CN101113470A - SLC39A7 gene as genetic label of pig fat deposition description and application thereof - Google Patents
SLC39A7 gene as genetic label of pig fat deposition description and application thereof Download PDFInfo
- Publication number
- CN101113470A CN101113470A CNA2007100524558A CN200710052455A CN101113470A CN 101113470 A CN101113470 A CN 101113470A CN A2007100524558 A CNA2007100524558 A CN A2007100524558A CN 200710052455 A CN200710052455 A CN 200710052455A CN 101113470 A CN101113470 A CN 101113470A
- Authority
- CN
- China
- Prior art keywords
- pig
- gene
- slc39a7
- genetic marker
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention pertains to the technical field of pig genetics and breeding and assistant selection by molecular marker, in particular to a genetic marker for screening SLC39A7 gene of pig fat deposition trait. The genetic marker has a nucleotide sequence as shown in sequence table SEQ ID NO.1 and SEQ ID NO. 2. A missense mutation of A250-G250 is shown in the place of 250bp in the SEQ ID NO.1, which causes the coded amino acid to be changed from arginine to glycine and causes polymorphism of HpaII-RFLP. The genetic marker of the invention is adopted to do relative analysis of relative fat deposition trait of foreign pig variety and local variety in China. The invention also discloses a detection method of SNP typing of a third exon in SLC39A7 gene and provides the novel genetic marker and the detection method for assistant selection by molecular marker.
Description
Technical field
The present invention relates to the molecule assisted Selection technical field of pig breeding and pig, be specifically related to the segmental clone of fatty deposits trait related gene SLC39A7DNA of a kind of and pig and as the application of the genetic marker of label of pig fat deposition description proterties, for the marker assisted selection of pig provides a kind of new mark and novel method.
Background technology
The breeding value that phenotypic number by the production traits estimates is carried out animal selection breeding, has promoted the genetic improvement of Livestock Production proterties greatly.Since the nineties, along with the progress of Protocols in Molecular Biology and in the pig Application for Field, progressively having occurred is the molecular marker assisted selection and the infiltration equimolecular breeding technique of core with the molecule marker, and these technology combine with conventional breeding, have quickened the pig breeding process greatly.The gene or the mark that can be applied to molecular marker assisted selection must have bigger genetic contribution to objective trait, be major gene or mark, therefore seeking prerequisite and the basis that these major genes and closely linked with it molecule marker become molecular marker assisted selection, also is the research emphasis and the urgent problem of for some time pig biology field at present and in the future.
Have a plurality of being found and applying for a patent of functional gene inside that are positioned at present with the closely linked molecule marker of the production traits.For example, at traditional pig breeding in the works, because the human consumer to the interest of lean meat, therefore selects mainly to emphasize to reduce fat.Fat reduces mainly to reduce with the thickness of backfat to be weighed.Yet the thickness of backfat descends and has caused the decline of intramuscular fat equally, and the last deposition site of fat is a muscle, so the acceptance level of intramuscular fat and taste and muscle is proportionate.For preventing that intramuscular fat from further descending, must find the molecule marker that influences this proterties, because intramuscular fat is difficult in the live body vacuum metrics.Gerbens etc. have confirmed to be arranged in the relation of muscle tissue special candidate gene heart fat acid binding protein and pig intramuscular fat content and other production traits on No. 6 karyomit(e)s of pig, and this gene has been applied patent, and its patent No. is WO97/35878; In addition, Rothschild etc. have found the molecule marker relevant with lean ratio in the leptin acceptor gene, and its patent No. is U.S.Pat.Nos.5972621.
In whole vital movement process, zinc has multiple effect, and it has not only participated in protein, nucleic acid, carbohydrate and lipid metabolism, but also has participated in genetic transcription control, growth, growth and differentiation.Zinc is not only the cofactor of 300 plurality of enzymes, and is that multiple zinc refers to the constituent with ring finger protein.Zine ion can not be passive diffuse through cytolemma, must have zinc translocator transhipment zinc to enter enchylema, so the zinc translocator is keeping the balance between the growth of natural death of cerebral cells and cell to have crucial effects.39 members 7 (SLC39A7) of zinc translocator family belong to zinc translocator family, this gene mainly is positioned on the subcellular structure films such as the endoplasmic reticulum, golgi body of cell, the Chinese hamster ovary cell of expressing this gene recombinant protein can improve the content of free zine ion, and this gene carries out the transhipment of zinc mainly from the golgi cell device to tenuigenin.
Many reports show, in the plum mountain pig with place of china pig blood relationship and other pig kind hybridization F2 resource colony, there are the QTL (BidanelJP etc. of fatty deposits proterties such as remarkably influenced fat thickness at back of pig in No. 7 karyomit(e)s, .Current status of quantitative trait locus mapping in pigs.Pig News and Information, 2002,2:39-54; Sato S etc., Quantitative trait loci analysis for growth and carcass traitsin a Meishan * Duroc F2 resource population.J Anim Sci, 2003,81 (12): 2938-2949; Zuo B (2004) Mapping of quantitative trait loci on porcine chromosome 7 using combined data analysis.Asian-AustralianJournal of Animal Science 17 such as (left ripples), 1350-1354).What is interesting is that this QTL zone all is positioned at the pig major histocompatibility complex band of position, and the allelotrope of the reduction thickness of backfat derives from plum mountain swinery body among this QTL, rather than Large White colony.Therefore, probably there is the same recessive favourable QTL that derives from plum mountain pig in this zone.Be fabricated about this area B AC storehouse at present and check order, the SLC39A7 gene is exactly a functional gene that is positioned to this QTL zone, and its gene structure is made up of 8 exons and 7 introns.
Up to now, Shang Weijian about with fatty deposits trait related gene SLC39A7DNA genetic marker of pig and the report of in polymorphism analysis, using thereof.
Summary of the invention
The specific DNA fragment that the objective of the invention is to clone pig SLC39A7 gene, as the genetic marker of label of pig fat deposition description proterties and in the application of the context of detection of label of pig fat deposition description proterties polymorphism, for the marker assisted selection of pig provides a kind of new mark and novel method.
The invention provides the genome nucleotide sequence that European blood relationship pig variety " Large White " and place of china blood relationship pig variety " plum mountain pig " comprise the 402bp of pig SLC39A7 gene the 3rd exon, its dna sequence dna such as sequence table SEQ ID NO:1 (Large White), SEQ ID NO:2 (plum mountain pig); Carrying out Cluster W comparison by the above-mentioned sequence of 2 pig kinds (Large White and Mei Shan pig) provides the 2 place's single nucleotide polymorphism (SNP) that are positioned at this 402bp amplified fragments inside, and its SNP site as shown in Figure 1.
The step for preparing this gene fragment is as follows: selecting Chinese native pig breed plum mountain pig and external European pig Large White is test materials, from pig blood, extract DNA, according to the genome sequence of pig SLC39A7 gene (with reference to the GeneBank accession number: CT737383) design primer, sequence is as follows:
Forward primer F:ATCCTGCTGAGTTTTGCTTCG,
Reverse primer R:TGGGGATGGACACATTGAGAC.
Utilize this primer to carry out pcr amplification, PCR product purification, cloning and sequencing, sequence comparing analysis.
The invention provides HpaII-RFLP (restriction fragment length polymorphism) the genotyping method of identifying the above-mentioned sequence 250bp A/G of place variation.Its step comprises: (the GeneBank accession number: CT737383) design primer, its primer sequence is as implied above, carries out pcr amplification in the pig genomic dna, pcr amplified fragment HpaII enzyme cutting type and detection according to pig SLC39A7 gene genome sequence.
Further, the invention provides the application of the association analysis that utilizes definite different genotype individuality of HpaII-RFLP method and the correlationship between the fatty deposits proterties.
Sequence table, description of drawings:
Sequence table SEQ ID NO:1: the nucleotide sequence that is European blood relationship pig variety " Large White ";
Sequence table SEQ ID NO:2: the nucleotide sequence that is place of china pig blood relationship kind " plum mountain pig ";
Wherein: sequence table SEQ ID NO:1: be the specific nucleotide sequence of implementing pig SLC39A7 gene the 3rd exon A/G variation HpaII-RFLP (restriction fragment length polymorphism) genotyping method;
Sequence table SEQ ID NO:2: be the specific nucleotide sequence of implementing pig SLC39A7 gene the 3rd exon A/G variation HpaII-RFLP (restriction fragment length polymorphism) genotyping method.
Fig. 1: be respectively Large White and Mei Shan pig SLC39A7 gene order comparison result and SNP site.
Fig. 2: SLC39A7 gene HpaII-RFLP detected result
Agarose gel concentration is 1.5%; Among the figure: swimming lane M is DL2000Markers; 3,4 swimming lanes are the AA genotype, 402bp; 1 swimming lane is the AB genotype, 402bp, 250bp, 152bp; 2 swimming lanes are the BB genotype, 250bp, 152bp.
Embodiment
The acquisition of embodiment 1:SLC39A7 gene fragment and the foundation of pleiomorphism detecting method
" plum mountain pig " two kinds of different genotype pig varieties that selection has European blood relationship " Large White " and has a place of china pig blood relationship are test materials, according to pig SLC39A7 gene genome sequence (GeneBank accession number: CT737383), design following primer, primer sequence is as follows:
Forward primer F:ATCCTGCTGAGTTTTGCTTCG
Reverse primer R:TGGGGATGGACACATTGAGAC
In Large White and Mei Shan pig genomic dna, carry out pcr amplification with above-mentioned primer, the PCR reaction system is 25 μ l, wherein template DNA is 50ng, dNTPs concentration is 200 μ mol/L, every primer concentration is 0.4 μ mol/L, the Taq archaeal dna polymerase of 3U (available from BiostarInternational, Canada), adds deionized water to cumulative volume 25 μ l; PCR response procedures: 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 50s, 64 ℃ of annealing 50s, 72 ℃ of extensions 1min, totally 35 circulations then; Last 72 ℃ are extended 10min.
Behind PCR product to above-mentioned two kinds of genotype pig kinds purified (give birth to the worker UNIQ-10 of company pillar DNA glue referring to Wuhan and reclaim the test kit specification sheets), the clone, carry out sequencing, sequencing is given birth to worker biotech company by Shanghai and is finished.The PCR product sequence of above-mentioned two kinds of genotype pig kinds is carried out sequence alignment through ClusterW software, and comparison result is seen Fig. 1 between sequence.Above-mentioned amplified fragments size is 402bp, co-exists in 2 nucleotide variations, and the A/G variation that wherein is positioned at this segmental 250bp place has caused corresponding amino acid whose sudden change, and has caused HpaII restriction enzyme site (↓ CCGG) polymorphism.
Get that 8.5 μ lPGR products add 0.5 μ l (10U/ μ l) restriction enzyme and 1 μ l10 * buffer (contains 10 * BSA), 37 ℃ of HpaII enzymes are cut 4h, get 5 μ l enzymes and cut product with agarose or polyacrylamide gel electrophoresis detection, under ultraviolet lamp or silver dye that the back is observed and the record enzyme is cut the result.This amplified fragments size is 402bp, the HpaII enzyme is cut pleomorphism site and is positioned at this segmental 250bp place, if the base at 250bp place is A, then there is not the HpaII restriction enzyme site, cuts detected result with the HpaII enzyme and have only a 402bp fragment (A allelotrope), when this site is G, the result causes the generation of a HpaII restriction enzyme site, enzyme is cut and is obtained two fragments, and length is respectively 250bp and 152bp (B allelotrope), and the result as shown in Figure 2.
Embodiment 2: the application that the present invention clone's the polymorphism of genetic marker in the different genotype swinery detects
Utilize genetic marker of the present invention to detect from two the external swinerys (Large White, landrace) of European blood relationship and the HpaII-RFLP polymorphism of middle detection pig SLC39A7 the 3rd exon of 6 swinerys from place of china pig blood relationship (Wan Nan flower pig, eight eyebrow pigs, Jianli pig, Yangxin pig, plum mountain pig, the black pig of west place in Hubei), detected result is as shown in table 1.In the several pig kinds that detected, Europe blood relationship pig kind Large White, the allelic gene frequency of the dominant A of landrace group are respectively 0.734 and 0.679, the allelic gene frequency of B of advantage is respectively 0.917,0.667,0.714,1,0.738 and 0.615 in place of china pig blood relationship pig kind Wan Nan flower pig, eight eyebrow pigs, Jianli pig, Yangxin pig, plum mountain pig, the black pig of west place in Hubei, come between Europe and Chinese native pig breed their gene frequency performance significant difference above-mentioned.
Table 1 SLC39A7 gene HpaII enzyme is cut the distribution results of polymorphism in different pig kinds
| Kind | Quantity | The AA genotype | The AB genotype | The BB genotype | The A gene frequency | The B gene frequency |
| The black pig of pig plum mountain, pig Yangxin, Large White landrace Wan Nan flower pig eight eyebrow pig Jianli pig west place in Hubei | 32 28 18 12 14 12 42 13 | 19 12 0 0 1 0 5 3 | 9 14 3 8 6 0 12 4 | 4 2 15 4 7 12 25 6 | 0.734 0.679 0.083 0.333 0.286 0 0.262 0.385 | 0.266 0.321 0.917 0.667 0.714 1 0.738 0.615 |
Embodiment 3: the present invention clone's the application of genetic marker in the association analysis of label of pig fat deposition description proterties
(1) single labeled analysis
In order to determine whether the SLC39A7 gene pleiomorphism is relevant with the pig phenotypic difference, 293 Large Whites * plum mountain pig F2 that selects the Ministry of Agriculture of Hua Zhong Agriculture University pig genetics and breeding emphasis open laboratory, Chinese Wuhan City, Hubei Province to set up is a test materials for resource colony, the HpaII-RFLP method that adopts embodiment 2 to be set up is carried out polymorphism and is detected, and analyzes the correlationship of pig SLC39A7 gene HpaII-RFLP different genotype and hog on hook proterties.Employing SAS statistical software (SAS Institute Inc, Version8.0) the glm program is carried out single mark variance analysis, and model is as follows:
y
ijkl＝μ+g
i+f
j+s
k+y
l+βcov
ijkl+e
ijkl
y
IjklBe the proterties phenotypic number, μ is a mean value, g
iBe genotype effect (comprising additive effect of gene and dominant effect); s
k, y
i, f
jBe fixed effect, be respectively sex, year, family effect, β is the regression coefficient of slaughter weight; Cov
IjklFor slaughter weight as concomitant variable, e
IjklBe the residual error effect.
293 Large Whites that detected * plum mountain pig F2 for individuality in, the AA genotype has 97, the AB genotype has 143, the BB genotype has 53.Statistic analysis result between different genotype and carcass trait is summarized in table 2.As can be seen from Table 2, the HpaII-RFLP genotype is not simultaneously, exist significantly or utmost point significant difference in fatty deposits proterties such as leaf fat weight, lactones rate, the shoulder thickness thickness of backfat, the chest lumbar vertebrae junction thickness of backfat, the average thickness of backfat of buttocks and the average thickness of backfats, the allelotrope that derives from plum mountain pig variety reduces fatty deposits, and effect direction and interracial phenotypic effect are also not quite identical.This site does not have remarkable effect to eye muscle height, eye muscle area and lean ratio.
The statistical analysis table of table 2 SLC39A7 gene HpaII-RFLP genotype and hog on hook proterties
| Proterties | SLC39A7 genotype(μ±SE) | P-value | ||||
| AA | AB | BB | AA-AB | AA-BB | AB-BB | |
| The average thickness of backfat triadic mean of the heavy lactones rate shoulder thickness thickness of backfat chest lumbar vertebrae junction thickness of backfat buttocks of leaf fat thickness of backfat eye muscle height eye muscle area lean ratio | 0.753±0.023 3.055±0.066 3.596±0.077 2.099±0.057 1.865±0.065 2.515±0.058 8.674±0.089 29.261±0.505 54.725±0.393 | 0.706±0.019 3.048±0.054 3.496±0.064 2.022±0.047 1.831±0.053 2.452±0.048 8.702±0.074 28.814±0.418 55.046±0.325 | 0.615±0.031 2.829±0.089 3.333±0.105 1.844±0.077 1.688±0.088 2.248±0.079 8.858±0.121 28.467±0.687 54.162±0.534 | 0.124 0.934 0.322 0.301 0.690 0.408 0.805 0.500 0.533 | 0.0006 0.046 0.047 0.0093 0.039 0.0076 0.225 0.359 0.402 | 0.014 0.038 0.187 0.0509 0.165 0.028 0.271 0.667 0.158 |
(2) linkage analysis
Utilize Crimap2.4 software that linkage analysis is carried out in this site and 7 microsatellite markers of No. 7 karyomit(e), this chromosomal genetic map is: Swr1343-33.7-Sw2155-36.3-Sw1856-13.4-SLC39A7-26.1-Sw352-12.9-Sw252-33.1-Sw581-26.7-S0212, adopt QTL express software to carry out the QTL positioning analysis, and carry out test of significance, the model that adopts is:
Model 1:y
Ijklm=u+s
i+ f
j+ g
k+ β cov
Ijkm+ c
AmA+c
DmD+e
Ijkm
Model 2:y
Ijklm=u+s
i+ f
j+ g
k+ SL
l+ β cov
Ijklm+ c
AmA+c
DmD+e
Ijklm
Whether the model 1 and 2 key distinctions consider the SLC39A7 gene as fixed effect, and wherein model 1 is not considered the SLC39A7 gene as fixed effect, and model 2 has considered that the SLC39A7 gene is as fixed effect; Show by the QTL linkage analysis: do not considering (model 1) under the prerequisite of SLC39A7 gene as fixed effect, there is the QTL of remarkably influenced eye muscle area and lean ratio simultaneously in the QTL that has fatty deposits proterties such as remarkably influenced leaf fat weight, lactones rate, the shoulder thickness thickness of backfat, the chest lumbar vertebrae junction thickness of backfat, the average thickness of backfat of buttocks and the average thickness of backfat on this karyomit(e).When considering under the prerequisite of SLC39A7 gene as fixed effect (model 2), the significance level (F value) that influences the QTL of above-mentioned fatty deposits proterties significantly descends or is not significantly (table 3), and for muscle correlated character such as eye muscle area, eye muscle height and lean ratios, the F value changes little (table 3), illustrates that the influence of this gene pairs muscle correlated character is little; Additive effect is on the occasion of showing that the allelotrope that derives from plum mountain pig has the effect QTL that reduces the thickness of backfat.
Table 3 thickness of backfat QTL positioning result
| Proterties | Model | The position | Between the mark zone | The F value | Additive effect | Dominant effect |
| The heavy lactones rate of the heavy leaf fat of the average thickness of backfat triadic mean of shoulder thickness thickness of backfat chest lumbar vertebrae junction thickness of backfat buttocks thickness of backfat caul-fat eye muscle height eye muscle area lean ratio | 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 | 74cM 58cM 107cM 84cM 72cM 74cM 74cM 74cM 76cM 79cM 74cM 81cM 76cM 83cM 71cM 78cM 70cM 74cM 175cM 174cM | Sw1856-SLC39A7 Sw2155-Sw1856 SLC39A7-Sw352 SLC39A7-Sw352 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856-SLC39A7 Sw1856 Sw1856-SLC39A7 Sw581-S0212 Sw581-S0212 | 5.60 *3.89 8.37 **5.28 *5.65 *4.23 9.61 **6.57 *12.0 **5.61 *3.44 3.63 5.80 *3.73 4.48 5.56 *6.82 *6.07 *6.64 *6.19 * | 0.311±0.093 0.287±0.103 0.246±0.060 0.215±0.071 0.202±0.061 0.172±0.059 0.257±0.071 0.236±0.069 0.205±0.795 0.117±0.025 0.063±0.031 0.291±0.115 0.186±0.070 -0.070±0.067 0.192±0.100 0.527±0.249 1.575±0.467 2.086±0.707 1.430±0.420 1.402±0.428 | 0.063±0.143 0.060±0.173 0.030±0.097 0.070±0.120 0.064±0.092 0.055±0.086 0.111±0.105 0.066±0.108 0.130±0.845 0.054±0.040 0.091±0.048 0.417±0.179 0.266±0.115 -0.322±0.126 -0.268±0.140 -0.619±0.319 -0.533±0.635 -0.996±0.974 1.216±0.848 1.226±0.868 |
More than two kinds of methods the equal strong support of application the evidence of SLC39A7 gene as the recessive favourable thickness of backfat QTL candidate genes of No. 7 karyomit(e)s of pig.
Sequence table
＜110〉Hua Zhong Agriculture University
＜120〉the SLC39A7 gene is as the genetic marker and the application of label of pig fat deposition description proterties
<130>
<141>2007-06-12
<160>2
<170>PatentIn version 3.1
<210>1
<211>402
<212>DNA
＜213〉pig (Sus scrofa)
<220>
<221>gene
<222>(1)..(402)
<223>
<220>
<221>exon
<222>(218)..(271)
<223>
<220>
<221>mutation
<222>(250)..(250)
<223>
<400>1
atcctgctga gttttgcttc gggtgggctc ttgggagatg ccttcctgca cctcattcct 60
catgctctgg gtaagtgacc tcaaatctta gagtgtttta ttctttgaat gagagggttc 120
tttcctcttt gtgatccctg accttctagt gtccccccaa tacacacctt ttgtgtggga 180
tattccctta tctaaccttt tcccccactt cttccag aac ccc att ctc acc acc 235
Asn Pro Ile Leu Thr Thr
1 5
ctc tgg agc agc cca gac acg gac att ccc aca gtg gtaaggaagg 281
Leu Trp Ser Ser Pro Asp Thr Asp Ile Pro Thr Val
10 15
ggaggatgga gataatggtt tggggtgcta gggaaggtct gtccctccct gttctcctct 341
acttggggag gaagagtctg gaatctatat ttctcttaat gtctcaatgt gtccatcccc 401
a 402
<210>2
<211>402
<212>DNA
＜213〉pig (Sus scrofa)
<220>
<221>gene
<222>(1)..(402)
<223>
<220>
<221>mutation
<222>(250)..(250)
<223>
<220>
<221>exon
<222>(218)..(271)
<223>
<400>2
atcctgctga gttttgcttc gggtgggctc ttgggagatg ccttcctgca cctcattcct 60
catgctctgg gtaagtgacc tcaaatctta gagtgtttta ttctttgaat gagagggttc 120
tttcctcttt gtgatccctg accttctagt gtccccccaa tacacacctt ttgtgtggga 180
tattccctta tctaaccttt tcccccactt cttccag aac ccc att ctc acc acc 235
Asn Pro Ile Leu Thr Thr
1 5
ctc tgg agc agc ccg gac acg gac att ccc aca gtg gtaaggaaag 281
Leu Trp Ser Ser Pro Asp Thr Asp Ile Pro Thr Val
10 15
ggaggatgga gataatggtt tggggtgcta gggaaggtct gtccctccct gttctcctct 341
acttggggag gaagagtctg gaatctatat ttctcttaat gtctcaatgt gtccatcccc 401
a 402
Claims (5)
1. the genetic marker of the label of pig fat deposition description proterties SLC39A7 gene of a screening, it has the nucleotide sequence shown in sequence table SEQ ID NO:1 and SEQ IDNO:2.
2. genetic marker according to claim 1, it is characterized in that, there is the missense mutation of an A250-G250 at the 250bp place of sequence table SEQ ID NO:1, causes its amino acids coding to become glycine (Gly) by arginine (Arg), and causes the HpaII-RFLP polymorphism.
3. genetic marker according to claim 1, the dna sequence dna of specific DNA fragment the primer of wherein cloning SLC39A7 gene the 3rd exon is as follows:
Forward primer F:ATCCTGCTGAGTTTTGCTTCG,
Reverse primer R:TGGGGATGGACACATTGAGAC.
4. a screening is applicable to the method for the genetic marker of label of pig fat deposition description proterties, according to following steps:
From pig blood, extract genomic dna, according to pig SLC39A7 gene genome sequence design primer, obtain the primer shown in claim 3, in the genomic dna of pig gene, carry out pcr amplification with the primer shown in the claim 3, PCR product purification and cloning and sequencing obtain the nucleotide sequence shown in sequence table SEQ ID NO:1 and SEQ ID NO:2.
5. the application of the described genetic marker of claim 1 in label of pig fat deposition description proterties assisted Selection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100524558A CN101113470B (en) | 2007-06-13 | 2007-06-13 | SLC39A7 gene as genetic label of pig fat deposition description and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100524558A CN101113470B (en) | 2007-06-13 | 2007-06-13 | SLC39A7 gene as genetic label of pig fat deposition description and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101113470A true CN101113470A (en) | 2008-01-30 |
| CN101113470B CN101113470B (en) | 2010-12-08 |
Family
ID=39021999
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100524558A Expired - Fee Related CN101113470B (en) | 2007-06-13 | 2007-06-13 | SLC39A7 gene as genetic label of pig fat deposition description and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101113470B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101880663A (en) * | 2010-07-05 | 2010-11-10 | 华中农业大学 | Molecular markers related to swine production properties and preparation and application |
| CN101348832B (en) * | 2008-07-16 | 2011-08-10 | 华中农业大学 | Clone and use of molecular marker related to pig growth and meat quality traits |
| CN101544979B (en) * | 2009-01-22 | 2012-03-28 | 北京众仕和生物技术有限公司 | Major gene for porcine intramuscular fat deposition and molecular marker thereof |
| CN103255135A (en) * | 2012-02-21 | 2013-08-21 | 华中农业大学 | Pig PPARdelta gene 5' regulatory region as fat deposition trait genetic marker |
| CN103451180A (en) * | 2013-08-23 | 2013-12-18 | 中国农业大学 | Molecular marker related to sedimentary character of pork fat, and application thereof |
| CN104087582A (en) * | 2014-07-18 | 2014-10-08 | 湖北省农业科学院畜牧兽医研究所 | Pig fat deposition character SNP genetic marker and application thereof |
| CN106967832A (en) * | 2017-05-19 | 2017-07-21 | 广东海洋大学 | The deciding field method of Chicken rolls plumage character major gene resistance and application |
-
2007
- 2007-06-13 CN CN2007100524558A patent/CN101113470B/en not_active Expired - Fee Related
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101348832B (en) * | 2008-07-16 | 2011-08-10 | 华中农业大学 | Clone and use of molecular marker related to pig growth and meat quality traits |
| CN101544979B (en) * | 2009-01-22 | 2012-03-28 | 北京众仕和生物技术有限公司 | Major gene for porcine intramuscular fat deposition and molecular marker thereof |
| CN101880663A (en) * | 2010-07-05 | 2010-11-10 | 华中农业大学 | Molecular markers related to swine production properties and preparation and application |
| CN103255135A (en) * | 2012-02-21 | 2013-08-21 | 华中农业大学 | Pig PPARdelta gene 5' regulatory region as fat deposition trait genetic marker |
| CN103255135B (en) * | 2012-02-21 | 2014-10-15 | 华中农业大学 | Pig PPARdelta gene 5' regulatory region as fat deposition trait genetic marker |
| CN103451180A (en) * | 2013-08-23 | 2013-12-18 | 中国农业大学 | Molecular marker related to sedimentary character of pork fat, and application thereof |
| CN103451180B (en) * | 2013-08-23 | 2015-02-25 | 中国农业大学 | Molecular marker related to sedimentary character of pork fat, and application thereof |
| CN104087582A (en) * | 2014-07-18 | 2014-10-08 | 湖北省农业科学院畜牧兽医研究所 | Pig fat deposition character SNP genetic marker and application thereof |
| CN106967832A (en) * | 2017-05-19 | 2017-07-21 | 广东海洋大学 | The deciding field method of Chicken rolls plumage character major gene resistance and application |
| CN106967832B (en) * | 2017-05-19 | 2020-11-03 | 广东海洋大学 | Interval positioning method and application of chicken curly feather character major gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101113470B (en) | 2010-12-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101113470B (en) | SLC39A7 gene as genetic label of pig fat deposition description and application thereof | |
| CN106498052B (en) | Molecular labeling, detection method and its application of one influence goat early growth | |
| CN107164463B (en) | SNP marker for determining and/or genetically improving growth traits of pigs | |
| CN109929935B (en) | Method for identifying pig backfat thickness based on rs80995809 locus genotyping and application thereof | |
| CN104059963B (en) | Detection method of Chinese simmental cattle carcass and meat quality trait genetic markers | |
| CN104774836A (en) | Polygene pyramiding early-breeding method for raising litter size of sheep | |
| CN108048597B (en) | SNP molecular marker related to drought resistance of rice and application thereof | |
| CN104878099B (en) | The detection method of goat ATBF1 gene mononucleotide polymorphisms and its application | |
| CN110331211B (en) | Molecular marker SNP732 of Hu sheep MC4R gene and application thereof | |
| CN114150070A (en) | SNP molecular marker related to chicken growth and slaughter traits, detection primer, kit and breeding method | |
| CN116356038A (en) | Breeding method for screening Fugu rubripes individuals with rapid growth performance | |
| CN101818195B (en) | Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application | |
| CN113584181B (en) | SNP molecular marker related to pig residual feed intake and application thereof | |
| CN108950008B (en) | Breeding method for analyzing multi-site aggregation effect for improving number of lambs born by Hu sheep | |
| Sun et al. | Genetic variation in eight Chinese cattle breeds based on the analysis of microsatellite markers | |
| CN104087582A (en) | Pig fat deposition character SNP genetic marker and application thereof | |
| CN113699246A (en) | SNP molecular marker influencing pig feed conversion efficiency traits and application thereof | |
| CN103421771B (en) | Genetic marker for character of litter size of pig utilizing WIF1 gene | |
| CN110564867B (en) | SNP molecular marker of Qinchuan cattle CFL1 gene and detection method thereof | |
| CN104611349A (en) | FDFT1 gene key loci affecting Chinese simmental cattle fat deposition | |
| CN112080570A (en) | KASP labeled primer combination for identifying hybrid stichopus japonicus in Zhongrussia and application thereof | |
| CN103710427B (en) | Single nucleotide polymorphism, detection method and application of chicken gene | |
| CN114350818B (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CA2473263A1 (en) | Novel calpastatin (cast) alleles | |
| CN107828891B (en) | Molecular marker screening and application related to pig rib number characters |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101208 Termination date: 20130613 |