CN101144080A - Method for preparing recombination human VIP-Humanin fusion protein - Google Patents

Abstract

The name of the present invention is a preparation method of recombinant human VIP-Humanin fusion protein. The present invention relates to the technical fields of biological engineering, food engineering and health care product. The present invention adopts the DNA reconstructing technology, according to the bacillus coli favorite coding, the coding gene of a series and co-expression human VIP-Humanin fusion protein is designed and synthetized and cloned into pET28a (+) through BamHI and SaCI; after the positive clone is screened out, a single colony is chosen to perform the optimizing treatment to the fermenting condition and the isolation and purification process of products. After being fermented about 3 hours, the OD600 reaches to 0.6 to 0.7 hours, an inductor is added till the concentration reaches to 1 mmol/mL, the induce express is 4 hours, the synthesis of aim protein achieves the peak, crude protein is separated through adopting the Ni-chelate affinity chromatography, a DEAE-sepherose ion exchange column is purified, through reconstruction, after enterokinase is enzymed and purified, the rhVIP-Humanin fusion protein is obtained. The attributes of Tricine-SDS-PAGE, RP-HPLC and MALDI-TOF-TOF-MS, etc., are adopted to confirm that the prepared protein is rhVIP-Humanin. The rhVIP-Humanin is used to prevent and cure the senile dementia.

Description

Method for preparing recombination human VIP-Humanin fusion protein

Technical field the present invention relates to biotechnology, bio-pharmaceutical field, especially use the DNA recombinant technology, make up people's vasoactive intestinal peptide (vasoactive intestinal polypeptide, VIP) with Humanin (HN) fusion rotein, by the method for gene engineering colibacillus fermentative preparation recombination human VIP-Humanin fusion protein.

Background technology people's vasoactive intestinal peptide (VIP) is a kind of neuropeptide, and total length is 28 amino acid, and the C end is the amidation l-asparagine.VIP mainly is neuroendocrine and paracrine action, comprises the promotion peripheral vasodilation, the unstriated muscle expansion, vagusstoff (ACh) effect is promoted in the gastric acid inhibitory secretion, promotes fat and liver starch to decompose, promote insulin secretion, promote the electrolyte secretion of small intestine etc.; In central nervous system, VIP promotes the prolactin secretion, and cerebral cortex neurons is had excitation, and the motion of the vertebra neurone is also had the depolarization effect.VIP also participates in the adjusting of sleep physiology, but the effect of promote sleep.In addition, VIP can promote lymph gland B cell to produce antibody, and suppressor T cell propagation is regulated the killing activity of natural killer cell etc.

People Humanin (HN) is a kind of neuroprotective polypeptide that Hashimoto equals the calendar year 2001 discovery, and total length is 24 amino acid.It can block the nerve cell death that is caused by familial Alzheimer (FAD) gene and beta-amyloyd peptide (A β) special and effectively.Its mechanism of action may be HN reaches the neuroprotective cell by the signal path of blocking some necrocytosis specifically effect.Calendar year 2001 Mamiya T. waits [Gly (14)]-HN with chemosynthesis to carry out cell and mouse experiment, and the result shows that the latter is more effective than HN, can play very significantly improvement effect to the learning and memory of mouse.Therefore HN is a kind of very promising anti-AD medicine.

In view of the medicinal effect and the self structure feature of above-mentioned two peptide species, the present invention is designed to a fusogenic peptide with them, in the hope of reaching drug bioavailability height, the better target of drug effect.

Summary of the invention

1. according to the primary structure of people VIP and HN, designed a series connection coexpression fusion rotein.Its N end of VIP position, its C end of HN position, the centre is the little peptide of connection that designs voluntarily, and length is 13 amino acid, and two is two basic aminoacidss.Take the ripe required of fusion rotein into account, before VIP, add the enteropeptidase recognition sequence (DDDDK-).

2. based on 1, adopt intestinal bacteria preference password, obtain the dna sequence dna of this fusion rotein of coding; Both sides add recognition sequence and the protectiveness base of BamH I and SacI.Designed and synthesized 6 primers that PCR is required according to this, adopted bypass method to obtain required dna fragmentation through PCR, pET28a (+) is advanced by BamH I and the site-directed clone of SacI in the order-checking back, obtains expression vector.

3. the positive colony fermentation condition obtains high expression level purpose product through optimizing.

4. adopt separation purification process such as multiple chromatography, obtain the VIP-HN fusion rotein.

Description of drawings

Fig. 1. the construction of expression vector synoptic diagram

Fig. 2. adopt the diagram of the synthetic goal gene of bypass method

Fig. 3. obtain target DNA at 1.5% agarose gel electrophoretogram through bypass method PCR. wherein first road is 100bp landerMarker, and second road is the PCR product, and goal gene is 231bp, and a band is arranged between 200bp and 300bp as seen from the figure.

Fig. 4. the sequencing result of fusion rotein VIP-HN encoding gene (arrow marks 51 to 263 for target gene sequences among the figure)

Fig. 5. fusion rotein VIP-HN abduction delivering result's Tricine-SDS-PAGE collection of illustrative plates, 1, induce the fermentation 4h; 2, induce primary fermentation 4h.3, molecular weight marker thing (, be respectively 97,66,45,30,20.1 from top to bottom, 14.4KD) as seen from the figure, before and after inducing considerable change to be arranged, obvious expression albumen is arranged about 11KD, close with target protein.

Fig. 6. substance assistant laser desorpted attached ionization flight time tandem mass spectrum (MADIL-TOF/MS) collection of illustrative plates of fusion rotein VIP-HN

Embodiment

1.rhVIP-HN the clone of gene

1.1 the design of series connection coexpression fusogenic peptide

VIP and HN are the linear polypeptides that alzheimer's disease is had the improvement effect, wherein VIP has 28 amino acid, HN has 24 amino acid, their single expression are all difficult, the C of VIP end can't amidation, and if express the very little polypeptide of two molecular weight respectively the separation and purification in later stage is also put to no little inconvenience.So consider VIP and HN series connection coexpression have not only been improved molecular weight, the C that has also solved VIP holds amidated problem, and expects that it can have synergy on the effect of antagonism Alzheimer's disease.13 amino acid whose connection peptides of design prevent influencing each other of structure between two polypeptide between VIP and HN.The restriction enzyme site that adds enteropeptidase at the N end is to remove the amalgamation and expression peptide section on the carrier.

The aminoacid sequence of reorganization VIP-HN fusogenic peptide:

1.2 the design of rhVIP-HN gene primer

Aminoacid sequence according to VIP and HN converts gene order to by the intestinal bacteria preference codon, adopt bypass method to obtain goal gene and need synthesize six primers, add BamH I and two restriction enzyme sites of Sac I respectively at 5 ' end and 3 ' two primers holding.The primer resultant quantity is 2OD, and being diluted to final concentration is 50pmol/ μ L.

1.3rh the VIP-HN gene is synthetic

Adopt bypass method to carry out the synthetic of goal gene, pcr amplification goal gene

The PCR reaction system is as follows:

Amplification program:

Pre-95 ℃ of 5min of sex change

95 ℃ of 1min of sex change

64 ℃ of 1min of renaturation

Extend 72 ℃ of 1min

72℃ 10min

The PCR product carries out 1.5% agarose gel electrophoresis, behind ethidium bromide staining, and gel imaging.

1.4 goal gene is connected into expression vector pET28a (+)

Goal gene both sides restriction enzyme site is respectively BamHI and SacI, and the goal gene that is connected into the pMD-18T carrier that order-checking is correct downcuts, and electrophoresis reclaims segment, and pET28a (+) expression vector is also cut purifying with these two enzymes.

The fragment of downcutting is connected with the carrier that cuts, and linked system is as follows:

The plasmid that the repetition above-mentioned steps will be connected with expression vector is transformed into DH5 α (kantlex screening), after enzyme is cut evaluation order-checking correctly, recombinant plasmid can be changed over to expression strain BL21 (DE3).The rhVIP-HN genetically engineered bacterial classification that builds is saved as the glycerine pipe, and-20 ℃ frozen.

The abduction delivering of 2 genetic engineering bacteriums

2.1 actication of culture

Freezing glycerol stock in-20 ℃ of refrigerators is rule on the flat board that contains Kan (30 μ g/mL), and picking list colony inoculation is cultivated 8～10h in liquid LB substratum.

2.2 culture of seed liquid

The activatory bacterial classification inoculation is contained Kan (30 μ g/mL) in 10ml LB liquid nutrient medium, 37 ℃ of shaking table temperature, rotating speed 200r/min cultivates 3h.

2.3 fermentation culture

Cultured seed liquid is inoculated in (liquid amount 30% contains kantlex 30 μ g/ml) in the fermention medium, rotating speed 200r/min, 37 ℃ of cultivations in the ratio of 1: 100 (v/v).Fermentation 3h left and right sides OD600 reaches at 0.6～0.7 o'clock, adds inductor to final concentration 1mmol/mL, abduction delivering 4h.

The SDS-PAGE polyacrylamide gel electrophoresis is relatively before and after inducing:

3. the separation and purification of fusion rotein rhVIP-HN

3.1 the preparation of inclusion body

Fermented liquid through the centrifugal 15min of 4800r/min, is collected in the refrigerator that thalline is frozen in-20 ℃ and stored.Before the smudge cells, multigelation is several times so that cell walls is easier to fragmentation, use then cell washing liquid (100mmol/L Tris-HCl, 10mmol/LEDTA, 100mmol/L NaCl, pH8.0) washed twice is stored in-20 ℃ refrigerator again.Before broken with 10 times of volume cell washing liquid thalline that suspends again, ultrasonic disruption in ice bath.

Ultrasonic disruption condition: power 600W, ultrasonic 5s, 10s at interval.

Microscopy is not used 10000r/min after having complete intestinal bacteria, 4 ℃ of centrifugal 30min, and supernatant discarded promptly obtains the warm proteic inclusion body crude product of rhVIP-HN.

3.2 the washing of rough inclusion body

The crude product of fusion rotein inclusion body is added in the inclusion body washings, and magnetic agitation is washed half an hour, 10000r/min, and 4 ℃ of centrifugal 30min, supernatant discarded is washed half an hour with same washings again, and is centrifugal, abandons supernatant.In order to prevent that the composition in the washings from exerting an influence to sex change, renaturation process, use deionized water wash at last, centrifugal, supernatant discarded is got precipitation and is promptly obtained the warm proteic refining inclusion body of rhVIP-HN.

3.3 the dissolving of inclusion body

The ratio that inclusion body after the washing is added 10ml in 0.5g adds the inclusion body lysate, and (pH7.0), magnetic agitation is spent the night in ice bath for 7mol/L Guanidinium hydrochloride, 100mmol/LTris-HCl.Then, 14000r/min, 4 ℃ of centrifugal precipitations of going are got the lysate that supernatant is the inclusion body of target protein.

3.4 the separation of fusion rotein rhVIP-HN

Because the fusion rotein N that pET-28a (+) expression vector is expressed end has six Histidines, can combine with immobilized some divalent-metal ion (as nickel) on metal chelate affinity chromatography (IMAC) post by forming coordinate bond, can and Ni ²⁺Form coordinate bond with, with the imidazole buffer wash-out of different concns, through protein content in ultraviolet monitoring instrument (280nm) the continuously measured solution.

To be stored in the Chelating Sepharose Fast Flow dress post in 20% the ethanol earlier,, cross post with fix N i with the NiSO4 of the 0.1M/L of 5 times of column volumes with the deionized water rinsing of 10 times of volumes ²⁺After, use level pad 100mmol/LNa ₂HPO ₄10mmol/L Tris, 500mmol/LNaCl, 6mol/L Urea (pH 7.5) washes 10 column volumes, with dissolved inclusion body supernatant with 5 times of level pad dilutions after, rely on action of gravity to allow sample liquid slowly from post, flow out, go up sample more again after will effluent liquid collecting, 3 times so repeatedly, allow albumen fully be combined on the pillar.Again with level pad balance again, unconjugated albumen is washed, after getting back to baseline again to the registration of ultraviolet monitoring instrument, the level pad of the promptly available 50mmol/L of containing imidazoles washes foreign protein, and the level pad with the imidazoles that contains 200mmol/L washes target protein again.

Because imidazoles also has absorption peak at 280nm place, thus can not the refunds baseline during wash-out, can measure protein concentration by the Xylene Brilliant Cyanine G method, to there being albumen outflow can not stopping collection substantially.The protein sample of collecting is detected through the SDS-PAGE polyacrylamide gel electrophoresis, and the rhVIP-HN purity of visible separation and purification reaches more than 90% on the electrophorogram.

3.5 the renaturation of fusion rotein rhVIP-HN

Fusion rotein is the separation of carrying out under the sex change condition, so need renaturation.The protein liquid of collecting is dialysed overnight in 2mol/L Urea earlier, uses 0.1mol/L Urea then, 100mmol/LNa2HPO4,10mmol/L Tris, the 0.25mol/L NaClpH7.5 24h that dialyses.

4.rhVIP-HN the preparation of finished product

Because the just fusion that above-mentioned separation and purification obtains has the fusion rotein of coexpression peptide section on pET28a (+) carrier, so need be with enteropeptidase with its excision fusogenic peptide section.Enzyme is cut back albumen and is become about 7KD by 11KD.

4.1 the enteropeptidase enzyme is cut

After the deionized water dialysis, lyophilize concentrates with the protein solution of renaturation.Add 1/10 enzyme and cut 10 * enzyme cutting buffering liquid of system cumulative volume (0.5mol/L Tris, 10mmol/L CaCl ₂, 1%Tween-20), 20 ℃ of enzymes are cut 24h.

4.2 cutting the back, separates enzyme

After enzyme was cut, becoming two little peptides was respectively about 4KD and 7KD, and wherein the peptide weak point of 3KD contains 6 His, and did not have His among the rhVIP-HN of enzyme after cutting, so also adopt metal chelate chromatography that the small segment of 4KD is gone out.

Sample after enzyme cut is with metal-chelating level pad (100mmol/L Na ₂HPO ₄, 10mmol/L Tris 0.5mol/LNaCl) is diluted to 10mg/mL, and metal chelating column is also used the balance liquid balance, and effluent liquid is rhVIP-HN behind the last sample.After collecting effluent liquid dialysis desalination, lyophilize promptly makes the pure product of rhVIP-HN.

5.rhVIP-HN substance assistant laser desorpted attached ionization flight time tandem mass spectrum MALDI-TOF-TOF MS identify

5.1 pre-treatment and Trypsin enzymolysis

Sample behind the enteropeptidase enzymolysis is carried out the SDS-PAGE polyacrylamide gel electrophoresis, the cutting-out of the rhVIP-HN purpose band about 7.25KD is used for MALDI-TOF-TOF-MS analyzes.Micelle needs to carry out enzymolysis through the following step, is used for mass spectrum after the extraction peptide section and identifies.

1. decolouring: 50% acetonitrile+50mM bicarbonate of ammonia 100uL, 20 minutes.

2. remove solution wherein.Repeat twice.

3. dried glue: 100% acetonitrile 100uL, 10 minutes

4. remove acetonitrile wherein, put into 37 ℃ of baking oven 5-10 minutes then to guarantee dried fully glue.

5. enzymolysis: adding 5uL-10ul concentration is the trypsin enzyme solution of 12.5ng/uL, in 4 ℃ of refrigerators about 30 minutes, can absorb enzyme liquid well to guarantee micelle, and take out back enzymolysis in 37 ℃ of baking ovens and spend the night.

5. the peptide section is extracted: 50% acetonitrile+0.1%TFA 60uL, after 30-40 minute, solution is transferred in the 96 new orifice plates.Repeat 2-3 time.

With peptide section solution at N ₂Flow down and dry up concentratedly, identify to be ready for use on mass spectrum.

5.2 substance assistant laser desorpted attached ionization flight time tandem mass spectrum (MALDI-TOF-TOF MS) is identified

With the peptide section of complete drying be dissolved in again 0.7uL 0.5g/L CHCA (alpha-cyano-4-hydroxycinnamic acid) solution (solvent, 0.1%TFA+50%ACN) in, and it is all put on the stainless steel MALDI target plate, and seasoning at room temperature.

The mass spectroscopy condition:

Sample is with 4700 time-of-flight mass spectrometry instrument [4700 Proteomics Analyzer (TOF/TOFTM) (AppliedBiosystems, USA)] carry out mass spectroscopy, laser source is the Nd:YAG laser apparatus of 355 nm wavelength, acceleration voltage is 20kV, adopts positive ion mode and obtains the type collection data of data automatically.PMF mass scanning scope is 700-3500Da, and 5 peaks of intensity maximum carry out cascade mass spectrometry; Spectrogram carries out external standard with the myoglobin peptide hydrolysis and proofreaies and correct.Gained result GPS (Applied Biosystems, USA)-(Matrix Science, London UK) carry out database retrieval to MASCOT.

Search parameter is provided with: with rhVIP-HN is search database; The mode of data retrieval is combined; It is 1 that the site is cut in maximum permission leakage; Enzyme is a trypsinase.The quality error scope is provided with: PMF 0.3Da, MS/MS 0.4Da; Pancreatin is all rejected by hand from the peak of degradation peak and pollution substance when database retrieval.

Table 1 The MALDI-TOF MS data and pancreatin are separated the segmental distribution of rhVIP-HN

m/z(Da)	The fragment position	Peptide sequence
			2303.2501	42-62	MAPRGFSCLLLLTSEIDLPV K
2004.1198	46-63	GFSCLLLLTSEIDLPVKR
			1848.0186	46-62	GFSCLLLLTSEIDLPVK
1694.8245	1-14	HSDAVFTDNYTRLR
			1425.6393	1-12	HSDAVFTDNYTR
1148.6534	22-30	YLNSILNRR
			1120.6473	21-29	KYLNSILNR
992.5523	22-29	YLNSILNR
			986.5490	30-40	RGGAGIVGGSR
958.5428	31-41	GGAGIVGGSRK
			830.4478	31-40	GGAGIVGGSR
704.4123	15-20	KQMAVK
			704.4123	16-21	QMAVKK
602.3443	41-45	KMAPR
			576.3174	16-20	QMAVK

Data in the table 1 have covered 96.9% of rhVIP-HN whole sequence.The following fragment of 500Da is not listed in table.It is 7248.51Da that analysis draws molecular-weight average, and single isotopic molecule amount is 7243.94.Conform to the molecular weight of estimating, the albumen of proof detection is rhVIP-HN thus.

The sequence page

1. the aminoacid sequence of reorganization VIP-HN fusogenic peptide:

DDDDKHSDAV FTDNYTRLRK QMAVKKYLNS ILNRRGGAGI VGGSRKMAPR GFSCLLLLTS EIDLPVKRRA

2.rhVIP-HN the design of gene primer

Primer1

5’GGC GATGATGATGACAAACATTCCGATGCGGTGTTTACCGATAACTATA3’(55)

Primer2

5’CGGTGAAAAAATATCTGAACAGCATTCTGAACCGCCGCGGCGGCGCGGGCATTGT 3’(55)

Primer3

5’CCCGCGCGGCTTTAGCTGCCTGCTGCTGCTGACCAGCGAAATTGATCTGC3’(50)

Primer4

5’CAGATATTTTTTCACCGCCATCTGTTTGCGCAGGCGGGTATAGTTATCGGTAAAC 3’(55)

Primer5

5’AGCTAAAGCCGCGCGGGGCCATTTTGCGGCTACCGCCCACAATGCCCGCGCCGCC 3’(55)

Primer6

5’GCG

TTACGCGCGGCGTTTCACCGGCAGATCAATTTCGCTGGTC 3’(49)

3. the nucleotide sequence of reorganization VIP-HN fusion rotein encoding gene

GGC

G ATGATGATGA CAAACATTCC GATGCGGTGT TTACCGATAA CTATACCCGC

CTGCGCAAAC AGATGGCGGT GAAAAAATAT CTGAACAGCA TTCTGAACCG CCGCGGCGGC

GCGGGCATTG TGGGCGGTAG CCGCAAAATG GCCCCGCGCG GCTTTAGCTG CCTGCTGCTG

CTGACCAGCGAAATTGATCT GCCGGTGAAA CGCCGCGCGT AA

CG C(231)

Claims (9)

1. the preparation method of a recombinant human VIP-HN fusion rotein is characterized in that, adopts genetic engineering fungus fermentation method production, rather than prepares from naturally occurring biomaterial.

2. genetic engineering fungus fermentation method as claimed in claim 1 comprises: a, the design of recombinant human VIP-HN fusion rotein genes involved are with synthetic, b, structure recombinant human VIP-HN fusion protein expression vector, c, transform the host with described expression vector and make up genetic engineering bacterium, d, utilize described genetic engineering bacterium fermentative production recombinant human VIP-HN fusion rotein.

3. production method as claimed in claim 1 or 2, described genes involved structure is:

GGCGGATCCG ATGATGATGA CAAACATTCC GATGCGGTGT TTACCGATAA CTATACCCGC

CTGCGCAAAC AGATGGCGGT GAAAAAATAT CTGAACAGCA TTCTGAACCG CCGCGGCGGC

GCGGGCATTG TGGGCGGTAG CCGCAAAATG GCCCCGCGCG GCTTTAGCTG CCTGCTGCTG

CTGACCAGCG AAATTGATCT GCCGGTGAAA CGCCGCGCGT AAGAGCTC CG C(231)

4. method as claimed in claim 2, wherein the technical process of fermentative production recombinant human VIP-HN fusion rotein is as follows: select single bacterium colony genetic engineering bacterium, carry out seed liquor and amplification culture, abduction delivering, collect thalline for following jar and carry out cytoclasis, the centrifugal inclusion body that gets, broken inclusion body and target protein sex change and renaturation are crossed Ni ²⁺It is former that metal chelating column obtains target protein, passes through Ni after enteropeptidase is separated again ²⁺Metal chelating column obtains recombinant human VIP-HN fusion rotein, desalination and impurity elimination again, and freeze drying example, quality inspection gets final sample.

5. as claim 1,3 described recombinant human VIP-HN fusion roteins, it is:

DDDDKHSDAV FTDNYTRIRK QMAVKKYLNS ILNRRGGAGI VGGSRKMAPR GFSCLLLLTS EIDLPVKRRA

6. gene nucleotide as claimed in claim 3 order, and replace the gene that obtains not changing the base of being carried out under its amino acid sequence coded prerequisite.

7. amino-acid sequence as claimed in claim 5, and the amino acid that is carried out under the prerequisite that does not change its biological function is replaced the huge peptide that obtains.

8. the described carrier of claim 2 is commercial pET28a (+), and substitute.

9. the described host cell of claim 2 is commercial BL21 (DE3), and substitute.

Images