RU2393224C2 - Polypeptides with antimicrobial activity and polynucleotides coding them - Google Patents

Abstract

FIELD: agriculture.

SUBSTANCE: polypeptide homological to polypeptide expressed by Eurotinium amstelodami, has antimicrobial activity and may be used to administer as medical or prophylactic agent to a person or animal, and also in fodder for animals.

EFFECT: improved efficiency of application.

19 cl, 2 tbl, 6 ex

Description

FIELD OF THE INVENTION

The present invention relates to isolated polypeptides with antimicrobial activity and to isolated polynucleotides encoding the polypeptides. This invention also relates to nucleic acid constructs, vectors and host cells containing polynucleotides, as well as to methods for producing and using polypeptides.

BACKGROUND OF THE INVENTION

An object of the present invention is to provide polypeptides with antimicrobial activity and polynucleotide-encoding polypeptides.

SUMMARY OF THE INVENTION

The present invention relates to selected polypeptides with antimicrobial activity selected from the group consisting of

(a) a polypeptide with an amino acid sequence that has at least 60% identity to amino acids 1-42 of the sequence of SEQ ID NO: 2;

(b) a polypeptide that is encoded by a nucleotide sequence that hybridizes under conditions of at least moderate stringency (i) with nucleotides 145-270 of the sequence SEQ ID NO: 1, (ii) with a cDNA sequence that is contained in nucleotides 1-270 in the sequence SEQ ID NO: 1, or (iii) with a chain complementary to (i) or (ii); and

(c) a variant comprising a conservative substitution, deletion, and / or insertion of one or more amino acids in amino acids 1-42 in the sequence of SEQ ID NO: 2.

The present invention also relates to isolated polynucleotides encoding polypeptides with antimicrobial activity selected from the group consisting of

(a) a polynucleotide encoding a polypeptide with an amino acid sequence that has at least 60% identity to amino acids 1-42 of the sequence SEQ ID NO: 2;

(b) a polynucleotide having at least 60% nucleotide identity 145-270 of the sequence of SEQ ID NO: 1; and

(c) a polynucleotide that hybridizes under conditions of at least moderate stringency (i) with nucleotides 145-270 of the sequence SEQ ID NO: 1, (ii) with a cDNA sequence that is contained in nucleotides 1-270 of the sequence SEQ ID NO: 1, or (iii) with a chain complementary to (i) or (ii).

The present invention also relates to nucleic acid constructs, recombinant expression vectors and recombinant host cells containing polynucleotides.

The present invention also relates to methods for producing such polypeptides with antimicrobial activity, including (a) culturing a recombinant host cell containing a nucleic acid construct containing a polynucleotide encoding a polypeptide under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide.

The present invention also relates to methods of using the polypeptides and polynucleotides of the invention.

DEFINITIONS

Antimicrobial activity: In the present description, the term "antimicrobial activity" is defined as activity that can cause death or inhibit the growth of microbial cells. In the context of the present invention, it is understood that the term "antimicrobial" means the existence of a bactericidal and / or bacteriostatic and / or fungicidal and / or fungistatic and / or virocidal effect, where the term "bactericidal" is understood to be capable of killing bacterial cells. The term "bacteriostatic" should be understood as being capable of inhibiting the growth of bacteria, i.e. inhibitory growth of bacterial cells. The term "fungicidal" should be understood as capable of killing fungal cells. The term "fungistatic" should be understood as being capable of inhibiting the growth of fungi, i.e. inhibitory growth of fungal cells. The term "virocidal" should be understood as being capable of inactivating the virus. The term "microbial cells" refers to bacterial or fungal cells (including yeast).

In the context of the present invention, it is understood that the term "inhibitory growth of microbial cells" means that the cells are in a non-growing state, that is, that they are unable to multiply. For the purposes of the present invention, antimicrobial activity can be determined in accordance with the method described by Lehrer et al., Journal of Immunological Methods, Vol. 137 (2) pp. 167-174 (1991). Alternative antimicrobial activity can be determined in accordance with the NCCLS guidelines of CLSI (Institute of Clinical and Laboratory Standards; formerly known as the National Committee for Clinical and Laboratory Standards).

Antimicrobial activity polypeptides may have the ability to reduce the number of living cells of Escherichia coli (DSM 1576) to 1/100 after 8 hours (preferably after 4 hours, more preferably after 2 hours, most preferably after 1 hour, and especially after 30 minutes) incubation at 20 ° C in an aqueous solution of 25% (wt./mass.); preferably in an aqueous solution of 10% (w / w); more preferably in an aqueous solution of 5% (w / w); more preferably in an aqueous solution of 1% (w / w); most preferably in an aqueous solution of 0.5% (w / w); and especially in an aqueous solution of 0.1% (w / w) polypeptides with antimicrobial activity.

Antimicrobial activity polypeptides may also be able to inhibit the growth of Escherichia coli (DSM 1576) for 24 hours at 25 ° C in a microbial growth substrate when added at a concentration of 1000 ppm; preferably when added in a concentration of 500 ppm; more preferably when added in a concentration of 250 ppm; more preferably when added in a concentration of 100 ppm; most preferably when added in a concentration of 50 ppm; and especially when added at a concentration of 25 ppm.

Antimicrobial activity polypeptides may be able to reduce the number of living Bacillus subtilis cells (ATCC 6633) to 1/100 after 8 hours (preferably after 4 hours, more preferably after 2 hours, most preferably after 1 hour, and especially after 30 minutes) incubation at 20 ° C in an aqueous solution of 25% (wt./mass.); preferably in an aqueous solution of 10% (w / w); more preferably in an aqueous solution of 5% (w / w); more preferably in an aqueous solution of 1% (w / w); most preferably in an aqueous solution of 0.5% (w / w); and especially in an aqueous solution of 0.1% (w / w) polypeptides with antimicrobial activity.

Antimicrobial polypeptides may also be able to inhibit the growth of Bacillus subtilis (ATCC 6633) for 24 hours at 25 ° C in a substrate for microbial growth, when added at a concentration of 1000 ppm; preferably when added in a concentration of 500 ppm; more preferably when added in a concentration of 250 ppm; more preferably when added in a concentration of 100 ppm; most preferably when added in a concentration of 50 ppm; and especially when added at a concentration of 25 ppm.

The polypeptides of the invention have at least 20%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, and most preferably at least 100%, the antimicrobial activity of the polypeptide consisting of the amino acid sequence represented as amino acids 1-42 of sequence S EQ ID NO: 2.

Defensin: As used herein, the term "defensin" refers to polypeptides known to those skilled in the art that belong to the class of antimicrobial peptides defensins. In order to determine whether a polypeptide is a defensin in accordance with this invention, the amino acid sequence is preferably compared with profiles of hidden Markov models (HMM profiles) of the PFAM database using the publicly available HMMER software (see Example 6).

Families of PFAM defensin include mammalian defensin_1 or mammalian defensin (registration no. PF00323), defensin_2 or arthropod defensin (registration no. PF01097), beta defensin or beta-defensin (registration no. PF00711), propeptide defensin or (registration no. PF00879) and gamma-thionine or the "gamma-thionine family" (registration no. PF00304).

Defensins can belong to the class of alpha-defensin, to the class of beta-defensin, to the class of theta-defensin, to the class of insects defensin (arthropods), to the class of defensin of plants, to the class of defensin of bivalves, or to other classes of defensin, where the amino acid sequence contains 6 or 8 cysteines, and which are structurally similar to any of the previously mentioned classes of defensin. Defensins can also be synthetic defensins that have characteristic properties common to any of the classes of defensin.

Examples of such defensins include, but are not limited to, α-defensin HNP-1 (human neutrophil peptide) HNP-2 and HNP-3; β-defensin-12, drosomycin, heliomycin, γ1-purothionine, insect A defensin and defensins described in PCT applications WO 99/53053, WO 02/085934 and WO 03/044049.

Isolated polypeptide: As used herein, the term “isolated polypeptide” refers to a polypeptide that is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, more preferably at least 80% pure, more preferably at least 90% pure, and most preferably at least 95% pure, as determined by SDS-PAGE.

Essentially Pure Polypeptide: As used herein, the term “substantially pure polypeptide” means a preparation of a polypeptide that contains not more than 10%, preferably not more than 8%, more preferably not more than 6%, more preferably not more than 5%, more preferably not more 4%, not more than 3%, more preferably not more than 2%, more preferably not more than 1%, and most preferably not more than 0.5% by weight of other polypeptide substances with which it is associated in nature. Thus, it is preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, more preferably at least 99%, more preferably at least 99.5% pure, and most preferably 100% pure weight of the total polypeptide material present in the preparation.

The polypeptides of the invention are preferably in substantially pure form. In particular, it is preferable that the polypeptides are "essentially pure", that is, that the preparation of the polypeptide essentially does not contain other polypeptide substances with which it is associated in nature. This can be achieved, for example, by preparing a polypeptide by well-known recombinant methods or classical purification methods.

As used herein, the term “substantially pure polypeptide” is synonymous with the terms “isolated polypeptide” and “polypeptide in isolated form”.

Identity: The similarity between two amino acid sequences or between two nucleotide sequences is described by the "identity" parameter.

For the purposes of the present invention, the degree of identity between two amino acid sequences can be determined using the FASTA program, which is included in version 2.0x of the FASTA software package (see WR Pearson and DJ Lipman (1988), "Improved Tools for Biological Sequence Analysis", PNAS 85: 2444-2448; and WR Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA", Methods in Enzymology 183: 63-98). The score matrix used was BLOSUM50, the penalty for deletion was -12, and the penalty for continuing the deletion was -2.

The degree of identity between two nucleotide sequences is determined using the specified algorithm and software package, as described above. The score matrix used was an identity matrix, the penalty for deletion was -16, and the penalty for continuing the deletion was -4.

Alternatively, alignment of two amino acid sequences is determined using the Needle program from the EMBOSS package (http://emboss.org) version 2.8.0. Needle runs the general alignment algorithm described in Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453. The substitution matrix used is BLOSUM62, the penalty for introducing a deletion is 10, and the penalty for continuing a deletion is 0.5.

The degree of identity between the amino acid sequence of the present invention (“sequence according to the invention”; for example, amino acids 1-42 of SEQ ID NO: 2) and another amino acid sequence (“foreign sequence”) is calculated as the number of exact matches when aligning the two sequences, divided by the length of the "sequence according to the invention" or the length of the "foreign sequence", based on which one is shorter. Results are expressed as percent identity.

An exact match occurs if the "sequence according to the invention" and the "foreign sequence" have identical amino acid residues at the same positions of the overlapping portion (in the alignment example below, they are depicted by "|"). The length of the sequence is the number of amino acid residues in the sequence (for example, the length for amino acids 1-42 in the sequence of SEQ ID NO: 2 is 42).

In the alignment example below, the overlapping region is the amino acid sequence “HTWGER-NL” of sequence 1; or the amino acid sequence "HGWGEDANL" of sequence 2. In the example, a deletion is indicated by "-".

Alignment Example

Polypeptide fragment: As used herein, the term “polypeptide fragment” is defined as a polypeptide having one or more amino acids deleted from the N-terminus and / or C-terminus of SEQ ID NO: 2 or a sequence homologous to it, where the fragment has antimicrobial activity. Preferably, a fragment of the polypeptide of the invention retains all cysteine residues and amino acid residues between cysteine residues.

Subsequence: In the present description, the term "subsequence" is defined as a nucleotide sequence having one or more nucleotides deleted from the 5'-end and / or 3'-end of SEQ ID NO: 1 or a sequence homologous to it, where the subsequence encodes a fragment of a polypeptide having antimicrobial activity.

Allelic variant: In the present description, the term "allelic variant" means any two or more alternative forms of a gene that occupy the same locus on the chromosome. Allelic diversity arises in nature due to mutations and can lead to polymorphism in populations. Mutations in genes can be silent (there is no change in the encoded polypeptide) or they can encode polypeptides with altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

Essentially Pure Polynucleotide: As used herein, the term “substantially pure polynucleotide” refers to a polynucleotide preparation that does not contain other extraneous or unnecessary nucleotides and is in a form suitable for use in genetic engineering protein production systems. Thus, a substantially pure polynucleotide contains not more than 10%, preferably not more than 8%, more preferably not more than 6%, more preferably not more than 5%, more preferably not more than 4%, more preferably not more than 3%, more preferably not more than 2%, more preferably not more than 1%, and most preferably not more than 0.5% by weight of other polynucleotide substances with which it is associated in nature. A substantially pure polynucleotide may, however, include naturally occurring 5 ′ and 3 ′ untranslated regions, such as promoters and terminators. Preferably, the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, more preferably at least 99% and most preferably at least 99.5% pure by weight. The polynucleotides of the invention are preferably in substantially pure form. In particular, it is preferable that the polynucleotides described herein are "substantially pure", that is, that the polynucleotide preparation is substantially free of other polynucleotide substances with which it is naturally associated. As used herein, the term “substantially pure polynucleotide” is synonymous with the terms “isolated polynucleotide” and “polynucleotide in isolated form”. Polynucleotides can be polynucleotides of genomic origin, polynucleotides from cDNA, from RNA, semisynthetic, synthetic origin, or any combination thereof.

cDNA: In the present description, the term "cDNA" is defined as a DNA molecule that can be obtained by reverse transcription from a mature spliced mRNA molecule obtained from a eukaryotic cell. There are no intron sequences in cDNA that are typically represented in the corresponding genomic DNA. The initial primary RNA transcript is an mRNA precursor that is processed through a series of steps before the formation of mature spliced mRNA. These stages include the removal of intron sequences in a process called splicing. The source of cDNA is mRNA, in which, therefore, there are no sequences of introns.

Nucleic acid construct: As used herein, the term “nucleic acid construct” refers to a nucleic acid molecule, either single-stranded or double-stranded, that is isolated from a natural gene or that is modified to contain segments of nucleic acids, in a manner that otherwise does not occur in nature. The term nucleic acid construct is synonymous with the term “expression cassette” when the nucleic acid construct contains the control sequences necessary for the expression of the coding sequence of the invention.

Control sequence: In the present description, the term "control sequence" is defined as including all components that are necessary for expression or facilitate the expression of a polynucleotide encoding a polypeptide according to the invention. Each control sequence may be its own or foreign nucleotide sequence encoding a polypeptide. Such control sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, and a transcription terminator. Control sequences include at least a promoter and transcriptional and translational stop signals. In order to introduce specific restriction sites that facilitate ligation of the control sequences with the coding region of the nucleotide sequence encoding the polypeptide, linkers may be provided in the control sequences.

Functionally linked: In the present description, the term "functionally linked" means a configuration in which the control sequence is placed in an appropriate position relative to the coding sequence of the polynucleotide sequence so that the control sequence controls the expression of the coding sequence of the polypeptide.

Coding sequence: In the present description, the term "coding sequence" means a nucleotide sequence that directly determines the amino acid sequence of its protein product. The boundaries of the coding sequence are typically determined by an open reading frame, which typically starts with an ATG initiation codon or alternative initiation codons, such as GTG and TTG. The coding sequence may be DNA, cDNA, or a recombinant nucleotide sequence.

Expression: The term "expression" includes any stage involved in the production of a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.

Expression vector: In the present description, the term "expression vector" is defined as a linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide according to the invention, and which is operably linked to additional nucleotides that provide expression.

Host cell: As used herein, the term "host cell" includes any type of cell capable of transformation, transfection, transduction, and the like. a nucleic acid construct comprising a polynucleotide according to the invention.

Modification: In the present description, the term "modification" means any chemical modification of a polypeptide consisting of amino acids 1-42 of the sequence SEQ ID NO: 2, as well as the genetic effect on DNA encoding this polypeptide. Modification (s) may be a substitution (s), deletion (s) and / or insertion (s) of amino acid (s), as well as rearrangement (s) of amino acid side chain (s); or the use of unnatural amino acids with similar properties in the amino acid sequence. In particular, the modification (s) may be an amidation, such as a C-terminal amidation.

Artificial variant: In the present description, the term "artificial variant" means a polypeptide having antimicrobial activity produced by an organism expressing the modified nucleotide sequence of SEQ ID NO: 1. The modified nucleotide sequence is obtained by modifying the nucleotide sequence described in SEQ ID NO: 1, through human intervention.

DETAILED DESCRIPTION OF THE INVENTION

Antimicrobial activity polypeptides

In a first aspect, the present invention relates to isolated polypeptides having an amino acid sequence that has a degree of identity with amino acids 1-42 of SEQ ID NO: 2 (i.e., with a mature polypeptide) of at least 60%, preferably at least 65% more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably least 95%, and most preferably at least 97%, which have antimicrobial activity (hereinafter “homologous polypeptides”). In a preferred aspect, homologous polypeptides have an amino acid sequence that differs by ten amino acids, preferably five amino acids, more preferably four amino acids, more preferably three amino acids, more preferably two amino acids, and most preferably one amino acid from amino acids 1-42 of the sequence of SEQ ID NO: 2.

The polypeptide according to the invention preferably contains the amino acid sequence of SEQ ID NO: 2 or its allelic variant; or a fragment thereof that has antimicrobial activity. In a preferred aspect, the polypeptide comprises the amino acid sequence of SEQ ID NO: 2. In another preferred aspect, the polypeptide comprises amino acids 1-42 of the sequence SEQ ID NO: 2, or an allelic variant thereof; or a fragment thereof that has antimicrobial activity. In another preferred aspect, the polypeptide comprises amino acids 1-42 of the sequence SEQ ID NO: 2. In another preferred aspect, the polypeptide consists of the amino acid sequence of SEQ ID NO: 2 or an allelic variant thereof; or a fragment thereof that has antimicrobial activity. In another preferred aspect, the polypeptide consists of the amino acid sequence of SEQ ID NO: 2. In another preferred aspect, the polypeptide consists of amino acids 1-42 of the sequence of SEQ ID NO: 2 or an allelic variant thereof; or a fragment thereof that has antimicrobial activity. In another preferred aspect, the polypeptide consists of amino acids 1-42 of the sequence SEQ ID NO: 2.

In a second aspect, the present invention relates to isolated antimicrobial activity polypeptides that are encoded by polynucleotides that hybridize under conditions of very low stringency, preferably under conditions of low stringency, more preferably under conditions of moderate stringency, more preferably, conditions of medium-high stringency, more preferably under conditions of high stringency, and most preferably, in conditions of very high stringency, (i) with nucleotides 145-270 of the sequence SEQ ID NO: 1, (ii) followed by the cDNA sequence contained between nucleotides 1-270 of the sequence SEQ ID NO: 1, (iii) with a subsequence (i) or (ii), or (iv) complementary to (i), (ii), or (iii) the chain (J. Sambrook, EF Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York). A subsequence of SEQ ID NO: 1 contains at least 100 contiguous nucleotides, or preferably at least 200 contiguous nucleotides. Moreover, a subsequence can encode a fragment of a polypeptide that has antimicrobial activity. The nucleotide sequence of SEQ ID NO: 1 or its subsequence, as well as the amino acid sequence of SEQ ID NO: 2 or its fragment can be used to create a nucleic acid probe to detect and clone DNA encoding polypeptides with antimicrobial activity in strains of various genera or species in accordance with methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, followed by the standard southern blotting method, in order to identify and isolate the corresponding gene from them. Such probes can be significantly shorter than the complete sequence, but their length should be at least 14, preferably at least 25, more preferably at least 35 and most preferably at least 70 nucleotides. However, it is preferred that the length of the nucleic acid probe is at least 100 nucleotides. For example, a nucleic acid probe may be at least 200 nucleotides, preferably at least 270 nucleotides. Both DNA and RNA probes can be used. To identify the corresponding gene, probes are typically labeled (e.g. ³² P, ³ H, ³⁵ S, biotin or avidin). Such probes are encompassed by the present invention.

For genomic libraries of DNA or cDNA derived from such other organisms, it is thus possible to screen for DNA that hybridizes with the probes described above and that encodes a polypeptide with antimicrobial activity. Genomic or other DNA from such other organisms can be isolated by agarose or polyacrylamide gel electrophoresis, or by other methods of isolation. DNA from libraries or isolated DNA can be transferred and immobilized on nitrocellulose or another suitable vehicle. In order to identify a clone or DNA that is homologous to SEQ ID NO: 1 or a subsequence thereof, the carrier is used in a southern blot.

For the purposes of the present invention, hybridization shows that the nucleotide sequence hybridizes with a labeled nucleic acid probe corresponding to the nucleotide sequence shown in SEQ ID NO: 1, with its complementary strand, or with its subsequence, under conditions of very low to very high stringency. Molecules with which the nucleic acid probe hybridizes under these conditions can be determined using an X-ray film.

In a preferred aspect, the nucleic acid probe is a polynucleotide sequence that encodes a polypeptide of SEQ ID NO: 2 or a subsequence thereof. In another preferred aspect, the nucleic acid probe is SEQ ID NO: 1. In another preferred aspect, the nucleic acid probe is a portion of SEQ ID NO: 1 encoding a mature polypeptide.

For long probes with a length of at least 100 nucleotides, conditions from very low to very high stringency are defined as prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 μg / ml digested and denatured salmon sperm DNA, and either 25% formamide for very low and low stiffness, 35% formamide for medium and medium high stiffness, or 50% formamide for high and very high stiffness, followed by southern blotting, is optimal for 12 to 24 hours.

For long probes with a length of at least 100 nucleotides, the carrier is washed at the end three times, each for 15 minutes, using 2X SSC, 0.2% SDS, preferably at least 45 ° C (very low hardness), more preferably at least at least 50 ° C (low hardness), more preferably at least 55 ° C (medium hardness), more preferably at least 60 ° C (medium high hardness), more preferably at least 65 ° C (high hardness ), and most preferably at least 70 ° C (very high hard be).

For short probes ranging in length from about 15 nucleotides to about 70 nucleotides, stringency conditions are defined as prehybridization, hybridization, and washing after hybridization at a temperature that is from about 5 ° C to about 10 ° C below Tm calculated using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48: 1390), 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP- 40, 1X Denhard's solution, 1 mM sodium pyrophosphate, 1 mm monobasic sodium phosphate, 0.1 mm ATP, and 0.2 mg yeast RNA per ml in accordance with the standard method of southern blotting. For short probes ranging in length from about 15 nucleotides to about 70 nucleotides, the carrier is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice for 15 using 6X SSC at a temperature lower than the calculated Tm by 5 ° C to 10 ° C.

In a third aspect, the present invention relates to artificial variants comprising a conservative substitution, deletion and / or insertion of one or more amino acids of SEQ ID NO: 2 or a mature polypeptide thereof. Preferably, amino acid changes in nature are minor changes, namely, conservative amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; small deletions, typically from one to about 30 amino acids; small N- or C-terminal extensions, such as the N-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a slight elongation that simplifies purification by altering the total charge or other function, such as a polyhistidine region, an antigenic epitope, or a binding domain.

Examples of conservative substitutions are substitutions in the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions, which, as a rule, do not change a particular activity, are known in the art and are described, for example, by H. Neurath and R. L. Hill, 1979, In, The Proteins, Academic Press, New York. The most common substitutions are Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu and Asp / Gly.

In addition to the 20 standard amino acids, wild-type residues can be replaced with non-standard amino acids (such as 4-hydroxyproline, 6-N-methyllysine, 2-aminoisobutyric acid, isovalin and alpha-methylserine). Amino acid residues can be replaced by a limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids. "Unnatural amino acids" are modified after protein synthesis and / or have a chemical structure in their side chain (s) that is different from the chemical structure of standard amino acids. Unnatural amino acids can be chemically synthesized, and preferably they are commercially available and include pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, and 3,3-dimethylproline.

Alternative amino acid changes are changes of this nature that alter the physicochemical properties of the polypeptides. For example, amino acid changes can increase the thermal stability of the polypeptide, change substrate specificity, change the optimal pH value, and the like.

Basic amino acids in the parent polypeptide can be detected in accordance with methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter method, to identify amino acid residues that are responsible for the activity of a molecule, single mutations of alanine are introduced into each residue of the molecule, and the resulting mutant molecules are analyzed for biological activity (i.e., antimicrobial activity). See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by analysis of the structure, as determined by methods such as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, together with a mutation of the putative amino acids of the contact area. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. Belonging to the necessary amino acids can also be established based on the analysis of identity with polypeptides that are similar to the polypeptide in accordance with this invention.

Single or multiple amino acid substitutions can be made and analyzed using known methods of mutagenesis, recombination and / or shuffling, followed by a suitable screening method, such as the methods described by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include PCR with reduced accuracy, phage display (e.g., Lowman et al., 1991, Biochem. 30: 10832-10837; US patent No. 5223409; WO 92/06204), and site-directed mutagenesis ( Derbyshire et al., 1986; Gene 46: 145; Ner et al., 1988; DNA 7: 127).

Mutagenesis / shuffling methods can be combined with high-throughput automated screening methods to detect the activity of cloned mutant polypeptides expressed by host cells. Mutant DNA molecules that encode active polypeptides can be obtained from host cells and quickly sequenced using standard methods in this field. These methods enable the rapid determination of the value of individual amino acid residues in a polypeptide of interest, and they can be applied to polypeptides with an unknown structure.

The total number of amino acid substitutions, deletions and / or inserts in amino acids 1-42 of the sequence SEQ ID NO: 2 is 10, preferably 9, more preferably 8, more preferably 7, more preferably not more than 6, more preferably not more than 5, more preferably 4 , more preferably 3, more preferably 2, and most preferably 1.

In a preferred embodiment, the polypeptides of the invention are defensin polypeptides. In another embodiment, the polypeptides of the invention comprise three dicysteine bonds.

N-terminal extension

Suitable N-terminal extension of the polypeptides according to the invention may consist of from 1 to 50 amino acids, preferably from 2-20 amino acids, mainly from 3-15 amino acids. In one embodiment, the N-terminal extension of the peptide does not contain Arg (R). In another embodiment, the N-terminal extension comprises a kex2 cleavage site or a kex2-like cleavage site, as defined below. In a preferred embodiment, the N-terminal extension is a peptide containing at least two amino acid residues Glu (E) and / or Asp (D), such as an N-terminal extension, containing the following sequences: EAE, EE, DE and DD.

Kex2 plots

Kex2 regions (see, for example, Methods in Enzymology Vol 185, ed. D. Goeddel, Academic Press Inc. (1990), San Diego, CA, “Gene Expression Technology”) and kex2-like regions are dibasic recognition regions ( i.e., cleavage sites) located between the propeptide coding region and the mature region of some proteins. It has been shown that the insertion of a kex2 or kex2-like region in certain cases leads to an increase in error-free processing of endopeptidase in the propeptide cleavage site, which leads to an increased level of protein secretion.

In the context of this invention, the insertion of a kex2 or kex2-like region leads to the possibility of cleavage at a certain position of the N-terminal extension, which leads to the fact that the antimicrobial polypeptide is elongated compared to the mature polypeptide represented as amino acids 1-42 of the SEQ sequence ID NO: 2.

Fusion Polypeptides

The polypeptides of the invention also include fusion polypeptides or cleavable fusion polypeptides in which the other polypeptide is fused to the N-terminus or C-terminus of a polypeptide of the invention or a fragment thereof. A fusion polypeptide is obtained by fusing a nucleotide sequence (or part thereof) encoding another polypeptide with a nucleotide sequence (or part thereof) according to the invention. Methods for producing fusion polypeptides are known in the art and include ligation of coding sequences encoding the polypeptides so that they are in the reading frame and that expression of the fusion polypeptide is controlled by said promoter (s) and terminator.

Sources of antimicrobial polypeptides

The polypeptide according to the invention can be obtained from microorganisms of any kind. As used herein, for the purposes of the present invention, the term “derived from” as applied to a given source means that the polypeptide encoded by the nucleotide sequence is produced by the source or strain into which the nucleotide sequence from the source has been inserted. In a preferred aspect, the polypeptide obtained from this source is secreted extracellularly.

The polypeptide according to the invention may be a bacterial polypeptide. For example, the polypeptide may be a polypeptide of Gram positive bacteria, e.g., such as a polypeptide Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis , Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis , or Bacillus thuringiensis ; or a Streptomyces polypeptide, for example, a Streptomyces lividans or Streptomyces murinus polypeptide; or a gram negative bacteria polypeptide, for example, a polypeptide of E. coli or Pseudomonas sp.

The polypeptide according to the invention may also be a peptide of fungi, and more preferably a yeast polypeptide, such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowia polypeptide; or more preferably the polypeptide micellar fungi such as Acremonium polypeptide, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium , Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium , or Trichoderma .

In a preferred aspect, the polypeptide is an antimicrobial polypeptide from Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces o .

In another preferred aspect, the polypeptide is a polypeptide of Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus nigerumus, Fusarium fibusarus fibusarus fibusarus fibusarus fibusarus fibusarius , Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride .

In another preferred aspect, the polypeptide is an Eurotium amstelodami, Aspergillus amstelodami, Aspergillus montevidensis or Aspergillus vitis polypeptide.

In a more preferred aspect, the polypeptide is an Eurotium amstelodami polypeptide, for example, the polypeptide of SEQ ID NO: 2.

It is clear that for the species mentioned above, this invention relates to both the perfect and the imperfect stages, and other taxonomic equivalents, for example, anamorphs, regardless of the name of the species by which they are known. Those skilled in the art will easily determine the identity of the respective equivalents.

Strains of these species are readily available for public use in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

Moreover, such polypeptides can be detected and obtained from other sources, including microorganisms isolated from a natural source (e.g., soil, compost, water, etc.) using the probes mentioned above. Methods for isolating microorganisms from the natural environment are well known in the art. The polynucleotide can then be obtained in a similar manner by screening a genomic or cDNA library of another microorganism. Once a polynucleotide encoding a polypeptide is detected using the probe (s), the polynucleotide can be isolated or cloned using methods that are well known to those of ordinary skill in the art (see, for example, Sambrook et al., 1989, supra ). The polypeptides of the invention also include fusion polypeptides or cleavable fusion polypeptides in which the other polypeptide is fused to the N-terminus or C-terminus of a polypeptide or fragment thereof. A fusion polypeptide is obtained by fusing a nucleotide sequence (or part thereof) encoding another polypeptide with a nucleotide sequence (or part thereof) according to the invention. Methods for producing fusion polypeptides are known in the art and include ligation of coding sequences encoding the polypeptides so that they are in the reading frame and that expression of the fusion polypeptide is controlled by one promoter (s) and terminator.

Polynucleotides

The present invention also relates to isolated polynucleotides with a nucleotide sequence that encodes a polypeptide according to the invention. In a preferred aspect, the nucleotide sequence is indicated in SEQ ID NO: 1. In another preferred aspect, the nucleotide sequence is a mature polypeptide coding region of SEQ ID NO: 1. The present invention also relates to nucleotide sequences that encode a polypeptide with the amino acid sequence of SEQ ID NO: 2 or its mature polypeptide, which differ from SEQ ID NO: 1 due to the degeneracy of the genetic code. The present invention also relates to a subsequence of SEQ ID NO: 1, which encodes fragments of SEQ ID NO: 2 that have antimicrobial activity.

The present invention also relates to mutant polynucleotides containing at least one mutation in the SEQ ID NO: 1 sequence encoding the mature polypeptide, in which the mutant nucleotide sequence encodes a polypeptide that consists of amino acids 1-42 of SEQ ID NO: 2.

Methods used to isolate or clone a polynucleotide encoding a polypeptide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. Cloning of polynucleotides according to the invention from such genomic DNA can be carried out, for example, using the well-known polymerase chain reaction (PCR) or screening expression libraries by antibodies to identify cloned DNA fragments with common structural elements. See, for example, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification methods can be used, such as ligase chain reaction (LCR), ligation activated transcription (LAT), and nucleotide sequence amplification (NASBA). Polynucleotides can be cloned from a strain of Eurotium , or another or related organism, and thus, for example, they can be allelic or species variants of a polypeptide-encoding portion of a nucleotide sequence.

The present invention also relates to polynucleotides with nucleotide sequences that have a degree of identity with a mature polypeptide coding sequence of SEQ ID NO: 1 (i.e., with nucleotides 145-270) of at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, and most preferably at least 97% of the identity that encodes the active polypeptide.

Modification of the nucleotide sequence encoding the polypeptide according to the invention may be necessary for the synthesis of polypeptides essentially similar to the polypeptide. The term "substantially similar" to a polypeptide refers to non-natural forms of the polypeptide. These polypeptides may differ in some prescribed way from a polypeptide isolated from a natural source, for example, artificial variants that differ in specific activity, thermal stability, optimal pH value, or similar to them. The sequence of the variant can be constructed based on the nucleotide sequence represented as the polypeptide encoding region of SEQ ID NO: 1, for example, as its subsequence, and / or by introducing nucleotide substitutions that do not lead to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the use of codons of the host organism intended for the production of the enzyme, or by introducing nucleotide substitutions, which can lead to different amino acid sequences. For a general description of nucleotide substitutions, see, for example, Ford et al., 1991, Protein Expression and Purification 2: 95-107.

Specialists in this field it is clear that such replacements can be carried out outside the areas responsible for the function of the molecule, and still receive the active polypeptide. Amino acid residues necessary for the activity of a polypeptide encoded by an isolated polynucleotide according to the invention, and thus which are preferably not replaced, can be identified in accordance with methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g. Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter method, mutations are introduced into each positively charged residue of the molecule, and the resulting mutant molecules are analyzed for antimicrobial activity to identify amino acid residues responsible for the activity of the molecule. The substrate-enzyme interaction sites can also be determined by analysis of a three-dimensional structure, as determined by methods such as analysis by nuclear magnetic resonance, crystallography or photoaffinity labeling (see, for example, de Vos et al., 1992, Science 255: 306- 312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

The present invention also relates to isolated polynucleotides encoding a polypeptide according to the invention, which hybridize under conditions of low stringency, preferably under conditions of moderate stringency, more preferably under conditions of medium-high stringency, more preferably under conditions of high stringency, and most preferably under conditions of very high stringency (i ) with nucleotides 145-270 of the sequence SEQ ID NO: 1, (ii) with a cDNA sequence that is contained in nucleotides 1-270 of the sequence SEQ ID NO: 1, or (iii) with epyu complementary to (i) or (ii); or their allelic variants and subsequences (Sambrook et al., 1989, supra ), as defined herein.

The present invention also relates to isolated polynucleotides obtained by (a) hybridizing a DNA assembly under conditions of low, moderate, medium, high or very high stringency (i) with nucleotides 145-270 of the sequence SEQ ID NO: 1, (ii) with the cDNA sequence which is contained in nucleotides 1-270 of the sequence of SEQ ID NO: 1, or (iii) with a chain complementary to (i) or (ii); and (b) isolating a hybridized polynucleotide that encodes a polypeptide with antimicrobial activity.

Nucleic acid constructs

The present invention also relates to nucleic acid constructs comprising an isolated polynucleotide of the invention operably linked to one or more control sequences that regulates the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

An isolated polynucleotide encoding a polypeptide according to the invention can be processed in various ways to ensure expression of the polypeptide. Processing the polynucleotide sequence before embedding it in a vector may be desirable or necessary depending on the expression vector. Methods for modifying polynucleotide sequences using recombinant DNA methods are well known in the art.

The control sequence may be a suitable promoter sequence, a nucleotide sequence that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the invention. The promoter sequence contains transcriptional control sequences that express the polypeptide. A promoter can be any nucleotide sequence that exhibits transcriptional activity in a preferred host cell, including mutant, truncated, and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides, either homologous or heterologous to the host cell.

Examples of suitable promoters for transcription regulation of the nucleic acid constructs according to the invention, especially in a bacterial host cell, are the promoters obtained from lac- operon of E. coli, agarase gene (dagA) Streptomyces coelicolor, levansucrase gene (sacB) Bacillus subtilis, alpha gene amylases ( amyL ) of Bacillus licheniformis , maltogenic amylase gene ( amyM ) of Bacillus stearothermophilus , alpha-amylase gene ( amyQ ) of Bacillus amyloliquefaciens , penicillinase gene ( penP ) of Bacillus licheniformis , and bacillus subtilis xylase gene Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731) as well as the tac promoter (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25). In addition, promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242: 74-94; and in Sambrook et al., 1989, supra .

Examples of suitable promoters for regulating the transcription of nucleic acid constructs according to the invention in host cells in the form of micellar fungi are promoters derived from TAKA Aspergillus oryzae amylase, Rhizomucor miehei aspartic protease, Aspergillus niger alpha-amylase alpha-amylase, stable in relation to Aspergillus niger, glucoamylase (glaA) Aspergillus niger or Aspergillus awamori, lipase Rhizomucor miehei, alkaline protease Aspergillus oryzae, triosephosphate isomerase Aspergillus oryzae, acetamidase Aspergillus nidulans, amyloglucosidase Fusarium venenatum (WO 00/56900 ), Daria Fusarium venenatum (WO 00/56900), Quinn Fusarium venenatum (WO 00/56900), trypsin-like protease Fusarium oxysporum (WO 96/00787), beta-glucosidase Trichoderma reesei , Trichoderma lyase endogase , Trichoderma lyase II Trichoderma reesei, endoglucanase III Trichoderma reesei , endoglucanase IV Trichoderma reesei , endoglucanase V Trichoderma reesei , xylanase I Trichoderma reesei , xylanase II Trichoderma reesei , beta-xylosidase Trichoderma alfa promysylumidae Aspergillus niger and Aspergillus oryzae triosophosphatisomerase ); and their mutant, truncated and hybrid promoters.

The yeast host useful promoters are obtained from the genes for enolase (ENO-1) Saccharomyces cerevisiae, galactokinase (GAL1) Saccharomyces cerevisiae, alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP) Saccharomyces cerevisiae, triose phosphate isomerase (TPI) Saccharomyces cerevisiae, metallothionein ( CUP1 ) Saccharomyces cerevisiae and Saccharomyces cerevisiae 3-phosphoglycerate kinases . Other suitable promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.

The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by the host cell to complete transcription. The termination sequence is operably linked to the 3 ′ end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in a preferred host cell can be used in accordance with the present invention.

Preferred terminators for host cells are filamentous fungal amylase obtained from the genes TAKA Aspergillus oryzae, Aspergillus niger glucoamylase, antranilatsintetazy Aspergillus nidulans, alpha-glucosidase Aspergillus niger and trypsin-like protease Fusarium oxysporum.

Preferred terminators for yeast host cells are obtained from the genes for enolase Saccharomyces cerevisiae, cytochrome C (CYC1) Saccharomyces cerevisiae, and glyceraldehyde-3-phosphate dehydrogenase Saccharomyces cerevisiae. Other suitable terminators for yeast host cells are described by Romanos et al., 1992, supra .

The control sequence may also be a suitable leader sequence, an untranslated mRNA region that is important for translation of the host cell. The leader sequence is functionally linked to the 5'-end of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in a preferred host cell can be used in accordance with the present invention.

Preferred leader sequences for micellar fungal host cells are derived from Aspergillus oryzae TAKA amylase and Aspergillus nidulans triosophosphatisomerase genes.

Suitable leader sequences for yeast host cells are obtained from the genes for enolase (ENO-1) Saccharomyces cerevisiae, 3-phosphoglycerate kinase Saccharomyces cerevisiae, the alpha-factor of Saccharomyces cerevisiae, and alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP) Saccharomyces cerevisiae.

The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-end of the nucleotide sequence, and which, upon transcription, is recognized by the host cell as a signal to add polyadenosine residues to the transcribed mRNA. Any polyadenylation sequence that is functional in a preferred host cell can be used in accordance with the present invention.

Preferred polyadenylation sequences for host cells representing filamentous fungal amylase obtained from the genes TAKA Aspergillus oryzae, glucoamylase, Aspergillus niger, antranilatsintetazy Aspergillus nidulans, trypsin-like protease Fusarium oxysporum, and alpha-glucosidase Aspergillus niger.

Suitable polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.

The control sequence may also be a signal peptide-encoding region that encodes the amino acid sequence linked to the N-terminus of the polypeptide and directs the encoded polypeptide along the secretory pathway of the cell. The 5 ′ end of the coding sequence of the nucleotide sequence may initially comprise a signal peptide coding region that is naturally linked in the translational reading frame to a segment of the coding region that encodes a secreted polypeptide. Alternatively, the 5 ′ end of the coding sequence may comprise a signal peptide coding region that is foreign to the coding sequence. A foreign signal peptide coding region may be necessary when the coding sequence in nature does not contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to increase the secretion of the polypeptide. However, in accordance with the present invention, any signal peptide coding region can be used that directs the expressed polypeptide along the secretory pathway in the selected preferred host cell.

Effective signal peptide-encoding regions for bacterial host cells are signal-peptide-encoding regions derived from the genes for maltogenic amylase NCIB 11837, alpha-amylase Bacillus stearothermophilus , subtilisin Bacillus licheniformis , beta-lactamase Bacillus licheniformis , neutral protease ( nprT, nprT, nprT, nprT, Bacillus stearothermophilus and prsA Bacillus subtilis . Additional signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

Effective signal peptide coding portions to host cells which are filamentous fungi, are the signal peptide coding portions obtained from the genes for amylases TAKA Aspergillus oryzae, neutral amylase Aspergillus niger, glucoamylase, Aspergillus niger, aspartic protease Rhizomucor miehei, Cellulase Humicola insolens and lipase Humicola lanuginosa .

In a preferred aspect, the signal peptide encoding region is nucleotides 1-60 of the sequence SEQ ID NO: 1, which encode amino acids -48 to -29 of SEQ ID NO: 2.

Useful signal peptides for yeast host cells are obtained from the genes for the alpha-factor and Saccharomyces cerevisiae invertase Saccharomyces cerevisiae. Additional suitable signal peptide coding regions are described by Romanos et al., 1992, supra .

The control sequence may also be a propeptide encoding region that encodes the amino acid sequence located at the N-terminus of the polypeptide. The resulting polypeptide is known as a proenzyme or propolipeptide (or, in some cases, zymogen). The propolypeptide is typically inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolipeptide. The propeptide coding region can be obtained from the alkaline protease ( aprE ) genes of Bacillus subtilis , neutral protease ( nprT ) of Bacillus subtilis , Saccharomyces cerevisiae alpha factor, Rhizomucor miehei aspartic protease, and Myceliophthora thermophila laccase (WO 95/33836).

In a preferred aspect, the propeptide encoding region is nucleotides 61-144 of the sequence SEQ ID NO: 1, which encode amino acids -28 at -1 of SEQ ID NO: 2.

In the case where the signal peptide and propeptide portions are at the N-terminus of the polypeptide, the propeptide region is located near the N-terminus of the polypeptide, and the signal peptide region is located near the N-terminus of the propeptide.

It may also be necessary to add regulatory sequences that regulate the expression of the polypeptide associated with the growth of the host cell. Examples of regulatory systems are systems that lead to the on or off of gene expression in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac , tac, and trp operator systems. In yeast, the ADH2 system or the GAL1 system can be used. In micellar fungi, the TAKA alpha-amylase promoter, the Aspergillus niger glucoamylase promoter, and the Aspergillus oryzae glucoamylase promoter can be used as regulatory sequences. Other examples of regulatory sequences are sequences that provide for amplification of a gene. In eukaryotic systems, they include the dihydrofolate reductase gene, which amplifies in the presence of methotrexate, and metalloteonein genes, which amplify in the presence of heavy metals. In these cases, the nucleotide sequence encoding the polypeptide is functionally linked to a regulatory sequence.

Expression vectors

The present invention also relates to recombinant expression vectors containing a polynucleotide according to the invention, a promoter, and transcriptional and translational stop signals. The various nucleic acids and control sequences described above can be combined with each other to produce a recombinant expression vector, which may include one or more suitable restriction sites to allow insertion or substitution at such sites in the nucleotide sequence encoding the polypeptide. Alternatively, the nucleotide sequence of the invention can be expressed by embedding a nucleotide sequence or nucleic acid construct containing the sequence in an appropriate expression vector. When creating an expression vector, the coding sequence is positioned in the vector so that the coding sequence is operably linked to the corresponding sequences to control expression.

The recombinant expression vector may be any vector (for example, a plasmid or virus), which can be conveniently subjected to processes associated with recombinant DNA, and which can lead to the expression of the nucleotide sequence. The choice of a vector, as a rule, depends on the compatibility of the vector with the host cell into which the vector is introduced. Vectors can be linear or closed circular plasmids.

The vector may be an autonomously replicating vector, i.e. a vector that fully exists extrachromosomally, whose replication is independent of chromosome replication, for example, it may be a plasmid, extrachromosomal element, minichromosome, or artificial chromosome. The vector may contain any elements for self-replication. Alternatively, the vector may be a vector that, when introduced into a host cell, integrates into the genome and replicates together with the chromosome (s) into which it is embedded. Moreover, you can use a single vector or plasmid or two or more vectors or plasmids that together contain all of the DNA intended for introduction into the genome of the host cell, or transposon.

The vectors according to the invention preferably contain one or more selective markers that provide convenient selection of transformed cells. A selectable marker is a gene whose product provides resistance to biocides or viruses, resistance to heavy metals, prototrophy of auxotrophs, etc.

Examples of bacterial selective markers are dal genes from Bacillus subtilis or Bacillus licheniformis , or markers that confer antibiotic resistance, such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3. Selective markers for use in host cells that are micellar fungi include, but are not limited to, amdS (acetamidase), argB (ornithinecarbamoyltransferase), bar (phosphinotricin acetyltransferase), hph (hygromycin phosphotransferase ), nitride- d-gamma 5'-phosphate decarboxylase), sC ( sulfatadenyl transferase ) and trpC (anthranilate synthetase ), as well as their equivalents. Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar Streptomyces hygroscopicus gene.

The vectors according to the invention preferably contain element (s) that allow the incorporation of the vector into the genome of the host cell or autonomous replication of the vector in the cell regardless of the genome.

For insertion into the genome of a host cell, the basis of the vector may be a polynucleotide sequence encoding a polypeptide, or any other element of a vector for insertion into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences to direct integration through homologous recombination into the genome of the host cell at the exact position (s) on the chromosome (s). To increase the likelihood of being embedded in the exact position, the inserted elements should preferably contain a sufficient number of base pairs of nucleic acids, such as from 100 to 10,000 base pairs, preferably from 400 to 10,000 base pairs and most preferably from 800 to 10,000 base pairs, which are highly identity with the corresponding target sequence to increase the likelihood of homologous recombination. The inserted elements can be any sequence that is homologous to the target sequence in the genome of the host cell. Moreover, inline elements may be non-coding or coding nucleotide sequences. Alternatively, the vector can be inserted into the genome of the host cell through non-homologous recombination.

For autonomous replication, the vector may further comprise a replication origin, enabling the vector to autonomously replicate in the host cell of interest. The origin of replication can be any plasmid replicator that provides autonomous replication that functions in the cell. As used herein, the term “origin of replication” or “plasmid replicator” is defined as a nucleotide sequence that allows a plasmid or vector to replicate in vivo .

Examples of bacterial origin of replication are the replication origin of the plasmids pBR322, pUC19, pACYC177 and pACYC184, which provide replication in E. coli , and pUB110, pE194, pTA1060 and pAMβ1, which provide replication in Bacillus . Examples of replication origin for use in a yeast host cell are a 2 micron origin of replication, ARS1, ARS4, a combination of ARS1 and CEN3, and a combination of ARS4 and CEN6.

Examples of replication origin useful in micellar fungal cells are AMA1 and ANS1 (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic acids Research 15: 9163-9175; WO 00/24883) . Isolation of the AMA1 gene and the construction of plasmids or vectors containing the gene can be carried out in accordance with the methods described in WO 00/24883.

To increase the production of a gene product into the host cell, more than one copy of the polynucleotide of the invention can be introduced. An increase in the number of copies of the polynucleotide can be achieved by inserting at least one additional copy of the sequence into the genome of the host cell or by including the amplified selectable marker gene together with the polynucleotide, where the cells containing amplified copies of the selectable marker gene, and thus additional copies of the polynucleotide, can be selected by culturing cells in the presence of an appropriate selection substance.

The methods used to ligate the elements described above with the constructs of recombinant expression vectors according to the invention are well known to those skilled in the art (see, for example, Sambrook et al., 1989, supra ).

Host cells

The present invention also relates to recombinant host cells containing a polynucleotide according to the invention, which are preferably used for the recombinant production of polypeptides. A vector containing a polynucleotide according to the invention is introduced into the host cell so that the vector is maintained as an element integrated into the chromosome or as a self-replicating extrachromosomal vector as previously described. The term "host cell" includes any descendant of the original cell that is not identical to the original cell due to mutations that occur during replication. The choice of a host cell is highly dependent on the gene encoding the polypeptide and its source.

The host cell may be a unicellular microorganism, for example, a prokaryotic organism, or a multicellular microorganism, for example, a eukaryotic organism. Useful unicellular microorganisms are bacterial cells such as gram positive bacteria including, but not limited to, Bacillus cell, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis , Bacillus megaterium , Bacillus stearothermophilus , Bacillus subtilis and Bacillus thuringiensis ; or a Streptomyces cell, for example, Streptomyces lividans and Streptomyces murinus , or gram-negative bacteria, such as E. coli and Pseudomonas sp . In a preferred aspect, the bacterial host cell is a Bacillus lentus , Bacillus licheniformis , Bacillus stearothermophilus or Bacillus subtilis cell. In another preferred aspect, the Bacillus cell is an alkalophilic Bacillus cell.

The introduction of a vector into a bacterial host cell can, for example, be accomplished by transformation of a protoplast (see, for example, Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, for example, Young and Spizizin , 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742- 751), or conjugation (see, for example, Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).

A host cell may also be an eurotic cell, such as a mammalian, insect, plant or fungal cell.

In a preferred aspect, the host cell is a fungal cell. As used herein, “mushrooms” include Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al, In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK), as well as Oomycota (as cited in Hawksworth et al, 1995, supra , p. 171) and all mitospore fungi (Hawksworth et al, 1995, supra ).

In a more preferred aspect, the fungal host cell is a yeast cell. As used herein, “yeast” includes ascosporogenic yeast (Endomycetales), basidiosporogen yeast, and yeast belonging to imperfect fungi (Blastomycetes). Since yeast classification may change in the future, for the purposes of this invention, yeast should be determined as described in Biology and Activities of Yeast (Skinner, FA, Passmore, SM, and Davenport, RR, eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

In a more preferred aspect, the yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowia cell.

In a most preferred aspect, the yeast host cell is a Saccharomyces carlsbergensis , Saccharomyces cerevisiae , Saccharomyces diastaticus , Saccharomyces dougflasii , Saccharomyces kluyveri , Saccharomyces norbensis or Saccharomyces oviform cell . In another most preferred aspect, the yeast host cell is a Kluyveromyces lactis cell. In another most preferred aspect, the yeast host cell is a Yarrowia lipolytica cell.

In another more preferred aspect, the fungal host cell is a micellar fungal cell. “Micellar fungi” include all micellar forms of the Eumycota and Oomycota subgroups (as defined by Hawksworth et al, 1995, supra ). Micellar fungi are mainly characterized by a mycelium wall consisting of chitin, cellulose, glucan, chitosan, mannan and other complex polysaccharides. Vegetative growth occurs by lengthening the hypha, and carbon catabolism is obligate aerobic. In contrast, vegetative growth of yeast such as Saccharomyces cerevisiae occurs through budding of unicellular thallus, and carbon catabolism can be enzymatic.

In a more preferred aspect, the micellar fungal host cell is a cell of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coholus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Nephorms, Myocorms, Mycomorx, Myocoris, Myformora, Myocoris, Myformor Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma .

In a most preferred aspect, the micellar fungal host cell is Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae . In another most preferred aspect, the micellar fungal host cell is a cell of Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium fumarium frosporum negumium negrosumum Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides or Fusarium venenatum . In another most preferred aspect, the host cell belonging to the micellar fungi is a cell of the strain Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis cilipisriiserisriiserisorisorisori poryocriisori poriocriori pisocriori poryocriori hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Trametrichidae, tricorium trichomeria, tricorichi trichomeria, tricorichi tricium trichis, tricorium trichomeria Trichoderma viride .

The transformation of fungal cells can be carried out by a process including the formation of protoplasts, transformation of protoplasts and regeneration of the cell wall in a substantially known manner. Suitable methods for transforming Aspergillus and Trichoderma host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al, 1989, Gene 78: 147-156, and in WO 96/00787. Yeast can be transformed using the methods described by Becker and Guarente, In Abelson, JN and Simon, MI, editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al, 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.

Production methods

The present invention also relates to methods for producing a polypeptide according to the invention, comprising (a) culturing a cell which, in its wild-type form, is capable of producing a polypeptide under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide. Preferably, the cell is a cell of the genus Eurotium , and more preferably Eurotium amstelodami .

The present invention also relates to methods for producing a polypeptide according to the invention, comprising (a) culturing a host cell under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide.

The present invention also relates to methods for producing a polypeptide according to the invention, comprising (a) culturing a host cell under conditions conducive to the production of the polypeptide, where the host cell contains a mutant nucleotide sequence with at least one mutation in the mature polypeptide coding region of SEQ ID NO: 1 where the mutant nucleotide sequence encodes a polypeptide that consists of amino acids 1-42 of the sequence SEQ ID NO: 2, and (b) the selection of the polypeptide.

In the production methods of the invention, cells are cultured in a growth medium suitable for the production of a polypeptide using methods well known in the art. For example, a cell can be cultured by shaking flask cultivation, and small-scale or large-scale cultivation (including continuous, batch cultivation, fed culture or solid phase cultivation) in a laboratory or in industrial bioreactors, carried out in a suitable medium and under conditions that allow expression and / or peptide isolation. The cultivation is carried out in a suitable nutrient medium containing carbon and nitrogen sources and inorganic salts, using methods known in the art. Suitable media are available from commercial suppliers or may be obtained in accordance with published formulations (e.g., in the American Type Culture Collection catalogs). If the polypeptide is secreted into the culture medium, the polypeptide can be isolated directly from the medium. If the polypeptide is not secreted, it can be isolated from cell lysates.

Polypeptides can be detected using methods known in the art that are specific for the polypeptides. These detection methods may include the use of specific antibodies. For example, an antimicrobial activity assay can be used to determine the activity of a polypeptide, as described herein.

The resulting polypeptide can be isolated using methods known in the art. For example, a polypeptide can be isolated from a culture medium by conventional methods, including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

The polypeptides of the invention can be purified by various methods known in the art, including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic chromatography, chromatofocusing and gel filtration), electrophoretic methods (e.g. preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Plants

The present invention also relates to a transgenic plant, part of a plant, or plant cell that has been transformed with a nucleotide sequence encoding a polypeptide with antimicrobial activity according to the invention in order to express and produce a polypeptide in isolable amounts. The polypeptide can be isolated from a plant or part of a plant. Alternatively, a plant or part of a plant containing a recombinant polypeptide can be used by itself to improve the quality of food or feed, for example, to improve nutritional value, taste and rheological properties or to destroy the anti-nutritional factor.

The transgenic plant may be dicotyledonous (dicot) or monocotyledonous (monocot). Examples of monocotyledonous plants are grasses such as meadow bluegrass (Bluegrass, Poa), forage grasses such as Festuca, Lolium, temperate grasses such as Agrostis, and cereals such as wheat, oats, rye, barley, rice , sorghum and maize (corn).

Examples of dicotyledonous plants are tobacco, legumes such as lupins, potatoes, sugar beets, peas, beans and soybeans, and cruciferous plants (Brassicaceae family) such as cauliflower, rapeseed, and the closely related model organism Arabidopsis thaliana .

Examples of plant parts are the stem, callus, leaves, root, fruits, seeds and tubers, as well as the individual tissues forming these parts, for example, the epidermis, mesophyll, parenchyma, vascular tissues, meristems. Particular sections of plant cells, such as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and the cytoplasm, are also considered as parts of plants. Moreover, any plant cell, regardless of the source tissue, is considered as part of the plant. Similarly, parts of plants, such as specific tissues and cells isolated to facilitate use according to the invention, are also considered as parts of a plant, for example, an embryo, endosperm, aleuron and seed coat.

Also included in the scope of the present invention is the progeny of such plants, plant parts, and plant cells.

A transgenic plant or plant cell expressing a polypeptide according to the invention can be obtained in accordance with methods known in the art. Briefly, a plant or plant cell is obtained by embedding one or more expression constructs encoding a polypeptide of the invention in the genome of a host plant and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.

It is advisable that the expression construct is a nucleic acid construct that contains a polynucleotide encoding a polypeptide according to the invention, operably linked to the appropriate regulatory sequences necessary for expression of the nucleotide sequence in a preferred plant or part of a plant. Moreover, the expression construct may contain a selectable marker suitable for identifying host cells into which the expression construct has been inserted, and the DNA sequences necessary to introduce the construct into the plant of interest (the latter depend on the method used to introduce DNA).

The choice of regulatory sequences, such as promoter and terminator sequences, and optionally signal or transport sequences, is determined, for example, based on when, where and how to express the polypeptide. For example, the expression of a gene encoding a polypeptide of the invention may be constitutive or inducible, or may be developmentally specific for a stage or tissue, and the gene product may be directed to a specific tissue or part of a plant, such as seeds or leaves. Regulatory sequences are described, for example, by Tague et al., 1988, Plant Physiology 86: 506.

For constitutive expression, the 35S-CaMV promoter, the promoter of ubiquitin maize 1 and actin rice 1 can be used (Franck et al., 1980, Cell 21: 285-294, Christensen et al., 1992, Plant Mo. Biol. 18: 675-689 ; Zhang et al., 1991, Plant Cell 3: 1155-1165). The organ specific promoters may be, for example, a promoter from storage tissues such as seeds, potato tubers and fruits (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from metabolizing tissues, such as meristems (Ito et al., 1994, Plant Mol. Biol. 24: 863-878), a seed-specific promoter, such as a promoter for glutelin, prolamine, globulin or rice albumin (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 gene and an unknown seed protein from Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152: 708-711), a base protein promoter s seed oil (Chen et al., 1998, Plant and Cell Physiology 39: 935-941), a promoter of the napA storage protein from Brassica napus , or any other seed specific promoter known in the art, for example, as described in WO 91/14772. Moreover, the promoter may be a leaf-specific promoter, such as the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant Physiology 102: 991-1000), the promoter of the chlorella virus adenine methyl transferase gene (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), or a damage-induced promoter, such as the potato pin2 promoter (Xu et al. 1993, Plant Molecular Biology 22: 573-588). Similarly, a promoter can be induced by abiotic effects, such as temperature, drought or a change in salt content, or it can be induced by the use of exogenous substances that activate the promoter, for example, ethanol, estrogen, plant hormones, such as ethylene, abscisic acid and gibberellic acid , and heavy metals.

Also, in order to achieve higher expression of the polypeptide of the invention in a plant, a promoter enhancing element can be used. For example, a promoter enhancing element may be an intron that is located between the promoter and the nucleotide sequence encoding the polypeptide of the invention. For example, Xu et al., 1993, supra , describes the use of the first intron of the rice actin 1 gene to increase expression.

The selectable marker gene and any other parts of the expression construct can be selected from those available in the art.

The nucleic acid construct is inserted into the plant genome in accordance with conventional methods known in the art, including Agrobacterium mediated transformation, virus mediated transformation, microinjection, particle bombardment, biolistic transformation and electroporation (Gasser et al., 1990, Science 244: 1293; Potrykus 1990, Bio / Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).

Currently, Agrobacterium tumefaciens- mediated gene transfer is the preferred method for producing transgenic dicotyledons (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38) and can be used to transform monocotyledons, although often for these plants use other methods of transformation. The currently preferred method for producing transgenic monocotyledons is particle bombardment (microscopic particles of gold or tungsten coated with DNA for transformation) of germ calluses or developing embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio / Technology 10: 667-674). An alternative method for monocotyledonous transformation is based on protoplast transformation as described by Omirulleh et al., 1993, Plant Molecular Biology 21: 415-428.

After transformation, transformants with an integrated expression construct are selected and regenerated into whole plants in accordance with methods well known in the art. Often, the transformation process is designed to selectively remove the genes that are being selected, either during regeneration or in subsequent generations, using, for example, co-transformation with two separate T-DNA constructs or a site-specific excision of the gene that is being selected using specific recombinase.

The present invention also relates to methods for producing a polypeptide according to the invention, comprising (a) cultivating a transgenic plant or plant cell containing a polynucleotide encoding a polypeptide with antimicrobial activity according to the invention, under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide.

Songs

The present invention also relates to compositions, such as pharmaceutical compositions comprising a polypeptide of the invention. Preferably, the compositions are enriched in such a polypeptide. The term "enriched" indicates that the antimicrobial activity of the composition is increased, for example, with an enrichment factor of 1.1.

In addition, the compositions may contain another pharmaceutically active substance, such as an additional biocidal substance, such as another antimicrobial polypeptide exhibiting antimicrobial activity, as defined above. The biocidal substance may be an antibiotic known in the art. Classes of antibiotics include penicillins, for example, penicillin G, penicillin V, methicillin, oxycillin, carbenicillin, nafcillin, ampicillin, etc .; penicillins in combination with beta-lactamase inhibitors, cephalosporins, for example, cefaclor, cefazolin, cefuroxime, moxalactam, etc .; carbapenems; monobactams; aminoglycosides; tetracyclines; macrolides; lincomycins; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; vancomycin; etc. The biocidal substance may also be an antimicrobial substance, including, polyenes, for example, amphotericin B, nystatin; 5-flucosine; and azoles, for example miconazole, ketoconazole, itraconazole and fluconazole.

In one embodiment, the biocidal agent is a non-enzymatic chemical. In another embodiment, the biocidal substance is a non-polypeptide chemical.

Compositions may contain a suitable carrier. The compositions may also contain a suitable delivery vehicle capable of delivering the antimicrobial polypeptides of the invention to the desired region using the compositions as a medicine.

Polypeptide compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or dry composition. For example, the composition of the polypeptide may be in the form of a granulate or microgranulate. The polypeptide to be included in the composition can be stabilized in accordance with methods known in the art.

Examples of compositions of the polypeptide according to the invention are presented below. The dose of the composition of the polypeptide according to the invention and other conditions of use of the composition can be determined based on methods known in the art.

Methods and application

The present invention also relates to methods of using polypeptides with antimicrobial activity. Antimicrobial polypeptides are generally suitable in any locus susceptible to infection by bacteria, fungi, yeast or algae. As a rule, foci are located in water systems, such as water cooling systems, water for rinsing laundry, oil systems, such as cutting oils, lubricants, the oil industry, etc., where microorganisms must be destroyed or where they growth must be controlled. However, the present invention can also be applied in all applications for which known antimicrobial compositions are suitable, such as protecting wood, latex, adhesive, glue, paper, cardboard, textiles, leather, plastics, sealing compounds and feed.

Other uses include foods, drinks, cosmetics, such as lotions, creams, gels, ointments, soaps, shampoos, hair conditioners, antiperspirants, deodorants, mouthwashes, contact lens products, or food ingredients.

Thus, the antimicrobial polypeptides according to the invention can be suitable as disinfectants, for example, for the treatment of infections of the eye or oral cavity, skin infections; in antiperspirants or deodorants; for cleaning and disinfecting contact lenses and teeth (oral care).

It is generally contemplated that the antimicrobial polypeptides of the invention are suitable for cleaning, disinfecting, or inhibiting the growth of microbes on the surface. Examples of surfaces with which the antimicrobial polypeptides can preferably be contacted according to the invention are surfaces of technological equipment used, for example, dairy plants, chemical or pharmaceutical plants, water sanitation systems, oil refineries, paper mills, water treatment plants and tower coolers. The antimicrobial polypeptides of the invention should be used in an amount that is effective for cleaning, disinfecting, or inhibiting microbial growth on a surface of interest.

The antimicrobial polypeptides of the invention can also be used to clean surfaces and kitchen utensils in food processing plants and in any premises where food is manufactured or served, such as hospitals, nursing homes and restaurants.

They can also be used as a preservative or disinfectant in water-based paints.

This invention also relates to the use of an antimicrobial polypeptide or composition according to the invention as a medicine. In addition, the antimicrobial polypeptide or composition according to the invention can also be used for the manufacture of a medicament for controlling or controlling microorganisms, such as fungi-related organisms or bacteria, preferably gram-positive bacteria.

The composition and antimicrobial polypeptide according to the invention can be used as an antimicrobial veterinary agent or a therapeutic or prophylactic agent for humans. Thus, the composition and antimicrobial polypeptide according to the invention can be used to obtain veterinary drugs or drugs or prophylactic agents for humans to treat microbial infections, such as bacterial or fungal infections, preferably infections by gram-positive bacteria. In particular, microbial infections may be associated with lung diseases, including but not limited to tuberculosis, pneumonia and cystic fibrosis; and sexually transmitted diseases, including but not limited to gonorrhea and chlamydia.

The composition according to the invention contains an effective amount of an antimicrobial polypeptide according to the invention.

As used herein, the term “effective amount” is intended to mean the amount of antimicrobial polypeptides of the invention that is sufficient to inhibit the growth of microorganisms of interest.

This invention also relates to compositions for healing wounds or products, such as support dressings, medical devices, such as catheters, and, in addition, to anti-dandruff hair products such as shampoos.

The antimicrobial polypeptide compositions of the invention are administered to a host suffering from or predisposed to a microbial infection. The introduction may be local, localized or systemic depending on the particular microorganism, preferably it is localized. Typically, the dose of the antimicrobial polypeptides according to the invention is sufficient to reduce the number of microbes with the destruction of at least about 50%, usually at least 1 order, and possibly 2 or more orders. The compounds of the invention are administered in a dosage that reduces the number of microbes while minimizing side effects. It is believed that for in vivo use, the composition is prepared and used under the guidance of a physician. The antimicrobial polypeptides of the invention are particularly suitable for killing gram-negative bacteria, including Pseudomonas aeruginosa and Chlamydia trachomatis ; and gram-positive bacteria, including streptococci, such as Streptococcus pneumonia , S. uberis , S. hyointestinalis , S. pyogenes or agalactiae ; and staphylococci, such as Staphylococcus aureus , S. epidermidis , S. simulans , S. xylosus , S. carnosus .

The antimicrobial polypeptide compositions of the invention can be administered to a host suffering from a microbial infection of the lungs or predisposed to a microbial infection of the lungs, such as pneumonia; or a microbial wound infection, such as a bacterial wound infection.

The antimicrobial polypeptides of the invention can also be administered to a host suffering from a skin infection or predisposed to a skin infection, such as acne, atopic dermatitis or seborrheic dermatitis; preferably, the skin infection is a bacterial infection of the skin, for example, caused by Staphylococcus epidermidis , Staphylococcus aureus , Propionibactehum acnes , Pityrosporum ovale or Malassezia furfur .

The antimicrobial polypeptides according to the invention are also suitable for compositions for the destruction of microbes in vitro , in particular when it is undesirable to use many common antibiotics. For example, the antimicrobial polypeptides of the invention can be added to food preparations for animals and / or humans; or they can be included as additives in in vitro cell cultures to prevent overgrowth of microbes in tissue culture.

The sensitivity of a particular microbe to destruction by the antimicrobial polypeptides according to the invention can be determined by in vitro analysis, as described in detail in the experimental section. Typically, a microbial culture is combined with an antimicrobial polypeptide in various concentrations for a period of time sufficient to provide protein exposure, typically from about one hour to one day. Then count the number of viable microbes and determine the level of death.

Microbes of interest include, but are not limited to, gram-negative bacteria, for example: Citrobacter sp .; Enterobacter sp .; Escherichia sp ., For example, E. coli ; Klebsiella sp .; Morganella sp .; Proteus sp .; Providencia sp .; Salmonella sp ., E.g. S. typhi , S. typhimurium ; Serratia sp .; Shigella sp .; Pseudomonas sp ., E.g. P. aeruginosa ; Yersinia sp ., E.g. Y. pestis , Y. pseudotuberculosis , Y. enterocolitica ; Franciscella sp .; Pasturella sp .; Vibrio sp ., E.g. V. cholerae , V. parahemolyticus; Campylobacter sp., E.g. C. jejuni; Haemophilus sp., E.g. H. influenzae, H. ducreyi; Bordetella sp., E.g. B. pertussis, B. bronchiseptica, B. parapertussis; Brucella sp., Neisseria sp., E.g. N. gonorrhoeae, N. meningitides, etc. Other bacteria of interest include Legionella sp ., For example L. pneumophila; Listeria sp., E.g. L. monocytogenes; Mycoplasma sp., E.g. M. hominis, M. pneumoniae; Mycobacterium sp., E.g. M. tuberculosis, M. leprae; Treponema sp., E.g. T. pallidum; Borrelia sp., E.g. B. burgdorferi; Leptospirae sp .; Rickettsia sp ., E.g. R. rickettsii, R. typhi; Chlamydia sp., E.g. C. trachomatis, C. pneumoniae, C. psittaci; Helicobacter sp., E.g. H. pylori , etc.

Non-bacterial pathogens of interest include pathogens of fungi and unicellular, for example, Plasmodia sp ., For example P. falciparum, Trypanosoma sp., For example T. brucei; shistosomes; Entaemoeba sp., Cryptococcus sp., Candida sp., E.g. C. albicans ; etc.

Various administration methods may be used. The composition of the polypeptide can be administered orally or can be injected intravenously, subcutaneously, peritoneally, by aerosol, ophthalmically, into the bladder, topically, etc. For example, methods of administration by inhalation are well known in the art. The dosage of the therapeutic composition varies widely depending on the particular antimicrobial polypeptide to be administered, the nature of the disease, frequency of administration, route of administration, excretion of the agent from the host, and the like. The initial dose may be larger with subsequent lower maintenance doses. The dose can be administered infrequently, once a week or once every two weeks, or it can be divided into smaller doses and administered once or several times a day, twice a week, etc. to maintain an effective dosage level. In many cases, a higher dose is required for oral administration than for intravenous administration. Amide bonds, as well as the C- and N-ends, can be modified for higher stability when administered orally. For example, the C-terminus may be amidated.

Compositions

The compounds of the invention may be included in various formulations for therapeutic administration. More specifically, the compounds of the invention can be formulated into pharmaceutical compositions by combining with appropriate pharmaceutically acceptable carriers or diluents, and they can be formulated in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, creams , foams, solutions, suppositories, injections, inhalants, gels, microspheres, lotions and aerosols. Essentially, the administration of the compounds can be carried out in various ways, including oral administration, administration to the mucous membrane of the cheek, rectal parenteral, intraperitoneal, intradermal, transdermal, intratracheal, etc. administration. The antimicrobial polypeptides according to the invention after administration can be systemic or can be localized through the use of an implant or other composition that acts to delay the active dose in the area of implantation.

In one embodiment, the topical composition contains a chelating agent that reduces the effective concentration of divalent cations, in particular calcium and magnesium. For example, agents such as citrate, EGTA or EDTA may be included in the composition, where citrate is preferred. The concentration of citrate, as a rule, is approximately from 1 to 10 mm.

The compounds according to the invention can be administered separately, in combination with each other, or they can be used in combination with other known compounds (for example, perforin, anti-inflammatory drugs, antibiotics, etc.). In pharmaceutical dosage forms, the compounds may be administered in the form of their pharmaceutically acceptable salts. The following methods and excipients are illustrative only and in no way limiting.

For oral preparations, the compounds can be used alone or in combination with appropriate additional substances for the manufacture of tablets, powders, granules or capsules, for example, with conventional additional substances, such as lactose, mannitol, corn starch or potato starch; with binders such as crystalline cellulose, cellulose derivatives, gum arabic, corn starch or gelatins; with disintegrating agents such as corn starch, potato starch or sodium carboxymethyl cellulose; with lubricants such as talc or magnesium stearate; and if necessary, with diluents, buffers, wetting agents, preservatives and flavors.

The compounds can be formulated for injection by dissolving, suspending or emulsifying them in an aqueous or non-aqueous solvent such as vegetable oil or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and, if necessary, with conventional additives, such as solubilizers, isotonic substances, suspending agents, emulsifiers, stabilizers and preservatives.

The compounds can be used in an aerosol formulation to be administered by inhalation. The compounds of the invention can be formulated in pressurized acceptable spraying agents, such as dichlorodifluoromethane, propane, nitrogen, and the like.

The compounds can be used as lotions, for example, to prevent infection of burns, through formulations with conventional adjuvants such as solubilizers, isotonic substances, suspending agents, emulsifiers, stabilizers and preservatives.

Moreover, the compounds can be prepared in suppositories by mixing with a variety of bases, such as emulsifying bases or water soluble bases. The compounds of the invention can be administered rectally with a suppository. A suppository may include a carrier, such as cocoa butter, carboax, and polyethylene glycols that melt at body temperature, but which solidify at room temperature.

Unit dosage forms for oral or rectal administration, such as syrups, elixirs and suspensions, can be formulated if each dosage unit, for example, a teaspoon, tablespoon, tablet or suppository, contains a predetermined amount of a composition containing one or more compounds of the invention. Similarly, unit dosage forms for injection or intravenous administration may contain the compound of the invention in the composition as a solution in sterile water, normal saline, or another pharmaceutically acceptable carrier.

Continuous release implants are well known in the art. Implants make up as microspheres, plates, etc. with biologically degradable polymers. For example, polymers of lactic acid and / or glycolic acid form a degradable polymer that is well tolerated by the host. An implant containing the antimicrobial polypeptides according to the invention is placed next to the infection area so that the local concentration of the active substance is increased relative to the rest of the body.

As used herein, the term “unit dosage form” refers to physically disintegrated units suitable as a unit dose for an animal or human subject, where each unit contains a predetermined amount of the compounds of the invention in a calculated amount sufficient to produce the desired effect, together with a pharmaceutically acceptable diluent, carrier or substance for delivery. The characteristics of the unit dosage forms according to the invention depend on the particular compound used and the intended effect, and the pharmacodynamics associated with the compound, in the host organism. Pharmaceutically acceptable excipients, such as a delivery substance, adjuvants, carriers or diluents, are generally available. Moreover, pharmaceutically acceptable excipients, such as pH-changing and buffering agents, tonicity-changing agents, stabilizers, moisturizing agents, and the like, are generally available.

Typical dosages for systemic administration are in the range of 0.1 pg to 100 milligrams per kg of subject weight per administration. A typical dosage may be one tablet, administered two to six times a day, or one capsule or sustained release tablet, administered once a day, and having a proportionally higher content of the active ingredient. The effect of delayed release can be achieved using capsule components that dissolve at different pH values, using capsules from which release occurs slowly under osmotic pressure, or by any other known controlled release methods.

Those skilled in the art will recognize that dose levels may vary depending on the particular compound, the severity of the symptoms, and the sensitivity of the subject to side effects. Some of the specific compounds are more effective than others. Preferred dosages of this compound will be readily determined by those skilled in the art in a variety of ways. Preferred methods are to determine the physiological effectiveness of the compound.

The use of liposomes as a carrier for delivery is one of the methods of interest. Liposomes combine with the cells of the area designated for exposure and deliver the contents of their lumen intracellularly. The contact of liposomes with cells is maintained for a sufficient period of time for fusion using various methods of maintaining contact, such as localization, binders, and the like. In one aspect of this invention, liposomes are designed to be aerosolized for pulmonary administration. Liposomes can be made with purified proteins or peptides that fuse membranes, such as Sendai virus or influenza virus, etc. Lipids can be any suitable combination of known liposome forming lipids, including cationic or zwitterionic lipids, such as phosphatidylcholine. The remaining lipids are usually neutral or acidic lipids, such as cholesterol, phosphatidylserine, phosphatidylglycerol and the like.

To obtain liposomes, the methods described by Kato et al. (1991) J. Biol. Chem. 266: 3361. Briefly, the lipids and the cavity composition containing the peptides are combined in an appropriate aqueous medium, more conveniently, in a salt medium, where the total solids content is in the range of about 1-10 percent by weight. After vigorous stirring for short periods of approximately 5-60 seconds, the tube is placed in a warm water bath at approximately 25-40 ° C, and this cycle is repeated approximately 5-10 times. The composition is then sonicated for a suitable period of time, typically about 1-10 seconds, and, in addition, it can be mixed by shaking. Then the volume is increased by adding an aqueous medium, as a rule, increasing the volume by about 1-2 times, and then shake and cool. This method allows the incorporation of high molecular weight molecules into the cavity.

Compounds with other active agents

For use in the methods discussed, the antimicrobial polypeptides according to the invention can be formulated with other pharmaceutically active agents, in particular with other antimicrobial agents. Other agents of interest include a wide variety of antibiotics known in the art. Classes of antibiotics include penicillins, for example, penicillin G, penicillin V, methicillin, oxycillin, carbenicillin, nafcillin, ampicillin, etc .; penicillins in combination with beta-lactamase inhibitors, cephalosporins, for example, cefaclor, cefazolin, cefuroxime, moxalactam, etc .; carbapenems; monobactams; aminoglycosides; tetracyclines; macrolides; lincomycins; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; vancomycin; etc.

Antimicrobial agents are also suitable, including polyenes, for example, amphotericin B, nystatin; 5-flucosine; and azoles, for example miconazole, ketoconazole, itraconazole and fluconazole. Anti-TB drugs include isoniazid, ethambutol, streptomycin and rifampin. Also, the composition of the antimicrobial polypeptides according to the invention can include cytokines, for example, interferon gamma, tumor necrosis factor alpha, interleukin 12, etc.

In vitro synthesis

The antimicrobial peptides according to the invention can be obtained by in vitro synthesis using conventional methods known in the art. Various commercial synthesis devices are available, for example, automated synthesis devices from Applied Biosystems Inc., Beckman, etc. By using synthesis devices, natural amino acids can be replaced by unnatural amino acids, in particular D-isomers (or D-forms), for example, D-alanine and D-isoleucine, diastereoisomers, side chains with different lengths or functionality, and the like. The specific sequence and method of preparation is determined based on convenience, economic calculations, required purity, etc.

Chemical bonding can be carried out in various peptides or proteins containing functional groups suitable for the formation of bonds, such as amino groups for the formation of an amide or a substituted amine, for example, reductive amination, thiol groups for the formation of a thioether or disulfide, carboxyl groups for the formation of an amide, etc. P.

If necessary, various groups can be introduced into the peptide during the synthesis or expression process, which provide binding to other molecules or to the surface. Thus, cysteines can be used to produce thioesters, histidines for binding to a complex of metal ions, carboxyl groups for the formation of amides or esters, amino groups for the formation of amides, etc. Polypeptides can also be isolated and purified in accordance with conventional recombinant synthesis methods. You can obtain a lysate of the expressing host and the lysate is purified using HPLC, gel filtration, gel electrophoresis, affinity chromatography, or other purification methods. Basically, the compositions used contain at least 20% by weight of the desired product, more often at least about 75% by weight, preferably at least about 95% by weight, and for therapeutic purposes, usually at least about 99.5% by weight, relative to the impurities associated with the method of obtaining the product and its purification. As a rule, percentages are based on the total protein content.

Pet food

The present invention also relates to methods of using polypeptides with antimicrobial activity in animal feed, as well as to feed compositions and feed additives containing the antimicrobial polypeptides of the invention.

The term animal includes all animals, including humans. Examples of animals are non-ruminant animals and ruminants such as cows, sheep and horses. In a specific embodiment, the animal is a non-ruminant animal. Non-ruminant animals include animals with a single-chamber stomach, for example, wild boars or pigs (including, but not limited to, piglets, pigs for rearing and pigs); poultry such as turkeys and chickens (including, but not limited to, broiler chickens, laying hens); young calves; and fish (including, but not limited to, salmon).

The term feed or feed composition means any compound, preparation, mixture, or composition suitable or intended for consumption by an animal.

The use of an antimicrobial polypeptide in accordance with this invention may be fed to an animal before, after or simultaneously with food. The latter is preferred.

In a specific embodiment, the antimicrobial polypeptide in the form in which it is added to the feed, or when included in the feed supplement, is strictly defined. Strictly defined means that the antimicrobial polypeptide preparation is at least 50% pure as determined by gel filtration (see example 12 in WO 01/58275). In another specific embodiment, the antimicrobial polypeptide preparation is at least 60, 70, 80, 85, 88, 90, 92, 94, or at least 95% pure as determined by this method.

A strictly defined antimicrobial polypeptide preparation is preferred. For example, it is much simpler to meter exactly the antimicrobial polypeptide in the feed, which essentially does not contain other interfering or contaminating antimicrobial polypeptides. The term dosage accurately refers, in particular, to the desire to obtain uniform and consistent results, and to the ability to optimize dosage based on the desired effect.

For use in animal feed, however, there is no need for the antimicrobial polypeptide to be so pure; it may, for example, include other enzymes, in which case it may be called an antimicrobial polypeptide preparation.

The antimicrobial polypeptide can be (a) added directly to the feed (or used directly in the processing of plant proteins), or (b) it can be used to obtain one or more intermediate compositions, such as feed additives or pre-mixes, which are then added to the feed (or used during processing). The degree of purity described above refers to the purity of the starting preparation of an antimicrobial polypeptide, irrespective of the use in accordance with (a) or (b) mentioned above.

Antimicrobial polypeptide preparations with a degree of purity of this order, in particular, can be obtained using recombinant production methods, while they are not so easy to obtain and they also undergo higher changes from batch to paria in the preparation of the antimicrobial polypeptide by traditional cultivation methods.

Such an antimicrobial polypeptide preparation can, of course, be mixed with other enzymes.

As used in the present description, the term plant proteins refers to any compound, composition, preparation or mixture that includes at least one protein derived from a plant or the source of which is a plant, including modified proteins and protein derivatives. In specific embodiments, the implementation of the protein content in vegetable proteins is at least 10, 20, 30, 40, 50, or 60% (w / w).

Plant proteins can be obtained from plant protein sources, such as legumes and grains, for example, from materials from plants of the families Fabaceae ( Leguminosae ), Cruciferaceae , Chenopodiaceae , and Poaceae , such as soy flour, lupine flour and rapeseed flour. In a specific embodiment, the vegetable protein source is a substance from one or more plants of the Fabaceae family , for example soy, lupine, peas or beans.

In another specific embodiment, the vegetable protein source is material from one or more plants of the Chenopodiaceae family, for example, beets, sugar beets, spinach or quinoa.

Other examples of vegetable protein sources are canola and cabbage.

Soy is a preferred source of vegetable protein.

Other examples of vegetable protein sources are cereals such as barley, wheat, rye, oats, maize (corn), rice and sorghum.

The antimicrobial polypeptide can be added to the food in any form, either as a relatively pure antimicrobial polypeptide, or in a mixture with other components intended to be added to animal feed, i.e. in the form of additives for animal feed, such as the so-called pre-mixes for animal feed.

In an additional aspect, the present invention relates to compositions for use in animal feed, such as animal feed, and in animal feed additives, for example, in premixes.

In addition to the antimicrobial polypeptide according to the invention, the animal feed additives according to the invention contain at least one fat-soluble vitamin, and / or at least one water-soluble vitamin, and / or at least one microelement, and / or at least one macroelement .

In addition, optionally, additional feed ingredients are colorants, aromatic compounds, stabilizers, and / or at least one other enzyme selected from phytases EC 3.1.3.8 or 3.1.3.26; xylanase EC 3.2.1.8; galactanase EC 3.2.1.89; and / or beta-glucanases EC 3.2.1.4.

In a specific embodiment, these other enzymes are strictly defined (as defined above for antimicrobial polypeptide preparations).

Examples of other antimicrobial peptides (AMPs) are CAP18, leukocin A, tritrpticin, protegrin-1, thanatin, defensin, ovispirin such as novispirin (Robert Lehrer, 2000), and variants or fragments thereof that retain antimicrobial activity.

Examples of other antifungal polypeptides (AFPs) are Aspergillus giganteus and Aspergillus niger peptides, as well as their variants and fragments that retain antifungal activity, as described in WO 94/01459 and WO 02/090384.

As a rule, fat-soluble and water-soluble vitamins, as well as trace elements, form part of the so-called pre-mixture intended to be added to the feed, while macronutrients are usually added separately to the feed. Any of these types of compositions, if supplemented with an antimicrobial polypeptide according to the invention, is an additive in animal feed according to the invention.

In a specific embodiment, the additive in animal feed according to the invention is intended to be included (or provided that it should be included) in animal diets or in food at a level of from 0.01 to 10.0%; more specifically from 0.05 to 5.0%; or from 0.2 to 1.0% (% means g additives per 100 g of feed). This is particularly true for pre-mixes.

The following components are a non-exclusive list of examples of these components:

Examples of fat-soluble vitamins are vitamin A, vitamin D3, vitamin E and vitamin K, for example, vitamin K3.

Examples of water soluble vitamins are vitamin B12, biotin and choline, vitamin B1, vitamin B2, vitamin B6, niacin, folic acid, and pantothenate, for example, Ca-D pantothenate.

Examples of trace elements are magnesium, zinc, iron, copper, iodine, selenium and cobalt.

Examples of macronutrients are calcium, phosphorus and sodium.

The nutritional requirements for these components (illustrated for poultry and piglets / pigs) are presented in table A of WO 01/58275. By nutritional needs is meant that these components must be present in the diet at the indicated concentrations.

Alternatively, the animal feed additive according to the invention contains at least one of the individual components indicated in table WO 01/58275. At least one means any of, one or more of, one, or two, or three, or four, and so on up to all thirteen or up to all fifteen separate components. More specifically, this at least one separate component is included in the additive according to the invention in such an amount as to obtain a feed concentration in the range indicated in column four, or in column five, or in column six of table A.

The present invention also relates to animal feed compositions. Animal feed compositions or diets are relatively high in protein. Poultry or pig diets can be characterized as indicated in table B of WO 01/58275, columns 2-3. Fish diets can be characterized as indicated in column 4 of this table B. Moreover, such fish diets typically have a crude fat content of 200-310 g / kg. The animal feed composition in accordance with this invention has a crude protein content of 50-800 g / kg, and furthermore contains at least one antimicrobial polypeptide as claimed in this application.

Moreover, or alternatively (the crude protein content indicated above), the animal feed composition according to the invention has a metabolic energy content of 10-30 MJ / kg; and / or a calcium content of 0.1-200 g / kg; and / or free phosphorus content of 0.1-200 g / kg; and / or methionine content of 0.1-100 g / kg; and / or methionine plus cysteine 0.1-150 g / kg; and / or a lysine content of 0.5-50 g / kg.

In specific embodiments, the metabolic energy, crude protein, calcium, phosphorus, methionine, methionine plus cysteine, and / or lysine content is in any of ranges 2, 3, 4, or 5 in table B of WO 01/58275 (R. 2-5 )

The crude protein is calculated as nitrogen (N) times 6.25, i.e. Crude protein (g / kg) = N (g / kg) × 6.25. The nitrogen content is determined by the method of Kjeldahl (A.O.A.C. 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).

Metabolic energy can be calculated from NRC Nutrient requirements in swine, ninth revised edition 1988, subcommittee on swine nutrition, committee on animal nutrition, board of agriculture, national research council. National Academy Press, Washington, D. C., pp. 2-6, and the European Table of Energy Values for Poultry Feed-stuffs, Spelderholt center for poultry research and extension, 7361 DA Beekbergen, The Netherlands. Grafisch bedrijf Ponsen & looijen bv, Wageningen. ISBN 90-71463-12-5.

The content of calcium, free phosphorus and amino acids in the total diets of animals in the diet is calculated on the basis of food tables, such as Veevoedertabel 1997, gegevens over chemische samenstelling, verteerbaarheid en voederwaarde van voedermiddelen, Central Veevoederbureau, Runderweg 6, 8219 pk Lelystad. ISBN 90-72839-13-7.

In a particular embodiment, the animal feed composition of the invention comprises at least one vegetable protein or protein source as defined above.

In further specific embodiments, the animal feed composition of the invention comprises 0-80% maize; and / or 0-80% sorghum; and / or 0-70% wheat; and / or 0-70% of barley; and / or 0-30% oats; and / or 0-40% soy flour; and / or 0-10% of fishmeal; and / or 0-20% serum. Diet for animals can be made as a mash (not granular) or granular feed. Generally, the ground feed material is mixed and sufficient quantities of the necessary vitamins and minerals are added to it according to the needs of the species of interest. Enzymes can be added as solid or liquid enzyme formulations. For example, a solid enzyme composition is typically added before or during the mixing step; and a liquid enzyme preparation is typically added after the granulation step. The enzyme can also be added to the feed additive or pre-mix.

The final concentration of the enzyme in the diet is in the range of 0.01-200 mg of enzyme protein per kg of diet, for example, in the range of 5-30 mg of enzyme protein per kg of animal ration. The antimicrobial polypeptide can be administered in one or more of the following amounts (dose ranges): 0.01-200; or 0.01-100; or 0.05-100; or 0.05-50; or 0.10-10 - all of these ranges are presented in mg of protein of the antimicrobial polypeptide per kg of feed (in parts per million).

To determine the mg of antimicrobial polypeptide protein per kg of feed, the antimicrobial polypeptide is purified from the feed composition and the specific activity of the purified antimicrobial polypeptide is determined using a suitable assay (see antimicrobial activity, substrates and assays). The antimicrobial activity of the feed composition is also essentially determined using the same analysis, and based on these two definitions, the dosage in mg of the antimicrobial polypeptide protein is calculated.

These principles are used to determine the mg of protein of the antimicrobial polypeptide in feed additives. Of course, if a sample of the antimicrobial polypeptide used to obtain a feed additive or feed is available, the specific activity is determined in this sample (there is no need to purify the antimicrobial polypeptide from the feed or additive composition).

Signal Peptide and Propeptide

The present invention also relates to nucleic acid constructs comprising a gene encoding a protein operably linked to one or both of the first nucleotide sequence, consisting of nucleotides 1-60 of the sequence SEQ ID NO: 1 encoding a signal peptide consisting of amino acids from -48 to -29 SEQ ID NO: 2, and a second nucleotide sequence consisting of nucleotides 61-144 of the sequence SEQ ID NO: 1 encoding a propeptide consisting of amino acids -28 to -1 SEQ ID NO: 2, where the gene is foreign to the first and second nucleotide s sequences.

The present invention also relates to recombinant expression vectors and recombinant host cells containing such nucleic acid constructs.

The present invention also relates to methods for producing a protein, comprising (a) culturing such a recombinant host cell under conditions suitable for protein production; and (b) protein isolation.

The first and second nucleotide sequences can be functionally linked to foreign genes separately from other control sequences or in combination with other control sequences. Such other control sequences are described above. As described previously, in the case where both the signal peptide and propeptide regions are at the N-terminus of the protein, the propeptide region is located near the N-terminal of the protein and the signal peptide region is located near the N-terminus of the propeptide.

The protein may be the host protein of the host cell or heterologous to it. The term "protein" is not intended in the present description to refer to a specific length of the encoded product and, therefore, includes peptides, oligopeptides and proteins. The term “protein” also includes two or more polypeptides combined to form an encoded product. Proteins also include hybrid polypeptides that contain a combination of parts or complete polypeptide sequences derived from at least two different proteins, where one or more of them may be heterologous to the host cell or its own. In addition, proteins include naturally occurring allelic and engineered variants of the aforementioned proteins and fusion proteins.

Preferably, the protein is a hormone or a variant thereof, an enzyme, a receptor or a fragment thereof, an antibody or a fragment thereof, or a reporter. In a more preferred aspect, the protein is an oxidoreductase, transferase, hydrolase, lyase, isomerase or ligase. In a more preferred aspect, the protein is aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyl transferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucose glucose, glucose glucose , lipase, mannoidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenol oxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylanase.

The gene can be obtained from any prokaryotic, eukaryotic or other source.

The present invention is further described by the following examples, which should not be construed as limiting the scope of this invention.

EXAMPLES

Chemical reagents used as buffers and substrates were at least chemically pure commercial products. In the following examples, the antimicrobial polypeptide represented as amino acids 1-42 of the sequence SEQ ID NO: 2 is referred to as "Eurocin".

EXAMPLE 1

Eurotium amstelodami cDNA library

A cDNA library was obtained from E. amstelodami grown for 5 days on potato dextrose agar (PDA). RNA containing poly-A was purified, cDNA was synthesized, and a library was prepared in accordance with standard molecular biology methods. A detailed protocol for the general process can be found in the examples of international patent application WO 01/12794. The vector used for cloning was pMhas5, which is presented in the sequence of SEQ ID NO: 8 and which has the following elements:

Table 1
PMhas5 vector elements Element Localization Description Cds 365-1156 Kanamycin Resistance Cds 2232-2387 Beta Galactosidase Alpha Peptide -10 signal sequence 2189-2192 Shine-Dalgarno sequence Promoter 2101-2189 Lac promoter Different element 626-650 KanP1 primer for the BACE system

EXAMPLE 2

Aspergillus Expression Vector Design for Eurocine

The nucleotide sequence encoding the eurocin was amplified from a cDNA library (see Example 1) as follows: 1 microliter of cDNA (approximately 10 nanograms of DNA) was used as a template in the PCR reaction mixture with primer A and primer B.

Primer A: TCTTGGATCCACCATGCACTTCACCAAGGTCTCC (SEQ ID NO: 4)

Primer B: TCTTCTCGAGTTAGAAAGAACAGGTGCAGGTAGG (SEQ ID NO: 5)

10 pmol of each primer was used in a reaction volume of 50 microliters. The annealing temperature was 55 degrees Celsius, and elongation occurred at 72 degrees Celsius for 1 minute. A total of 35 cycles were performed. Used the Expand High Fidelity PCR System (Roche).

Aliquots of the PCR reaction mixture were separated on a 4% agarose gel. A distinct band was visible in an area corresponding to a size of approximately 300 bp. The PCR fragment was digested with BamH 1 and Xho 1, which were digested in the protrusions introduced by PCR primers. The cleaved fragments were isolated and cloned into a BamH1-Xho1 pMT2786 cleaved expression plasmid Aspergillus based on the pMT2188 plasmid, which is based on pCaHj527 (see Example 7 of International Patent Application WO 02/12472; and WO 00/70064). It was confirmed that the sequence of interest encodes the sequence of Eurocine, as defined above. The sequence of the POR fragment is presented as SEQ ID NO: 6.

An Aspergillus expression plasmid with PCR product insert was designated pMT2935 and is presented as SEQ ID NO: 7.

EXAMPLE 3

Eurocine expression in Aspergillus

pMT2935 (see SEQ ID NO: 7) was transformed into the BECXh2 strain of Aspergillus oryzae (see international patent application WO 00/39322). 30 transformants were re-isolated twice under selective and non-inducing conditions on plates with minimal Cove medium with sucrose and acetamide. To analyze the expression of eurocine, transformants were grown for 6 days at 30 degrees Celsius in test tubes with 10 ml of YPM (2% peptone, 1% yeast extract, 2% maltose). Supernatants were separated on 10% Bis-Tris SDS NuPage gels (Invitrogen) according to the manufacturer's recommendations with MES separation buffer to ensure separation in the low Mw range. Transformants of Aspergillus oryzae grew well, even after the induction of Eurocine expression.

A distinct band with the size expected for eurocine was visible in most transformants, while this band was not visible in untransformed BECh2 A. oryzae host strains.

EXAMPLE 4

Purification of Eurocine

The cultivation broth was filtered through a 0.22 μm Corning 431118 filter and the pH was adjusted to 4.0 using formic acid. Filtering through a 0.22 μm filter was repeated to remove additional sediment after adjusting the pH. Conductivity was measured and adjusted to approximately 10 mS cm ^{-1 by the} addition of MQ water (Millipore). The filtrate was then placed in a 12 ml Source 30S column (Amersham Biosciences 17-1273-01) using an AKTA HPLC analyzer. The loading buffer was 50 mM formic acid, pH 4 (buffer A).

Evrocin was eluted using a gradient of buffer B 0-100% in 20 column volumes. Buffer B was 50 mM formic acid, 2 M sodium chloride, pH 4.0. The affinity of the purified fractions was checked by MALDI-TOF MS (Voyager DE Pro instrument, Applied Biosystems) and the purity was approximately checked by SDS-PAGE (Invitrogen, NuPage 12% Bis-Tris / MES stained with Gel code Blue Stain Reagent, Pierce 24592)

Fractions containing the compound of interest (based on MALDI-TOF MS) were combined and concentrated on an Amicon Ultra 5000 Da MWCO filter (Millipore UFC900524). Centrifugation was carried out at 4000 g for approximately 30 minutes. The solution was then desalted by washing three times with 0.01% acid using the same filter and centrifugation conditions.

The product was analyzed for exact sequence and purity by analysis of amino acids and MALDI-TOF MS. The measured mass of Eurocine was 4339 Yes. The calculated molecular weight was 4338.8 Yes, the average value, based on amino acids 1-42 of the sequence SEQ ID NO: 2.

The stock solution was stored at -20 ° C.

EXAMPLE 5

Antimicrobial Activity Assessment

Purified euocin was evaluated for antimicrobial activity in a microdilution assay. Minimum inhibitory concentrations were determined in accordance with the NCCLS / CLSI guidelines from CLSI (Institute of Clinical and Laboratory Standards).

Eurocin was analyzed in the following concentrations: 32; 16; 8; four; 2; one; 0.50; 0.25; 0.13; and 0.06 μg / ml.

As presented in table 2, euocin exhibits strong antimicrobial activity against many strains of ATCC.

table 2

Antimicrobial activity of Eurocine

EXAMPLE 6

Using HMM files from the PFAM database to detect defensin

Sequence analysis using profiles of the hidden Markov model (HMM profiles) can be performed either interactively via the Internet or locally on a computer using the well-known freely available HMMER software package. The latest version is HMMER 2.3.2, October 2003.

HMM profiles can be obtained from the well-known PFAM database. The latest version is PFAM 16.0, November 2004. Both HMMER and PFAM are available for any standardized computer equipment, such as from Washington University in St. Louis (USA), School of Medicine (http://pfam.wustl.edu and http://hmmer.wustl.edu).

If the amino acid sequence of interest, or a fragment thereof, belongs to the following five PFAM families, the amino acid sequence is a defensin in accordance with the present invention:

- Beta Defensin or Beta Defensin, registration number: PF00711;

- Defensin_propep or "defensin propeptide", registration number: PF00879;

- Defensin_1 or "mammalian defensin", registration number: PF00323;

- Defensin_2 or "arthropod defensin", registration number: PF01097;

- Gamma-thionine or "gamma-thionine family", registration number: PF00304.

Amino acid sequence belongs to the PFAM family, in accordance with the present invention, if its E value is greater than 0.1, and the score is greater than or equal to zero when using the PFAM database in interactive mode or when using the hmmpfam program locally (from the software package HMMER software).

If sequence analysis is performed locally using the hmmpfam program, you must obtain (download) HMM profiles from the PFAM database. For each family, there are two profiles; xxxjs.hmm for general searches and xxx_fs.hmm for local searches ("xxx" is the name of the family). This results in only ten profiles for the five families mentioned above.

These ten profiles can be used separately or combined (added) into a single profile (using a text editor - profiles are ASCII files), which can be called, for example, defensin.hmm. The amino acid sequence of interest can then be evaluated using the following command line:

hmmpfam -E 0,1 defensin.hmm sequence_file

- where "sequence_file" is a file with an amino acid sequence of interest in any format recognized by the HMMER software package.

If the score is greater than or equal to zero (0,0), and the value of E is greater than 0.1, then the amino acid sequence of interest is the defensin in accordance with the present invention.

The PFAM database is further described in Bateman et al. (2004) "The Pfam Protein Families Database", Nucleic acids Research, Vol. 32 (Database Issue) pp. D138-D141.

Claims (19)

1. The polypeptide with antimicrobial activity, selected from the group consisting of
(a) a polypeptide containing an amino acid sequence that has at least 70% identity to amino acids 1-42 of the sequence SEQ ID NO: 2;
(b) a polypeptide that is encoded by a polynucleotide that hybridizes under high stringency conditions with nucleotides 145-270 of the sequence SEQ ID NO: 1 or with a chain complementary to it. 2. The polypeptide according to claim 1, containing an amino acid sequence that has at least 80% identity to amino acids 1-42 of the sequence SEQ ID NO: 2. 3. The polypeptide according to claim 2, containing an amino acid sequence that has at least 90% identity to amino acids 1-42 of the sequence SEQ ID NO: 2. 4. The polypeptide according to claim 3, containing an amino acid sequence that has at least 95% identity to amino acids 1-42 of the sequence SEQ ID NO: 2. 5. The polypeptide according to claim 4, containing the amino acid sequence of amino acids 1-42 of the sequence SEQ ID NO: 2. 6. The polypeptide according to claim 5, which consists of amino acids 1-42 of the sequence SEQ ID NO: 2. 7. The selected polynucleotide containing the nucleotide sequence that encodes the polypeptide according to any one of claims 1 to 6. 8. The selected polynucleotide according to claim 7, having at least one mutation in the sequence of SEQ ID NO: 1 encoding a mature polypeptide, where the mutant nucleotide sequence encodes a polypeptide consisting of amino acids 1-42 of the sequence SEQ ID NO: 2. 9. The nucleic acid construct containing the polynucleotide according to claim 7, operably linked to one or more control sequences that regulate the production of the polypeptide in the host expression system. 10. Recombinant expression vector containing the nucleic acid construct of claim 9. 11. Recombinant host cell containing the nucleic acid construct of claim 9. 12. A method for producing a polypeptide according to any one of claims 1 to 6, comprising (a) culturing a cell which, in the form of its wild type, is capable of producing a polypeptide under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide. 13. A method for producing a polypeptide according to any one of claims 1 to 6, comprising (a) culturing a host cell containing a nucleic acid construct containing a nucleotide sequence encoding a polypeptide under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide. 14. A method of producing a polypeptide according to any one of claims 1 to 6, comprising (a) culturing a cell of a transgenic plant or transgenic plant containing a polynucleotide encoding a polypeptide having antimicrobial activity according to the invention under conditions conducive to the duplication of the polypeptide; and (b) isolation of the polypeptide. 15. A transgenic plant, part of a plant or plant cell expressing a polypeptide according to any one of claims 1 to 6, which is transformed with a polynucleotide encoding the polypeptide according to any one of claims 1 to 6. 16. A method of killing or inhibiting the growth of microbial cells, comprising contacting the microbial cells with an antimicrobial polypeptide, as defined in any one of claims 1 to 6. 17. The antimicrobial polypeptide according to any one of claims 1 to 6 for use as a medicine, or an antimicrobial veterinary agent, or a therapeutic or prophylactic agent for humans. 18. An antimicrobial polypeptide, as defined in any one of claims 1 to 6, for use in the manufacture of a veterinary drug or drug for humans for the treatment of microbial infections or for prophylactic use. 19. An antimicrobial polypeptide, as defined in any one of claims 1 to 6, for use in animal feed.