CN101084238B - Receptor selectivity lymphotoxin derivates - Google Patents
Receptor selectivity lymphotoxin derivates Download PDFInfo
- Publication number
- CN101084238B CN101084238B CN2004800446341A CN200480044634A CN101084238B CN 101084238 B CN101084238 B CN 101084238B CN 2004800446341 A CN2004800446341 A CN 2004800446341A CN 200480044634 A CN200480044634 A CN 200480044634A CN 101084238 B CN101084238 B CN 101084238B
- Authority
- CN
- China
- Prior art keywords
- mutant
- lymphotoxin
- tnfri
- tnfrii
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/525—Tumour necrosis factor [TNF]
- C07K14/5255—Lymphotoxin [LT]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
This invention discloses some receptor-selective lymphotoxin (LT) mutants and the ratio, the ability of these lymphotoxin mutants combining with the human TNFRI to that with the human TNFRII, is more than 10. The preparation method and the use of the above said LT mutants are also disclosed. In this invention, the LT mutants bind to the TNFRI selectively and that decreases the binding to the TNFRII in a large range, thereby the toxic effect which may be caused by the TNFRII will be reduced.
Description
Technical field
The invention belongs to protein engineering and pharmacy field, be specifically related to a kind of receptor-selective lymphotoxin (LT) derivative and method for making thereof and purposes.
Background technology
Lymphotoxin a (LT α) is also referred to as TNF β, is one of TNF superfamily member, is a class important cytokine.Compare with TNF, the 26S Proteasome Structure and Function of LT α is similar to TNF, has identical acceptor TNFRI, TNFRII, and the tumor cell type of the inhibition of LT α is slightly less than TNF, and the lethal effect of some tumour cell also is not quite similar.
LT α is produced by activated lymphocyte, be the secretor type glycoprotein of 25KD, the LT precursor contains 205 amino-acid residues, 34 amino-acid residue coded signal peptides wherein, sophisticated LT has 171 amino-acid residues (18kD) (SEQID NO:3), there is not disulfide linkage, the 62nd glycosylation site (glycosylation is inessential to its cytotoxic activity) for the N-connection, the action site of LT α and TNFRI, TNFRII concentrates on two lasso trick districts of tripolymer bottom.LT α homotrimer and TNFRI and TNFRII effect, thereby priming signal conduction.
TNFRI and TNFRII are in cell distribution, molecular weight, inequality in conjunction with the aspects such as biologic activity of the avidity of aglucon and mediation.TNFRI and TNFRII are present in except that in exo-erythrocytic all types of cells, and the existence of TNFRI is more general.The TNFRI acceptor mainly is expressed in epithelial cell, and the TNFRII acceptor mainly is expressed in medullary cell, and most cell is all expressed this two kinds of acceptors, but ratio is different.TNFRI is made up of 455 amino acid, and TNFRII is made up of 461 amino acid, all is I type transmembrane glycoprotein, by signal peptide, born of the same parents' outer structure district, stride membrane structure district and endochylema structural area and form.TNFRI cytoplasmic domain 326-413 position be dead zone (death domain, DD).TNFRI can be by DD in conjunction with the TNFR associated protein, transfer cell poison signal, and trigger cell is transferred and is died.The endochylema structural area of TNFRII does not have DD, and the signal that TNFRII transmitted mainly is confined in the immune system cell, with the immune response height correlation of virus infection.The homology of part is extremely low in the born of the same parents of TNFRI and TNFRII, illustrates that also they have different signal transduction paths, have different biological functions.
The biological activity of two kinds of receptor-mediated TNF has very big difference.The TNFa of mouse is similar to the bonding force of TNFRI of mouse and TNFRII, however people's TNFa TNFRI in conjunction with mouse, the TNFRII of debond mouse.In the experiment that causes death, people's TNFa has shown lower lethality rate than the TNFa of mouse, and this prompting TNFRII has very big influence to general toxicity.
Studies have shown that conduction has restraining effect to the TNFRII signal to insulin signaling, can alleviate the restraining effect of this signal to the insulin signaling conduction with anti-TNFRII antibody blocking TNFRII signal.
The TNFRII signal is also playing an important role aspect the adjusting vascular permeability.Anti-TNFRII antibody can be suppressed to the propagation of neurocyte oncocyte, and the cell killing vigor to TNF does not have influence simultaneously.In the mouse experiment, find that TNFRII participates in the injury of the kidney of cis-platinum mediation.
By transforming the calmodulin binding domain CaM of TNF and acceptor, obtain that TNFRI is had optionally TNF mutant, thereby promptly keep its cell killing activity tumour cell, alleviated the toxic side effect that TNFRII causes simultaneously, obtained good effect.In LT and the TNF body, external anti-tumor activity is equally matched, and toxicity is littler, the transformation period is longer, LT also has tangible chemotherapy sensitizing and radio therapy sensitization effect in addition.Therefore, the potential applicability in clinical practice of LT treatment tumour may be better than TNF.The lymphotoxin (LT) derivative LT α of the N terminal sequence 1-27 of disappearance LT α
28-171, be in II phase clinical stage at present, demonstrate clear and definite antitumor action.Yet LT still has certain toxic side effect, and therapeutic index is not high, and not high to the vigor that kills and wounds of some tumour cell, and these have all limited the application of lymphotoxin at field of medicaments.
Studies have shown that toxic side effect and the TNFRII signal correction of LT, the TNFRII signal can activate NF κ B, and NF κ B is important inflammatory factor, and the reaction that directly causes inflammation can also activate the multidrug resistant gene simultaneously, influences the curative effect of medicine to tumour cell.TNFRII also can compete part with TNFRI, causes LT insensitive to the tumour cell of TNFRII high expression level, has suppressed the cytotoxic activity of LT α.
At present, press for clinically and have optionally lymphotoxin of TNFRI, promptly kept the tumor cytotoxicity activity of lymphotoxin, reduced the toxic side effect of LT simultaneously; Make LT improve, can be applied to a greater variety of oncotherapies the tumour cell susceptibility of TNFRII high expression level; In LT and chemotherapy drugs in combination treatment, have better result of treatment, lower toxic side effect.
Yet, still do not have the gratifying lymphotoxin that TNFRI is had highly selective at present.Therefore, this area presses for that exploitation is new to have highly selective and the lymphotoxin mutant extremely low to the selectivity of TNFRII to TNFRI.
Summary of the invention
Purpose of the present invention just provides a kind of TNFRI and has highly selective and the lymphotoxin mutant extremely low to the selectivity of TNFRII.
In a first aspect of the present invention, a kind of receptor-selective lymphotoxin (LT) mutant is provided, in the 106-113 cover Cable Structure of described mutant 106-113 position in corresponding to the lymphotoxin native sequences, 106th, 107,109,110,111,112 or 113 at least one amino acid of amino acids residue are replaced, and/or in 106-113 cover Cable Structure, insert at least one amino acid
Supplementary condition are that 108 Y residues are constant;
And the ratio of the binding ability of described lymphotoxin mutant and people TNFRI and described lymphotoxin mutant and the binding ability of people TNFRII is greater than 10.
In another preference, the ratio of the binding ability of this lymphotoxin mutant and TNFRI and wild-type LT and the binding ability of people TNFRI is greater than 0.1.
In another preference, the ratio of the binding ability of this lymphotoxin mutant and people TNFRII and wild-type LT and the binding ability of people TNFRII is less than 0.01.
In another preference, it is that 106,107,109,110,111,112 or 113 amino acids are replaced by other amino acid that described amino acid is replaced.In another preference, insert 1-3 amino acid (preferred acidic or basic aminoacids) in the 106-113 position.
In another preference, described mutant has the sudden change of the group of being selected from down:
Q107E; Q107D; S106E; S106D; Q107R; Q107N; Q107E/S106E; Q107E/S106D; Q107D/S106E; Or Q107D/S106D.
In another preference, the ratio of the binding ability of described lymphotoxin mutant and people TNFRI and described lymphotoxin mutant and the binding ability of people TNFRII is greater than 100, more preferably greater than 200.
In a second aspect of the present invention, a kind of pharmaceutical composition is provided, it comprises the human lymphotoxin's mutant and the pharmaceutically acceptable carrier of safe and effective amount.
In another preference, described pharmaceutical composition also contains the chemotherapeutics that is selected from down group: CDDP, 5-FU, ADM, VCR or its combination.
In a third aspect of the present invention, the purposes of inventor's lymphotoxin mutant is provided, be used to prepare the medicine for the treatment of following disease: (a) tumour; (b) endobiosis parasitosis.
In a fourth aspect of the present invention, a kind of method of the TNFRI of preparation receptor-selective human lymphotoxin mutant is provided, constant at 108 residues of natural lymphotoxin sequence, replace at least one amino acid in the 106-113 position; Perhaps insert 1-3 amino acid in the 106-113 position.
In a fifth aspect of the present invention, provide a kind of separated DNA sequence, its lymphotoxin mutant of the present invention of encoding.A kind of expression vector that contains described dna sequence dna also is provided.Described expression vector or described dna sequence dna institute transformed host cells also are provided.
In sixth aspect present invention, a kind of method of producing lymphotoxin mutant of the present invention also is provided, the method comprising the steps of:
(a) under conditions suitable for the expression, cultivate above-mentioned host cell, thereby give expression to described lymphotoxin mutant;
(b) separation and purification goes out described lymphotoxin mutant.
In a seventh aspect of the present invention, a kind of method for the treatment of tumour or endobiosis parasitosis is provided, comprise step: the object for the treatment of for needs is used the lymphotoxin mutant of the present invention of safe and effective amount.
Description of drawings
Fig. 1 has shown the external Jurkat of killing and wounding of rhLT mutant LT008 (leukemia) cell.
Fig. 2 has shown the external Lovo of killing and wounding of rhLT mutant LT008 (colorectal carcinoma) cell.
Fig. 3 has shown the external MCF-7 of killing and wounding of rhLT mutant LT008 (mammary cancer) cell.
Fig. 4 has shown the external A549 of killing and wounding of rhLT mutant LT008 (lung cancer) cell.
Fig. 5 has shown the external A375 of killing and wounding of rhLT mutant LT008 (melanoma) cell.
Fig. 6 has shown the external Hela of killing and wounding of rhLT mutant LT008 (cervical cancer) cell.
Fig. 7 has shown the external U937 of killing and wounding of rhLT mutant LT008 (histocytic lymphoma) cell.
Fig. 8 has shown the external HL-60 of killing and wounding of rhLT mutant LT008 (leukemia) cell
Fig. 9 has shown the sensitization of rhLT mutant to chemotherapeutics CDDP.
Figure 10 has shown the sensitization of rhLT mutant to chemotherapeutics 5-FU.
Figure 11 has shown the sensitization of rhLT mutant to chemotherapeutics ADM.
Figure 12 has shown the sensitization of rhLT mutant to chemotherapeutics VCR.
Embodiment
The inventor is by the effect of Molecular Simulation Technique research LT and TNFRI, TNFRII.Through extensive and deep discovering, LT sequence 106-113 position cover Cable Structure is LT and its acceptor TNFRI, the TNFRII effect is tight but discrepant structural region, by introducing sudden change at this lasso trick structural area, can obtain to have optionally LT mutant of TNFRI, the binding ability of these LT mutant of receptor blocking experiment confirm and TNFRI keeps, and in conjunction with at least 10 times of the ability drop of TNFRII, usually at least 20 times, preferably at least 100, more preferably at least 1000 times, more preferably (as 40000 times) more than at least 10000 times.The cytology test confirms that this TNFRI selectivity LT is better than wild-type rhLT to the kinds of tumor cells vigor of killing and wounding, and the tumour cell susceptibility enhancing to the TNFRII high expression level can also improve the susceptibility of tumour cell to chemotherapeutics such as CDDP etc.
As used herein, term " lymphotoxin ", " LT ", " LT α ", " TNF β " are used interchangeably, and mean lymphotoxin LT α, comprise the lymphotoxin that derives from people, mouse, pig, horse or ox.Preferably, be people's lymph poison rope.In addition, lymphotoxin can be the LT with natural wild-type sequence, also can be to have the derivative type of mutant nucleotide sequence (wild-type sequence relatively) or the LT of reorganization.The aminoacid sequence of natural wild-type human lymphotoxin TNF α is shown among the SEQ ID NO:3.
As used herein, the amino acid numbering of lymphotoxin is based on the human lymphotoxin (SEQ ID NO:3) of wild-type.For example, the cover Cable Structure of 106-113 position be exactly the lymphotoxin native sequences be the SQYPFHVP of 106-113 position among the SEQ ID NO:3, or be equivalent to the amino acid whose zone of native sequences 106-113.
As used herein, term " TNFRI selectivity LT " or " LT mutant of the present invention " refer to such LT mutant, the binding ability of it and TNFRI keeps, and in conjunction with at least 10 times of the ability drop of TNFRII, usually at least 20 times, preferably at least 100 times, more preferably at least 1000 times, more preferably (as 40000 times) more than at least 10000 times.LT mutant of the present invention can contain or not contain initial methionine(Met).
As used herein, Q107E represents 107 Gln → Glu sudden change; Q107D represents 107 Gln → Asp; S106E represents 106 Ser → Glu; S106D represents 106 Ser → Asp, and the rest may be inferred.Q107E/S106E represents 107 Gln → Glu sudden change and 106 Ser → Glu, and the rest may be inferred.
Described human lymphotoxin's mutant of the present invention comprises DNA, RNA or human lymphotoxin's mutant protein of coding human lymphotoxin mutant.
In a preference, replace by amino acid, the 106-113 domain structure is finely tuned.For example, replace original amino acid with acidic amino acid L-glutamic acid or aspartic acid.
In another preference, by in the 106-113 zone, keep 108 residues constant, insert 1-3 amino acid.For example, insert a amino acid in acidity or basic aminoacids, especially L-glutamic acid, aspartic acid, arginine, the N in 106-113 zone.
In another preference, available chemical modification method is introduced the group that has negative charge in the 106-113 zone.
LT mutain of the present invention can be prepared like this: the sequence according to disclosed human lymphotoxin is come synthetic primer, amplifies human lymphotoxin's encoding sequence by the PCR method.Encoding sequence that also can the synthetic human TNF alpha.In addition, can carry out base to encoding sequence and replace, be beneficial to high expression level (for example, can replace natural codon) with the preferred codon of intestinal bacteria of coding same amino acid at expression in escherichia coli.Then, dna sequence dna with the human lymphotoxin, carry out genetic modification by the mutant form of pointing out among the present invention, the technology of carrying out genetic modification is as known in the art, for example can be referring to " Mutagenesis:a Practical Approach ", M.J.McPherson, Ed., (IRL Press, Oxford, UK. (1991) wherein for example comprise site-directed mutagenesis, cassette mutagenesis and polymerase chain reaction (PCR) mutagenesis.
After having obtained the proteic dna sequence dna of code book invention new mutant behind the rite-directed mutagenesis, it is connected into suitable expression vector, change proper host cell again over to.At last, cultivate the host cell after transforming, obtain new mutain of the present invention by separation and purification.
In the present invention, can select various carrier known in the art such as commercially available carrier for use.Such as, select commercially available carrier for use, then the proteic nucleotide sequence of code book invention new mutant operationally is connected in expression regulation sequence, can form protein expression vector.
As used herein, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjoining, then means in reading frame adjacent for the secretion leader sequence.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is a prokaryotic cell prokaryocyte, more preferably is intestinal bacteria.
In an example of the present invention, the method for preparing LT mutant of the present invention comprises the steps:
I. modify the encoding sequence of LT, make it keep replacing at least one amino acid in the 106-113 position with other amino acid under the constant situation of 108 residues of natural lymphotoxin sequence; Perhaps insert 1-3 amino acid (as acidity or basic aminoacids, preferably L-glutamic acid, aspartic acid, arginine or N) in the 106-113 position;
Ii. the lymph toxin gene of above-mentioned transformation is cloned into expression plasmid;
Iii. with the above-mentioned expression plasmid transformed host cell that carries lymph toxin gene;
Iv. cultivate by transformed host cells;
V. collect host cell and nutrient solution, separation and purification lymphotoxin mutant.
LT mutant of the present invention is applicable to treatment tumour and endobiosis parasitosis.Representational tumour comprises (but being not limited to): leukemia, histocytic lymphoma, cancer of the stomach, mammary cancer, lung cancer, colorectal carcinoma, cervical cancer, melanoma, bladder cancer.Representational endobiosis parasitosis comprises (but being not limited to): tokoplasmosis.
Lymphotoxin mutant of the present invention can use separately, also can unite use with other drug such as chemotherapeutics, so that increase the susceptibility of tumour cell to chemotherapeutics.
The present invention also provides pharmaceutical composition, and it comprises one or more LT mutains of the present invention of significant quantity, and at least a pharmaceutically acceptable carrier, thinner or vehicle.In preparation during these compositions, usually with activeconstituents and mixed with excipients, or with the vehicle dilution, wrap in can capsule or the carrier that exists of anther sac form in.Do the time spent when vehicle plays thinner, it can be solid, semisolid or the fluent material medium as vehicle, carrier or activeconstituents.Therefore, composition can be tablet, pill, pulvis,, solution, syrup, sterilizing injecting solution etc.The example of suitable vehicle comprises: lactose, glucose, sucrose, sorbyl alcohol, N.F,USP MANNITOL, starch, Microcrystalline Cellulose, polyvinylpyrrolidone, Mierocrystalline cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, sanitas (as methyl hydroxybenzoate and propyl ester), sweeting agent etc.
In another preference, also contain extra chemotherapeutics in the pharmaceutical composition of the present invention, as CDDP, 5-FU, ADM, VCR or its combination.
Composition can be made into unit or polynary formulation.Each formulation comprises the active substance that calculates predetermined amount in order to produce desired treatment effect, and the proper drug vehicle.
The administering mode of LT mutant of the present invention and pharmaceutical composition is not particularly limited, and can pass through oral, local, parenterai administration, for example muscle, vein or subcutaneous injection, or suck mode administration such as spraying.Optimal way is an intravenous administration.
When the LT mutant among the present invention is oral with tablet or capsule form, dosage for the adult of mean body weight 60-70 kilogram at about 1ug in the 1000ug scope, or with injection mode parenterai administration, dosage is about 1ug to 500ug, can once a day or divide administration several times.The dosage unit of pharmaceutical composition generally includes the activeconstituents that scope is 1ug-500ug, 1ug, 5ug, 10ug, 25ug, 50ug, 100ug, 200ug, 300ug, 400ug, 500ug typically.
The quantity and the dosage regimen of used therapeutic activity composition depend on multiple factor when treating concrete illness with the present composition, comprise medical symptom, disease weight, route of administration and the frequency of body weight, age, sex, certainty.This can be determined by the medical worker.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Universal method:
(a) evaluation of mutant
1. enzyme-linked immunosorbent assay
TNFRI:Fc/TNFRII:Fc is coated on the enzyme plate, with LT mutant to be measured be diluted on the same concentrations sample with it in conjunction with after, add the enzyme len antibody of the anti-LT of rabbit, colour developing reading.
Relatively calculate, LT compares with wild-type, asks percentage, infers that the binding ability of LT mutant and acceptor changes, and the mutant that preliminary screening and TNFRI:Fc bonding force are strong is further estimated.
2.rhLT mutant is at external determination of cytotoxic activity to L929 clone
The L929 cell is as target cell, and wild-type LT does contrast, measures the external tumor cell killing activity of rhLT mutant.The per unit vigor refers to the lymphotoxin that lymphotoxin has induced 50% inoculating cell to transfer to use when dying or the consumption of lymphotoxin mutant.
3. receptor binding capacity is measured
The L929 cell is as target cell, adding lymphotoxin or lymphotoxin (LT) derivative kills and wounds, use respectively among TNFRI and the TNFRII and the lethal effect of lymphotoxin, block lymphotoxin mutant to be measured with TNFRI:Fc the IC50 of L929 cell killing and blocking-up wild-type lymphotoxin are defined as LT and TNFRI receptor binding capacity to the ratio of the IC50 of L929 cell killing; Block lymphotoxin mutant to be measured with TNFRII:Fc the IC50 of L929 cell killing and blocking-up wild-type lymphotoxin are defined as LT and TNFRII receptor binding capacity to the ratio of the IC50 of L929 cell killing.
(b) anti-tumor activity of lymphotoxin mutant
At the killing activity of the various lymphotoxin mutant of vitro detection to tumour cell, employed tumor cell line comprises: Jurkat (leukemia), U937 (histocytic lymphoma), MKN-45/MGC-863 (cancer of the stomach), MCF-7 (mammary cancer), A549 (lung cancer), A375 (melanoma), T-24 (bladder cancer) cell etc.
Expression vector establishment:
According to people LT sequence (BAA00064) among the GENBANK, entrust Shanghai to give birth to wild-type LT, the LT of the 1st to 171, the 24th to 171, the 28th to 171 of the full gene composite coding LT maturation proteins of worker's biotechnology service company difference
24-171, LT
28-171Aminoacid sequence, and clone on the NdeI and HindIII site of pET32a (+) carrier (available from Novagen), recombinant expression plasmid LT/pET32a (+), LT obtained
24-171/ pET32a (+), LT
28-171/ pET32a (+).
Expression in intestinal bacteria:
Recombinant expression plasmid LT/pET32a (+), LT
24-171/ pET32a (+), LT
28-171/ pET32a (+) is transformed into escherichia coli BL21 (DE3) respectively, conversion fluid coating LB (containing penbritin 100ng/ μ l) flat board.Be inoculated in the 1mL LB substratum from transforming the dull and stereotyped picking mono-clonal of going up, after 37 ℃, 250rpm are cultivated 3h, add IPTG, continue to cultivate 3h to final concentration 0.5mM.Get the centrifugal collection bacterial sediment of bacterium liquid after 100ul expresses, add 50ul SDS specimen preparation liquid, in 12.5% PAGE glue, carry out electrophoresis detection.
Protein purification:
Get LT/pET32a (+)/BL21 (DE3), LT respectively
24-171/ pET32a (+)/BL21 (DE3), LT
28-171In/pET32a (+)/BL21 (DE3) recombinant bacterial strain 1ml inoculation 1000mlLB (the containing penbritin 100ng/ μ l) substratum, after 37 ℃, 250rpm are cultivated 5h, add IPTG, continue to cultivate 4h to final concentration 0.5mM.The collection weight in wet base is that the bacterial sediment of 5g washs back ultrasonication, centrifugal collection inclusion body with PBS.With urea solubilising inclusion body, with Tris damping fluid renaturation.Carry out purifying with Q-Sepharose FF ion-exchange chromatography, Phenyl-Sepharose FF hydrophobic chromatography and CM-Sepharose FF ion-exchange chromatography in succession.It is 1mg/ml that elutriant is diluted to protein concentration.
Obtain wild-type LT, LT respectively
24-171, LT
28-1711.0,3.5,4.2 milligrams in albumen.
The preparation of embodiment 2 mutant rhLT008
The structure of rhLT008 mutant expression vector:
(1) pcr amplification mutant gene:
With LT
24-171/ pET32a (+) plasmid is a template, is that a pair of primer increases with LT-P32U and Q107E-R, obtains the LT008-AB fragment, increases with LT-P32D and a pair of primer of Q107E-F simultaneously, obtains the LT008-CD fragment.Getting LT008-AB and LT008-CD again and mix the back for template, is that a pair of primer increases with LT-P32U and LT-P32D, obtains to contain the LT008 fragment of Q107E sudden change.
LT-P32U：5’ACACATATGATG?CAC?TCT?ACC?CTG?AAA?CCG?3’(SEQ?ID?NO：4)
LT-P32D：5’TGCAAGCTTCTA?CAG?AGC?GAA?GGC?TCC?AAA?3’(SEQ?ID?NO：5)
Q107E-F：5’CTCTTCTCCTCCGAATACCCCTTC?3’(SEQ?ID?NO：6)
Q107E-R：5’GAAGGGGTATTCGGAGGAGAAGAG?3’(SEQ?ID?NO：7)
Be connected with the pMD-18T carrier behind the PCR product purification, transformed into escherichia coli DH5a extracts the LT008/pMD-18T plasmid, forward and reverse sequencing that carries out.
(2) prokaryotic expression carrier of structure rhLT mutant:
The correct clone that checks order, its plasmid is with restriction enzyme NdeI and the two enzymic digestions of HindIII, and subclone obtains LT008/pET32a (+) recombinant expression plasmid to the same loci of pET32a (+) expression vector.
The expression of rhLT mutant in intestinal bacteria:
Recombinant expression plasmid LT008/pET3a (+) transformed into escherichia coli BL21 (DE3), conversion fluid coating LB (containing penbritin 100ng/ μ l) flat board.Be inoculated in the 1mL LB substratum from transforming the dull and stereotyped picking mono-clonal of going up, after 37 ℃, 250rpm are cultivated 3h, add IPTG, continue to cultivate 3h to final concentration 0.1mM.Get the centrifugal collection bacterial sediment of bacterium liquid after 100ul expresses, add 50ul SDS specimen preparation liquid, in 12.5% PAGE glue, carry out electrophoresis detection.
The preparation of embodiment 3 LT006
With LT
24-171/ pET32a (+) plasmid is a template, is that a pair of primer increases with LT-P32U and S106E-Q107E-R, obtains the LT006-AB fragment, increases with LT-P32D and a pair of primer of S106E-Q107E-F simultaneously, obtains the LT006-CD fragment.Getting LT006-AB and LT006-CD again and mix the back for template, is that a pair of primer increases with LT-P32U and LT-P32D, obtains the LT006 fragment that contains the S106E-Q107E sudden change of total length.
The PCR primer sequence is:
S106E-Q107E-F：5’CTCTTCTCCGAAGAATACCCCTTC?3’(SEQ?ID?NO：8)
S106E-Q107E-R：5’GAAGGGGTATTCTTCGGAGAAGAG?3’(SEQ?ID?NO：9)
Press embodiment 2 with quadrat method clone, expression, purifying LT006, obtain 3.1 milligrams in LT006 albumen.
The preparation of embodiment 4 LT009
With LT
24-171/ pET32a (+) plasmid is a template, is that a pair of primer increases with LT-P32U and Q107D-R, obtains the LT009-AB fragment, increases with LT-P32D and a pair of primer of Q107D-F simultaneously, obtains the LT009-CD fragment.Getting LT009-AB and LT009-CD again and mix the back for template, is that a pair of primer increases with LT-P32U and LT-P32D, obtains the LT009 fragment that contains the Q107D sudden change of total length.
The PCR primer sequence is:
Q107D-F：5’CTCTTCTCCTCCGACTACCCCTTC?3’(SEQ?ID?NO：10)
Q107D-R：5’GAAGGGGTAGTCGGAGGAGAAGAG?3’(SEQ?ID?NO：11)
Press embodiment 2 with quadrat method clone, expression, purifying LT009, obtain 4.2 milligrams in LT009 albumen.
The preparation of embodiment 5 mutant rhLT057
With LT
28-171/ pET32a (+) plasmid is a template, with LT
28-P32U and Q107E-R are that a pair of primer increases, and obtain the LT057-AB fragment, increase with LT-P32D and a pair of primer of Q107E-F simultaneously, obtain the LT057-CD fragment.Get LT057-AB and LT057-CD again and mix the back for template, with LT
28-P32U and LT-P32D are that a pair of primer increases, and obtain to contain the LT057 fragment of Q107E sudden change.
LT
28-P32U：5’ACACATATG?AAA?CCG?GCT?GCT?CAC?3’(SEQ?ID?NO：12)
LT-P32D：5’TGCAAGCTTCTA?CAG?AGC?GAA?GGC?TCC?AAA?3’(SEQ?ID?NO：5)
Q107E-F：5’CTCTTCTCCTCCGAATACCCCTTC?3’(SEQ?ID?NO：6)
Q107E-R：5’GAAGGGGTATTCGGAGGAGAAGAG?3’(SEQ?ID?NO：7)
Press embodiment 2 with quadrat method clone, expression, purifying LT057, obtain 3.1 milligrams in LT057 albumen.
The preparation of embodiment 6 LT090
With LT
24-171/ pET32a (+) plasmid is a template, is that a pair of primer increases with LT-P32U and Q107R-R, obtains the LT090-AB fragment, increases with LT-P32D and a pair of primer of Q107R-F simultaneously, obtains the LT090-CD fragment.Getting LT090-AB and LT090-CD again and mix the back for template, is that a pair of primer increases with LT-P32U and LT-P32D, obtains the LT090 fragment that contains the Q107R sudden change of total length.
The PCR primer sequence is:
Q107R-F：5’CTCTTCTCCTCCCGTTACCCCTTC?3’(SEQ?ID?NO：13)
Q107R-R：5’GAAGGGGTAACGGGAGGAGAAGAG?3’(SEQ?ID?NO：14)
Press embodiment 2 with quadrat method clone, expression, purifying LT090, obtain 3.3 milligrams in LT090 albumen.
The preparation of embodiment 7LT092
With LT
24-171/ pET32a (+) plasmid is a template, is that a pair of primer increases with LT-P32U and Q107N-R, obtains the LT092-AB fragment, increases with LT-P32D and a pair of primer of Q107N-F simultaneously, obtains the LT092-CD fragment.Getting LT092-AB and LT092-CD again and mix the back for template, is that a pair of primer increases with LT-P32U and LT-P32D, obtains the LT092 fragment that contains the Q107N sudden change of total length.
The PCR primer sequence is:
Q107N-F：5’CTCTTCTCCTCCAACTACCCCTTC?3’(SEQ?ID?NO：15)
Q107N-R：5’GAAGGGGTAGTTGGAGGAGAAGAG?3’(SEQ?ID?NO：16)
Press embodiment 2 with quadrat method clone, expression, purifying LT092, obtain 4.5 milligrams in LT092 albumen.
Embodiment 8. enzyme-linked immunosorbent assay receptors bind situations:
TNFRI:Fc/TNFRII:Fc is coated on the enzyme plate, with LT mutant to be measured be diluted on the same concentrations sample with it in conjunction with after, add the enzyme len antibody of the anti-LT of rabbit, colour developing reading.
Relatively calculate, LT compares with wild-type, asks percentage, infers the binding ability of LT and acceptor
Table 1: with the binding ability evaluation of acceptor
| The LT numbering | Bonding force with TNFRII:Fc | Bonding force with TNFRI:Fc |
| LT 1-171 | 93.56％ | 95.45％ |
| LT 28-171 | 100.00％ | 100.00％ |
| LT 24-171 | 99.77％ | 90.01％ |
| LT006 | 6.17％ | 95.80％ |
| LT008 | 6.89％ | 91.15％ |
| LT009 | 58.96％ | 91.14％ |
| LT057 | 0.46％ | 93.60％ |
| LT090 | 23.61％ | 65.16％ |
| LT092 | 10.53％ | 72.86％ |
The result shows, compares with LT, and the bonding force of LT006, LT008, LT009 and acceptor TNFRI keeps substantially, and greatly reduces with the bonding force of TNFRII.
Embodiment 9.rhLT mutant is at external determination of cytotoxic activity to L929 clone
To in the present embodiment mutant LT006,008,009 further being measured cytotoxic activity.
L929 cell 1.5 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h, every hole adds different dilution samples of 100ul and dactinomycin (1mg/L), continues to detect the cell survival situation with crystal violet staining assay behind the cultivation 24h.Test sample is respectively LT international standard substance, 27 amino acid whose first-generation LT stoste (LT of N end disappearance
28-171), 23 amino acid whose LT (LT of N end disappearance
24-171) and LT mutant LT006, LT008, LT009.
Unit refers to induce the amount of 50% the needed LT of detection natural death of cerebral cells.
The rhLT mutant the results are shown in Table 2 at external determination of cytotoxic activity to L929 clone:
Table 2 cytotoxicity
| Sample | Specific activity (IU/mg) |
| LT 1-171 | 5.12×10 7 |
| LT 28-171 | 7.22×10 7 |
| LT 24-171 | 5.94×10 7 |
| LT006 | 1.31×10 8 |
| LT008 | 1.28×10 8 |
| LT009 | 1.35×10 8 |
| LT057 | 6.70×10 7 |
| LT090 | 1.37×10 8 |
| LT092 | 1.79×10 8 |
The active neutralisation of embodiment 10.TNFRI and TNFRII detects the bind receptor ability of LT mutant:
(1) cell kind plate: the L929 cell 1.5 * 10 in the vegetative period of taking the logarithm
5/ ml inoculates in 96 well culture plates, and every hole 100ul cultivates 24h.
(2) diluted sample: plant plate next day, LT mutant and LT standard substance are made into 2 times of dilutions of 1ng/ml TNFRI, from 13 extent of dilution of 250ng/ml dilution.LT mutant and LT standard substance are made into 4 times of dilutions of 1ng/ml TNFRII, and from 500,000ng/ml plays 13 every holes of extent of dilution of dilution and contains 1 dactinomycin 1000ng/ml.Continue to cultivate 24h.
(3) sample reading: 96 orifice plates are taken out, discard nutrient solution and also pat dry as far as possible, detect cell survival situation, microplate reader 570nm place colorimetric with crystal violet staining assay.
(4) interpretation of result: adopt four parametric equations of PraphPad Prism4.0 data processing software to analyze automatically: the logarithmic value of LT standard substance concentration is an X-axis, the OD490 value is a Y-axis, software will provide the medium effective concentration (IC50) of sample and standard substance, and draw the serpentine curve.To block the IC50 and blocking-up wild-type lymphotoxin receptor binding capacity to the ratio definition LT of the IC50 of L929 cell killing of lymphotoxin mutant to be measured to the L929 cell killing.
The results are shown in Table 3.
Each mutant of table 3 LT is in conjunction with the ability of TNFRI, TNFRII
| Sample | Among the TNFRI and the IC50 of LT | In conjunction with the TNFRI ability | Among the TNFRII and the IC50 of LT | In conjunction with the TNFRII ability | The decline multiple |
| LT1-171 | 20.14ng/ml | ?1 | 12.21ng/ml | 1 | - |
| LT28-171 | 15.64ng/ml | ?1.29 | 10.15ng/ml | 1.20 | 0.83 |
| LT24-171 | 18.38ng/ml | ?1.10 | 12.57ng/ml | 0.97 | 1.03 |
| LT006 | 9.02ng/ml | ?2.23 | 2.86×10 5ng/ml | 4.27×10 -5 | 2.34×10 4 |
| LT008 | 8.11ng/ml | ?2.48 | 2.91×10 5ng/ml | 3.43×10 -5 | 2.38×10 4 |
| LT009 | 10.86ng/ml | ?1.86 | 4.98×10 3ng/ml | 2.45×10 -3 | 4.08×10 2 |
| LT057 | 14.21ng/ml | ?1.42 | ＞5×10 5ng/ml | ＜2.44×10 -5 | ＞4.10×10 4 |
| LT090 | 28.46ng/ml | ?0.71 | 3.12×10 3ng/ml | 3.91×10 -3 | 2.56×10 2 |
| LT092 | 22.88ng/ml | ?0.88 | 1.80×10 4ng/ml | 6.78×10 -4 | 1.47×10 3 |
Show that with experimental result LT006, LT008, LT009, LT057, LT090, LT092 keep in conjunction with the binding ability with TNFRI in the table 3, the bonding force that shows LT006, LT008, LT009 and TNFRI is a little more than LT; And with the binding ability of TNFRII reduced 200-40000 doubly more than, had high selectivity to the TNFRI acceptor.
The external knurl spectrum that presses down of embodiment 11.rhLT mutant:
The ability of the external Jurkat of killing and wounding of rhLT mutant LT008 (leukemia), U937 (histocytic lymphoma), MKN-45/MGC-863 (cancer of the stomach), MCF-7 (mammary cancer), A549 (lung cancer), A375 (melanoma), T-24 (bladder cancer) cell is better than LT.
(1) external Jurkat (leukemia) cell that kills and wounds of rhLT mutant LT008
The Jurkat cell is with 1.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h, every hole adds the different dilution samples of 100ul, and the dactinomycin final concentration is 25ng/ml, continues to detect the cell survival situation with the MTS staining behind the cultivation 48h.The sample that detects is respectively LT, rhLT mutant LT008.
The result as shown in Figure 1, the EC50=8.385ng/ml of LT, the EC50=1.390ng/ml of LT008.
(2) external Lovo (colorectal carcinoma) cell that kills and wounds of rhLT mutant LT008
The Lovo cell is with 2.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 4h, every hole adds the different dilution samples of 100ul, and the dactinomycin final concentration is 2000ng/ml, continues to detect the cell survival situation with crystal violet staining assay behind the cultivation 24h.The sample that detects is respectively LT, LT mutant LT008.
The result as shown in Figure 2, the EC50=5.171ng/ml of LT; The EC50=1.845ng/ml of LT008.
(3) external MCF-7 (mammary cancer) cell that kills and wounds of rhLT mutant LT008
The MCF-7 cell is with 1.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h, every hole adds the different dilution samples of 100ul, and the dactinomycin final concentration is 20ng/ml, continues to detect the cell survival situation with the MTS staining behind the cultivation 48h.The sample that detects is respectively LT, LT mutant LT008.
The result as shown in Figure 3, the EC50=1.773ng/ml of LT; The EC50=0.889ng/ml of LT008
(4) external A549 (lung cancer) cell that kills and wounds of rhLT mutant LT008
The A549 cell is with 1.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h, every hole adds the different dilution samples of 100ul, and the dactinomycin final concentration is 20ng/ml, continues to detect the cell survival situation with the MTS staining behind the cultivation 48h.The sample that detects is respectively LT, LT mutant LT008.
The result as shown in Figure 4, the EC50=6.010ng/ml of LT; The EC50=3.886ng/ml of LT008.
(5) external A375 (melanoma) cell that kills and wounds of rhLT mutant LT008
The A375 cell is with 1.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h, every hole adds the different dilution samples of 100ul, and the dactinomycin final concentration is 10ng/ml, continues to detect the cell survival situation with the MTS staining behind the cultivation 48h.The sample that detects is respectively LT, LT mutant LT008.
Fig. 5 is described as a result, the EC50=2.128ng/ml of LT; The EC50=0.621ng/ml of LT008.
(6) external HeLa (cervical cancer) cell that kills and wounds of rhLT mutant LT008
The HeLa cell is with 2.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 4h, every hole adds the different dilution samples of 100ul, and the dactinomycin final concentration is 2000ng/ml, continues to detect the cell survival situation with crystal violet staining assay behind the cultivation 24h.The sample that detects is respectively LT, LT mutant LT008.
Fig. 6 is described as a result, the EC50=3.024ng/ml of LT; The EC50=0.945ng/ml of LT008.
(7) external U937 (histocytic lymphoma) cell that kills and wounds of rhLT mutant LT008
The U937 cell is with 2.5 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h, every hole adds the different dilution samples of 100ul, and the dactinomycin final concentration is 20ng/ml, continues to detect the cell survival situation with the MTS staining behind the cultivation 48h.The sample that detects is respectively LT, LT mutant LT008.
The result as shown in Figure 7, the EC50=2.174ng/ml of LT; The EC50=0.562ng/ml of LT008.
(8) external HL-60 (leukemia) cell that kills and wounds of rhLT mutant LT008
The HL-60 cell is with 1.0 * 10
5Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 4h, every hole adds the different dilution samples of 100ul, and the dactinomycin final concentration is 300ng/ml, continues to detect the cell survival situation with the MTS staining behind the cultivation 24h.The sample that detects is respectively LT, rhLT mutant LT008.
The result as shown in Figure 8, the EC50=2.263ng/ml of LT; The EC50=1.034ng/ml of LT008.
Embodiment 12.rhLT mutant is to the sensitization of chemotherapeutics
(1) rhLT mutant LT008 increases K562 (the former leukemia of chronic marrow), U937 (histocytic lymphoma), A549 (lung cancer), MCF-7 (mammary cancer), SW-626 (ovarian cancer) the cell susceptibility to alkylating agent based chemotherapy medicine CDDP (cis-platinum) and CTX (endoxan).
K562, U937, A549, MCF-7 and SW-626 cell are with 1.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h.Dosing regimen is: the LT, the LT mutant LT008 that (a) singly add 0.1ng/ml;
(b) singly add different concns CDDP and CTX; (c) LT of 0.1ng/ml, LT mutant LT008 unite dosing simultaneously with different concns CDDP and CTX respectively; (d) blank valency group adds the equivalent nutrient solution.
Detect the cell survival situation with the MTS staining after continuing to cultivate 48h.According to the concentration-response curve, obtain the half-inhibition concentration IC50 that adds or do not add LT, TNF and LT008 chemotherapeutics, and obtain enhanced sensitivity multiple (T)=IC50 (single chemotherapeutic of using)/IC50 (LT, TNF and LT008 coupling chemotherapeutics)
The result as shown in Figure 9, the IC50=7.96mg/ml of CDDP group; The IC50=0.89mg/ml of LT+CDDP group, T=8.94; The IC50=0.12mg/m of LT008+CDDP group, T=66.33.
(2) rhLT mutant LT008 increases SW480 (colorectal cancer), MKN-45/MGC-863 (cancer of the stomach) the cell susceptibility to antimetabolic based chemotherapy medicine 5-FU (5 FU 5 fluorouracil) and MTX (methotrexate).
SW480 and MKN-45/MGC-863 cell are with 1.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h.Dosing regimen is: (a) singly add different concns LT, LT mutant LT008; (b) singly add different concns 5-FU and MTX; (c) different concns LT, LT mutant LT008 add the equivalent nutrient solution with different concns 5-FU and MTX associating dosing (d) simultaneously blank valency group respectively.Detect the cell survival situation with the MTS staining after continuing to cultivate 48h.
The result as shown in figure 10, the IC50=40mg/ml of 5-FU group; The IC50=21.5mg/ml of LT+5-FU group, T=1.86; The IC50=2.3mg/m of LT008+5-FU group, T=17.39.
(3) rhLT mutant LT008 increases Jurkat (leukemia), HL-60 (promyelocytic leukemia) the cell susceptibility to microbiotic based chemotherapy medicine ADM (Zorubicin).
Jurkat, HL-60 cell are with 1.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h.Dosing regimen is: (a) singly add different concns LT, LT mutant LT008; (b) singly add different concns ADM; (c) different concns LT, LT mutant LT008 unite dosing simultaneously with different concns ADM respectively; (d) blank valency group adds the equivalent nutrient solution.Detect the cell survival situation with the MTS staining after continuing to cultivate 48h.
The result as shown in figure 11, the IC50=1.07mg/ml of ADM group; The IC50=0.98mg/ml of LT+ADM group, T=1.09; The IC50=0.450.013mg/ml of LT008+ADM group, T=2.38.
(4) rhLT mutant LT008 increases A375 (melanoma), HeLa (cervical cancer), T-24 (bladder cancer) the cell susceptibility to plant based chemotherapy medicine VCR (vincristine(VCR)).
A375, HeLa, T-24 cell are with 1.0 * 10
4Cells/well is inoculated 96 orifice plates, 37 ℃, 5%CO
2Cultivate 24h.Dosing regimen is: (a) singly add different concns LT, LT mutant LT008; (b) singly add different concns VCR; (c) different concns LT, LT mutant LT008 unite dosing simultaneously with different concns VCR respectively; (d) blank valency group adds the equivalent nutrient solution.Detect the cell survival situation with the MTS staining after continuing to cultivate 48h.
The result as shown in figure 12, the IC50=0.437mg/ml of VCR group; The IC50=0.141mg/ml of LT+VCR group, T=3.10; The IC50=0.073mg/m of LT008+VCR group, T=5.99.
The above results shows that rhLT mutant LT008 can significantly increase the susceptibility of tumour cell to chemotherapeutics.
Discuss
LT108Y is the vital role residue of LT and acceptor.This 108Y residue is a high conservative, and the bonding force that any simple point mutation in this site all can produce LT and TNFR sharply descends, and receptor binding capacity descends more than 100 times.The inventor has carried out a large amount of mutation researches to the cover Cable Structure at LT108Y place, confirm that the cover Cable Structure that LT106-113 forms is the tight and discrepant position of effect of LT and TNFRI and TNFRII, sudden change in this zone may cause the generation significant change of LT to the avidity of TNFRI and TNFRII, the ideal survey region, the particularly amino acid of LT107 position that are acquisition receptor-selective mutant are huge to the bonding force influence of LT and two acceptors.Just show the selectivity of TNFRI of height when the residue Q-spoiling of LT107 position is E, D, N, R, the acceptor neutralization experimental results show that this point, the bonding force decline 200-40000 of LT and TNFRII times, and remain unchanged substantially with the binding ability of TNFRI; Illustrate that this regional amino acid character is very important, the bonding force of LTS106M mutant and TNFRI descends to some extent, and keep with the bonding force of TNFRII, the sudden change that the LT109 position is 110 also produces Different Effects to LT with combining of two acceptors, has proved that also this zone is the important research zone that obtains receptor-selective LT.By transformation, can design and two discrepant LT mutant of acceptor binding force this zone.
Compare with natural rhLT, rhLT of the present invention has the selective binding to TNFRI, and reducing with the TNFRII binding ability can be up to more than 200-40000 times.TNFRI selectivity LT has reduced the toxic side effect that TNFRII may cause, has lower general toxicity; Avoided TNFRII and TNFRI to the competition effect of LT and sTNFRII neutralizing effect to LT, thereby the susceptibility to the tumour cell of TNFRII high expression level improves, it is wider to press down the knurl pedigree, studies show that TNFRI optionally LT the lethal effect of kinds of tumor cells is strengthened, and better with chemotherapeutics coupling result of treatment.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Fudan Zhangjiang biomedical Co., Ltd
＜120〉receptor-selective lymphotoxin (LT) derivative
<130>048407
<160>16
<170>PatentIn?version?3.1
<210>1
<211>450
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<220>
<221>CDS
<222>(1)..(450)
<223>
<400>1
atg?cac?tct?acc?ctg?aaa?ccg?gct?gct?cac?ctc?att?gga?gac?ccc?agc 48
Met?His?Ser?Thr?Leu?Lys?Pro?Ala?Ala?His?Leu?Ile?Gly?Asp?Pro?Ser
1 5 10 15
aag?cag?aac?tca?ctg?ctc?tgg?aga?gca?aac?acg?gac?cgt?gcc?ttc?ctc 96
Lys?Gln?Asn?Ser?Leu?Leu?Trp?Arg?Ala?Asn?Thr?Asp?Arg?Ala?Phe?Leu
20 25 30
cag?gat?ggt?ttc?tcc?ttg?agc?aac?aat?tct?ctc?ctg?gtc?ccc?acc?agt 144
Gln?Asp?Gly?Phe?Ser?Leu?Ser?Asn?Asn?Ser?Leu?Leu?Val?Pro?Thr?Ser
35 40 45
ggc?atc?tac?ttc?gtc?tac?tcc?cag?gtg?gtc?ttc?tct?ggg?aaa?gcc?tac 192
Gly?Ile?Tyr?Phe?Val?Tyr?Ser?Gln?Val?Val?Phe?Ser?Gly?Lys?Ala?Tyr
50 55 60
tct?ccc?aag?gcc?acc?tcc?tcc?cca?ctc?tac?ctg?gcc?cat?gag?gtc?cag 240
Ser?Pro?Lys?Ala?Thr?Ser?Ser?Pro?Leu?Tyr?Leu?Ala?His?Glu?Val?Gln
65 70 75 80
ctc?ttc?tcc?tcc?gaa?tac?ccc?ttc?cat?gtg?cct?ctc?ctc?agc?tcc?cag 288
Leu?Phe?Ser?Ser?Glu?Tyr?Pro?Phe?His?Val?Pro?Leu?Leu?Ser?Ser?Gln
85 90 95
aag?atg?gtg?tat?cca?ggg?ctg?cag?gaa?ccc?tgg?ctg?cac?tcg?atg?tac 336
Lys?Met?Val?Tyr?Pro?Gly?Leu?Gln?Glu?Pro?Trp?Leu?His?Ser?Met?Tyr
100 105 110
cac?ggg?gct?gcg?ttc?cag?ctc?acc?cag?gga?gac?cag?cta?tcc?acc?cac 384
His?Gly?Ala?Ala?Phe?Gln?Leu?Thr?Gln?Gly?Asp?Gln?Leu?Ser?Thr?His
115 120 125
aca?gat?ggc?atc?ccc?cac?cta?gtc?ctc?agc?cct?agt?act?gtc?ttc?ttt 432
Thr?Asp?Gly?Ile?Pro?His?Leu?Val?Leu?Ser?Pro?Ser?Thr?Val?Phe?Phe
130 135 140
gga?gcc?ttc?gct?ctg?tag?450
Gly?Ala?Phe?Ala?Leu
145
<210>2
<211>149
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>2
Met?His?Ser?Thr?Leu?Lys?Pro?Ala?Ala?His?Leu?Ile?Gly?Asp?Pro?Ser
1 5 10 15
Lys?Gln?Asn?Ser?Leu?Leu?Trp?Arg?Ala?Asn?Thr?Asp?Arg?Ala?Phe?Leu
20 25 30
Gln?Asp?Gly?Phe?Ser?Leu?Ser?Asn?Asn?Ser?Leu?Leu?Val?Pro?Thr?Ser
35 40 45
Gly?Ile?Tyr?Phe?Val?Tyr?Ser?Gln?Val?Val?Phe?Ser?Gly?Lys?Ala?Tyr
50 55 60
Ser?Pro?Lys?Ala?Thr?Ser?Ser?Pro?Leu?Tyr?Leu?Ala?His?Glu?Val?Gln
65 70 75 80
Leu?Phe?Ser?Ser?Glu?Tyr?Pro?Phe?His?Val?Pro?Leu?Leu?Ser?Ser?Gln
85 90 95
Lys?Met?Val?Tyr?Pro?Gly?Leu?Gln?Glu?Pro?Trp?Leu?His?Ser?Met?Tyr
100 105 110
His?Gly?Ala?Ala?Phe?Gln?Leu?Thr?Gln?Gly?Asp?Gln?Leu?Ser?Thr?His
115 120 125
Thr?Asp?Gly?Ile?Pro?His?Leu?Val?Leu?Ser?Pro?Ser?Thr?Val?Phe?Phe
130 135 140
Gly?Ala?Phe?Ala?Leu
145
<210>3
<211>171
<212>PRT
＜213〉homo sapiens (Homo sapiens)
<400>3
Leu?Pro?Gly?Val?Gly?Leu?Thr?Pro?Ser?Ala?Ala?Gln?Thr?Ala?Arg?Gln
1 5 10 15
His?Pro?Lys?Met?His?Leu?Ala?His?Ser?Thr?Leu?Lys?Pro?Ala?Ala?His
20 25 30
Leu?Ile?Gly?Asp?Pro?Ser?Lys?Gln?Asn?Ser?Leu?Leu?Trp?Arg?Ala?Asn
35 40 45
Thr?Asp?Arg?Ala?Phe?Leu?Gln?Asp?Gly?Phe?Ser?Leu?Ser?Asn?Asn?Ser
50 55 60
Leu?Leu?Val?Pro?Thr?Ser?Gly?Ile?Tyr?Phe?Val?Tyr?Ser?Gln?Val?Val
65 70 75 80
Phe?Ser?Gly?Lys?Ala?Tyr?Ser?Pro?Lys?Ala?Thr?Ser?Ser?Pro?Leu?Tyr
85 90 95
Leu?Ala?His?Glu?Val?Gln?Leu?Phe?Ser?Ser?Gln?Tyr?Pro?Phe?His?Val
100 105 110
Pro?Leu?Leu?Ser?Ser?Gln?Lys?Met?Val?Tyr?Pro?Gly?Leu?Gln?Glu?Pro
115 120 125
Trp?Leu?His?Ser?Met?Tyr?His?Gly?Ala?Ala?Phe?Gln?Leu?Thr?Gln?Gly
130 135 140
Asp?Gln?Leu?Ser?Thr?His?Thr?Asp?Gly?Ile?Pro?His?Leu?Val?Leu?Ser
145 150 155 160
Pro?Ser?Thr?Val?Phe?Phe?Gly?Ala?Phe?Ala?Leu
165 170
<210>4
<211>30
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
acacatatga?tgcactctac?cctgaaaccg 30
<210>5
<211>30
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
tgcaagcttc?tacagagcga?aggctccaaa 30
<210>6
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
ctcttctcct?ccgaataccc?cttc 24
<210>7
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>7
gaaggggtat?tcggaggaga?agag 24
<210>8
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>8
ctcttctccg?aagaataccc?cttc 24
<210>9
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>9
gaaggggtat?tcttcggaga?agag 24
<210>10
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>10
ctcttctcct?ccgactaccc?cttc 24
<210>11
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>11
gaaggggtag?tcggaggaga?agag 24
<210>12
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>12
acacatatga?aaccggctgc?tcac 24
<210>13
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>13
ctcttctcct?cccgttaccc?cttc 24
<210>14
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>14
gaaggggtaa?cgggaggaga?agag 24
<210>15
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>15
ctcttctcct?ccaactaccc?cttc 24
<210>16
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>16
gaaggggtag?ttggaggaga?agag 24
Claims (10)
1. a receptor-selective lymphotoxin (LT) mutant is characterized in that, described mutant is in corresponding to the lymphotoxin native sequences, and 107 amino acids residues are replaced by E, D, N or R, and wherein the lymphotoxin native sequences is shown in SEQ ID NO:3;
Supplementary condition are that 108 Y residues are constant;
And the ratio of the binding ability of described lymphotoxin mutant and people TNFRI and described lymphotoxin mutant and the binding ability of people TNFRII is greater than 10;
And the sudden change of described mutant is selected from down group: Q107E; Q107D; Q107R; Q107N; Q107E/S106E; Q107E/S106D; Q107D/S106E; Or Q107D/S106D.
2. lymphotoxin mutant as claimed in claim 1 is characterized in that,
The ratio of the binding ability of this lymphotoxin mutant and TNFRI and wild-type LT and the binding ability of people TNFRI is greater than 0.1;
The ratio of the binding ability of this lymphotoxin mutant and people TNFRII and wild-type LT and the binding ability of people TNFRII is less than 0.01.
3. lymphotoxin mutant as claimed in claim 2 is characterized in that, the 107th the residue Q-spoiling in corresponding to the lymphotoxin native sequences of described mutant is E.
4. lymphotoxin mutant as claimed in claim 1 is characterized in that, the sudden change of described mutant is selected from down group:
Q107E/S106E; Or Q107D/S106D.
5. lymphotoxin mutant as claimed in claim 1 is characterized in that, the ratio of the binding ability of described lymphotoxin mutant and people TNFRI and described lymphotoxin mutant and the binding ability of people TNFRII is greater than 100.
6. a pharmaceutical composition is characterized in that, it comprises the described lymphotoxin mutant of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.
7. pharmaceutical composition as claimed in claim 6 is characterized in that, it also contains the chemotherapeutics that is selected from down group: CDDP, 5-FU, ADM, VCR or its combination.
8. the purposes of human lymphotoxin's mutant as claimed in claim 1 is characterized in that, is used to prepare the medicine for the treatment of tumour.
9. method for preparing the described TNFRI receptor-selective of claim 1 human lymphotoxin mutant, it is characterized in that, constant at 108 residues of natural lymphotoxin sequence, 107 amino acids are replaced with E, D, N or R, wherein the lymphotoxin native sequences is shown in SEQ ID NO:3.
10. a separated DNA sequence is characterized in that, the described lymphotoxin mutant of its coding claim 1.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2004/001522 WO2006066463A1 (en) | 2004-12-24 | 2004-12-24 | Receptor-selective lymphotoxin deviants |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010189454XA Division CN101890156A (en) | 2004-12-24 | 2004-12-24 | Receptor-selective lymphotoxin (LT) derivative |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101084238A CN101084238A (en) | 2007-12-05 |
| CN101084238B true CN101084238B (en) | 2011-09-21 |
Family
ID=36601356
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2004800446341A Active CN101084238B (en) | 2004-12-24 | 2004-12-24 | Receptor selectivity lymphotoxin derivates |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN101084238B (en) |
| WO (1) | WO2006066463A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107213456A (en) * | 2017-05-25 | 2017-09-29 | 苏州华测生物技术有限公司 | The new application of lymphotoxin (LT) derivative |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009062344A1 (en) * | 2007-11-16 | 2009-05-22 | Shanghai Fudan-Zhangjiang Bio-Pharmaceutical Co., Ltd. | Use of lymphotoxin for sensitizing tumor cells to chemotherapeutic drugs |
-
2004
- 2004-12-24 WO PCT/CN2004/001522 patent/WO2006066463A1/en not_active Application Discontinuation
- 2004-12-24 CN CN2004800446341A patent/CN101084238B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Cynthia R.Goh et al.Aspartic acid 50 and tyrosine 108 are essentialforreceptorbinding and cytotoxic activity of tumournecrosisfactorbeta(lymphotoxin)..Protein Engineering.4 7.1991,4(7),785-791. |
| Cynthia R.Goh et al.Aspartic acid 50 and tyrosine 108 are essentialforreceptorbinding and cytotoxic activity of tumournecrosisfactorbeta(lymphotoxin)..Protein Engineering.4 7.1991,4(7),785-791. * |
| Toshiaki Wakabayashi et al.Deletion of lysine 84 to lysine 89 Enhances theCytotoxicityandthe Receptor Binding Affinity of HumanLymphotoxin..The Journal of Biological Chemistry.265 13.1990,265(13),7604-7609. |
| Toshiaki Wakabayashi et al.Deletion of lysine 84 to lysine 89 Enhances theCytotoxicityandthe Receptor Binding Affinity of HumanLymphotoxin..The Journal of Biological Chemistry.265 13.1990,265(13),7604-7609. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107213456A (en) * | 2017-05-25 | 2017-09-29 | 苏州华测生物技术有限公司 | The new application of lymphotoxin (LT) derivative |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2006066463A1 (en) | 2006-06-29 |
| CN101084238A (en) | 2007-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5591827A (en) | Interleukin-6 receptor antagonists | |
| AU709889B2 (en) | Ligands for EPH-like receptors | |
| CN1329512C (en) | Modulator of TNF/NGF superfamily receptors and soluble oligomeric TNF/NGF superfamily receptors | |
| EP3139965B1 (en) | Cholix toxin-derived fusion molecules for oral delivery of biologically active cargo | |
| US7629147B2 (en) | PEGylated soluble GP130-dimers useful as a medicament | |
| ZA200208795B (en) | Mammalian cytokine receptor subunit proteins, related reagents and methods. | |
| NZ269871A (en) | Haemopoietic maturation factor and coding sequences | |
| JPH01503354A (en) | Production and use of IL-6 | |
| CN102250918A (en) | Recombinant human interferon-like proteins | |
| US6541619B1 (en) | Fusion protein of hEGF and human angiogenin and process for preparing the same | |
| JP2023040155A (en) | Composition and method for recombinant nerve growth factor | |
| WO2002044197A2 (en) | Cytokine receptor binding peptides | |
| CN101084238B (en) | Receptor selectivity lymphotoxin derivates | |
| WO1997010338A9 (en) | Improved interleukin-6 receptor antagonist | |
| WO1997010338A1 (en) | Improved interleukin-6 receptor antagonist | |
| CN101085813B (en) | Soluble TNF acceptor mutant | |
| CN101890156A (en) | Receptor-selective lymphotoxin (LT) derivative | |
| CN101497886B (en) | Polypeptide of fungal thioredoxin, coding sequence, preparation and use | |
| EP0676413B1 (en) | Interferon-alpha/beta binding protein, its preparation and use | |
| CA2080008C (en) | Water-soluble mutein of fibroblast growth factor (fgf) receptor | |
| CN101928335B (en) | Fungus antitumor polypeptide nucleotide sequence, and preparation method and applications thereof | |
| KR100863060B1 (en) | A recombinant protein with cancer suppression action, its encoding gene and pharmaceutical composition for treating cancers comprising recombinant protein as an active ingredient | |
| CN114380919B (en) | Modified IL-2 molecules and uses thereof | |
| CN101392262B (en) | Polypeptide of fungal ubuquitin-conjugating enzyme, coding sequence thereof and preparation method and application | |
| Siegall et al. | Selective killing of IL6 receptor bearing myeloma cells using recombinant IL6-Pseudomonas toxin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20091120 Address after: Shanghai Zhangjiang hi tech Park Cailun Road No. 308 Applicant after: Shanghai Fudan Zhangjiang biological medicine Limited by Share Ltd Co-applicant after: Taizhou Fudan Zhangjiang Pharmaceutical Co., Ltd. Address before: Shanghai Zhangjiang hi tech Park Cailun Road No. 308 Applicant before: Fudan Zhangjiang Biological Medicine Co., Ltd., Shanghai |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |