CN101153330B - Primer, detection method and detection reagent kit for detecting vibrio parahemolyticus - Google Patents
Primer, detection method and detection reagent kit for detecting vibrio parahemolyticus Download PDFInfo
- Publication number
- CN101153330B CN101153330B CN2007100304416A CN200710030441A CN101153330B CN 101153330 B CN101153330 B CN 101153330B CN 2007100304416 A CN2007100304416 A CN 2007100304416A CN 200710030441 A CN200710030441 A CN 200710030441A CN 101153330 B CN101153330 B CN 101153330B
- Authority
- CN
- China
- Prior art keywords
- vibrio parahemolyticus
- primer
- tih
- reaction
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates a technique for fast detecting food-borne pathogens based on a loop-mediated isothermal amplification, LAMP technique. A primer for diction of vibrio parahemolyticus can augment the specific base sequence of a target gene which is the tih-GenBank (accession no. AY578148) of the vibrio parahemolyticus, and the primer is complementary to a part of or a complementary chain fragment of the nucleic acid sequence on the 946-1140 loci on the target gene. The invention provides a primer having specificity to a specific gene fragment of the vibrio parahemolyticus, and through detecting whether or not the detecting specimen in a reagent box of the primer unit contains the specific gene fragment of the vibrio parahemolyticus, determines whether the vibrio parahemolyticus exists in the specimen or not.
Description
Technical field
The present invention relates to a kind of based on ring mediated isothermal amplification (loop-mediated isothermalamplification, LAMP) the food-borne causal agent Fast Detection Technique of technology.Be particularly related to Vibrio parahemolyticus specific gene fragment is had specific primer and primer sets; Also relate to and use the ring mediated isothermal amplification method to detect detection method and the detection kit of Vibrio parahemolyticus described primer and primer sets.
Background technology
The food origin disease sickness rate is higher, by Salmonellas, Shigellae, streptococcus aureus, Bacillus proteus, vibrio cholerae, Vibrio parahemolyticus and E.coli O157:H7, the food poisoning that rotavirus and norovirus cause, its sickness rate accounts for very high ratio in China's food origin disease sickness rate, be a serious public health problem.
Detection to food-borne causal agent at present mainly relies on pathogen isolation method, immunological method and various PCR method.Though pathogen isolation is a gold standard, loaded down with trivial details time-consuming, generally need 5 day time, the longlyest need one month, and the specificity of immunological method and susceptibility are all lower.
Along with the development of Protocols in Molecular Biology, people adopt round pcr to be applied to the diagnosis of bacterium.The for example patent application of PCR Chinese patent publication number CN1526825 has disclosed a kind of specificity of utilizing Vibrio parahemolyticus PR72H sequence, detects the method for Vibrio parahemolyticus by DNA extraction, pcr amplification, electrophoresis observation equimolecular biological means.Though this method sensitivity, accurately, fast, owing to need the plant and instrument of costliness, higher testing cost and make it not be suitable for field quick detection and basic unit's popularization and application the higher technical requirements of testing staff.
Ring mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) technology (International Patent Publication No. WO 00/28082) is that Notomi in 2000 etc. develop a kind of nucleic acid amplification new technology, promptly at 4 special primers of 6 zone design of target gene (can also be added with ring primer to) if needed, utilize a kind of strand displacement archaeal dna polymerase (Bst DNA polymerase) to be incubated about 60 minutes at 65 ℃ of left and right sides constant temperatures, can finish nucleic acid amplification reaction, amplification can directly be judged by naked eyes amplification by product magnesium pyrophosphate precipitation or its turbidity be detected, also available fluorescence dye SYBR Green I dyeing in conjunction with double-stranded DNA is judged by naked eyes.2 pairs of primers that are used for LAMP technology amplification are at 6 sections of gene, thereby have the specificity higher than PCR, and possessing does not simultaneously need in thermal cycling, its unit time amplification efficiency higher and do not need advantage such as specific apparatus yet.But the detection kit of utilizing the ring mediated isothermal amplification method to detect Vibrio parahemolyticus is not arranged at present, and the report that Vibrio parahemolyticus tih specific gene fragment is had specific primer and primer sets.
Summary of the invention
One object of the present invention is, provides a kind of Vibrio parahemolyticus specific gene fragment is had specific primer.
Above-mentioned purpose is achieved by the following technical solution:
A kind of Vibrio parahemolyticus detects uses primer, it is characterized in that, the special base sequence of energy amplified target gene, described target gene is the tih---GenBank number of landing of Vibrio parahemolyticus: AY578148, described primer and described target gene 946--a part or its complementary strand complementation of-1140 nucleotide sequence.
Another object of the present invention is, provides a kind of Vibrio parahemolyticus specific gene fragment is had specific primer sets.
Above-mentioned purpose is achieved by the following technical solution:
A kind of Vibrio parahemolyticus detects and uses primer sets, it is characterized in that described primer sets is made up of following primer:
Forward outer primer F3-tih GGCACAAGCGATGTACTACA
Reverse outer primer B3-tih GACGCTGCACACTCAGAG
Forward inner primer FIP-tih
GCGCAGAAGTTAGCGTCTCGAAGCGCAAGGTTACAACATCAC
Reverse inner primer BIP-tih GGTTTCGTGAACGCGAGCGACGCAATGCGTGGGTGTAC
946 of tih (AY578148) gene order of Vibrio parahemolyticus can increase--a part or its complementary strand of-1140 nucleotide sequence.
Another object of the present invention is, a kind of detection method of utilizing above-mentioned primer sets to detect Vibrio parahemolyticus based on the ring mediated isothermal amplification method is provided.
Above-mentioned purpose is achieved by the following technical solution:
The detection method of a kind of Vibrio parahemolyticus, this method is used for detecting sample and whether has Vibrio parahemolyticus, it is characterized in that, with 946 of the tih gene order of Vibrio parahemolyticus--a part or its complementary strand of-1140 nucleotide sequence are target, with the above-mentioned target region of above-mentioned primer sets selective amplification, confirm whether to have amplified production by the LAMP method.
Concrete detection method is:
1) sample preparation and template extraction, the sample scope is applicable to samples such as food samples, ight soil, vomitus; Bacterium sample to be checked increases the bacterium cultivation after 8-12 hour with corresponding enteron aisle enrichment liquid, got 1.0ml enrichment liquid 10000rpm centrifugal 2 minutes, after abandoning its supernatant liquor, extract template DNA or add 20～30ul tri-distilled water with the DNA extraction test kit and boiled 5 minutes, get the 2ul supernatant liquor again and do template DNA to be checked;
2) ring mediated isothermal amplification of Vibrio parahemolyticus (LAMP)
Get amplification reaction solution, add template to be checked earlier, enzyme-added again, add distilled water at last, form the reaction system that following cumulative volume is 20ul～100ul, mixing point is incubated about 60-90 minute from back constant temperature under about 60-65 ℃ condition, places following 2 minutes inactivators of environment of 80 ℃ then.
Reaction system be (reaction cumulative volume 20ul～100ul):
| Composition | Final concentration or amount | |
| Template to be checked | Nucleic acid-templated | 1-10ul |
| Amplification reaction solution | The reverse outer primer B3-tih of the reverse inner primer BIP-tih of forward inner primer FIP-tih forward outer primer F3-tih trimethyl-glycine betainedNTPmgsO 4 | 1.0-2.0uM 1.0-2.0uM 0.15-0.3uM 0.15-0.3uM 0.8-1.5M 1.0-1.6mM 2-6mM |
| Reaction buffer Bst DNA Polymerase Buffer 10 * | 1/10 reaction volume (ul) | |
| Enzyme | Bst?DNA?Polymerase | 0.16-0.64U/ul |
| Distilled water | ddH 2O | Add to predetermined reaction volume (ul) |
3) detection of LAMP reaction product:
A) naked eyes detect: show relatively that with the negative control pipe detector tube occurs obviously muddy positive, do not see muddy negative; Or,
B) detect after adding dyestuff: the reaction tubes of every 25ul system adds 1000 * SYBR Green I invitrogen1-2ul, 1-5 minute observations, and it is green positive that reaction solution turns, and keeps colourless or brown negative; Or,
C) electrophoresis detection: the 2-3% sepharose, the about 60-100 of 70V electrophoresis minute, the electrophoresis picture showed LAMP characteristic scalariform band, and minimal segment is about 160bp, and then the result is positive; As then the result is negative not have any band.
Another object of the present invention is, a kind of detection kit of utilizing above-mentioned primer sets to detect Vibrio parahemolyticus based on the ring mediated isothermal amplification method is provided.
Above-mentioned purpose is achieved by the following technical solution:
A kind of Vibrio parahemolyticus detects and uses test kit, it is characterized in that described test kit comprises amplification reaction solution, the enzyme that contains above-mentioned primer sets at least.
Comprise following reagent in the described amplification reaction solution:
| Composition | Final concentration or amount | |
| Amplification reaction solution | The reverse outer primer B3-tih of the reverse inner primer BIP-tih of forward inner primer FIP-tih forward outer primer F3-tih trimethyl-glycine betaine dNTP mgsO 4 | 1.0-2.0uM 1.0-2.0uM 0.15-0.3uM 0.15-0.3uM 0.8-1.5M 1.0-1.6mM 2-6mM |
| Reaction buffer Bst DNA Polymerase Buffer 10 * | 1/10 predetermined reaction volume (ul) |
Wherein 10 * Bst DNA Polymerase Buffer reaction buffer contains trihydroxy-methionine(Met) methane-hydrochloric acid (Tris-Hcl), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100 of 200mM pH8.8;
Described enzyme is the Bst DNA enzyme that every microlitre contains 8 activity units.
Described test kit also comprises feminine gender and positive control template, and described negative control template is a distilled water; Described positive control template is a Vibrio parahemolyticus genomic dna (1～100nM).
The present invention has specific primer sets by providing a kind of to Vibrio parahemolyticus specific gene fragment, and detect in the sample whether have Vibrio parahemolyticus specific gene fragment, and then whether there is Vibrio parahemolyticus in definite sample with the test kit that includes above-mentioned primer sets.Detection reagent of the present invention and detection method have susceptibility height, high specificity, convenient and swift, do not need specific apparatus, advantage such as applied widely, can solve field quick detection and basic unit's popularization and application difficult problem of food-borne causal agent; Particularly on-the-spot detect and wartime field application.Simultaneously, compare with existing P CR method have high specificity, susceptibility than PCR high or quite, than PCR save time about 2 hours, do not need specific apparatus advantages such as (amplified reaction can be finished) in water-bath.
Description of drawings
Fig. 1 primer sets of the present invention can be by macroscopic result after carrying out ring mediated isothermal amplification (LAMP).Legend: 1, positive amplification; 2, negative amplification.
Fig. 2 primer sets of the present invention is carried out ring mediated isothermal amplification (LAMP) back and is added the result that dyestuff is observed.Legend: 1, negative amplification; 2,3, positive amplification.
Fig. 3 primer sets of the present invention is carried out ring mediated isothermal amplification (LAMP) result's electrophorogram;
Legend, 1:100bp marker; 2: Vibrio parahemolyticus; 3-8 is respectively streptococcus aureus, streptococcus aureus produces enterotoxin A bacterial strain, streptococcus aureus product enterotoxin B bacterial strain, streptococcus aureus product enterotoxin C bacterial strain, Salmonella typhimurium, salmonella typhi.
Fig. 4 primer sets of the present invention is carried out ring mediated isothermal amplification (LAMP) result's electrophorogram two;
Among the figure, 1:100bp marker; 2: Vibrio parahemolyticus; 3-8 is respectively Salmonella enteritidis, shigella dysenteriae, Escherichia coli O 157: H7, Proteus mirabilis, vibrio cholerae and negative control.
Embodiment
The present invention will be described below by concrete Vibrio parahemolyticus testing process, but the present invention is not limited to these embodiment.
The amplification of the tih gene of a pair of known bacterial strain of embodiment
One) design of primer sets
By consulting document and filtering out the 946---1140bp nucleotide sequence of Vibrio parahemolyticus specific gene tih with the BLAST software analysis, design LAMP primer and synthetic at these segmental six sites (these six sites difference: 946-965bp, 968-987bp, 1010-1031bp, 1043-1062bp, 105-1122bp, 1123-1140bp), obtain following primer; Design of primers is finished by LAMP primer special design software binding molecule biological analysis software Advance Vector NTI.
Sequence numbering 1
Forward outer primer F3-tih GGCACAAGCGATGTACTACA
Reverse outer primer B3-tih GACGCTGCACACTCAGAG
Sequence numbering 3
Forward inner primer FIP-tih
GCGCAGAAGTTAGCGTCTCGAAGCGCAAGGTTACAACATCAC
Reverse inner primer BIP-tih GGTTTCGTGAACGCGAGCGACGCAATGCGTGGGTGTAC
The sequence in described 6 sites is respectively:
946-965bp： ggcac?aagcgatgta?ctaca
968-987bp gcg?caaggttaca?acatcac
1010-1031bp t?tcgagacgct?aacttctgcg?c
1043-1062bp ggtttcgt?gaacgcgagc?ga
1105-1122bp gtacac?ccacgcattg?cg
1123-1140bp ctctgagt?gtgcagcgtc
Wherein,
Described forward outer primer F3: amplification starts from 946-965bp (ggcacaagcgatgta ctaca);
Described forward inner primer FIP: amplification starts from complementary sequence and the 968-987bp (gcg caaggttaca acatcac) of 1010-1031bp (ttcgagacgct aacttctgcgc);
Described reverse outer primer B3: amplification starts from the complementary sequence of 1123-1140bp (ctctgagt gtgcagcgtc);
Reverse inner primer BIP: amplification starts from the complementary sequence of 1043-1062bp (ggtttcgtgaacgcgagcga) and 1105-1122bp (gtacacccacgcattg cg).
The general character of each primer is in the above-mentioned primer sets: with the 946-1140bp nucleic acid array complementation of Vibrio parahemolyticus specific gene tih.
Two) amplification of the bacterial strain of present embodiment experiment and each bacterial strain such as following table one and table two table one (for the ease of understanding, the applicant with number among following sequence number and Fig. 3 be arranged to consistent)
| Sequence number | Molecular weight standard product and strains tested | The |
| 1 | 100bp? |
|
| 2 | Vibrio parahemolyticus (VPL 4-90) | Sun |
| 3 | Streptococcus aureus (CMCC-26003-25) | |
| 4 | Streptococcus aureus produces enterotoxin A bacterial strain (ATCC-13565) | Cloudy |
| 5 | Streptococcus aureus produces enterotoxin B bacterial strain (ATCC-14458) | Cloudy |
| 6 | Streptococcus aureus produces enterotoxin C bacterial strain (ATCC-19095) | Cloudy |
| 7 | Salmonella typhimurtum (CMCC-50115) | Cloudy |
| 8 | Salmonella typhi (CMCC-50071) | Cloudy |
| Table two (for the ease of understanding, the applicant with number among following sequence number and Fig. 4 be arranged to consistent) | ||
| 1 | 100bp? |
|
| 2 | Vibrio parahemolyticus (VPL 4-90) | Sun |
| 3 | Salmonella enteritidis (ATCC-13076) | Cloudy |
| 4 | Shigella dysenteriae (CMCC-51252) | Cloudy |
| 5 | Escherichia coli O 157: H7 (CMCC-44050-3) | |
| 6 | Proteus mirabilis (CMCC-49005) | Cloudy |
| 7 | Vibrio cholerae (569B) | Cloudy |
| 8 | Negative control | Cloudy |
Above-mentioned strains tested is reference culture, available from Chinese medicine microbial strains preservation administrative center.The no amplified reaction of " the moon " expression, " sun " expression has amplified reaction.
Three) extraction of above-mentioned each strain gene DNA
Vibrio parahemolyticus sample to be checked increases bacterium cultivation 8-12 hour with containing 3.5%NaCl enteron aisle enrichment liquid, other bacteriums sample to be checked all increases the bacterium cultivation after 8-12 hour with corresponding enteron aisle enrichment liquid, got 1.0ml enrichment liquid 10000rpm centrifugal 2 minutes, after abandoning its supernatant liquor, extract template DNA or add the 30ul tri-distilled water with DNA extraction test kit (as TIANamp Bacteria DNA Kit) and boiled 5 minutes, directly get the 2ul supernatant liquor and make template DNA, streptococcus aureus sample to be checked needs to increase the bacterium cultivation with the enteron aisle enrichment liquid and extracts DNA with genome DNA extracting reagent kit (TIANamp Bacteria DNAKit) after 8-12 hour.
Four) based on the gene amplification of LAMP method
Get amplification reaction solution 14.6ul, add 2.0ul template to be checked, add the 1ul enzyme, add 7.4ul ddH again
2O, forming as the following table cumulative volume is the reaction system of 25ul, is that 65 ℃ thermostat water bath is incubated about 60 minutes in temperature, places 80 ℃, 2 minutes inactivators then.
Reaction system is: (the reaction cumulative volume is 25ul)
| Composition | Storage liquid concentration | Amount (ul) | Final concentration |
| Nucleic acid-templated FIP-tihBIP-tihF3-tihB3-tihbetainedNTPmgsO 4Bst?DNA?Polymerase?BufferBst?DNA?PolymeraseddH 2O | ?40uM?40uM?10uM?10uM?5M?10mM?150mM?10×?8U/ul | 2.0 1.0 1.0 0.5 0.5 5.0 3.5 0.6 2.5 1.0 7.4 | 1.6uM 1.6uM 0.2uM 0.2uM 1M 1.4mM 3.6mM 0.32U/ul |
Except that nucleic acid-templated, above-mentioned reaction system can be reduced to amplification reaction solution, enzyme and distilled water.
Amplification reaction solution: reverse outer primer B3-tih, 1.4mM dNTP and the 1M trimethyl-glycine (betaine) of forward outer primer F3-tih, 0.2uM that comprises 10 * Bst DNA Polymerase Buffer reaction buffer, 3.6mM sal epsom, 1.6uM forward inner primer FIP-tih, the reverse inner primer BIP-tih of 1.6uM, the 0.2uM of 1/10 predetermined reaction volume;
Wherein 10 * Bst DNA Polymerase Buffer reaction buffer contains trihydroxy-methionine(Met) methane-hydrochloric acid (Tris-HCl), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100 of 200mM pH8.8;
Enzyme: Bst archaeal dna polymerase (every microlitre contains 8 activity units).
The adding principle of distilled water is after the amount of other reagent is determined, to add distilled water and make reaction volume arrive predetermined reaction volume.
Five) detection of amplified production
Along with the carrying out of amplified reaction, the magnesium ion that exists pyrophosphate ion of separating out from dNTP and the reaction solution will form the magnesium pyrophosphate precipitation.Therefore, only just white opacity can appear in the reaction solution that nucleic acid amplification takes place.Can judge in the following way like this.
A) naked eyes detect: show relatively that with the negative control pipe detector tube occurs obviously muddy positive, do not see muddy negative; (referring to Fig. 1) or,
B) detect after adding dyestuff: the reaction tubes of every 25ul system adds 1000 * SYBR Green I (invitrogen) 1-2ul, 1-5 minute observations, and it is green positive that reaction solution turns, and keeps colourless or brown negative; (referring to Fig. 2) or,
C) electrophoresis detection: the 2-3% sepharose, the about 60-100 of 70V electrophoresis minute, the electrophoresis picture showed LAMP characteristic scalariform band, and minimal segment is about 160bp, and then the result is positive; As then the result is negative not have any band.(referring to Fig. 3,4)
Detection through to amplified production shows that above-mentioned primer sets the LAMP amplified reaction occurs to Vibrio parahemolyticus, and amplified reaction does not appear in the contrast bacterium, has shown good specificity.
6) remolding sensitivity is:
With Vibrio parahemolyticus as detecting bacterium, with 1 * 10
6The bacterium liquid of CFU/mL is done a series of dilutions: 10
6, 10
5, 10
4, 10
3, 10
2, 10
1, 10
0, use LAMP method and PCR method (the upstream and downstream primer is respectively F3-tih, B3-tih) to detect respectively, detected result shows that the LAMP reaction sensibility reaches 10
0CFU/mL; The PCR reaction sensibility reaches 10
1CFU/mL; The result shows that the LAMP reaction sensibility is than responsive 10 times of PCR reaction.
Embodiment two
The difference of present embodiment and embodiment one is that in the present embodiment, the reaction system of using based on the gene amplification of LAMP method is:
Reaction system is: (the reaction cumulative volume is 25ul)
| Composition | Storage liquid concentration | Amount (ul) | Final concentration |
| Nucleic acid-templated FIP-tihBIP-tihF3-tihB3-tihbetainedNTPmgsO 4Bst?DNA?Polymerase?BufferBst?DNA?PolymeraseddH 2O | 25uM 25uM 7.5uM 7.5uM 4M 10mM 100mM 10× 8U/ul | 1.0 1.0 1.0 0.5 0.5 5.0 2.5 0.5 2.5 0.5 10.0 | 1.0uM 1.0uM 0.15uM 0.15uM 0.8M 1.0mM 2.0mM 0.16U/ul |
Except that nucleic acid-templated, above-mentioned reaction system can be reduced to amplification reaction solution, enzyme and distilled water.
Amplification reaction solution: reverse outer primer B3-tih, 1.0mM dNTP and the 0.8 M trimethyl-glycine (betaine) of forward outer primer F3-tih, 0.15uM that comprises 10 * Bst DNA Polymerase Buffer reaction buffer, 2mM sal epsom, 1.0uM forward inner primer FIP-tih, the reverse inner primer BIP-tih of 1.0uM, the 0.15uM of 1/10 predetermined reaction volume;
Wherein 10 * Bst DNA Polymerase Buffer reaction buffer contains trihydroxy-methionine(Met) methane-hydrochloric acid (Tris-HCl), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100 of 200mM pH8.8;
Enzyme: Bst archaeal dna polymerase (every microlitre contains 8 activity units).
The adding principle of distilled water is after the amount of other reagent is determined, to add distilled water and make reaction volume arrive predetermined reaction volume.
Reaction conditions: in temperature is that 60 ℃ thermostat water bath is incubated about 90 minutes, is warming up to 80 ℃, 2 minutes inactivators then.
Embodiment three
The difference of present embodiment and embodiment one is that in the present embodiment, the reaction system of using based on the gene amplification of LAMP method is:
Reaction system is: (the reaction cumulative volume is 25ul)
| Composition | Storage liquid concentration | Amount (ul) | Final concentration |
| Nucleic acid-templated FIP-tihBIP-tihF3-tihB3-tihbetainedNTPmgsO 4Bst?DNA?Polymerase?BufferBst?DNA?PolymeraseddH 2O | 50uM 50uM 15uM 15uM 7.5M 10mM 150mM 10× 16U/ul | 1.0 1.0 1.0 0.5 0.5 5.0 4.0 1.0 2.5 1.0 7.5 | 2.0uM 2.0uM 0.3uM 0.3uM 1.5M 1.6mM 6.0mM 0.64U/ul |
Except that nucleic acid-templated, above-mentioned reaction system can be reduced to amplification reaction solution, enzyme and distilled water.Amplification reaction solution: reverse outer primer B3-tih, 1.6mM dNTP and the 1.5M trimethyl-glycine (betaine) of forward outer primer F3-tih, 0.3uM that comprises 10 * Bst DNA Polymerase Buffer reaction buffer, 6mM sal epsom, 2.0uM forward inner primer FIP-tih, the reverse inner primer BIP-tih of 2.0uM, the 0.3uM of 1/10 predetermined reaction volume;
Wherein 10 * Bst DNA Polymerase Buffer reaction buffer contains trihydroxy-methionine(Met) methane-hydrochloric acid (Tris-HCl), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100 of 200mM pH8.8;
Enzyme: Bst archaeal dna polymerase (every microlitre contains 16 activity units).
The adding principle of distilled water is after the amount of other reagent is determined, to add distilled water and make reaction volume arrive predetermined reaction volume.
Reaction conditions: in temperature is that 65 ℃ thermostat water bath is incubated about 60 minutes, places 80 ℃, 2 minutes inactivators then.
Embodiment four
The difference of present embodiment and embodiment one is that in the present embodiment, the reaction system of using based on the gene amplification of LAMP method is:
Reaction system is: (the reaction cumulative volume is 20ul)
| Composition | Storage liquid concentration | Amount (ul) | Final concentration |
| Nucleic acid-templated FIP-tihBIP-tihF3-tihB3-tihbetainedNTPmgsO 4Bst?DNA?Polymerase?BufferBst?DNA?PolymeraseddH 2O | ?40uM?40uM?10uM?10uM?5M?10mM?150mM?10×?8U/ul | 2.0 0.8 0.8 0.4 0.4 4.0 2.8 0.48 2.0 0.8 5.52 | 1.6uM 1.6uM 0.2uM 0.2uM 1M 1.4mM 3.6mM 0.32U/ul |
Embodiment five
The difference of present embodiment and embodiment one is that in the present embodiment, the reaction system of using based on the gene amplification of LAMP method is:
Reaction system is: (the reaction cumulative volume is 100ul)
| Composition | Storage liquid concentration | Amount (ul) | Final concentration |
| Nucleic acid-templated FIP-tihBIP-tihF3-tihB3-tihbetainedNTPmgsO 4Bst?DNA?Polymerase?BufferBst?DNA?PolymeraseddH 2O | ?40uM?40uM?10uM?10uM?5M?10mM?150mM?10×?8U/ul | 10.0 4.0 4.0 2.0 2.0 20.0 14.0 2.4 10.0 4.0 27.6 | 1.6uM 1.6uM 0.2uM 0.2uM 1M 1.4mM 3.6mM 0.32U/ul |
The detection of embodiment six strain separated from vomitus
The extraction of strain gene DNA and amplification, detection
Get food poisoning person's vomitus 25g, increase the bacterium cultivation after 8-12 hour with containing 3.5%NaCl enteron aisle enrichment liquid, got 1.0ml enrichment liquid 10000rpm centrifugal 2 minutes, after abandoning its supernatant liquor, extract template DNA or add 20～30ul tri-distilled water with the DNA extraction test kit and boiled 5 minutes, get the 2ul supernatant liquor again and do template DNA to be checked.With aforementioned enteron aisle enrichment culture medium inoculation separation and Culture flat board, bacterium colony carries out the evaluation of strain isolated with biology-Mei Liai GNI+ card and VITEC 32 full automatic microorganism analysers in addition.The gene DNA of said extracted and the embodiment one same LAMP method of passing through is carried out the amplification of nucleic acid and the detection of amplified production.Amplification and the comparison of VITEC qualification result are as following table two.
| The bacterial strain sequence number | Have or not amplification | Qualification result |
| |
Have | Vibrio parahemolyticus |
| |
Do not have | Colibacillus of excrement |
Evaluation based on VITEC 32 full automatic microorganism analysers
As shown in Table 2, qualification result shows that strain separated contains Vibrio parahemolyticus and colibacillus of excrement, qualification result based on VITEC 32 full automatic microorganism analysers is consistent with the result who uses the primer sets amplification, only observes the amplification that above-mentioned primer sets produces in being accredited as the sample of Vibrio parahemolyticus.
Sequence table
＜110〉Zhuhai Disease Prevention And Control Center
＜120〉Vibrio parahemolyticus detects with primer, detection method, detection kit
<160>5
<210>1
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>1
GTGCGAAAGTGCTTGAGATG 20
<210>2
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>2
CGCAATGCGTGGGTGTAC 18
<210>3
<211>42
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>3
CGTCTCGAACAAGGCGTGAGTATCATCAAGGCACAAGCGATG 42
<210>4
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>4
CGCCCGAAGAGCACGGTTTCAATCGACAGACGATGAGCG 39
<210>5
<211>195
<212>DNA
＜213〉Vibrio parahemolyticus
<400>5
946?ggcac?aagcgatgta
961?ctacaaagcg?caaggttaca?acatcacgtt?gtttgatact?cacgccttgt?tcgagacgct
1021?aacttctgcg?cccgaagagc?acggtttcgt?gaacgcgagc?gatccttgtt?tggacatcaa
1081?ccgctcatcg?tctgtcgatt?acatgtacac?ccacgcattg?cgctctgagt?gtgcagcgtc
Claims (8)
1. a Vibrio parahemolyticus detects and uses primer sets, it is characterized in that described primer sets is made up of following primer:
Forward outer primer F3-tih GGCACAAGCGATGTACTACA
Reverse outer primer B3-tih GACGCTGCACACTCAGAG
Forward inner primer FIP-tih
GCGCAGAAGTTAGCGTCTCGAAGCGCAAGGTTACAACATCAC
Reverse inner primer BIP-tih GGTTTCGTGAACGCGAGCGACGCAATGCGTGGGTGTAC
The specific nucleic acid sequence of Vibrio parahemolyticus tih gene can increase.
2. Vibrio parahemolyticus according to claim 1 detects and uses primer sets, it is characterized in that, 946 of described primer sets amplification Vibrio parahemolyticus tih genes---1140 specific nucleic acid squences part.
3. the detection method of a Vibrio parahemolyticus, this method is used for detecting food samples and whether has Vibrio parahemolyticus, it is characterized in that, with the Vibrio parahemolyticus GenBank number of landing is that 946 of the tih genes of AY578148---1140 nucleotide sequence is a target gene, with any described target gene of described primer sets selective amplification of claim 1-2, confirm whether to have amplified production by the LAMP method.
4. Vibrio parahemolyticus detection method according to claim 3 is characterized in that, concrete detection method is:
1) sample preparation and template extraction, the sample scope is applicable to the food samples sample; Bacterium sample to be checked increases the bacterium cultivation after 8-12 hour with corresponding enteron aisle enrichment liquid, got 1.0ml enrichment liquid 10000rpm centrifugal 2 minutes, after abandoning its supernatant liquor, extract template DNA or add 20～30ul tri-distilled water with the DNA extraction test kit and boiled 5 minutes, get the 2ul supernatant liquor again and do template DNA to be checked;
2) ring mediated isothermal amplification of Vibrio parahemolyticus
Get amplification reaction solution, add template to be checked earlier, enzyme-added again, add distilled water at last, form the reaction system that following cumulative volume is 20ul～100ul, mixing point is incubated about 60-90 minute from back constant temperature under about 60-65 ℃ condition, places following 2 minutes inactivators of environment of 80 ℃ then;
The reaction system of reaction cumulative volume 20ul～100ul is:
Wherein 10 * Bst DNA Polymerase Buffer reaction buffer contains trihydroxy-methionine(Met) methane-hydrochloric acid, 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100 of 200mM pH 8.8;
Described enzyme is the Bst DNA enzyme that every microlitre contains 8-16 activity unit;
3) detection of LAMP reaction product:
A) naked eyes detect: show relatively that with the negative control pipe detector tube occurs obviously muddy positive, do not see muddy negative; Or,
B) detect after adding dyestuff: the reaction tubes of every 25ul system adds 1000 * SYBR Green I invitrogen1-2ul, 1-5 minute observations, and it is green positive that reaction solution turns, and keeps colourless or brown negative; Or,
C) electrophoresis detection: the 2-3% sepharose, the about 60-100 of 70V electrophoresis minute, the electrophoresis picture showed LAMP characteristic scalariform band, and minimal segment is about 160bp, and then the result is positive; As then the result is negative not have any band.
5. Vibrio parahemolyticus detection method according to claim 4 is characterized in that, when the reaction cumulative volume was 25ul, described reaction system was specially:
6. a Vibrio parahemolyticus detects and uses test kit, it is characterized in that described test kit comprises amplification reaction solution, the enzyme that contains the described primer sets of claim 1 at least;
Comprise following reagent in the described amplification reaction solution:
Wherein 10 * Bst DNA Polymerase Buffer reaction buffer contains trihydroxy-methionine(Met) methane-hydrochloric acid, 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100 of 200mM pH 8.8;
Described enzyme is the Bst DNA enzyme that every microlitre contains 8 activity units, final concentration 0.16-0.64U/ul.
7. Vibrio parahemolyticus according to claim 6 detects and uses test kit, it is characterized in that,
Amplification reaction solution: reverse outer primer B3-tih, the 1.4mM dNTP and the 1M trimethyl-glycine that comprise forward outer primer F3-tih, the 0.2uM of 1/10 predetermined reaction volume 10 * Bst DNA Polymerase Buffer reaction buffer, 3.6mM sal epsom, 1.6uM forward inner primer FIP-tih, the reverse inner primer BIP-tih of 1.6uM, 0.2uM;
Described enzyme is the Bst DNA enzyme that every microlitre contains 8 activity units, final concentration 0.32U/ul.
8. use test kit according to claim 6 or 7 described Vibrio parahemolyticus detections, it is characterized in that described test kit also comprises feminine gender and positive control template, described negative control template is a distilled water; Described positive control template is 1～100nM Vibrio parahemolyticus genomic dna.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100304416A CN101153330B (en) | 2007-09-21 | 2007-09-21 | Primer, detection method and detection reagent kit for detecting vibrio parahemolyticus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100304416A CN101153330B (en) | 2007-09-21 | 2007-09-21 | Primer, detection method and detection reagent kit for detecting vibrio parahemolyticus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101153330A CN101153330A (en) | 2008-04-02 |
| CN101153330B true CN101153330B (en) | 2011-07-13 |
Family
ID=39255216
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100304416A Expired - Fee Related CN101153330B (en) | 2007-09-21 | 2007-09-21 | Primer, detection method and detection reagent kit for detecting vibrio parahemolyticus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101153330B (en) |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102477463A (en) * | 2010-11-25 | 2012-05-30 | 上海海洋大学 | Viable but nonculturable state of vibrio parahaemolyticus detection method |
| CN102399882B (en) * | 2011-11-17 | 2013-03-20 | 山东出入境检验检疫局检验检疫技术中心 | Nicking incision enzyme nucleic acid isothermal amplification and rapid detection kit of vibrio parahaemolyticus |
| CN102586452B (en) * | 2012-03-12 | 2013-09-11 | 上海海洋大学 | Vibrio parahemolyticus detection kit and detection method thereof |
| CN102747148B (en) * | 2012-05-31 | 2014-10-29 | 冯家望 | Vibrio parahaemolyticus detection primer set and detection method |
| CN102747149B (en) * | 2012-05-31 | 2014-10-29 | 王小玉 | Hemolytic streptococcus detection primer set and method |
| CN103725765A (en) * | 2012-10-12 | 2014-04-16 | 苏州四同医药科技有限公司 | High-specificity high-sensitivity vibrio parahemolyticus detection method |
| CN103160602B (en) * | 2013-04-08 | 2015-07-01 | 北京出入境检验检疫局检验检疫技术中心 | Real-time fluorescent PCR (polymerase chain reaction) detection kit of vibrio parahaemolyticus and detection method thereof |
| CN103243168A (en) * | 2013-05-16 | 2013-08-14 | 汇智泰康生物技术(北京)有限公司 | Kit for detecting vibrio parabaemolyticus in food and using method for kit |
| CN104513857A (en) * | 2014-12-22 | 2015-04-15 | 广东省微生物研究所 | Loop-mediated isothermal amplification detection primer group, detection method and kit of vibrio parahaemolyticus |
| CN105087787A (en) * | 2015-08-03 | 2015-11-25 | 山东博科生物产业有限公司 | Reagent and method for fast detecting vibrio parahaemolyticus |
| CN110964789A (en) * | 2015-09-02 | 2020-04-07 | 上海旺旺食品集团有限公司 | Rapid constant-temperature detection method of vibrio cholerae O1 group, primer set and application |
| CN106222274B (en) * | 2016-08-05 | 2020-01-31 | 集美大学 | quick detection method for hollisgilettia |
| CN106520937A (en) * | 2016-10-27 | 2017-03-22 | 南京福海生物科技有限公司 | Shellfish vibrio parahemolyticus LAMP detection kit and application thereof |
| CN111154901B (en) * | 2020-01-19 | 2022-05-20 | 广东省微生物研究所（广东省微生物分析检测中心） | Specific new molecular target of vibrio parahaemolyticus and rapid detection method thereof |
| CN113337627B (en) * | 2021-06-03 | 2022-08-05 | 浙江省农业科学院 | Label-free visual detection method for vibrio parahaemolyticus gene based on CRISPR/Cas12a |
| CN114350827A (en) * | 2022-01-21 | 2022-04-15 | 国科宁波生命与健康产业研究院 | CDA primer group and kit for detecting vibrio parahaemolyticus and application of CDA primer group and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101008037A (en) * | 2007-01-18 | 2007-08-01 | 中国科学院南海海洋研究所 | Kit and method for detecting Bibrio Parahemolyticus using loop-mediated equal-temperature amplification technology |
-
2007
- 2007-09-21 CN CN2007100304416A patent/CN101153330B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101008037A (en) * | 2007-01-18 | 2007-08-01 | 中国科学院南海海洋研究所 | Kit and method for detecting Bibrio Parahemolyticus using loop-mediated equal-temperature amplification technology |
Non-Patent Citations (1)
| Title |
|---|
| AY578148.GenBank.2007, * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101153330A (en) | 2008-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101153327B (en) | Primer, detection method and detection reagent kit for detecting salmonella | |
| CN101153330B (en) | Primer, detection method and detection reagent kit for detecting vibrio parahemolyticus | |
| CN101153329B (en) | Primer, detection method and detection reagent kit for detecting staphylococcus aureus | |
| CN101153326B (en) | Primer, detection method and detection reagent kit for detecting shigella | |
| CN101153331A (en) | Primer, detection method and detection reagent kit for detecting bacillus coli O157:H7 | |
| CN101153332B (en) | Primer, detection method and detection reagent kit for detecting cholera vibrio | |
| CN101153342B (en) | Primer group and detection reagent kit for detection of group A type G3 rotavirus | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| Bertrand et al. | Evaluation of enrichment-free PCR-based detection on the rfbE gene of Escherichia coli O157—application to municipal wastewater | |
| CN101153328B (en) | Primer, detection method and detection reagent kit for detecting proteus | |
| CN103484536A (en) | Kit used for rapid detection of enterobacter sakazakii in milk, and applications thereof | |
| CN101153341B (en) | Primer, detection method and detection reagent kit for detecting type G2 norovirus | |
| CN103898222A (en) | Salmonella molecular detection kit based on bcfD genes and non-diagnostic detection method | |
| CN101768636B (en) | Composition and kit for detecting vibrio cholerae and detection method | |
| CN107022638A (en) | The LAMP primer group of quick detection salmonella and its application | |
| CN102559912A (en) | Method for real-time quantitative polymerase chain reaction (PCR) detection of bifidobacteria and Escherichia coli by using Taqman probes | |
| CN102304573A (en) | Nucleotide sequence for bacterium diagnosis and application | |
| CN101768633B (en) | Composition for detecting O139 group vibrio cholerae, kit and detection method for food | |
| CN103305613B (en) | Giant salamander pathogenic hydrophila gingivalis PCR diagnostic kit | |
| CN109750114A (en) | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production | |
| CN102154469A (en) | General detection method for pathogenic vibrios and nucleic acid isothermal amplification detection kit used in same | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| Wang et al. | Endonuclease restriction-mediated real-time PCR for simultaneous detection of Listeria monocytogenes and Listeria ivanovii | |
| CN106222291B (en) | A kind of kit of Molecular Detection strain different with identification sugarcane red streak bacterium | |
| CN104328113B (en) | One group of nucleotide sequence and the application in Listeria monocytogenes is identified |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110713 Termination date: 20120921 |