

Thr Arg Cys Trp Trp Lys Gly Lys Ser Gly Cys Cys Gly Val Lys Glu

10 15 20 25

cac tat ggt gta tgc atc tgc tat cag cat ctc ggc ccg aag gac agc 240

His Tyr Gly Val Cys Ile Cys Tyr Gln His Leu Gly Pro Lys Asp Ser

30 35 40

aga tgc ctg gcc 252

Arg Cys Leu Ala

45

<210>22

<211>84

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>22

Met Lys Pro Ile Ile Leu Leu Met Leu Leu Val Ala Val Val Val Met

-35 -30 -25

Ala Thr Val Thr Ala Glu Pro Leu Asp Glu Glu Ser Asp Val Glu Ile

-20 -15 -10

Val Ser Gln Pro Glu Gln Arg Ile Pro Cys Trp Thr Pro Thr Cys Ser

-5 -1 1 5

Thr Arg Cys Trp Trp Lys Gly Lys Ser Gly Cys Cys Gly Val Lys Glu

10 15 20 25

His Tyr Gly Val Cys Ile Cys Tyr Gln His Leu Gly Pro Lys Asp Ser

30 35 40

Arg Cys Leu Ala

45

<210>23

<211>297

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(297)

<220>

＜221〉signal peptide

<222>(1).(57)

<220>

＜221〉mature peptide

<222>(151)..(297)

<400>23

atg aag ttt tta tta ccg ttg atg gtc gtc atg gcc ttt gct gcc gtc 48

Met Lys Phe Leu Leu Pro Leu Met Val Val Met Ala Phe Ala Ala Val

-50 -45 -40 -35

gcc atg gca act gct gat act gag ccg gtt gag agg gag gag ggt gtt 96

Ala Met Ala Thr Ala Asp Thr Glu Pro Val Glu Arg Glu Glu Gly Val

-30 -25 -20

ttc atc atg cta ccg ttt gtt gaa gac gat atg ctg gag aaa cca att 144

Phe Ile Met Leu Pro Phe Val Glu Asp Asp Met Leu Glu Lys Pro Ile

-15 -10 -5

ctt cgg ggg ggc cgg ccc tgt cat agg cat ggc cat gac atg ggt tgc 192

Leu Arg Gly Gly Arg Pro Cys His Arg His Gly His Asp Met Gly Cys

-1 1 5 10

aca gct gct tgc aac gaa agg ggg cac agt cta ggt agt tgc tgt cct 240

Thr Ala Ala Cys Asn Glu Arg Gly His Ser Leu Gly Ser Cys Cys Pro

15 20 25 30

gtg ggc cac tat agt gga tact gt tac tgc cac gac agt ggc act ccc 288

Val Gly His Tyr Ser Gly Tyr Cys Tyr Cys His Asp Ser Gly Thr Pro

35 40 45

gat agg tgc 297

Asp Arg Cys

<210>24

<211>99

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>24

Met Lys Phe Leu Leu Pro Leu Met Val Val Met Ala Phe Ala Ala Val

-50 -45 -40 -35

Ala Met Ala Thr Ala Asp Thr Glu Pro Val Glu Arg Glu Glu Gly Val

-30 -25 -20

Phe Ile Met Leu Pro Phe Val Glu Asp Asp Met Leu Glu Lys Pro Ile

-15 -10 -5

Leu Arg Gly Gly Arg Pro Cys His Arg His Gly His Asp Met Gly Cys

-1 1 5 10

Thr Ala Ala Cys Asn Glu Arg Gly His Ser Leu Gly Ser Cys Cys Pro

15 20 25 30

ValGly His Tyr Ser Gly Tyr Cys Tyr Cys His Asp Ser Gly Thr Pro

35 40 45

Asp Arg Cys

<210>25

<211>252

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(252)

<220>

＜221〉signal peptide

<222>(1)..(63)

<220>

＜221〉mature peptide

<222>(121)..(252)

<400>25

atg aca acg ctg ctc cta atg ttt ggg gtc gcc atc gtc gtc ctg gca 48

Met Thr Thr Leu Leu Leu Met Phe Gly Val Ala Ile Val Val Leu Ala

-40 -35 -30 -25

act gta gca gcc gtg cct cta caa gat gac gat gtc ctt gac cca tca 96

Thr Val Ala Ala Val Pro Leu Gln Asp Asp Asp Val Leu Asp Pro Ser

-20 -15 -10

ggt ctt gtg gaa ggg gaa aca cgg ggc agg tcg tgt aat ttc tgg ttg 144

Gly Leu Val Glu Gly Glu Thr Arg Gly Arg Ser Cys Asn Phe Trp Leu

-5 -1 1 5

tgc cac gca tcc tgc atc gct aaa gtc gct gaa cga ggc tgc tgt gga 192

Cys His Ala Ser Cys Ile Ala Lys Val Ala Glu Arg Gly Cys Cys Gly

10 15 20

gtt gga aac tac ctt ggc tac tgt tat tgt tat gac agt ggc tat gaa 240

Val Gly Asn Tyr Leu Gly Tyr Cys Tyr Cys Tyr Asp Ser Gly Tyr Glu

25 30 35 40

tac agg tgc cgc 252

Tyr Arg Cys Arg

<210>26

<211>84

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>26

Met Thr Thr Leu Leu Leu Met Phe Gly Val Ala Ile Val Val Leu Ala

-40 -35 -30 -25

Thr Val Ala Ala Val Pro Leu Gln Asp Asp Asp Val Leu Asp Pro Ser

-20 -15 -10

Gly Leu Val Glu Gly Glu Thr Arg Gly Arg Ser Cys Asn Phe Trp Leu

-5 -1 1 5

Cys His Ala Ser Cys Ile Ala Lys Val Ala Glu Arg Gly Cys Cys Gly

10 15 20

Val Gly Asn Tyr Leu Gly Tyr Cys Tyr Cys Tyr Asp Ser Gly Tyr Glu

25 30 35 40

Tyr Arg Cys Arg

<210>27

<211>321

<212>DNA

＜213〉lugworm (Arenicola marina)

<220>

<221>CDS

<222>(1)..(321)

<220>

＜221〉signal peptide

<222>(1)..(66)

<220>

＜221〉mature peptide

<222>(145)..(321)

<400>27

atg aag ttg ttc tta ccc ttg gtg gtc acc gtg gca ttt gcc gcc gtc 48

Met Lys Leu Phe Leu Pro Leu Val Val Thr Val Ala Phe Ala Ala Val

-45 -40 -35

gtc atg act gat acg gag cca gtt gag gct gag gat gaa gtt tcc atc 96

Val Met Thr Asp Thr Glu Pro Val Glu Ala Glu Asp Glu Val Ser Ile

-30 -25 -20

atg aac cct tat gta aaa gac ggt gtg caa ggg aga cag acc ctc gag 144

Met Asn Pro Tyr Val Lys Asp Gly Val Gln Gly Arg Gln Thr Leu Glu

-15 -10 -5 -1

ggt ggg atg tgt ggt gac gac ttt ggc tcg tgg tct gac atc cgt gac 192

Gly Gly Met Cys Gly Asp Asp Phe Gly Ser Trp Ser Asp Ile Arg Asp

1 5 10 15

aac cag tgc agg gat tat tgt cgt tcg agg ggt agc ttc gga ggt tgc 240

Asn Gln Cys Arg Asp Tyr Cys Arg Ser Arg Gly Ser Phe Gly Gly Cys

20 25 30

tgt ggt att ggt ctc tgg cag gga caa tgt tac tgc tat tac ttc tac 288

Cys Gly Ile Gly Leu Trp Gln Gly Gln Cys Tyr Cys Tyr Tyr Phe Tyr

35 40 45

gga ccc agt ctt acc tat agg tgc tgg tcg aaa 321

Gly Pro Ser Leu Thr Tyr Arg Cys Trp Ser Lys

50 55

<210>28

<211>107

<212>PRT

＜213〉lugworm (Arenicola marina)

<400>28

Met Lys Leu Phe Leu Pro Leu Val Val Thr ValAla Phe Ala Ala Val

-45 -40 -35

Val Met Thr Asp Thr Glu Pro Val Glu Ala Glu Asp Glu Val Ser Ile

-30 -25 -20

Met Asn Pro Tyr Val Lys Asp Gly Val Gln Gly Arg Gln Thr Leu Glu

-15 -10 -5 -1

Gly Gly Met Cys Gly Asp Asp Phe Gly Ser Trp Ser Asp Ile Arg Asp

1 5 10 15

Asn Gln Cys Arg Asp Tyr Cys Arg Ser Arg Gly Ser Phe Gly Gly Cys

20 25 30

Cys Gly Ile Gly Leu Trp Gln Gly Gln Cys Tyr Cys Tyr Tyr Phe Tyr

35 40 45

Gly Pro Ser Leu Thr Tyr Arg Cys Trp Ser Lys

50 55

<210>29

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Marinasin1B-F

<400>29

ggatgcgaac caacttcaga aacgtagctg gctatgtaac tggttgggc 49

<210>30

<211>34

<212>DNA

＜213〉artificial

<220>

<223>Marinasin1B-R

<400>30

cccaagcttc acatggtgta tggttgatct ctcc 34

<210>31

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Marinasin2A-F

<400>31

ggatgcgaac caacttcaga aacgtggttg gtgctggcag tggacatgt 49

<210>32

<211>31

<212>DNA

＜213〉artificial

<220>

<223>Marinasin2A-R

<400>32

cccaagcttg cccttctagc gttcagctct t 31

<210>33

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Marinasin3B-F

<400>33

ggatgcgaac caacttcaga aacgtcattg gtgtttcgag tggtcatgt 49

<210>34

<211>31

<212>DNA

＜213〉artificial

<220>

<223>Marinasin3B-R

<400>34

cccaagcttt cagtggagaa ccgttacagc a 31

<210>35

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Marinasin4-F

<400>35

ggatgcgaac caacttcaga aacgtatccc ctgttggact ccgacatgt 49

<210>36

<211>30

<212>DNA

＜213〉artificial

<220>

<223>Marinasin4-R

<400>36

cccaagctta gcccagtatg ctctgcacgt 30

<210>37

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Marinasin5-F

<400>37

ggatgcgaac caacttcaga aacgtggggg ccggccctgt cataggcat 49

<210>38

<211>32

<212>DNA

＜213〉artificial

<220>

<223>Marinasin5-R

<400>38

cccaagctta gttgttcgct ccattagcac ct 32

<210>39

<211>40

<212>DNA

＜213〉artificial

<220>

<223>Marinasin6-F

<400>39

accaacttca gaaacgtggc aggtcgtgta atttctggtt 40

<210>40

<211>32

<212>DNA

＜213〉artificial

<220>

<223>Marinasin6-R

<400>40

cccaagcttt gggcgattct atctgcctct ta 32

<210>41

<211>37

<212>DNA

＜213〉artificial

<220>

<223>Marinasin7-F

<400>41

accaacttca gaaacgtggt gggatgtgtg gtgacga 37

<210>42

<211>29

<212>DNA

＜213〉artificial

<220>

<223>Marinasin7-R

<400>42

cccaagcttg cacatcgttt ccaccgcaa 29

<210>43

<211>36

<212>DNA

＜213〉artificial

<220>

<223>PlecBHI-F

<400>43

cgcggatccc accatgcaat ttaccaccat cctctc 36

<210>44

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Plec-Mar1B-R

<400>44

gcccaaccag ttacatagcc agctacgttt ctgaagttgg ttcgcatcc 49

<210>45

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Plec-Mar2A-R

<400>45

acatgtccac tgccagcacc aaccacgttt ctgaagttgg ttcgcatcc 49

<210>46

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Plec-Mar3B-R

<400>46

acatgaccac tcgaaacacc aatgacgttt ctgaagttgg ttcgcatcc 49

<210>47

<211>38

<212>DNA

＜213〉artificial

<220>

<223>Plec-Mar4-R

<400>47

tccaacaggg gatacgtttc tgaagttggt tcgcatcc 38

<210>48

<211>49

<212>DNA

＜213〉artificial

<220>

<223>Plec-Mar5-R

<400>48

atgcctatga cagggccggc ccccacgttt ctgaagttgg ttcgcatcc 49

<210>49

<211>42

<212>DNA

＜213〉artificial

<220>

<223>Plec-Mar6-R

<400>49

aaattacacg acctgccacg tttctgaagt tggttcgcat cc 42

<210>50

<211>38

<212>DNA

＜213〉artificial

<220>

<223>Plec-Mar7-R

<400>50

cacacatccc accacgtttc tgaagttggt tcgcatcc 38

Claims

1. the polypeptide that has antimicrobial acivity, described polypeptide comprise following represented aminoacid sequence: C-x (3)-C-x (7,9)-C-C; C-C-x (8)-C-x-C; Or C-x-C-x (8,11)-C.

2. the polypeptide of claim 1, it is a defensin.

3. claim 1 or 2 each polypeptide, described polypeptide comprises 5,6,7,8,9 or 10 cysteine residues.

4. each polypeptide of claim 1-3, described polypeptide is:

(a) polypeptide, it comprises the aminoacid sequence that has at least 60% identity with following sequence:

The amino acid/11 to 49 of SEQ ID NO:2,

The amino acid/11 to 49 of SEQ ID NO:4,

The amino acid/11 to 49 of SEQ ID NO:6,

The amino acid/11 to 49 of SEQ ID NO:8,

The amino acid/11 to 49 of SEQ ID NO:10,

The amino acid/11 to 46 of SEQ ID NO:12,

The amino acid/11 to 46 of SEQ ID NO:14,

The amino acid/11 to 48 of SEQ ID NO:16,

The amino acid/11 to 48 of SEQ ID NO:18,

The amino acid/11 to 48 of SEQ ID NO:20,

The amino acid/11 to 45 of SEQ ID NO:22,

The amino acid/11 to 49 of SEQ ID NO:24,

The amino acid/11 to 44 of SEQ ID NO:26, or

The amino acid/11 to 59 of SEQ ID NO:28;

(b) by nucleotide sequence coded polypeptide, described nucleotides sequence is listed under the middle at least stringent condition and following sequence hybridization:

(i): the Nucleotide 151 to 297 of SEQ ID NO:1,

The Nucleotide 151 to 297 of SEQ ID NO:3,

The Nucleotide 151 to 297 of SEQ ID NO:5,

The Nucleotide 151 to 297 of SEQ ID NO:7,

The Nucleotide 151 to 297 of SEQ ID NO:9,

The Nucleotide 118 to 255 of SEQ ID NO:11,

The Nucleotide 118 to 255 of SEQ ID NO:13,

The Nucleotide 112 to 255 of SEQ ID NO:15,

The Nucleotide 112 to 255 of SEQ ID NO:17,

The Nucleotide 112 to 255 of SEQ ID NO:19,

The Nucleotide 118 to 252 of SEQ ID NO:21,

The Nucleotide 151 to 297 of SEQ ID NO:23,

The Nucleotide 121 to 252 of SEQ ID NO:25, or

The Nucleotide 145 to 321 of SEQ ID NO:27;

Or (ii) with (i) complementary chain; Or

(c) variant, it comprises conservative one or more amino acid whose following sequences that replace, lack and/or insert:

The amino acid/11 to 49 of SEQ ID NO:2,

The amino acid/11 to 49 of SEQ ID NO:4,

The amino acid/11 to 49 of SEQ ID NO:6,

The amino acid/11 to 49 of SEQ ID NO:8,

The amino acid/11 to 49 of SEQ ID NO:10,

The amino acid/11 to 46 of SEQ ID NO:12,

The amino acid/11 to 46 of SEQ ID NO:14,

The amino acid/11 to 48 of SEQ ID NO:16,

The amino acid/11 to 48 of SEQ ID NO:18,

The amino acid/11 to 48 of SEQ ID NO:20,

The amino acid/11 to 45 of SEQ ID NO:22,

The amino acid/11 to 49 of SEQ ID NO:24,

The amino acid/11 to 44 of SEQ ID NO:26, or

The amino acid/11 to 59 of SEQ ID NO:28.

5. the polypeptide of claim 4 comprises with following sequence and has at least 65% identity, preferably at least 70% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, or the aminoacid sequence of at least 99% identity:

The amino acid/11 to 49 of SEQ ID NO:2,

The amino acid/11 to 49 of SEQ ID NO:4,

The amino acid/11 to 49 of SEQ ID NO:6,

The amino acid/11 to 49 of SEQ ID NO:8,

The amino acid/11 to 49 of SEQ ID NO:10,

The amino acid/11 to 46 of SEQ ID NO:12,

The amino acid/11 to 46 of SEQ ID NO:14,

The amino acid/11 to 48 of SEQ ID NO:16,

The amino acid/11 to 48 of SEQ ID NO:18,

The amino acid/11 to 48 of SEQ ID NO:20,

The amino acid/11 to 45 of SEQ ID NO:22,

The amino acid/11 to 49 of SEQ ID NO:24,

The amino acid/11 to 44 of SEQ ID NO:26, or

The amino acid/11 to 59 of SEQ ID NO:28.

6. during the polypeptide of claim 4, the nucleotides sequence of coding said polypeptide are listed under the stringent condition, preferably in-the Gao stringent condition under, or under the high stringent condition, and following sequence hybridization:

(i) Nucleotide 151 to 297 of SEQ ID NO:1,

The Nucleotide 151 to 297 of SEQ ID NO:3,

The Nucleotide 151 to 297 of SEQ ID NO:5,

The Nucleotide 151 to 297 of SEQ ID NO:7,

The Nucleotide 151 to 297 of SEQ ID NO:9,

The Nucleotide 118 to 255 of SEQ ID NO:11,

The Nucleotide 118 to 255 of SEQ ID NO:13,

The Nucleotide 112 to 255 of SEQ ID NO:15,

The Nucleotide 112 to 255 of SEQ ID NO:17,

The Nucleotide 112 to 255 of SEQ ID NO:19,

The Nucleotide 118 to 252 of SEQ ID NO:21,

The Nucleotide 151 to 297 of SEQ ID NO:23,

The Nucleotide 121 to 252 of SEQ ID NO:25, or

The Nucleotide 145 to 321 of SEQ ID NO:27; Or (ii) with (i) complementary chain.

7. each polypeptide of claim 1-6, described polypeptide is by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ IDNO:24, SEQ ID NO:26 or SEQ ID NO:28, or they have the fragment composition of antimicrobial acivity.

8. the polypeptide of claim 7, described polypeptide is made up of SEQ ID NO:2, SEQ ID NO:4, SEQ IDNO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28.

9. the polypeptide of claim 7, described polypeptide is made up of following sequence:

The amino acid/11 to 49 of SEQ ID NO:2,

The amino acid/11 to 49 of SEQ ID NO:4,

The amino acid/11 to 49 of SEQ ID NO:6,

The amino acid/11 to 49 of SEQ ID NO:8,

The amino acid/11 to 49 of SEQ ID NO:10,

The amino acid/11 to 46 of SEQ ID NO:12,

The amino acid/11 to 46 of SEQ ID NO:14,

The amino acid/11 to 48 of SEQ ID NO:16,

The amino acid/11 to 48 of SEQ ID NO:18,

The amino acid/11 to 48 of SEQ ID NO:20,

The amino acid/11 to 45 of SEQ ID NO:22,

The amino acid/11 to 49 of SEQ ID NO:24,

The amino acid/11 to 44 of SEQ ID NO:26, or

The amino acid/11 to 59 of SEQ ID NO:28.

10. polynucleotide, it comprises the nucleotide sequence of each described polypeptide of coding claim 1-9.

11. the polynucleotide of claim 10, it has at least one sudden change, wherein Tu Bian nucleotide sequence coded polypeptide of being made up of following sequence in the mature polypeptide encoded sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ IDNO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ IDNO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQID NO:25 or SEQ ID NO:27:

The amino acid/11 to 49 of SEQ ID NO:2,

The amino acid/11 to 49 of SEQ ID NO:4,

The amino acid/11 to 49 of SEQ ID NO:6,

The amino acid/11 to 49 of SEQ ID NO:8,

The amino acid/11 to 49 of SEQ ID NO:10,

The amino acid/11 to 46 of SEQ ID NO:12,

The amino acid/11 to 46 of SEQ ID NO:14,

The amino acid/11 to 48 of SEQ ID NO:16,

The amino acid/11 to 48 of SEQ ID NO:18,

The amino acid/11 to 48 of SEQ ID NO:20,

The amino acid/11 to 45 of SEQ ID NO:22,

The amino acid/11 to 49 of SEQ ID NO:24,

The amino acid/11 to 44 of SEQ ID NO:26, or

The amino acid/11 to 59 of SEQ ID NO:28.

12. nucleic acid construct, it comprises the polynucleotide of claim 10, and described polynucleotide are operably connected with one or more regulating and controlling sequences that instruct described polypeptide to produce in expressive host.

13. recombinant expression vector, it comprises the nucleic acid construct of claim 12.

14. recombinant host cell, it comprises the nucleic acid construct of claim 12.

15. be used to produce each the method for polypeptide of claim 1-9, it comprises that (a) is being of value to culturing cell under the condition that described polypeptide produces, described cell can produce described polypeptide with its wild-type form; (b) reclaim described polypeptide.

16. be used to produce each the method for polypeptide of claim 1-9, it comprises that (a) cultivates the host cell that comprises nucleic acid construct being of value under the condition that described polypeptide produces, described nucleic acid construct comprises the nucleotide sequence of coding said polypeptide; (b) reclaim described polypeptide.

17. isolating polynucleotide, it is by following acquisition: (a) under middle stringent condition, preferably in-the Gao stringent condition under, or under the high stringent condition, with DNA colony and following sequence hybridization:

(i) Nucleotide 151 to 297 of SEQ ID NO:1,

The Nucleotide 151 to 297 of SEQ ID NO:3,

The Nucleotide 151 to 297 of SEQ ID NO:5,

The Nucleotide 151 to 297 of SEQ ID NO:7,

The Nucleotide 151 to 297 of SEQ ID NO:9,

The Nucleotide 118 to 255 of SEQ ID NO:11,

The Nucleotide 118 to 255 of SEQ ID NO:13,

The Nucleotide 112 to 255 of SEQ ID NO:15,

The Nucleotide 112 to 255 of SEQ ID NO:17,

The Nucleotide 112 to 255 of SEQ ID NO:19,

The Nucleotide 118 to 252 of SEQ ID NO:21,

The Nucleotide 151 to 297 of SEQ ID NO:23,

The Nucleotide 121 to 252 of SEQ ID NO:25, or

The Nucleotide 145 to 321 of SEQ ID NO:27; Or (ii) with (i) complementary chain; (b) separate the polynucleotide of hybridizing, described polynucleotide encoding has the polypeptide of antimicrobial acivity.

18. be used to produce the method for polynucleotide with sudden change nucleotide sequence, it comprises (a) mature polypeptide encoded sequence with at least a sudden change introducing SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ IDNO:27, the nucleotide sequence coded polypeptide of being made up of following sequence of wherein said sudden change:

The amino acid/11 to 49 of SEQ ID NO:2,

The amino acid/11 to 49 of SEQ ID NO:4,

The amino acid/11 to 49 of SEQ ID NO:6,

The amino acid/11 to 49 of SEQ ID NO:8,

The amino acid/11 to 49 of SEQ ID NO:10,

The amino acid/11 to 46 of SEQ ID NO:12,

The amino acid/11 to 46 of SEQ ID NO:14,

The amino acid/11 to 48 of SEQ ID NO:16,

The amino acid/11 to 48 of SEQ ID NO:18,

The amino acid/11 to 48 of SEQ ID NO:20,

The amino acid/11 to 45 of SEQ ID NO:22,

The amino acid/11 to 49 of SEQ ID NO:24,

The amino acid/11 to 44 of SEQ ID NO:26, or

The amino acid/11 to 59 of SEQ ID NO:28; (b) reclaim the polynucleotide that comprise described sudden change nucleotide sequence.

19. the polynucleotide of the sudden change that produces by the method for claim 18.

20. be used to produce the method for polypeptide, it comprises that (a) under the condition that is of value to described polypeptide generation, cultivates the cell of the sudden change polynucleotide of the claim 19 that comprises coding said polypeptide; (b) reclaim described polypeptide.

21. be used to produce each the method for polypeptide of claim 1-9, it comprises that (a) is under the condition that is of value to described polypeptide generation, cultivation comprises the transgenic plant or the vegetable cell of polynucleotide, the described polynucleotide encoding polypeptide with antimicrobial acivity of the present invention; (b) reclaim described polypeptide.

22. transgenic plant, plant part or vegetable cell, it transforms with each the polynucleotide of polypeptide of coding claim 1-9.

23. be used to kill or suppress the method for microorganism cells growth, it comprises each defined antimicrobial polypeptide of described microorganism cells and claim 1-9 is contacted.

24. each defined antimicrobial polypeptide of claim 1-9, it is as medicine, or antimicrobial for animals or technology personal care agent or preventive.

25. the purposes of each defined antimicrobial polypeptide of claim 1-9 in preparing for animals or technology personal care agent, described therapeutical agent is used for the treatment of infected by microbes or is used for preventive use.

26. the purposes of each defined at least a antimicrobial polypeptide of claim 1-9 in animal-feed.