CN101084238A

CN101084238A - Receptor selectivity lymphotoxin derivates

Info

Publication number: CN101084238A
Application number: CNA2004800446341A
Authority: CN
Inventors: 刘彦君; 杨彤; 沈毅珺; 吴劲松; 曹峰; 王征; 谭靖伟; 吴芳; 许燕; 王海波
Original assignee: SHANGHAI FUDAN-ZHANGJIANG BIO-PHARMACEUTICAL CO LTD
Current assignee: Shanghai Fudan Zhangjiang biological medicine Limited by Share Ltd; Taizhou Fudan Zhangjiang Pharmaceutical Co Ltd
Priority date: 2004-12-24
Filing date: 2004-12-24
Publication date: 2007-12-05
Anticipated expiration: 2024-12-24
Also published as: WO2006066463A1; CN101084238B

Abstract

This invention discloses some receptor-selective lymphotoxin (LT) mutants and the ratio, the ability of these lymphotoxin mutants combining with the human TNFRI to that with the human TNFRII, is more than 10. The preparation method and the use of the above said LT mutants are also disclosed. In this invention, the LT mutants bind to the TNFRI selectively and that decreases the binding to the TNFRII in a large range, thereby the toxic effect which may be caused by the TNFRII will be reduced.

Description

Receptor selectivity lymphotoxin derivates

Body selective lymphotoxin (LT) derivative

Technical field

The invention belongs to protein engineering and pharmaceutical field, and in particular to a kind of receptor-selective lymphotoxin (LT) derivative and its preparation method and purposes.Background technology

Lymphotoxin a (LT a), also referred to as TNF P, are one of TNF superfamily members, are the important cell factors of a class.Compared with TNF, LT a 26S Proteasome Structure and Function is similar to TNF, and the tumor cell type of the suppression with identical acceptor TNFRI, TNFRI I, L'l'o is slightly less than TNF, and the lethal effect of some tumour cells is also not quite similar.

LT a are produced by active lymphocyte, are 25KD secreting type glycoprotein, and LT precursors contain 205 amino acid residues, wherein 34 amino acid residue encoded signal peptides, ripe LT has 171 amino acid residues（i8kD) (SEQ ID N0 :3), without disulfide bond, the 62nd glycosylation site for N- connections（Glycosylation is non-essential to its cytotoxic activity）, LT a and TNFRI, TNFRI I action site concentrates on the Liang Ge lasso tricks area of tripolymer bottom.LT a homotrimers are acted on TNFRI and TNFRII, so that priming signal conducts.

TNFRI and TNFRII is different from terms of cell distribution, molecular weight, the affinity with reference to aglucon and the biological activity of mediation.TNFRI and T ' FRII are present in except in exo-erythrocytic all types of cells, TNFRI presence is more commonly.TNFRI acceptors are mainly expressed in epithelial cell, and TNFRII acceptors are mainly expressed in bone marrow cell, and most cell all expresses both acceptors, but ratio is different. T!FRI is made up of 455 amino acid, 461 amino acid compositions of TNFRII, is all I type transmembrane glycoproteins, is constituted by signal peptide, extracellular structural area, transmembrane structure area and endochylema structural area.TNFRI cytoplasmic domains 326- 413 is death domain（death domain, DD).TNFRI can trigger natural death of cerebral cells by DD combination TNFR GAP-associated protein GAPs, transfer cell poison signal.The signal that TN'FRII endochylema structural area does not have DD, TNFRII to be transmitted is mainly limited in immune system cell, the immune response height correlation with virus infection.The homology of TNFRI and TN'FRII intracellular part is extremely low, also illustrates that they have different Signal transduction pathways, there is different biological functions.

Two kinds of receptor-mediated TNF bioactivity has very big difference.The TNFa of mouse is similar to the TNFRI of mouse and TNFRII adhesion, but the TMFa of people only combines the TNFRI of mouse, and the TNFRII of mouse is not combined.In lethal experiment, the TNFa of people shows relatively low fatal rate than the TNFa of mouse, and this prompting TNFRII has a great impact to general toxicity.

Research has shown that TNFRII signals have inhibitory action to insulin signal transduction, and inhibitory action of the signal to insulin signal transduction can be alleviated with anti-TNFRII antibody blockings TNFRII signals.

TNFRII signals also play an important role in terms of vasopermeability is adjusted.Anti- TNFRII antibody can suppress the propagation of neuroblastoma cells, while on TNF cell killing vigor without influence.In mouse it was found that, TNFRII participates in the injury of kidney of cis-platinum mediation.

By transforming TNF and acceptor calmodulin binding domain CaM, TNF mutant selective to TNFRI is obtained, so as to be the cell killing activity for keeping it to tumour cell, while toxic side effect caused by alleviating TNFRI I, has obtained good effect.LT is interior with TNF bodies, external antitumor activity is equally matched, and toxicity is smaller, and half-life period is longer, and LT also has obvious chemotherapy sensitizing and Apoptosis in addition.Therefore, the potential applicability in clinical practice of LT treatments tumour may be more preferable than TNF.Lack LTa N-terminal sequence 1-27 lymphotoxin (LT) derivative LT_a28__m, II phase clinical stages are currently in, clear and definite antitumor action is shown.But LT still has certain toxic side effect, therapeutic index is not

- 1-confirm this Height, and it is not high to the killing vigor of some tumour cells, and these all limit application of the lymphotoxin in field of medicaments.Research has shown that LT toxic side effect is related to TNFRII signals, TNFRII signals can activate NFKB, and NFKB is important inflammatory factor, directly cause inflammatory reaction, Multiresistant genes, curative effect of the influence medicine to tumour cell can also be activated simultaneously.TNFRII also can compete part with TNFRI, cause LT insensitive to the tumour cell of TNFRII height expression, it is suppressed that LTa cytotoxic activity.

At present, clinically the tumor cytotoxicity activity of lymphotoxin is maintained, while reducing LT toxic side effect in the urgent need to the lymphotoxin with TNFRI selectivity；So that LT is improved to the tumour cell susceptibility of TNFRII height expression, a greater variety of oncotherapies can be applied to：In LT and chemotherapy drugs in combination treatment, more preferable therapeutic effect, lower toxic side effect are had.

However, there is no the lymphotoxin satisfactorily to TNFRI with high selectivity at present.Therefore, what this area was new in the urgent need to developing has high selectivity and the extremely low lymphotoxin mutant of the selectivity to TNFRII to TNFRI.The content of the invention

There is high selectivity and the extremely low lymphotoxin mutant of the selectivity to TNFRII it is an object of the invention to provide a kind of TNFRI.

In the first aspect of the present invention, there is provided a kind of receptor-selective lymphotoxin (LT) mutant, the mutant in corresponding to lymphotoxin native sequences in 106- 113 lasso structures of 106- 113, the 106th, 107,109,110, Π Κ 112 or】13 amino acids residue at least one amino acid are replaced, and/or insert in 106-113 lasso structures at least one amino acid,

Additional conditions are that 108 Y residues are constant,

And the ratio between the lymphotoxin mutant and people TNFRI binding ability of binding ability and the lymphotoxin mutant and people TNFRII is more than 10.

In another preference, the ratio between the lymphotoxin mutant and TNFRI binding ability and wild type LT and people TNFRI binding ability are more than 0.1.

In another preference, binding ability and wild type LT and people of the lymphotoxin mutant with people TNFRII

The ratio between TNFRII binding ability is less than 0.01.

In another preference, described amino acid substitution is that 106,107,109,110,111,112 or 113 amino acids are replaced by other amino acid.In another preference, 1-3 amino acid is inserted at 106-113（Preferred acidic or basic amino acid）.

In another preference, described mutant has the mutation being selected from the group：

Q107E; Q107D; S106E; S106D: Q107R; Q107N: Q107E/S106E; Q107E/S106D; Q107D/S106E;Or Q107D/S106D.

In another preference, the ratio between the lymphotoxin mutant and people TNFRI binding ability of binding ability and the lymphotoxin mutant and people TNFRII is more than 100, even more preferably greater than 200.

In the second aspect of the present invention, there is provided a kind of pharmaceutical composition, its human lymphotoxin's variant comprising safe and effective amount and pharmaceutically acceptable carrier.

In another preference, described pharmaceutical composition is also containing the chemotherapeutics being selected from the group：CDDP, 5-FU, ADM, VCR or its combination. In the third aspect of the present invention there is provided the purposes of the present inventor's lymphotoxin mutant, the medicine for preparing the following disease for the treatment of：（A) tumour：（B) parasites disease in the body.

It is constant in natural 108 residues of lymphotoxin sequence in the fourth aspect of the present invention there is provided a kind of method for preparing TNFRI receptor-selective human lymphotoxin's mutant, replace at least one amino acid in 106-113；Or in 106- 1-3 amino acid of 113 insertions.

In the fifth aspect of the present invention there is provided a kind of DNA sequence dna of separation, it encodes the lymphotoxin mutant of the present invention.Additionally provide a kind of expression vector containing described DNA sequence dna.Additionally provide the host cell that the expression vector or described-DNA sequences are converted.

In sixth aspect present invention, a kind of method for the lymphotoxin mutant for producing the present invention is additionally provided, the method comprising the steps of：

(a) under conditions suitable for the expression, above-mentioned host cell is cultivated, so as to give expression to described lymphotoxin mutant；

(b) described lymphotoxin mutant is isolated and purified out.

In the seventh aspect of the present invention, there is provided a kind of method for treating tumour or parasites disease in the body, including step：The lymphotoxin mutant of the invention of safe and effective amount is applied to the object for needing to treat.Brief description of the drawings

Fig. 1 shows rhLT mutant LT008 Cytotoxicity in vitro Jurkat (leukaemia）Cell.

Fig. 2 shows rhLT mutant LT008 Cytotoxicity in vitro Lovo (colon cancers）Cell.

Fig. 3 shows the (breast cancer of rhLT mutant LT008 Cytotoxicity in vitro MCF- 7）Cell.

Fig. 4 shows rhLT mutant LT008 Cytotoxicity in vitro A549 (lung cancer）Cell.

Fig. 5 shows rhLT mutant LT008 Cytotoxicity in vitro A375 (melanomas）Cell.

Fig. 6 shows rhLT mutant LT008 Cytotoxicity in vitro Hela (cervical carcinomas）Cell.

Fig. 7 shows rhLT mutant LT008 Cytotoxicity in vitro U937 (histocytic lymphomas）Cell.

Fig. 8 shows rhLT mutant LT008 Cytotoxicity in vitro HL -60 (leukaemia）Cell

Fig. 9 shows sensitization of the rhLT mutant to chemotherapeutics CDDP.

Figure 10 shows sensitization of the rhLT mutant to chemotherapeutics 5- FU.

Figure 11 shows sensitization of the rhLT mutant to chemotherapeutics ADM.

Figure 12 shows sensitization of the rhLT mutant to chemotherapeutics VCR.Embodiment

The present inventor by Molecular Simulation Technique research LT and TNFRI, TNFRII effect.By extensive, in-depth study is found, 113 lasso structures of LT sequences 106- are that LT acts on close but discrepant structural region with its acceptor TNFRI, TNFRII, it is mutated by being introduced in the lasso structure area, the 192-GLY LT with TNFRI selectivity can be obtained, receptor blocking experiment confirms that these 192-GLY LTs and TNFRI binding ability are kept, and the ability for combining TNFRII declines at least 10 times, typically at least 20 times, preferably at least 100, more preferably at least 1000 times, at least more preferably more than 10000 times（Such as 40000 times）.Cytologic experiments confirm that this TNFRI selectivity LT are better than wild type rhLT to kinds of tumor cells killing vigor, the sensitivity of tumor cells of TNFRII height expression are strengthened, additionally it is possible to improve sensitiveness of the tumour cell to chemotherapeutics such as CDDP etc.. As used herein, term " lymphotoxin ", " LT. ", " LTc ", " TNFp " be used interchangeably ' mean lymphotoxin LToc, including from the lymphotoxin of people, mouse, pig, horse or ox.It is preferred that being human lymphotoxin.In addition, lymphotoxin can be LT with Natural wild-type sequence or with mutant nucleotide sequence（For versus wild type sequence）Derivative type or restructuring LT.Natural wild type human lymphotoxin TNFoc amino acid sequence is shown in SEQ ID NO:In 3.

As used herein, human lymphotoxin of the amino acid number of lymphotoxin based on wild type（SEQ ID Ν0·· 3).For example, 106- L 13 lasso structure is exactly lymphotoxin native sequences i.e. SEQ ID NO:The SQYPFHVP of 106-113 in 3, or the amino acid equivalent to native sequences 106-113 region.

As used herein, term " TNFRI selectivity LT " or " 192-GLY LT of the present invention " refer to such 192-GLY LT, its binding ability with TNFRI is kept, and the ability for combining TNFRII declines at least 10 times, typically at least 20 times, preferably at least 100 times, more preferably at least 1000 times, at least more preferably more than 10000 times（Such as 40000 times）.The 192-GLY LT of the present invention may or may not contain the methionine of starting.

As used herein ' Q107E represents 107 Gln-Glu mutation：Q107D represents 107 Gin-Asp;S106E represents 106 Ser-Glu;S106D represents 106 Ser-Asp, and the rest may be inferred.Q107E/ S106E represent 107 Gin-Glu mutation and 106 Ser → Glu, and the rest may be inferred.

Human lymphotoxin's mutant of the present invention includes DNA, RNA or human lymphotoxin's mutant protein of coding human lymphotoxin's mutant.

In a preference, by amino acid substitution, 106-113 regional structures are finely adjusted.For example, replacing original amino acid with acid propylhomoserin glutamic acid or aspartic acid.

In another preference, by the regions of 106- 113, keeping 108 residues constant, 1-3 amino acid is inserted.For example, the amino acid inserted in 106-113 regions in acid or basic amino acid, especially glutamic acid, aspartic acid, arginine, N.

In another preference, chemical modification method can be used, the group with negative electrical charge is introduced in 106-113 regions.The LT mutains of the present invention can be prepared so：The sequence of human lymphotoxin amplifies the coded sequence of human lymphotoxin by PCR methods come synthetic primer according to disclosed in oneself.Can also artificial synthesized people TNFo coded sequence.Furthermore, it is possible to base replacement be carried out to coded sequence, in favor of height expression（For example in order in expression in escherichia coli, native codon can be replaced with the preferred codon of Escherichia coli of coding same amino acid）.Then, with the DNA sequence dna of human lymphotoxin, genetic modification is carried out by the mutant form pointed out in the present invention, the technology for carrying out genetic modification is as known in the art, see, for example, " Mutagenesis:A Practical Approach ", M. J. McPherson, Ed., (IRL Press, Oxford, UK. (1991), wherein for example including direct mutagenesis, cassette mutagenesis and polymerase chain reaction (PCR) mutagenesis.

After the DNA sequence dna of the coding new mutation albumen of the present invention after obtaining rite-directed mutagenesis, suitable expression vector is connected into, then be transferred to suitable host cell.Finally, the host cell after culture conversion, the new mutain of the present invention is obtained by isolating and purifying.

In the present invention, it can select oneself various carriers for knowing of this area such as commercially available carrier.Such as, from commercially available carrier, the nucleotide sequence for encoding new mutation albumen of the present invention is then operably coupled to expression regulation sequence, protein expression vector can be formed. As used herein, the activity of same linear DNA molecule other parts can be influenceed by " being operably coupled to " refer to some parts of such a situation, i.e. linear DNA molecule.If for example, signal peptide DNA is as precursor expression and participates in the secretion of polypeptide, then signal peptide（Secrete targeting sequencing）DNA is exactly to be operably coupled to polypeptid DNA;If the transcription of promoter control sequence, then it is to be operably coupled to coded sequence：If ribosome bind site is placed in the position that can translate it, then it is to be operably coupled to coded sequence.Typically, " it is operably coupled to " mean adjoining, and then means adjacent in reading frame for secretion targeting sequencing.

In the present invention, term " host cell " includes prokaryotic and eukaryotic.The example of conventional prokaryotic host cell includes Escherichia coli, hay bacillus etc..Conventional eukaryotic host cell includes yeast cells, insect cell and mammalian cell.It is preferred that the host cell is prokaryotic, more preferably it is Escherichia coli.

In an example of the present invention, the method for preparing 192-GLY LT of the present invention comprises the following steps：

I modify LT coded sequence, make it in the case where keeping natural 108 residues of lymphotoxin sequence constant, with least one amino acid in other amino acid substitution 106-113；Or insert 1-3 amino acid at 106-113（Such as acid or basic amino acid, preferably glutamic acid, aspartic acid, arginine or N）；

The lymph toxin gene of above-mentioned transformation is cloned into expression plasmid by i i.；

I i i. convert host cell with the expression plasmid of above-mentioned carrying lymph toxin gene,

The host cell that i v. cultures are converted：

V. host cell and nutrient solution are collected, lymphotoxin mutant is isolated and purified.

The 192-GLY LT of the present invention is applied to treatment tumour and parasites disease in the body.Representational tumour includes（But it is not limited to）：Leukaemia, histocytic lymphoma, stomach cancer, breast cancer, lung cancer, colon cancer, cervical carcinoma, melanoma, carcinoma of urinary bladder.Representational parasites disease in the body includes（But it is not limited to）：Tokoplasmosis.

The lymphotoxin mutant of the present invention can be used alone, and can be also used in combination with the other drugs such as chemotherapeutics, to increase sensitiveness of the tumour cell to chemotherapeutics.

Present invention also offers pharmaceutical composition, it includes the LT mutains of the one or more present invention of effective dose, and at least one pharmaceutically acceptable carrier, diluent or excipient.When preparing these compositions, generally active component is mixed with excipient, or uses figuration dilution agent, or Bao Ke with capsule or the carrier of sachet presence.When excipient plays diluent, it can be the medium of solid, semisolid or fluent material as excipient, carrier or active component.Therefore, composition can be tablet, pill, pulvis, solution, syrup, sterilizing injecting solution etc..The example of suitable excipient includes：Lactose, glucose, sucrose, sorbierite, mannitol, starch, microcrystalline cellulose, polyvinyl pyrrole protective embankment ketone, cellulose, water, etc..Preparation may also include：Wetting agent, emulsifying agent, preservative（Such as methyl hydroxybenzoate and propyl ester）, sweetener etc..

In another preference, extra chemotherapeutics, such as CDDP, 5- FU, ADM, VCR or its combination are also contained in pharmaceutical composition of the invention.

Composition can be made into unit or polynary formulation.Each formulation includes the active material that scheduled volume is calculated to produce desired response to treatment, and suitable pharmacy excipient.

The 192-GLY LT and the administering mode of pharmaceutical composition of the present invention is not particularly limited, and such as muscle, vein or can be subcutaneously injected by oral, part, parenterai administration, or the mode such as suction spraying is administered.It is preferable that intravenous injection administration.

When the 192-GLY LT in the present invention is oral in the form of tablets or capsules, dosage is for 60-70 kilograms of average weight Adult and g in the range of about lug to lOOOug, or with injection mode parenterai administration, dosage is about lug to 500ug, can once a day or divide be administered several times.The dosage unit of pharmaceutical composition generally includes the active component that scope is lug-500ug, typically lug, 5ug, 10ug, 25ug, 50ug, 100ug, 200ug, 300ug, 400ug, 500ug.

The quantity and dosage regimen of therapeutic activity composition used during with the present composition specific illness for the treatment of, depending on many factors, including body weight, age, sex, inevitable medical symptom, disease weight, method of administration and frequency.This can be determined by medical worker.With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.The experimental method of unreceipted actual conditions in the following example, generally according to normal condition, such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) described in condition, or according to the condition proposed by manufacturer.

Universal method：

(a) evaluation of mutant

1, enzyme linked immunosorbent assay (ELISA)s

TNFRI -. Fc/TNFRII :Fc is coated on ELISA Plate, by 192-GLY LT to be measured be diluted to same concentrations loading it is in combination after, plus rabbit-anti LT enzyme-linked antibody, develop the color reading.

Compare calculating, be compared with wild type LT, seek percentage, thus it is speculated that the binding ability change of 192-GLY LT and acceptor, preliminary screening and TNFRI:The strong mutant of Fc adhesions is further evaluated.

2. the determination of cytotoxic activity of rhLT mutant in vitro to L929 cell lines

L929 cells are compareed as target cell, wild type LT, determine the Cytotoxicity in vitro activity of tumor cells of rhLT mutant.Per unit vigor refers to the consumption that lymphotoxin adjusts lymphotoxin or lymphotoxin mutant when dying induction of 50% inoculating cell.

3. receptor binding capacity is determined

L929 cells add lymphotoxin or lymphotoxin (LT) derivative are killed, respectively with the lethal effect in TNFRI and TNFRII with lymphotoxin, with TI ' FRI as target cell:Fc blocks lymphotoxin mutant to be measured to the IC50 of L929 cell killings with blocking wild type lymphotoxin to be defined as LT and TNFRI receptor binding capacities to the ratio between IC50 of L929 cell killings；With TNFRI I:Fc blocks lymphotoxin mutant to be measured to the IC50 of L929 cell killings with blocking wild type lymphotoxin to be defined as LT and TNFRI I receptor binding capacities to the ratio between IC50 of L929 cell killings.

(b) anti-tumor activity of lymphotoxin mutant

Killing activity of the various lymphotoxin mutant to tumour cell is detected in vitro, and used tumor cell line includes：Jurkat (leukaemia）, U937 (histocytic lymphomas）, (the stomach cancers of MKN- 45/MGC- 863）, (the breast cancer of MCF- 7）, A549 (lung cancer）, A375 (melanomas）, T-24 (carcinomas of urinary bladder）Cell etc..Wild type LT, LT of embodiment 1₂₄.₁₇ LT₂₈__mPreparation

Expression vector establishment：

According to people LT sequences in GENBANK（), BAA00064 commission Shanghai Sheng Gong biotechnologys service company difference full genome composite coding LT maturation proteins the 1st to 171, the 24th to 171, wild type LT, LT of the 28th to 171₂,_-17 LT₂₈__mAmino acid sequence, and it is cloned in pET32a (+) carrier（Purchased from Novagen) Λ Ι On Η η Λ II sites, recombinant expression plasmid LT/pET32a (+), LT are obtained_¾.,₇₁/pET32a (+)、 LT₂₈ - l_7l/pET32a(+)。

Expression in Escherichia coli-recombinant expression plasmid LT/pET32a (+), LT_24-171/pET32a (+)、 LT_28-17l/ pET32a (+) converts e. coli bl21 (DE3), conversion fluid coating LB (μ of lOOng/ containing ampicillin Ι) flat board respectively.From picking monoclonal is inoculated in ImLLB culture mediums on conversion flat board, after 37'C, 250rpm culture 3h, IPTG to the 5m of final concentration 0 is added, continues to cultivate 3h.Take the bacterium solution after lOOul expression that bacterial sediment is collected by centrifugation, add 50ul SDS sample preparation liquid, electrophoresis detection is carried out in 12.5% PAGE glue.

" protein purification-take LT/pET32a (+)/BL21 (DE3), LT respectively₂₄.₁₇₁/pET32a (+) /BL21 (DE3) 、 LT_28-/ pET32a (+)/BL21 is (in DE3 ＞ recombination engineerings 1ml inoculation lOOOmlLB (μ of lOOng/ containing ampicillin 1) culture mediums, 37 °C, 250rpm culture 5h after, IPTG to the 5mM of final concentration 0 is added, continues to cultivate 4h.Ultrasonication after weight in wet base is washed for 5g bacterial sediment with PBS is collected, inclusion body is collected by centrifugation.With the solubilized inclusion body of urea, with Tris buffer solution renaturation.Purified in succession with Q- Sepharose FF ion-exchange chromatographies, Phenyl-Sepharose FF hydrophobic chromatographies and CM- Sepharose FF ion-exchange chromatographies.Eluent is diluted to protein concentration for lmg/ml

Wild type LT, LT is obtained respectively₂.,._17r LT_{2 m}Albumen 1.0,3.5,4.2 milligrams.The mutant rhLT008 of embodiment 2 preparation

RhLT008 is mutated the structure of body expression vector：

(1) PCR expands mutant gene：

With LT₂.,_₁₇₁/ pET32a (+) plasmid is template, is expanded using LT-P32U and Q107E- R as pair of primers, LT008- AB fragments is obtained, while with LT- P32D and Q】07E- F-expanded to primer, obtain LT008-CD fragments.It is template to take again after LT008-AB and LT008-CD mixing, is expanded using LT- P32U and LT-P32D as pair of primers, obtains the LT008 fragments being mutated containing Q107E.

LT-P32U-. 5*ACACATATGATG CAC TCT ACC CTG AAA CCG 3,（SEQ ID NO :4)

LT-P32D: 5'TGCAAGCTTCTA CAG AGC GAA GGC TCC AAA 3'(SEQ ID NO: 5)

Q107E-F: 5'CTCTTCTCCTCCGAATACCCCTTC 3'(SEQ ID NO :6)

Q107E-R: 5 ' GAAGGGGTATTCGGAGGAG AAGAG 3'(SEQ ID NO: 7)

PCR primer is connected with pMD- 18T carriers after purification, converts escherichia coli DH5a, extracts 008/pMD-18T plasmids, forward and reverse carry out sequencing.

(2) prokaryotic expression carrier of rhLT mutant is built：

On the correct clone of sequencing, its plasmid restriction enzyme and the double enzymic digestions of ffindUl, subclone to the same loci of pET32a (+) expression vector, LT008/pET32a (+) recombinant expression plasmid is obtained.

Expression of the rhLT mutant in Escherichia coli：

Recombinant expression plasmid LT008/_PET3a (+) conversion e. coli bl21 (DE3), conversion fluid coating LB (μ of lOOng/ containing ampicillin 1) flat board.From picking monoclonal is inoculated in ImLLB culture mediums on conversion flat board, after 37'C, 250rpm culture 3h, IPTG to the ImM of final concentration 0. is added, continues to cultivate 3h.The bacterium solution centrifugation after lOOul expression is taken to receive Collect bacterial sediment, add 50u l SDS sample preparation liquid, electrophoresis detection is carried out in 12. 5 % PAGE glue.

LT008 is purified by the same method of embodiment 1,3. 6 milligrams of L.T008 albumen is obtained.The LT006 of embodiment 3 preparation

With LT^_{I 71}/ pET32a (+) plasmid is template, expanded using LT-P32U and S 106E- Q107E-R as pair of primers, LT006- AB fragments are obtained, while with LT- P32D and S106E- Q107E-F-expanded to primer, acquisition LT006- CD fragments.It is template to take again after LT006- AB and LT006- CD mixing, is expanded using LT- P32U and LT- P32D as pair of primers, obtains the LT006 fragments of the mutation of Q107E containing S106E- of total length.

PC primer sequences are：

S 106E-Q107E-F: 5 ' CTCTTCTCCGAAGAATACCCCTTC 3 ' (SEQ ID NO : 8)

S106E-Q107E-R: 5' GAAGGGGTATTCTTCGGAGAAGAG 3' (SEQ ID NO : 9)

By the same method of embodiment 2 clone, expression, purifying LT006,3. 1 milligrams of LT006 albumen is obtained.The LT009 of embodiment 4 preparation

With LT₂.,__m/ pET32a (+) plasmid is template, is expanded using LT- P32U and Q107D- R as pair of primers, acquisition LT009-AB fragments, while with LT- P32D and Q107D- F-expanded to primer, acquisition LT009-CD fragments.It is template to take again after LT009-AB and LT009-CD mixing, is expanded using LT-P32U and LT-P32D as pair of primers, obtains the LT009 fragments being mutated containing Q107D of total length.

PCR primer sequence is-Q107D-F.- 5'CTCTTCTCCTCCGACTACCCCTTC 3'(SEQ ID NO: 10)

Q107D-R : 5' CAAGGGGTAGTCGGAGGAGAAGAG 3' (SEQ ID NO : 1 1 )

By the same method of embodiment 2 clone, expression, purifying LT009,4. 2 milligrams of LT009 albumen is obtained.The mutant rhLT057 of embodiment 5 preparation

With LT₂₈__m/ pET32a (+) plasmid is template, with LT₂₈- P32U and Q107E- R is that pair of primers is expanded, and obtains LT057-AB fragments, while being expanded with LT-P32D and Q107E- F pair of primers, obtains LT057-CD fragments.It is template to take again after LT057-AB and LT057-CD mixing, with LT₂₈- P32U and LT-P32D is that pair of primers is expanded, and obtains the LT057 fragments being mutated containing Q107E.

LT₂₈-P32U : 5'ACACATATG AAA CCG GCT GCT CAC 3' (SEQ ID NO : 12)

LT-P32D: 5'TGCAAGCTTCTA CAG AGC GAA GGC TCC AAA 3' (SEQ ID NO : 5)

Q107E-F: 5'CTCTTCTCCTCCGAATACCCCTTC 3' (SEQ ID NO : 6)

Q 107E-R : 5 'GAAGGGGTATTCGGAGGAGAAGAG 3' (SEQ ID NO : 7)

By the same method of embodiment 2 clone, expression, purifying LT057,3. 1 milligrams of LT057 albumen is obtained.The LT090 of embodiment 6 preparation

With LT^₁₇₁/ pET32a (+) plasmid is template, is expanded using LT- P32U and Q107R- R as pair of primers, acquisition LT090-AB fragments, while with LT- P32D and Q107R- F-expanded to primer, acquisition LT090-CD fragments.It is template to take again after LT090-AB and LT090-CD mixing, using LT-P32U and LT-P32D as pair of primers Expanded, obtain the LT090 fragments being mutated containing Q107R of total length.

PCR primer sequence is：

Q107R-F: 5' CTCTTCTCCTCCCGTTACCCCTTC 3' (SEQ ID NO: 13)

Q107R-R-. 5, GAAGGGGTAACGGGAGGAGAAGAG 3'(SEQ ID NO: 14)

By the same method of embodiment 2 clone, expression, purifying LT090,3.3 milligrams of 1^090 albumen is obtained.The LT092 of embodiment 7 preparation

With LT₂₄_/pET32a (+) plasmid is template, is expanded using LT-P32U and Q107N- R as pair of primers, acquisition LT092- AB fragments, while with-P32D and Q107N- F-expanded to primer, acquisition LT092-CD fragments.It is template to take again after LT092-AB and LT092- CD mixing, is expanded using LT- P32U and LT- P32D as pair of primers, obtains the LT092 fragments being mutated containing Q107N of total length.

PCR primer sequence for-

Q107N-F:5, CTCTTCTCCTCCAACTACCCCTTC 3'(SEQ ID NO: 15)

Q107 -R: 5' GAAGGGGTAGTTGGAGGAGAAGAG 3' (SEQ ID NO: 16)

By the same method of embodiment 2 clone, expression, purifying LT092,4.5 milligrams of LTO92 albumen is obtained.The enzyme linked immunosorbent assay (ELISA) acceptor bonding state of embodiment 8.：

TNFRI: Fc/TNFRII:Fc is coated on ELISA Plate, by LT mutant to be measured be diluted to same concentrations loading it is in combination after, plus rabbit-anti LT enzyme-linked antibody, develop the color reading.

Compare calculating, be compared with wild type LT, seek percentage, thus it is speculated that the binding ability of LT and acceptor

Table 1:With the binding ability evaluation of acceptor

As a result show, compared with LT, LT006, LT008, LT009 and acceptor TNFRI adhesion are kept substantially, and are greatly reduced with TNFRII adhesion.The determination of cytotoxic activity of the rhLT mutant of embodiment 9. in vitro to L929 cell lines

To further determining cytotoxic activity to mutant LT006,008,009 in the present embodiment.

L929 cells 1.5x10 " cells/wells are inoculated with 96 orifice plates, 37'C, 5% C0₂24h is cultivated, cell survival is detected with crystal violet staining assay after the sample and actinomycin D (lmg/L) of the different dilution factors of lOOul, continuation culture 24h are added per hole.Detection sample is respectively LT international standard substances, the first generation LT stostes of N ends 27 amino acid of missing (LT^_!71), N-terminal lack 23 amino acid LT (LT_21-m;^fl 192-GLY LTs LT006, LT008, LT009.One unit refer to induction 50% detection natural death of cerebral cells required for LT amount.

RhLT mutant the results are shown in Table 2 to the determination of cytotoxic activity of L929 cell lines in vitro:

The active neutralisations of the TNFRI of embodiment 10. and TNFRII detect the bind receptor ability of 192-GLY LT：

(1) cell kind plate：Take the logarithm the L929 cells 1.5X10 in growth period⁵In/ml, 96 well culture plates of inoculation, per hole Ι Ο Ο υ Ι, 24h is cultivated.

(2) sample dilutes：Plate next day is planted, 192-GLY LT and LT standard items are made into 2 times of dilution TNFRI of lng/ml, 13 dilution factors are diluted from 250ng/ml.192-GLY LT and LT standard items are made into 4 times of dilution TNFRI I of I ng/ml, 13 dilution factors of dilution are played per hole ng/ml containing 1 actinomycin D 1000 from 500,000 ng/ml.Continue to cultivate 24h.

(3) sample readout：96 orifice plates are taken out, nutrient solution is discarded and pats dry as far as possible, colorimetric at cell survival, ELIASA 570nm is detected with crystal violet staining assay.

(4) interpretation of result：Automatically analyzed using the quadruplex parameters of PraphPad Prism4.0 data processing softwares：The logarithm value of LT standard concentrations is X-axis, and 0D490 values are Y-axis, and software will provide the medium effective concentration of sample and standard items（), IC50 and " S " shape curve is drawn.To block lymphotoxin mutant to be measured to the IC50 of L929 cell killings with blocking wild type lymphotoxin to define LT receptor binding capacity to the ratio between IC50 of L929 cell killings.

It the results are shown in Table 3.

Each mutant combination TNFRI, TNFRII of the LT of table 3 ability

TNFRI, which is neutralized, to be combined in TNFRI TNFRII and LT combination TNFRII samples decline multiple

The IC50 abilities of LT IC50 abilities

LT1-171 20.14ng/ml 1 12.2 lng/ml 1 -

LT28-171 15.64ng/ml 1.29 10.15ng/ml 1.20 0.83

LT24-171 18.38ng/ml 1.10 12.57ng/ml 0.97 1.03

LT006 9.02ng/ml 2.23 2.86X 10⁵ng/ml 4.27X10 2.34Χ 10⁴

LT008 8.1 lng/ml 2.48 2.91X10⁵ng/ral 3.43X10"⁵ 2.38Χ 10⁴

LT009 10.86ng/ml 1.86 4.98X 10³ng/ml 2.45X10— ³ 4.08 X 10²

LT057 14.2 lng/ml 1.42 >5 10⁵ng/ml <2· 44X10 〉4.10X10⁴

LT090 28.46ng/ml 0.71 3.12X10 ng/ml 3.91X10'³ 2.56X10²

LT092 22.88ng/ml 0.88 1.80X10'ng/nil 6.78X10"' 1.47X10³ The neutralization of table 3 shows LT006, LT008. LT009 and TNFRI adhesion slightly above LT test result indicates that LT006, LT008, LT009, LT057, LT090, LT092 are combined is kept with TNFRI binding ability;And more than 200-40000 times is reduced with TNFRII binding ability, it is provided with the high selectivity to TNFRI acceptors.The external tumor suppression spectrum of the rhLT mutant of embodiment 11.：

RhLT mutant LT008 Cytotoxicity in vitro Jurkat (leukaemia）, U937 (histocytic lymphomas）, GC-863 (the stomach cancers of MKN- 45/）, MCF-7 (breast cancer）, A549 (lung cancer）, A375 (melanomas）, T -24 (carcinoma of urinary bladder) cell ability be better than LT.

(l) rhLT mutant LT008 Cytotoxicity in vitro Jurkat (leukaemia）Cell

Jurkat cell is with l.OxlO⁴Cells/well is inoculated with 96 orifice plates, 37 °C, 5% C0₂24h is cultivated, cell survival is detected with MTS decoration methods after the sample of the different dilution factors of lOOul, the final concentration of 25ng/nil of actinomycin D, continuation culture 48h are added per hole.The sample of detection is respectively LT, rhLT mutant LT008.

As a result as shown in figure 1, LT EC50=8.38ong/ral, LT008 EC50=1.390ng/ml.

(2) rhLT mutant LT008 Cytotoxicity in vitro Lovo (colon cancers）Cell

Lovo cells are with 2. Ο χ Ι Ο⁴Cells/well is inoculated with 96 orifice plates, 37,5%C0₂4h is cultivated, the sample of the different dilution factors of lOOul, actinomycin D final concentration of 2000 are added per hole_nG/ml, continues to cultivate after 24h with crystal violet staining assay detection cell survival.The sample of detection is respectively LT, 192-GLY LT LT008.

As a result as shown in Fig. 2 LT EC50=5.171ng/ml;LT008 EC50=L 845ng/ml.

(3) rhLT mutant LT008 Cytotoxicity in vitro MCF-7 (breast cancer）Cell

The cells of MCF- 7 are with Ι Ο χ Ι Ο⁴Cells/well is inoculated with 96 orifice plates, 37 " C, 5%C0₂24h is cultivated, the sample of the different dilution factors of lOOul, the final concentration of 20n of actinomycin D are added per hole_g/ ml, continues to cultivate after 48h with MTS decoration methods detection cell survival.The sample of detection is respectively LT, 192-GLY LT LT008.

As a result as shown in figure 3, LT EC50=1.773ng/ml_;LT008 EC50=0.889ng/ml

(4) rhLT mutant LT008 Cytotoxicity in vitro A549 (lung cancer）Cell

A549 cells with】.0χ10⁴Cells/well is inoculated with 96 orifice plates, 37 °C, 5%C0₂24h is cultivated, cell survival is detected with MTS decoration methods after the sample of the different dilution factors of lOOul, the final concentration of 20ng/ml of actinomycin D, continuation culture 48h are added per hole.The sample of detection is respectively LT, 192-GLY LT LT008.

As a result as shown in figure 4, LT EC50=6. OlOng/ml;LT008 EC50=3.886ng/m

(5) rhLT mutant LT008 Cytotoxicity in vitro A375 (melanomas）Cell

A375 cells are with l.OxlO⁴Cells/well is inoculated with 96 orifice plates, 37'C, 5%C0₂24h is cultivated, cell survival is detected with MTS decoration methods after the sample of the different dilution factors of lOOul, the final concentration of lOng/ml of actinomycin D, continuation culture 48h are added per hole.The sample of detection is respectively LT, 192-GLY LT LT008. '

Described in result figure 5, LT EC50=2.128ng/ml_;LT008 EC50=0.621ng/ml.

(6) rhLT mutant LT008 Cytotoxicity in vitro He (cervical carcinomas）Cell

HeLa cells are with 2.0 χ 10⁴Cells/well be inoculated with 96 orifice plates, 3 C, 5% (：0₂Culture 411, cell survival is detected after the sample of the different dilution factors of lOOul, the final concentration of 2000ng/nil of actinomycin D, continuation culture 24h are added per hole with crystal violet staining assay.The sample of detection is respectively LT, 192-GLY LT LT008. Described in result figure 6, LT EC50=3.024ng/ml_;LT008 EC50=0.945ngM.

(7) r h 192-GLY LTs LT008 Cytotoxicity in vitro U937 (histocytic lymphomas）Cell

U937 cells are inoculated with 96 orifice plates, 37 °C, 5%C0 with 2.5x10 " cells/wells₂24h is cultivated, cell survival is detected with MTS decoration methods after the sample of the different dilution factors of lOOul, the final concentration of 20ng/ml of actinomycin D, continuation culture 48h are added per hole.The sample of detection is respectively LT, 192-GLY LT LT008.

As a result as shown in fig. 7, LT EC50=2.174ng/ml;LT008 EC50=0.562ng/mlo

(8) (leukaemia ＞ cell-HL-60 cells are with Ι Ο χ Ι Ο by rhLT mutant LT008 Cytotoxicity in vitro HL- 60⁵Cells/well is inoculated with 96 orifice plates, 37 °C, 5%C0₂4h is cultivated, cell survival is detected with MTS decoration methods after the sample of the different dilution factors of lOOul, the final concentration of 300ng/ml of actinomycin D, continuation culture 24h are added per hole.The sample of detection is respectively LT, rhLT mutant LT008.

As a result as shown in figure 8, LT EC50- 2.263ng/ml;Sensitization of the LT008 rhLT mutant of EC50=1.034ng/mlo embodiments 12. to chemotherapeutics

(DrhLT mutant LT008 increases K562 (the former leukaemia of chronic marrow）, U937 (histocytic lymphomas）, A549 (lung cancer）, MCF-7 (breast cancer）, (the oophoromas of SW- 626）Cell is to alkylating agents chemotherapy medicine CDDP (cis-platinums）With CTX (endoxan）Sensitiveness.

The cell of K562, U937, A549 MCF-7 and SW- 626 is with 1. OxlO⁴Cells/well is inoculated with 96 orifice plates, 37 °C, 5% CO cultures 24h.Dosing regimen is：（A) single plus 0. lng/ml LT, 192-GLY LT LT008;

(b) single plus various concentrations CDDP and CTX;(c) 0. lng/ml LT, 192-GLY LT LT008 combine dosing simultaneously with various concentrations CDDP and CTX respectively；With（D) blank control valency group adds equivalent nutrient solution.

Continue to cultivate after 48h with MTS decoration methods detection cell survival.According to concentration-response curve, the half-inhibition concentration IC50 for adding or being not added with LT, TNF and LT008 chemotherapeutics is obtained, and obtain enhanced sensitivity multiple（T)=IC50 (alone chemotherapeutics）/ IC50 (LT, TNF and LT008 are combined chemotherapeutics)

As a result as shown in figure 9, IC50=7.96mg/ml of CDDP groups;IC50=0.89mg/ml of LT+CDDP groups, T=8.94；IC50=0.12mg/m of LT008+CDDP groups, T=66.33.

(2) rhLT mutant LT008 increases SW480 (colorectal cancers）, MKN-45/ GC-863 (stomach cancers）Cell is to antimetabolic based chemotherapy medicine 5-FU (5 FU 5 fluorouracils）With MTX (amethopterins）Sensitiveness.

SW480 and MKN 5/MGC-863 cells are with Ι Ο χ Ι Ο⁴Cells/well is inoculated with 96 orifice plates, 37 °C, 5% C0₂Culture 2.Dosing regimen is（A) single plus various concentrations LT, 192-GLY LT LT008;(b) single plus various concentrations 5-FU and MTX;(c) various concentrations LT, 192-GLY LT LT008 combine dosing (d) blank control valency group simultaneously with various concentrations 5-FU and MTX and add equivalent nutrient solution respectively.Continue to cultivate after 48h with MTS decoration methods detection cell survival.

As a result as shown in Figure 10, IC50=40rag/ml of 5-FU groups_;IC50=21.5mg/ml of LT+5-FU groups ,=1.86_:IC50=2.3mg/m of LT008+5- FU groups, T=17.39₀

(3) rhLT mutant LT008 increases Jurkat (leukaemia）, (the promyelocytic leukemias of HL- 60）Cells with Antibiotics based chemotherapy medicine ADM (adriamycins）Sensitiveness.

Jurkat, HL -60 cell are with 1. OxlO⁴Cells/well is inoculated with 96 holes and pulled, 37 °C, 5%C0₂Cultivate 24h.Plus Prescription case is：（A) single plus various concentrations LT, 192-GLY LT LT008;(b) single plus various concentrations ADM;(c) various concentrations LT, 192-GLY LT LT008 combine dosing simultaneously with various concentrations ADM. respectively；（D) blank control valency group adds equivalent nutrient solution.Continue to cultivate after 48h with MTS decoration methods detection cell survival.

As a result as shown in Fig. 11, the 07mg/ml of the IC50 of ADM groups=1.;The IC50 of LT+ ADM groups=0. 98mg/ml, T- l 09；IC50 0. 450. 013mg/ml, T of LT008+ ADM groups=2. 38.

(4 ＞ rhLT mutant LT008 increase A375 (melanomas）, HeLa (cervical carcinomas）, T-24 (carcinomas of urinary bladder）Cell is to plant chemotherapeutics VCR (vincristine）Sensitiveness. ·

A375, HeLa, T-24 cell are inoculated with 96 orifice plates, 37 °C, 5% C0 with 1. cells/wells₂Cultivate 24h.Dosing regimen is：（A) single plus various concentrations LT, 192-GLY LT LT008;(b) single plus various concentrations VCR;(c) various concentrations LT, 192-GLY LT LT008 combine dosing simultaneously with various concentrations VCR respectively：（D) blank control valency group adds equivalent nutrient solution.Continue to cultivate after 48h with MTS decoration methods detection cell survival.

As a result as shown in figure 12, the IC50 of VCR groups: 0. 437mg/ml ;The Hlmg/ml of the IC50 of LT+ VCR groups=0., T=3. 10；The 073mg/m of the IC50 of LT008+ VCR groups=0., T=5. 99.

The above results show that rhLT mutant LT008 can dramatically increase sensitiveness of the tumour cell to chemotherapeutics.Discuss

LT108Y is the important function residue of LT and acceptor.The 108Y residues are highly conserved, and any single-point in the site studies carefully that change can all produce LT and TN'FR adhesion drastically declines, and receptor binding capacity declines more than 100 times.The present inventor has carried out substantial amounts of mutation research to the lasso structure where LT108Y, the lasso structure for confirming the formation of LT106-1 13 is LT and TNFRI and TNFRI I effect is close and discrepant position, mutation in this region is likely to result in generation great changes of the LT to TNFRI and TNFRI I affinity, it is the preferable survey region for obtaining receptor-selective mutant, the amino acid of particularly LT107 influences huge to the adhesion of LT and two acceptors.The TNFRI of height selectivity is just shown when LT107 residue Q-spoilings are E, D, N', R, in acceptor this point is demonstrated with experiment, LT and TNFRI I adhesion declines 40000 times of 200-, and is held essentially constant with TNFRI binding ability；Illustrate that the amino acid nature in this region is critically important, LTS106M mutant and TNFRI adhesion have declined, and kept with TNFRI I adhesion, the mutation of LT109 positions 1 10 also produces Different Effects to the combination of LT and two acceptor, and it is the important research region for obtaining receptor-selective LT to also demonstrate this region.By the transformation to this region, it can be designed that and two discrepant 192-GLY LTs of acceptor binding force.

Compared with natural rhLT, rhLT of the invention has the selective binding to TNFRI, and 200- is may be up to more than 40000 times with the reduction of TNFRII binding abilities.TNFRI selectivity LT reduces the possible caused toxic side effects of TNFRI I, with lower systemic toxicity；Avoid TNFRI I and neutralizations of the TNFRI to LT Competition and sTNFRI I to LT, so as to which the sensitiveness of the tumour cell to TNFRI I height expression is improved, tumor suppression pedigree is wider, research shows that the LT of TNFRI selectivity strengthens the lethal effect of kinds of tumor cells, and with chemotherapeutics combination therapeutic effect more preferably.

All documents referred in the present invention are all incorporated as reference in this application, are individually recited just as each document as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can make various changes or modifications to the present invention, and these equivalent form of values equally fall within the application appended claims limited range.

Claims

Claim

1. a kind of receptor-selective lymphotoxin (LT) mutant, it is characterized in that, the mutant is in corresponding to lymphotoxin native sequences in the lasso structures of 106- 113 of 106-113,106th, 107,109,110,111,112 or 113 amino acids residue at least one amino acid are replaced, and/or at least one amino acid is inserted in 106-113 lasso structures

Additional conditions are that 108 Y residues are constant；

And the ratio between the lymphotoxin mutant and people TNFRI binding ability of binding ability and the lymphotoxin mutant and people TNFRII is more than 10.

2. lymphotoxin mutant as claimed in claim 1, it is characterised in that

The ratio between the lymphotoxin mutant and TNFRI binding ability and wild type LT and people TNFRI binding ability are more than 0. 1;

The ratio between the lymphotoxin mutant and people TNFRII binding ability of binding ability and wild type LT and people TNFRII is less than 0. 01.

3. lymphotoxin mutant as claimed in claim 2, it is characterised in that described amino acid substitution is that 106,107,109,110,111,112 or 113 amino acids are replaced by other amino acid；Or insert 1-3 amino acid at 106-113.

4. lymphotoxin mutant as claimed in claim 3, it is characterised in that described mutant has the mutation being selected from the group：

Q107E; Q107D; S106E; S106D; Q107R; Q107N; Q107E/S 106E; Q107E/S 106D;

Q107D/S 106E;Or Q107D/S106D.

5. lymphotoxin mutant as claimed in claim 1, it is characterised in that the ratio between the lymphotoxin mutant and people TNFRI binding ability of binding ability and the lymphotoxin mutant and people TNFRII is more than 100.

6. a kind of pharmaceutical composition, it is characterised in that its human lymphotoxin's mutant comprising safe and effective amount and pharmaceutically acceptable carrier.

7. pharmaceutical composition as claimed in claim 6, it is characterised in that it is also containing the chemotherapeutics being selected from the group：CDDP, 5_FU, ADM, VCR or its combination.

8. the purposes of human lymphotoxin's mutant as claimed in claim 1, it is characterised in that the medicine for preparing the following disease for the treatment of：（A) tumour；（B) parasites disease in the body.

9. a kind of method for preparing TNFRI receptor-selective human lymphotoxin's mutant, it is characterised in that constant in natural 108 residues of lymphotoxin sequence, replaces at least one amino acid in 106- 113；Or insert 1-3 amino acid at 106-113.

10. a kind of DNA sequence dna of separation, it is characterised in that it encodes the lymphotoxin mutant described in claim 1.