CN101100676A - Bivalent expression carrier for culturing anti-glyphosate plants - Google Patents
Bivalent expression carrier for culturing anti-glyphosate plants Download PDFInfo
- Publication number
- CN101100676A CN101100676A CNA2007101189684A CN200710118968A CN101100676A CN 101100676 A CN101100676 A CN 101100676A CN A2007101189684 A CNA2007101189684 A CN A2007101189684A CN 200710118968 A CN200710118968 A CN 200710118968A CN 101100676 A CN101100676 A CN 101100676A
- Authority
- CN
- China
- Prior art keywords
- plant
- gene
- glyphosate
- gat
- expression carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A bivalent plant expression carrier for culturing high anti-roundup transfer gene plant contains G2-aroA and gat. It has better anti-roundup performance and can be used to culture various high anti-roundup transfer gene plants.
Description
Technical field:
The present invention relates to a kind of bivalent expression carrier of cultivating anti-glyphosate plants, particularly relate to the two valency plant expression vectors that contain gat and G2-aroA gene.
Background technology:
Glyphosate (Glyphosate) is an inner sucting conduction type, the wide spectrum steriland herbicide, its mechanism of action is by suppressing EPSP synthase (full name is 5-enol pyruvic acid shikimic acid-3-phosphate synthase) activity in the plant materials, disturb the biosynthesizing of die aromatischen Aminosaeuren in the plant materials, cause plant death (S.R.Padgette et al., in Herbicide-ResistentCrops:Agricultural, Environmental, Economic, Regulatory, and TechnicalAspects, S.O.Duke, Ed. (CRC Press, Boca Raton, FL, 1996), pp.53-84).
If the intravital epsp synthase gene of plant is undergone mutation, produce the EPSP synthase lower with the glyphosate affinity, can not well even at all can not combine with glyphosate, then this plant has just had the resistance glyphosate ability.
In addition, the someone utilizes Transacetylase to make the intravital glyphosate N-of plant acetylize.Studies show that acetylize also can make glyphosate lose herbicidal activity (Castle et al., 2004).
Yet the resistance glyphosate effect of above-mentioned dual mode is very not satisfactory, as glyphosate meristematic tissue accumulation (Gougler﹠amp especially in plant materials; Geiger, 1981), can influence plants ' reproduction development and then reduce crop yield (Plineet al., 2002).
Summary of the invention:
The objective of the invention is to make up the EPSPS gene (G2-aroA) that contains resistance glyphosate simultaneously and two valency plant expression vectors of N-acetyl-transferase gat gene, cultivate transgenic plant with more excellent resistance glyphosate ability.
The present invention utilizes the gene (G2-aroA) and the N-acetyl-transferase gat gene of resistance glyphosate, and glyphosate active resistance approach is combined with the passive resistance approach, has made up the plant expression vector that contains these two genes simultaneously.
The recombinant plant expression vector that contains G2-aroA gene and gat gene provided by the invention can be expressed the EPSPS synthase of degradation of glyphosate and be made the acetylizad N-acetyl-transferase of glyphosate N-in plant.This reorganization bivalent expression carrier is meant at 5 ' of coding G2-aroA gene and gat gene holds the dna sequence dna and the 3 ' end of enhancer sequence, Ω sequence, Kozak sequence and secretory signal sequence, coding G2-aroA gene and the gat gene of the be operably connected promoter sequence of one or more restriction enzyme sites, one or more different sourcess, one or more different sourcess to have the terminator sequence that multienzyme is cut site and one or more different sourcess.
For make foreign gene in vegetable cell transcribe with translation skill on obtain to efficiently express, must be connected with suitable expression regulation element at the foreign gene flank.Designed among the present invention in recipient plant, efficiently expressing G2-aroA gene and gat gene required promotor, enhanser, terminator, polyadenylic acid sequence and being convenient in suitable substratum screening by the selectable marker gene of transformant etc.
Be suitable for the two valency carriers of the present invention in the G2-aroA gene is connected with the gat gene, and this DNA sequences encoding of startup is transcribed beginning in vegetable cell comprises composing type, induction type, tissue or organ specificity or specific promotor of etap.Include but not limited to cauliflower mosaic virus (CaMV) 35S or 19S promotor, mannopine synthetic enzyme (MAS) promotor, rouge alkali synthetase and octopine synthase promoter, the maize alcohol dehydrogenase promotor, diphosphoribulose carboxylase/oxygenase small subunit promotor, by the promotor and the 35S promoter of cauliflower mosaic virus of mannopine synthase gene merge the promotor that forms mutually, the 35S promoter of the cauliflower mosaic virus that has two enhancement sequences and the Ubi that is suitable in monocotyledons, expressing, Emu, ActinI promotor etc.The 35S promoter of the preferred cauliflower mosaic virus of the present invention.
Described terminator be meant any can termination structure the gene terminator of in plant, expressing, as comprise the terminator or the like of the two-way terminator of T-DNA7 ' 5 ', octopine synthase gene terminator, cauliflower mosaic virus 35S RNA terminator or nopaline synthase (Nos) gene or other genes of plasmid pTiA6.The terminator of the preferred Nos gene of the present invention.
Can use method as known in the art, with the bivalent gene construct that is suitable in vegetable cell, expressing provided by the invention, be connected to any can the carrier of self-replacation in bacterial cell or vegetable cell on.Such carrier for example comprises and is derived from colibacillary plasmid vector pUC18, pUC19 (Yanisch-perron et al., Gene 33:103-119,1985), plant expression vector pBI101 especially, pBI121, (the Jefferson of pBI131 system, et al., EMBO J.16:3901,1987) and (the Hajdukiewicz et al. of pCamBia system, Plant Mol Biol 25:989-994,1994; Hiei et al., The Plant J 6:271-282,1994) or the like.In a preferred embodiment of the invention, the carrier that carries G2-aroA gene and gat gene construct is pBlueScriptSK, pUC18, pUC19, pCamBia2301 etc., and the latter is particularly suitable for the instrument plasmid vector as the preparation plant bivalent expression vector.
Certainly, as previously mentioned, in order correctly to select and to identify by the plant transformed cell, but above-mentioned recombinant expression vector of the present invention also should contain selectable marker gene.The both sides of employed selectable marker gene can have adjusting sequence separately, to impel their expression in plant.The selective marker that is suitable for is known in the art.Foreign gene and other genes of coding selective marker can be contained in the same expression vector, perhaps are contained in when transforming in the simultaneously applied different carrier.The preferred selectable marker gene of the present invention is the NPTII gene, and together is contained in the same recombinant expression vector, thereby has guaranteed the reliability selected by transformant or plant.
Conclusion is got up, and G2-aroA gene that is suitable for expressing in vegetable cell provided by the invention and gat gene plant bivalent expression carrier comprise:
1) G2-aroA expression casette;
A) CaMV 35S promoter;
B) nucleotide sequence of coding G2-aroA gene;
C) Nos terminator.
2) gat expression casette
A) CaMV 35S promoter;
B) nucleotide sequence of coding gat gene;
C) Nos terminator.
3) derive from the carrier part of pCamBia2301:
A) NPTII expression cassette;
B) initial replicon and the functional structures such as T-DNA left and right sides border sequence relevant with Plant Transformation.
For in vegetable cell, expression alien gene in the particularly whole strain plant must use appropriate means will carry in the reorganization bivalent expression carrier conversion of G2-aroA gene and gat gene or transduce appropriate host cell or the plant materials.
With recombinant vectors importing host plant or its intracellular many methods of carrying foreign gene all is well known to those skilled in the art.These methods are including but not limited to agriculture bacillus mediated conversion method (Agrobacterium-mediated transformation) 1); 2) physics method is as particle bombardment (Particle bombardment or Particle gun or Gene gun), electric shocking method (Electroporation), microinjection (Microinjection), supersonic method (Ultrasonic), laser microbeam method (Laser microwave), silicon carbide fiber mediated method (Silicon carbidefiber), electrophoretic method (Electrophoretic transfection) etc.; 3) chemical method is as the conversion method of PEG mediation, liposome-mediated conversion method etc.; 4) germplasm system conversion method is as pollen-mediated method, pollen tube passage method (ovary injection), infusion method etc.; 5) with conversion methods that virus vector was mediated such as cauliflower mosaic virus (CaMV), geminivirus infection (Geminiviruses) or RNA viruses or the like.
Plant of the present invention had both comprised whole plant, also comprised organ, tissue and the cell of plant seed, plant materials, also comprised the offspring of two valency transgenic plant, and by by the plant of cell transformed or callus regeneration.At the example that the present invention provides, described plant is a tobacco.Change tobacco over to by agrobacterium-mediated transformation, obtained the stronger more stable two valency transgene tobaccos of glyphosate resistance.
Advantage of the present invention and effect: by changing G2-aroA and gat gene over to plant simultaneously, not only avoided glyphosate in negative impact that plant interior accumulation produced, also improve the ability of transgenic plant opposing glyphosate simultaneously, in the anti-glyphosate plants genetically engineered, had important application prospects.
Description of drawings:
Fig. 1 is the p2301G2-gat restriction analysis.Among the figure, M: λ DNA H/E Marker; 1:EcoRI; 2:EcoRI+HindIII; 3:HindIII+KpnI; 4:EcoRI+KpnI; 5:BamHI+PstI; 6:EcoRI+XbaI.
Fig. 2 is that the PCR of transgene tobacco detects.Among the figure,
A: change the gat gene M: Molecular marker; The CK+:p2301GAT plasmid DNA is a template; 1-11: transfer-gen plant, CK-: acceptor NC89 genomic dna is a template;
B: change the G2-aroA gene M: Molecular marker; The CK+:p2301G2 plasmid DNA is a template; 1-6: transfer-gen plant, CK-: acceptor NC89 genomic dna is a template;
C: change gat and G2-aroA gene M: Molecular marker; The CK+:p2301G2-gat plasmid DNA is a template; 1-11: transfer-gen plant, CK-: acceptor NC89 genomic dna is a template.
Fig. 3 is that the Southern hybridization of transgene tobacco detects.Among the figure,
A: the Southern that changes the gat genetic tobacco detects M:Molecular Marker; The CK+:p2301GAT plasmid DNA; 1～6: transgene tobacco 2#, 5#, 9#, 6#, 10#, 31#; CK-:NC89
B: the Southern of two valency transgene tobaccos detects, M:Molecular Marker; The CK+:p2301G2-gat plasmid DNA; 1～6: transgene tobacco 2#, 3#, 5#, 11#, 17#, 21#; CK-:NC89, wherein the 2.6kb fragment is the hybridization band that comprises complete G2-aroA gene, and comprises the 320bp of gat gene and the fragment of 121bp size respectively in 0.8kb and the 0.9kb hybridization band.
Fig. 4 is that the RT-PCR of transgene tobacco detects.Among the figure,
A: the RT-PCR that changes the gat genetic tobacco detects M:Molecular marker; The CK+:p2301GAT plasmid DNA is a template; 2-6: transfer- gen plant 2
#, 5
#, 9
#, 6
#, 10
#, 31
#7:Non-RT; The CK-:Non-transgene plant;
B: the RT-PCR that changes the G2-aroA genetic tobacco detects M:Molecular marker; The CK+:p2301G2 plasmid DNA is a template; 2-6: transfer- gen plant 2
#, 5
#, 9
#, 6
#, 10
#, 31
#7:Non-RT; The CK-:Non-transgene plant;
C: two valency transgene tobacco gat and G2-aroA gene RT-PCR detect, M:Molecular marker; The CK+:p2301G2-gat plasmid DNA is a template; 2-6: transfer- gen plant 2
#, 5
#, 9
#, 6
#, 10
#, 31
#7:Non-RT; The CK-:Non-transgene plant.
Fig. 5 is that the western blot that changes tobacco detects.Wherein,
A: the western blot that changes the gat genetic tobacco detects CK+:EGAT expression product CK-:Non-transgene plant; 1-5: transfer-gen plant 2#, 5#, 9#, 6#, 10#;
B: the western blot of two valency transgene tobaccos detects, CK+:EGAT and MEPS expression product CK-:Non-transgene plant; 1-5: transfer-gen plant 2#, 3#, 5#, 11#, 17#.
Fig. 6 is after spraying glyphosate agent (the Roundup weedicide of 1 liter of/hectare dosage), the growing state of 4 kinds of different tobaccos (comprising transgenosis and non-transgenic), as to the glyphosate resistance analysis, 4 grow tobacco is respectively: (a) the two valency transgenosiss of GAT and EPSPS, (b) GAT unit price transgenosis, (c) EPSPS unit price transgenosis, (d) non-transgenic acceptor NC89 tobacco.
Embodiment:
The plasmid of being lifted in following examples, bacterial strain, plant etc. just are used for method of the present invention is further illustrated, and flesh and blood of the present invention are not limited.
The plasmid, the bacterium source that use among the embodiment are as follows:
Plant expression vector pBI121 is Clontech company commercially available prod;
Plant expression vector pCamBia2301, plasmid pGAT, plasmid pG2 and plasmid p4A: derive from biotechnology institute of Chinese Academy of Agricultural Sciences Lin Min laboratory and make up preservation;
Cloning vector pBluescript II (SK) (-): be Stratagene company commercially available prod
Cloning vector T-carrier and recipient bacterium E.coli DH5 α are TaKaRa company commercially available prod;
Recipient bacterium LBA4404: be Gibco company commercially available prod.
The structure of 1 pair of valency plant expression vector of embodiment
1) be template with the pGAT plasmid, with 5 ' G
CTCGAGATGATTGACGTGAACCCAAT 3 ' and 5 ' G
GTTAACTTATGCGATCCTCTTGTACA 3 ' utilizes pcr amplification to obtain the gene fragment that two ends have XhoI and hpaI restriction site respectively for primer (adding people XhoI and hpaI site), is connected with the T-carrier;
2) the connection product transformed into escherichia coli DH5 α 1) selects positive colony, called after pGAT-T;
3) p4A and pSK plasmid reclaim the DNA band of 1.4kb and 2.7kb respectively after KpnI and HindIII digestion, connect back transformed into escherichia coli DH5 α, select positive colony, called after pSK4A;
4) pSK4A and pGAT-T plasmid reclaim the DNA band of 4.1kb and 435bp respectively after XhoI and hpaI digestion, connect back transformed into escherichia coli DH5 α, select positive colony, called after pS4AGAT;
5) pS4AGAT and pCAMBIA2301 plasmid reclaim the DNA band of 1.8kb and 11.6kb respectively after KpnI and PstI digestion, connect back transformed into escherichia coli DH5 α, select positive colony, called after p2301GAT;
6) be template with the pG2 plasmid, with 5 ' G
CTCGAGATGGCGTGTTTGCCTGATGA 3 ' and 5 ' G
GTTAACTCAGTCGTTTAGGTGAACGCC 3 ' utilizes pcr amplification to obtain the gene fragment that two ends have XbaI and SacI restriction site respectively for primer (adding XbaI and SacI site), be connected transformed into escherichia coli DH5 α with the T-carrier, select positive colony, called after pG2-T;
7) pSK and pBI121 plasmid are cut through EcoRI and HindIII are two, reclaim the DNA band of 2.7kb and 2.9kb respectively, connect back transformed into escherichia coli DH5 α, select positive colony, called after pSK121;
8) pSK121 and pG2-T plasmid are cut through XbaI and SacI are two, reclaim the DNA band of 3.7kb and 1.35kb respectively, connect back transformed into escherichia coli DH5 α, select positive colony, called after pSKG2;
9) pSKG2 and pCAMBIA2301 plasmid reclaim the DNA band of 11.6kb and 2.5kb respectively through KpnI and EcoRI double digestion, connect back transformed into escherichia coli DH5 α, select positive colony, called after p2301G2;
10) p2301G2 at first cuts with the BamHI enzyme, reclaims after the big fragment that to carry out the benefit of sticky end with T4 archaeal dna polymerase (Takara company) flat, cuts the big DNA band of digestion back recovery through the KpnI enzyme then; PS4AGAT cuts the DNA band that 1.8kb is reclaimed in the back through KpnI and SmaI are two, is connected transformed into escherichia coli DH5 α afterwards with the front fragment, selects positive colony, called after pG2-GAT;
11) pG2-GAT cuts evaluation through plurality of enzymes, proves that the carrier that makes up is correct.Enzyme is cut evaluation and is seen Fig. 1.
Present embodiment utilizes agrobacterium-mediated transformation, successful acquisition have a transgene tobacco of G2-aroA gene and gat gene.
The tobacco receptor material that adopts is NC89, and Agrobacterium is LBA4404, and the concrete operations step is as follows:
1) the competent preparation of agrobacterium tumefaciens lba4404
(1) picking list bacterium colony from the flat board is inoculated into 5ml YEB liquid nutrient medium (containing Streptomycin sulphate Strep 125mg/L), and 28 ℃, 250rpm shaking culture spend the night
(2) get 2ml bacterium liquid, add in the 50mlYEB liquid nutrient medium (containing Strep125mg/L), 28 ℃, 250rpm shaking culture are to OD
600About about 0.6
(3) bacterium liquid is gone in the aseptic centrifuge tube of 50ml ice bath 30min.The centrifugal 5min of 5000rpm
(4) abandon supernatant, precipitation 2ml 20mM CaCl
2Resuspended, every part 100 μ l branch installs in the 1.5ml centrifuge tube, preserves standby in the liquid nitrogen.
2) recombinant plasmid dna changes Agrobacterium over to
(1) p2301GAT, p2301G2 and the p2301G2-gat plasmid DNA with about 1 μ g joins in the 100 μ l LBA4404 competent cells mixing, ice bath 5min respectively
(2) centrifuge tube is put freezing 8min in the liquid nitrogen, gone to temperature bath 5min in 37 ℃ of water-baths rapidly
(3) add 1ml YEB liquid nutrient medium, 250rpm recovery 4-5h on 28 ℃ of shaking tables
(4) get an amount of bacterium liquid and be applied on the YEB solid medium that contains Strep 250-300mg/L, Rif (Rifampin) 250-300mg/L and Kan (kantlex) 100mg/L, put 28 ℃ and cultivate 24-48h.
3) leaf dish method transformation of tobacco kind NC89
(1) activation of Agrobacterium
The single bacterium colony of picking Agrobacterium from the flat board is inoculated into that (Rif300mg/L), shaking culture is spent the night for Kan 100mg/L, Strep100mg/L in the 5ml YEB liquid nutrient medium; Get 1ml bacterium liquid be inoculated into 50ml YEB liquid nutrient medium (Kan100mg/L, Strep 100mg/L, Rif300mg/L) in, thermal agitation is cultured to OD
600Be 0.4-0.5 (about 3-4h); 5, the centrifugal 5min of 000rpm, thalline MS
0Substratum (not containing hormone) is resuspended, makes OD
600Be 0.1-0.2
(2) genetic transformation of tobacco
A) cultivate altogether: the leaf piece that will infect is placed on the tobacco bud division culture medium (MS+IAA0.5mg/L+6-BA2mg/L) that is covered with 2 metafiltration paper, 25 ℃ of dark cultivations 4 days
B) screening of resistant buds: will transfer on the resistant buds screening culture medium (MS+IAA 0.5mg/L+6-BA2mg/L+Kan 100mg/L+Cef (Reflin) 500mg/L) through the tobacco explant of cultivating altogether,
Can sprout after 2～3 weeks
Take root: when treating resistant buds length, it is transferred on the root media (MS+Kan 100mg/L+Cef500mg/L), promptly have adventive root to form after 1～2 week to the 1cm left and right sides.
The Molecular Detection of experimental example 1 transgene tobacco
1.1 the extraction of tobacco DNA
1) the fresh tobacco leaf of 25-50mg grinds in 1.5ml Eppendorf pipe
2) add 65 ℃ of preheatings of 700 μ l the DNA extraction damping fluid (2% (W/V) CTAB, 1.42M NaCl, 20mMEDTA, 100mM Tris-HCl, 2% mercaptoethanol, pH8.0)
3) add 7 μ l RAase (20mg/ml), 65 ℃ of water-bath 1h
4) the centrifugal 10min of normal temperature
5) get supernatant, add equal-volume chloroform-primary isoamyl alcohol extracting
6) the centrifugal 10min of normal temperature
7) get supernatant, add the 3M NaAc (pH5.2) of 2 times of volume dehydrated alcohols and 1/10 volume ,-20 ℃ of precipitation 30min
8) 12000rpm, 4 ℃ of centrifugal 10min
9) precipitate once with 70% ethanol rinsing, centrifugal, dry
10) add an amount of TE dissolving
11) concentration of mensuration DNA, the sample electrophoresis that takes a morsel, the concentration of Agarose glue is 1%
12) sample is standby 4 ℃ of preservations.
1.2 the PCR of transgene tobacco detects
1) gat gene PCR
Is primer with F1 (5 ' ATGATTGACGTGAACCCAAT3 ') with R1 (5 ' TTATGCGATCCTCTTGTACA3 '), genomic dna is that template is carried out pcr amplification, amplification condition: 94 ℃ of pre-sex change 5min, 94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 30sec, 25 circulations, 72 ℃ are extended 5min.
2) G2-aroA gene PCR
Is primer with F2 (5 ' ATGGCGTGTTTGCCTGATGA 3 ') with R2 (5 ' TCAGTCGTTTAGGTGAACGCC3 '), genomic dna is that template is carried out pcr amplification, amplification condition: 94 ℃ of pre-sex change 5min, 94 ℃ of 30sec, 58 ℃ of 30sec, 72 ℃ of 90sec, 25 circulations, 72 ℃ are extended 5min.The results are shown in Figure 2.
1.3 the Southern blot of transgene tobacco detects
Get three class transgene tobacco PCR positive plant genomic dnas, 10 μ g respectively through suitably restriction enzyme digestion digestion, capillary tube technique is transferred on the HybondTM-N+ film, with gat gene and G2-aroA gene DNA fragment is that template prepares probe, utilizes DIG-High Prime DNA Labeling and Detection Starter Kit II (available from BoehringerMannheim Biochemicals) to carry out Southern blot and detects.Wherein gat gene unit price transgene tobacco DNA adopts that HindIII and EcoRI are two to be cut, and two valency transgene tobaccos adopt EcoRI and KpnI pair to cut.Concrete operations are as follows:
1) changes film
(1) behind the DNA electrophoresis, gel is transferred in the glass baking tray.Repair the useless part in gel edge with blade, comprise the gel of well top.Keep enough wells on the gel so that DNA shift finish after with the position mark of well on film, cut a little trilateral (well one end for down) in the gel lower left corner, as the mark in gel orientation
(2) gel is immersed in the 200ml sex change liquid, place 45min under the room temperature, and vibration gently; With the of short duration immersion gel of deionized water, then gel is dipped in 200ml (or 10 times to the gel volume) neutralization buffer, room temperature is placed 30min, and vibration gently.Change a neutralization buffer and continue to soak gel 15min
(3) when gel is carried out immersion treatment, prepare Hybond membrane.Wear clean gloves, cut a film, the size of film should be than the wide 1cm of the long 1em of gel.Film floated in the ware that fills deionized water soak fully from the bottom up, then film is immersed in the transfering buffering liquid 5min at least up to film.Downcut a jiao of film with clean blade, a jiao of downcutting with gel is consistent.Cut 6 filter paper that equate with membrane area, wherein 2 filter paper are soaked with transfering buffering liquid
(4) DNA carries out in the process of sex change, a thick thieving paper is placed on a slice resin glass plate or the glass dish forms long and wide upholder than gel, the two ends of thieving paper are immersed and are shifted in the liquid, it is almost concordant with support surface up to liquid level to put into suitable transfering buffering liquid in the ware, after the thieving paper on the upholder is moistening fully, drive bubble away with a glass stick
(5) take out gel and reversing and make original bottom surface upwards, inverse gel Caution! Wet Floor to upholder and be positioned at filter paper central authorities, is guaranteed no any bubble between filter paper and the gel
(6) use Saran packing film or Parafilm film around gel, but do not cover gel
(7) with suitable transfering buffering liquid that gel is moistening.Place moistening film on the gel and make both corner cut overlaids.For avoiding producing bubble, a jiao of film is contacted with gel again slowly film is put on the gel.An edge of film should surpass the edge of gel top well one line just
(8) two filter paper of transfering buffering liquid wetted are placed on the moistening film, drive the bubble of delay away, spread 4 dried filter paper then in the above with suction pipe
(9) shear the medicated napkin tower that 5-8cm is high, its size and filter paper are basic identical or smaller, and the paper tower is placed on above the filter paper, put a sheet glass at the paper handkerchief top and use the compacting of 400g weight then
(10) DNA shifts and need carry out 8-24h, and the paper handkerchief that more renews after paper handkerchief is moistening is avoided whole stacker towel all to be cushioned liquid as far as possible and soaked.Remove paper handkerchief and absorbent filter on the gel.Upset gel and the film that contacts with it, gel are upwards.
(11) lie against on the exsiccant thieving paper, with the position of a dead-soft pencil or ballpoint pen mark well; Gel is peeled off from film, discarded gel; Film is dipped among 6 * SSC 5min
(12) vacuum bakeout fixed dna: film taken out from 6 * SSC and make excess liquid stream clean.Film is placed on the paper handkerchief dries 30min under the room temperature, then film is clipped in the middle of two exsiccant thieving papers, 80 ℃ of baking 30-120min in vacuum oven.
2) label probe
(1) template DNA of adding 1 μ g in 500 μ l centrifuge tubes adds ultrapure water to 16 μ l
(2) in the boiling water behind the heating 10min, cool off rapidly and make the DNA sex change with ice/salt bath
(3) add 4 μ l DIG-HIGH Primer, mixing, instantaneous centrifugal
(4) 37 ℃ are spent the night
(5) add 2 μ l 0.2mol/l EDTA (pH8.0) or 10 minutes termination reactions of 65 ℃ of heating.
3) hybridization
(1) adds 200 μ l NBT/BCIP concentrated solutions to 10ml Detection buffer (0.1M Tris-HCl, 0.1M NaCl, 50mM MgCl
2, pH9.5) in
DIG Easy Hyb liquid (37-42 ℃) (10ml/100cm of (2) preheating proper volume
2Film)
(3) prehybridization film 30 minutes in hybrid pipe
(4) place cooled on ice rapidly after boiling DIG-labeled DNA probe (about 25ng/ml DIG Easy Hyb) sex change in 5 minutes
(5) DIG-labeled DNAprobe (3.5ml/100cm in the DIG of preheating Easy Hyb liquid of adding sex change
2Film) mixing (note do not produce bubble) was hybridized 4 hours or is spent the night.
4) wash film
(1) with 2 * SSC, 0.1%SDS is 15-25 ℃ of washing, 2 times 5 minutes.
(2) with 0.5 * SSC, 0.1%SDS (in advance preheating) is 65-68 ℃ of washing, 2 times 15 minutes.
5) detect (all are hatched all and carry out) under 25-50 ℃
(1) wash film after, with Washing buffer (Maleic acid buffer (0.1mol/l maleic acid, 0.15mol/lNaCl transfers to pH7.5 with NaOH) adds 0.3% Tween 20 (v/v)) wash film once (1-5 minute) gently
(2) in 100ml 1 * Blocking solution (diluting 10 * blocking solution (test kit is with) 1: 10), hatched 30 minutes with Maleic acid buffer
(3) hatched again 30 minutes at 20ml Antibody solution (Anit-Digoxigenin-AP 1:10000 in Blocking solution)
(4) with 100ml Washingbuffer washing 2 times 15 minutes
(5) use 20ml Detection buffer balance 2-5 minute
(6) face is put into hybridization bag up, add 1ml CSPD ready-to-use (bottle 5) immediately, hatched 5 minutes for 15-25 ℃
(7) drive bubble and unnecessary liquid out of, seal up hybridization bag
Hatched 10 minutes for (8) 37 ℃
(9) 15-25 minute (15-25 ℃) of X-ray sheet exposure.
6) flush away probe on the nitrocellulose filter
(1) prepare hundreds of milliliters of elutriant 0.05 * SSC, 0.01M EDTA (pH8.0) boils
(2) elutriant is moved down from well heater, add SDS to final concentration 0.1% (w/v)
(3) film was immersed above-mentioned hot elutriant 15 minutes, during shake gently
(4) newly prepare elutriant repeating step 2-3 (note: all processes can not make the film drying)
(5) with 0.01 * SSC of short duration rinsing filter membrane under room temperature, most of liquid is removed in control on filter paper
(6) whether the X-ray detection probes is removed totally
(7) dry filter membrane, aluminium foil is wrapped, and preserves under room temperature, the vacuum.
The results are shown in Figure 3.
1.4 the RT-PCR of transgene tobacco detects
The extraction of the total RNA of tobacco leaf (RNA extracts test kit available from Shanghai China Shun biotechnology W6771 of company limited)
1) cracking of tobacco leaf: smash tissue to pieces powdered under the liquid nitrogen freezing condition.After treating that liquid nitrogen volatilizees naturally, add 500 μ lTCP liquid, lash 5 times with suspended sample with pipettor.Move into the 1.5ml centrifuge tube, lash lysate 10 times with the disposable 5ml syringe of band syringe needle immediately.12, the centrifugal 3min of 000rpm moves into supernatant in the another one centrifuge tube
2) add 250 μ l, 75% ethanol.Thoroughly behind the mixing, all move in the adsorption column.Centrifugal 30sec.Outwell the liquid in the collection tube.Adsorption column is moved in the same collection tube
3) add 500 μ l RP liquid, centrifugal 30sec.Abandon the liquid in the collection tube, adsorption column is moved in the same collection tube
4) add 500 μ l W3 liquid, leave standstill 1min after, centrifugal 15sec
5) adsorption column is moved in the clean collection tube, add 500 μ l W3 liquid, centrifugal 15sec
6) outwell liquid in the collection tube, again adsorption column is moved in the same collection tube centrifugal 1min
7) adsorption column is moved in another clean 1.5ml centrifuge tube.Central authorities add 50 μ l pure water at adsorption film, after room temperature leaves standstill 1min, and centrifugal 1min.Place-70 ℃ of preservations standby 1.5ml centrifuge tube (RNA).
Extract the total RNA of Southern blot positive plant, total RNA removes the pollution of DNA through the DNAaseI effect.Reverse transcription is operated (ProtoScript by the test kit explanation
TMThe first chain cDNA synthetic agent box, NEB).Gat gene wherein, G2-aroA gene reverse transcription primer is respectively: R1 (5 ' TTATGCGATCCTCTTGTACA 3 '), R2 (5 ' TCAGTCGTTTAGGTGAACGCC 3 '); Two valency transgene tobacco reverse transcription primers are respectively R1 and R2.
The RT-PCR reaction conditions is
The gat gene: 94 ℃ of pre-sex change 5min, 94 ℃ of 30sec, 64 ℃ of 30sec, 72 ℃ of 30sec, 30 circulations, 72 ℃ are extended 5min;
The G2-aroA gene: 94 ℃ of pre-sex change 5min, 94 ℃ of 30 sec, 62 ℃ of 30 sec, 72 ℃ of 90sec, 25 circulations, 72 ℃ are extended 5min.
The results are shown in Figure 4.
1.5 the Western blot of transgene tobacco detects
Extract RT-PCR positive plant leaf protein: get the fresh tobacco leaf of 100mg, add liquid nitrogen and quartz sand, fully grind; Change powder over to the 1.5ml centrifuge tube, treat that liquid nitrogen volatilizees fully after, add 800 μ l protein extraction buffer (200mMTris-HCl (pH8.0), 100mM NaCl, 400mM sucrose, the 14mM beta-mercaptoethanol, 1mM PMSF, 0.05%Tween20), the vibration 5min; 12500rpm, 4 ℃ of centrifugal 20min get supernatant and are the blade crude protein, carry out Western blot and detect.
Western blot analyzes
The solution preparation:
a)Transfer buffer： 1L
25mM Tris 192mM Glycine PH8.3
Take by weighing 3.03gTris, 14.4g Glycin is settled to 1L
B) 10xAP colour developing Buffer:50ml
1M Tris-HCL PH9.5 1M NaCl 50mM MgCl
2
6.057g adding, Tris transfers pH to 9.5 2.922gNaCl about concentrated hydrochloric acid 300 μ l
4M MgCL
2Dilute 10 times 1.25ml be settled to the 50ml time spent
c)10xTBS：100mM Tris-HCL pH8.0 1.5MNaCl
d)TBST：1xTBS+0.05％Tween20
E) confining liquid: TBST+5% skim-milk (or 3%BSA)
Experimental procedure:
1) pvdf membrane is cut into glue etc. greatly, and methyl alcohol soaks 30sec, puts into and shifts balance among the Buffer (25mM Tris, 192mMGlycine pH8.3), and sponge sheet, filter paper, running gel and pvdf membrane are placed on and shift balance 20min among the Buffer
2) sandwich method: sponge, filter paper, film, glue, filter paper, sponge, the black clamping plate sequence successively, and guaranteeing does not have bubble between glue and the film, gripping unit, the black plate is relative with the black electrode, put into transfer groove, cooling tank is frozen into ice in refrigerator, puts in the transfer groove, adds Buffer
3) insert good electrode, just negative/red, relatively black, bear → just shift
4) between the about 80-130V of current stabilization 350Ma voltage.Pass in time, voltage can descend.If membrane-transferring device heating, be placed in the box of filled with ice and cool off.Change film 1h
5) unload lower device, pvdf membrane is with shifting the Buffer rinsing once, room temperature sealing 2h (confining liquid: 3%BSA 35ml)
6) glue is put into staining fluid and dye, not having any protein band, then to change film complete
7) confining liquid 10ml+10 μ l antiserum(antisera) (1: 1000) room temperature is in conjunction with 1-2h
8) with TBST (1xTBS (10x TBS 100mM Tris-HCL pH8.0,1.5M NaCl)+0.05%
Tween20
9) wash film 3 times, each 50ml, each 10-30min shakes
10) adding TBST20ml adds 0.7 μ l, two anti-(1: 30000) room temperatures and shakes 1h gently
11) wash film 3 times with TBST, each 50ml, 15min
12) get 5mlAPBuffer (1M Tris-HCLpH9.5 1MNaCl, 50mM MgCl
2) add 33 μ lNBT stock solutions, add 16.5 μ l BCIP mixings behind the mixing immediately, film is put into softly rocked, dark place colour developing 10min.Wait to develop the color behind desirable strength, pour out colour developing liquid, add ddH
2The O termination reaction.The results are shown in Figure 5.
Experimental example 2 T
0Adopt foliage-spray glyphosate method resistance to analyze for transfer-gen plant
1, the Roundup weedicide of 0.8 liter of/hectare dosage sprays processing
Method:
Choose grow fine, each 30 strain of tobacco of commentaries on classics gat, the G2-aroA of homogeneous and gat-G2-aroA bivalent gene, when plant grow to the 6-8 leaf during phase Roundup weedicide with 0.8 liter of/hectare dosage spray processing, with 10 strain acceptor tobaccos (NC89) is contrast, observes its situation of being injured.
The result:
Adjoining tree: sprayed the back 1-3 days, all adjoining trees show the symptom of being injured, and partial blade and stem apex begin to have slightly wilting, all seriously wilt after 5 days and have chlorosis to take place, one week the back all dead.
Change the gat genetic tobacco: after handling for two weeks tobacco 24 strains survival is arranged, the symptom of significantly not being injured, all the other 6 strains are handled and begun after 5 days to wilt, and are dead gradually after two weeks;
Change the aroA genetic tobacco: have only 4 strains survival and have 3 strains to show the symptom of being injured, partial blade chlorosis after handling for two weeks;
Two valency transgene tobaccos: 26 strains growth is normal, has the glyphosate tolerance ability, the symptom of significantly not being injured, and only 4 strains are handled and are begun to wilt chlorosis death gradually after 5 days.
2, the Roundup weedicide of 1 liter of/hectare dosage sprays processing
Method:
The same.But the Roundup weedicide with 1 liter of/hectare dosage sprays processing.
The result:
After two weeks, all unit price transgene tobaccos all can not be survived, and two valency transgene tobacco still has two strains survival, and show the symptom (Fig. 6) of slightly being injured.Show that two valency transgene tobaccos have higher glyphosate tolerance ability than the unit price transgene tobacco.
Experimental example 3 first filial generation transgene tobacco seed germination experiment glyphosate resistance analyses
Method:
The acceptor tobacco seed of unconverted is inoculated in and contains different concns glyphosate (0,30,50,80,100,150,200 μ M) MS behind surface sterilization
0On the substratum, 25 ℃, 1200 Lx half-lights according under sprout.Observe the growth of seedling situation after 4 weeks, determine to make the minimum glyphosate concentration of the complete albefaction of tobacco.
The transgene tobacco seed is handled through same, is inoculated in to contain (being higher than the minimum concentration glyphosate that makes the complete albefaction of acceptor tobacco) different concns glyphosate (100 μ M, 200 μ M, 1mM, 5mM, 10mM) MS
0The same terms is sprouted on the substratum, 4 weeks back observation growth of seedling situation.Green fully with spire, or most of green to have only some albefaction positions be the glyphosate resistance seedling; Albefaction death is non-resistance seedling.
The result:
The survival rate comparative result sees Table 1 on the MS0 substratum of different concns glyphosate containing for three types of transgene tobacco first filial generation seeds.
When glyphosate concentration is 100 μ M, change gat, G2-aroA gene unit price and gat+G2-aroA Gene Double valency tobacco and all have tolerance, no significant difference between the survival rate behind the seed germination is respectively 74%, 74% and 77%;
The unit price transgene tobacco that when glyphosate concentration reaches 1mM, contains the G2-aroA gene, non-resistant plant survival, the survival rate no significant difference of gat unit price and gat+G2-aroA Gene Double valency transgene tobacco is respectively 73% and 74%;
When glyphosate concentration reaches 10mM, contain the whole plant albefaction of the unit price transgene tobacco death of gat gene, and the two valency transgene tobaccos that contain the gat+G2-aroA gene still have 14% plant survival, difference reaches utmost point conspicuous level.
The survival rate of table 1 transgene tobacco on different glyphosate concentration substratum relatively
| The transgene tobacco type | Glyphosate concentration | ||||
| 100μM | 200μM | 1mM | 5mM | 10mM | |
| Contain gat separately | 74％A | 73％A | 73％A | 13％C | 0E |
| Contain aroA separately | 74％A | 65％A | 0B | 0B | 0BE |
| Contain gat+aroA simultaneously | 77％A | 75％A | 74％A | 44％D | 14％F |
Annotate:
1, the percentage ratio in the table is represented percentage survival;
2, multiple comparisons adopts the LSD method, and different capitalizations represent that difference reaches 0.01 conspicuous level.
Conclusion: above result shows, two valency transgene tobacco T
1Be better than gat and G2-aroA unit price transgene tobacco T for the seed glyphosate resistance
1For seed.
Claims (9)
1. a reorganization bivalent expression carrier is characterized in that containing G2-aroA gene and gat gene.
2. reorganization bivalent expression carrier according to claim 1, be suitable for described carrier in the G2-aroA gene be connected with the gat gene, and starting this DNA sequences encoding in vegetable cell, to transcribe the promotor of beginning be the 35S promoter of cauliflower mosaic virus.
3. reorganization bivalent expression carrier according to claim 1, the terminator that the termination structure gene is expressed in plant are the terminators of Nos gene.
4. according to the described reorganization bivalent expression carrier of arbitrary claim in the claim 1,2,3, the carrier that carries G2-aroA gene and gat gene construct is selected from one of pBlueScriptSK, pUC18, pUC19 or pCamBia2301.
5. the purposes of reorganization bivalent expression carrier according to claim 1 is to express the EPSPS synthase of degradable glyphosate and make the acetylizad N-acetyl-transferase of glyphosate N-in plant.
6. the purposes of reorganization bivalent expression carrier according to claim 5 is transgenic plant of cultivating the tolerance glyphosate.
7. a method of cultivation that tolerates the glyphosate transgenic plant is to utilize the described reorganization bivalent expression carrier of claim 1, with G2-aroA gene and gat gene transformation to recipient plant.
8. the method for cultivation of tolerance glyphosate transgenic plant according to claim 7, described recipient plant had both comprised whole plant, the organ, tissue and the cell that also comprise plant seed, plant materials, the offspring who also comprises two valency transgenic plant, and by by the plant of cell transformed or callus regeneration.
9. according to the method for cultivation of claim 7 or 8 described tolerance glyphosate transgenic plant, described recipient plant is a tobacco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101189684A CN101100676B (en) | 2007-06-15 | 2007-06-15 | Bivalent expression carrier for culturing anti-glyphosate plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101189684A CN101100676B (en) | 2007-06-15 | 2007-06-15 | Bivalent expression carrier for culturing anti-glyphosate plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101100676A true CN101100676A (en) | 2008-01-09 |
| CN101100676B CN101100676B (en) | 2010-12-22 |
Family
ID=39035124
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007101189684A Active CN101100676B (en) | 2007-06-15 | 2007-06-15 | Bivalent expression carrier for culturing anti-glyphosate plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101100676B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103194465A (en) * | 2012-01-10 | 2013-07-10 | 华中农业大学 | Isolation of 5-enol acetone shikimic acid-3-phosphate synthase gene |
| CN104450775A (en) * | 2014-12-04 | 2015-03-25 | 中国农业科学院作物科学研究所 | Transgenic glyphosate-resistant soybeans as well as preparation method and application thereof |
| CN105505981A (en) * | 2015-12-30 | 2016-04-20 | 中国农业科学院作物科学研究所 | Glyphosate-resistant transgenic soybean as well as preparation method and application thereof |
-
2007
- 2007-06-15 CN CN2007101189684A patent/CN101100676B/en active Active
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103194465A (en) * | 2012-01-10 | 2013-07-10 | 华中农业大学 | Isolation of 5-enol acetone shikimic acid-3-phosphate synthase gene |
| CN103194465B (en) * | 2012-01-10 | 2014-06-18 | 华中农业大学 | Isolation of 5-enol acetone shikimic acid-3-phosphate synthase gene |
| CN104450775A (en) * | 2014-12-04 | 2015-03-25 | 中国农业科学院作物科学研究所 | Transgenic glyphosate-resistant soybeans as well as preparation method and application thereof |
| WO2016086884A1 (en) * | 2014-12-04 | 2016-06-09 | 中国农业科学院作物科学研究所 | Transgenic glyphosate-resistant soybeans and preparation method and use thereof |
| CN104450775B (en) * | 2014-12-04 | 2018-04-27 | 中国农业科学院作物科学研究所 | Resistance glyphosate genetically engineered soybean and preparation method and application |
| CN105505981A (en) * | 2015-12-30 | 2016-04-20 | 中国农业科学院作物科学研究所 | Glyphosate-resistant transgenic soybean as well as preparation method and application thereof |
| CN105505981B (en) * | 2015-12-30 | 2018-12-25 | 中国农业科学院作物科学研究所 | A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101100676B (en) | 2010-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ishida et al. | High efficiency transformation of maize (Zea mays L.) mediated by Agrobacterium tumefaciens | |
| Schöpke et al. | Regeneration of transgenic cassava plants (Manihot esculenta Crantz) from microbombarded embryogenic suspension cultures | |
| Dong et al. | Agrobacterium-mediated transformation of Javanica rice | |
| Frame et al. | Production of fertile transgenic maize plants by silicon carbide whisker‐mediated transformation | |
| JP3329819B2 (en) | Method for transforming monocotyledonous plant using immature embryo scutellum | |
| Crane et al. | Transgenic Medicago truncatula plants obtained from Agrobacterium tumefaciens-transformed roots and Agrobacterium rhizogenes-transformed hairy roots | |
| Huang et al. | Successful Agrobacterium-mediated genetic transformation of maize elite inbred lines | |
| WO1994000977A1 (en) | Method of transforming monocotyledon | |
| US20070016985A1 (en) | Particle Preparation for Direct-Delivery Transformation | |
| CN108588118A (en) | Application of the soybean transcription factor GmWRKY23 genes in degeneration-resistant | |
| CN101100676B (en) | Bivalent expression carrier for culturing anti-glyphosate plants | |
| PL191113B1 (en) | Improved integration of exogenic dna introduced into eucariotic cells | |
| Barcelo et al. | Transformation and gene expression | |
| US8962916B2 (en) | Viral promoter, truncations thereof, and methods of use | |
| Akbulut et al. | Analysis and optimization of DNA delivery into chickpea (Cicer arietinum L.) seedlings by Agrobacterium tumefacience | |
| US8895716B2 (en) | Viral promoter, truncations thereof, and methods of use | |
| CA2457479A1 (en) | In planta transformation by embryo imbibition of agrobacterium | |
| CN103589750A (en) | Method for deleting transgenic rice marker genes on plant level | |
| US20110113511A1 (en) | Viral promoter, truncations thereof, and methods of use | |
| El-Siddig et al. | Agrobacterium-mediated transformation of tomato plants expressing defensin gene | |
| CN102071203B (en) | Induced promoter | |
| CN1316023C (en) | Photoinduction expressed Gacab promoter and its expression function in different segments | |
| CN110468136B (en) | Flower-specific promoter and application thereof | |
| Ilori et al. | Transgene expression in cowpea (Vigna unguiculata (L.) Walp.) through Agrobacterium transformation of pollen in flower buds | |
| Szegedi et al. | Transformation of tobacco plants with virEl gene derived from Agrobacterium tumefaciens pTiA6 and its effect on crown gall tumor formation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220324 Address after: 572025 building 3, nuclear energy R & D and Industrial Park, Yiju Road, Yazhou District, Sanya City, Hainan Province Patentee after: Longping Biotechnology (Hainan) Co.,Ltd. Address before: 100081 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Patentee before: BIOTECHNOLOGY Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |