CN101082623B - Preparation of detecting reagent of helicobacter pylori high virulence - Google Patents
Preparation of detecting reagent of helicobacter pylori high virulence Download PDFInfo
- Publication number
- CN101082623B CN101082623B CN 200710009200 CN200710009200A CN101082623B CN 101082623 B CN101082623 B CN 101082623B CN 200710009200 CN200710009200 CN 200710009200 CN 200710009200 A CN200710009200 A CN 200710009200A CN 101082623 B CN101082623 B CN 101082623B
- Authority
- CN
- China
- Prior art keywords
- oipa
- gene
- antibody
- oipa6
- serum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a preparing method of detecting agent of pylorus bacillus high-toxicity strain in the clinical diagnosis of human disease, which comprises the following parts: purifying the expressed product through molecular biological method and clone expression of gene; obtaining the recombinant OipA antigen; utilizing the antigen to test the corresponding antibody in the clinical serum sample; separating to culture Hp of biopsy specimen of stomach; augumenting the oipA signal area gene to test the sequence for Hp strain; comparing the antibody and the gene detecting result; estimating the sensitivity and specificity of serum antibody through recombinant antigen; obtaining oipA6-pET-42a as recon of pylorus bacillus oipA toxicity gene segment oipA6; transmitting the recon to theBL-21 cell; obtaining the high-effective expressive OipA6 fusing protein with molecular weight at 42KD; possessing good antigen property; detecting the sensitivity and specificity of the serum OipA antibody at 95.16% and 95.83% separately.
Description
Technical field
The present invention relates to the reagent of human diseases clinical diagnosis, specifically a kind of preparation of detecting reagent of helicobacter pylori high virulence.
Background technology
(western countries reach 50% to helicobacter pylori among the crowd for Helicobacter pylori, infection rate height Hp), and developing country can be up to 90%, but has only the infected of 10% to develop into DD.The different final results that Hp infects are different relevant with the virulence between the Hp bacterial strain, and whether the heterogeneity of virulence gene causes the generation of inflammation and ulcer after decision Hp infects.Thereby, use important Hp virulence sign, carry out the evaluation of supper toxic strain, for clinical diagnosis and whether need to carry out the radical treatment of Hp and have extremely important directive significance.
Can be divided into two kinds for the Hp diagnosis of infection at present: i.e. invasive inspection and non-intrusive inspection.The invasive inspection mainly is to get the gastric mucosa sample by gastroscope to do RUT diagnosis, microbe growth, PCR and histological examination; Non-intrusive inspection comprises detection, urea breath test, ight soil Detection of antigen of serum antibody etc.Because of the invasive inspection cause traumatic, especially can not be accepted by children, favored so non-intrusive inspection.But the inspection method of these Noninvasives, as urea breath test, ight soil antigen and serum UreB antibody test only is Hp to be infected diagnose, can not identify that the evaluation that high strain Hp is infected at present mainly is by detecting anti-Hp CagA antibody in the serum to high strain.
Increasing epidemiology survey is found, the infection rate of CagA positive bacteria is high, account for 60%～80% in western countries, domestic infection rate is higher, some the area in addition reach more than 90%, cagA+vacAsl infection rate height is also pointed out in the research of Lazebnik LB etc., be difficult to determine the relation of itself and disease.As seen, indicate virulent strain, can not satisfy clinical needs well, add that present detection kit susceptibility and specificity are undesirable, stoped widespread use clinically with CagA.
Summary of the invention
In order to overcome existing technical deficiency, the objective of the invention is to provide the recombinant antigen of a kind of helicobacter pylori virulence gene oipA, for clinical helicobacter pylori high virulence diagnosis of infection provides responsive, special detectable.
The technical solution adopted for the present invention to solve the technical problems is: will pass through molecular biology method, by the clonal expression of gene and the purifying of expression product, obtain reorganization OipA antigen, utilize the corresponding antibodies in the clinical serum specimen of this Detection of antigen, the Hp of while separation and Culture stomach biopsy specimen, the Hp bacterial strain is carried out the amplification and the order-checking of oipA signaling zone gene, the result who compares antibody and genetic test, thereby estimate recombinant antigen and detect the susceptibility of serum corresponding antibodies and the preparation of specific helicobacter pylori high virulence reagent, it is characterized in that:
One, material and method
1. bacterial strain, plasmid: helicobacter pylori NCTC11637, Escherichia coli BL-21, carrier pET-42a;
2. primer: according to the full-length gene order of the oipA of GeneBank, through homology analysis, design has six pairs of primers of restriction enzyme site within open reading frame, and the downstream is identical, and the upstream difference is blocked six different segments for reducing successively with the oipA gene; PCR product and corresponding primer thereof are respectively: oipA1:pF-1/pR; OipA2:pF-2/pR; OipA3:pF-3/pR; OipA4:pF-4/pR; OipA5:pF-5/pR; OipA6:pF-6/pR; The pcr amplification product size is respectively: oipA1:863bp; OipA2:803bp; OipA3:743bp; OipA4:683bp; OipA5:443bp; OipA6:204bp; Primer, sequence is as follows:
pF-1：5′CGGGATCCGGATTTTATTTAGGTTTA3′
pF-2：5′CGGGATCCGGCAAAAAAGCTTTAGCAG3′
pF-3：5′CGGGATCCTTATTCCCCGAACAAAACAC3′
pF-4：5′CGGGATCCAAAGATTCAACAAAGATCGC3′
pF-5：5′CGGGATCCCGAGCGTCCCAAGAATATGTTG3′
pF-6：5′CGGGATCCGGCGTTCGTTGGAGCGGTG3′
pR：5′CGGAATTCATGTTTGTTTTTAAAGTTA3′
Other designs oipA signaling zone primer SF/SR
oipA?SF5′TCTTAAAACCAAAGAAAAACC3′
SR5′ACAGAACCAACGCCACCAA3′
3. the structure of helicobacter pylori oipA gene segment prokaryotic expression recon
3.1oipA the acquisition of gene segment: with helicobacter pylori NCTC11637DNA is template, obtains the oipA gene segment by the PCR method.Reclaim kit according to glue and reclaim and purified pcr product, standby in-20 ℃ of preservations.
3.2 the acquisition of expression vector: the bacterial strain line separation that will contain plasmid pET-42a is inoculated in LB and selects on the nutrient culture media, cultivates 10h for 37 ℃.Picking list colony inoculation is selected in the nutrient solution in an amount of LB, shaken cultivation 8-10h.Use the plasmid extraction kit, extract plasmid pET-42a.
3.3oipA the enzyme of gene segment and carrier is cut and the carrier dephosphorylation
With BamH I and EcoRl I double digestion oipA gene segment and pET-42a carrier.Cut product by the purification kit purifying enzyme; The carrier dephosphorylation of purifying, reaction system:
CIP1 μ l, carrier 25 μ l, Buffer35 μ l, ddH
2O19 μ l, total50 μ l, reaction conditions: 37 ℃ of water-bath 1h; 65 ℃ of water-bath 20min cessation reactions are carried out purifying with the carrier of purification kit after to dephosphorylation.
3.4 genes of interest is connected with expression vector: respectively get purpose fragment and carrier 100V electrophoresis 20min in 1% Ago-Gel behind the 3 μ l purifying, roughly determine the coupled reaction system according to electrophoretic band, carrier and the mol ratio 3:1 that inserts fragment are to 1:3.The coupled reaction system:
oipA1 oipA2 oipA3 oipA4 oipA5 oipA6
Purpose fragment 4 μ l 3 μ l 3 μ l 5 μ l 6 μ l 2 μ l
Carrier 8 μ l 6 μ l 6 μ l 7 μ l 8 μ l 4 μ l
T4?Ligase 1μl 1μl 1μl 1μl 1μl 1μl
T4Ligase?Bufferlμl 2μl 2μl 2μl 2μl 2μl 2μl
ddH
2O 5μl 8μl 8μl 5μl 1μl 11μl
total 20μl 20μl 20μl 20μl 20μl 20μl
Reaction conditions: 4 ℃, 16h; 65 ℃ of water-bath 10min cessation reactions.
Connecting product is respectively: pET-42a/oipA1; PET-42a/oipA2; PET-42a/oipA3; PET-42a/oipA4; PET-42a/oipA5; PET-42a/oipA6.
3.5 the conversion of recon and screening: 6 recombinant plasmids that will obtain, be transformed into competent cell BL-21 respectively, several transform single bacterium colony picking, extract recombinant plasmid with opening auspicious plasmid extraction kit.With the recombinant plasmid is template, the template of the negative contrast of pET-42a, the template of the positive contrast of HpNCTC11637; With pF-1/pR; PF-2/pR; PF-3/pR; PF-4/pR; PF-5/pR; PF-6/pR is a primer, and pcr amplification is identified recombinant plasmid, and recombinant plasmid is identified with BamH I and EcoR I double digestion simultaneously, PCR and enzyme is cut all positive recon of evaluation send order-checking.
4. the expression of helicobacter pylori oipA genetic fragment and product purification
4.1 the expression of recon, evaluation and expression condition optimization
Induce the expression of 6 recons with IPTG (final concentration is 1.0mmol/L), after inducing, collect bacterium liquid, 10000rpm, centrifugal 10min, supernatant discarded.Bacterial precipitation (1.0ml bacterium liquid measure) adds the resuspended mixing of 1XSDS sample-loading buffer, boiling water bath 10min, the centrifugal 2min of 10000g.Get supernatant 20 μ l and carry out SDS-PAGE electrophoresis (resolving gel concentration 10%), with the protein band electrotransfer on the gel to cellulose nitrate (NC) film, with anti-GST Tag antibody, Western Breeze chemoluminescence method kit detects the GST label in the fusion.
IPTG with final concentration 0.5,1,1.5,2mmol/L induces recon to express 4h respectively, collects thalline and carries out the SDS-PAGE electrophoresis, and image analysis system is analyzed expression, determines best IPTG concentration.
Induce the expression of recon respectively with the IPTG of final concentration 1.5mmol/L, induction time is decided to be 0.5,1,2,3,4,5 respectively, 6h, collects thalline and carries out the SDS-PAGE electrophoresis, and image analysis system is analyzed expression, determines best induction time.
4.2 the purifying of recombinant protein peptide section
IPTG with final concentration 1.5mmol/L induces recon to express 4h, extracts the bacterium inclusion body, thoroughly dissolves inclusion body with 8mol/L urea lysis buffer.The centrifugal 20min of 10000g, abandon precipitation (containing) not by the urea solvent components, supernatant adds 2XSDS sample-loading buffer mixing, carry out the SDS-PAGE electrophoretic analysis behind 100 ℃ of water-bath 10min, then use Ni-NTA His.Bind resin affinity purification, measure the concentration of the recombinant protein of purifying with the Bradford method.
4.3 the antigenicity of recombinant protein peptide section is identified
With Western-blot method, detect the antigenicity of recombinant protein peptide section with goat-anti Hp polyclonal antibody.The recombinant protein of getting abduction delivering carries out SDS-PAGE electrophoresis, transfer, Ponceaux dyeing; The NC film spends the night with 4 ℃ of sealings of 5% skim milk; With 5% skim milk 1:400 dilution goat-anti Hp polyclonal antibody, 37 ℃, hatch 2h; With the anti-sheep IgG of rabbit of 5% skim milk 1:2000 dilution AP mark, 37 ℃, hatch 1h; Add colour developing liquid NBT/BCIP and hatch several min, band the back occurs with the distilled water rinsing for several times.
4.4 the strong recombinant protein peptide section of screening antigenicity
Detect the antigenic power of recombinant protein peptide section with indirect elisa method.Recombinant protein peptide section with purifying, Hp NCTC11637 poach albumen (positive control) and Escherichia coli BL-21 poach albumen (negative control) are adjusted to same concentrations with coating buffer, respectively get 100 μ l bag by enzyme mark reacting hole, done blank with 100 μ l coating buffer bags by an enzyme mark reacting hole simultaneously.Place 4 ℃ of bags by 24h.Discard coating buffer, add 37 ℃ of sealings of confining liquid 2h, fill it up with hole washing 3 times with cleansing solution, each 3min abandons the liquid in the most hole as far as possible.Goat-anti Hp polyclonal antibody is done the 1:500 dilution with PBS, get 100 μ l and add enzyme mark reacting hole, hatch 1h for 37 ℃, wash 3 times, each 3min does the 1:4000 dilution with the anti-sheep IgG of the rabbit of AP mark with PBS, gets 100 μ l and adds reacting hole, hatch 40min for 37 ℃, wash every hole and add 100 μ l NBT/BCIP colour developing liquid, room temperature reaction 10-15min adopts the 450nm wavelength, measure the OD value, return to zero with the blank hole.
5.OipA6 recombinant antigen detects serum corresponding antibodies and evaluation thereof
5.1 collection clinical samples
Collect biopsy gastric tissue sample and corresponding serum specimen and data.Biopsy specimen is got stomach hole portion mucosal tissue, and portion is done RUT experiment (routine clinical inspection), and portion is put and is used for bacterium separation and Culture (conventional separation and Culture and evaluation) in the 0.5ml Bu Shi nutrient solution.Extract corresponding patient's peripheric venous blood 5ml simultaneously, centrifugal collection serum, after the packing-20 ℃ of preservations standby, be used to detect serum antibody.
5.2Hp clinical isolates strain oipA and cagA gene PCR detect
Hp (83 strain) DNA that obtains with above-mentioned separation is a template, obtains oipA gene signal district DNA by the PCR method.Reaction system:
10Xbuffer 5μl
dNTP(10mmol/L?each) 1μl
primer?SF(20—40μmol/L) 0.5μl
primer?SR(20—40μmol/L) 0.5μl
template(0.15μg) 5μl
DNA?Polymerase(5u/μl) 0.5μl
MgCL
2(25mmol/L) 4μl
ddH
2O 33.5μl
total 50μl
Reaction conditions: 94 ℃ of 5min, (94 ℃ of 30s, 55 ℃ of 1min, 72 ℃ of 1min) * 30,72 ℃ of 5min
5.3oipA signaling zone PCR product sequencing analysis
With the PCR purification kit oipA signaling zone PCR product is carried out purifying, the PCR product behind the purifying send the mensuration sequence, and sequencing result is analyzed with Clustalx and Bioedit software.
5.4 patients serum OipA antibody
Serum OipA antibody test: with the OipA6 protein peptides section (0.95mg/ml) of purifying, each 100 μ l bag of Hp11637 poach albumen (positive control), Escherichia coli BL-21 poach albumen (negative control) and coating buffer (blank) is by enzyme mark reacting hole; One anti-hatching: the serum specimen of collecting is done the 1:100 dilution with PBS, get 100 μ l and add reacting hole, hatch 1h for 37 ℃; Two anti-hatching: the anti-human IgG of HRP mark is done the 1:4000 dilution with PBS, get 100 μ l and add reacting hole, hatch 40min for 37 ℃; Colour developing and result judge: be colour developing liquid with TMB, every hole adds 100 μ l reaction, 10-15min, after obvious change color appears in the positive control hole, adds 50 μ l stop buffer cessation reactions immediately, adopts the 450nm wavelength, measures the OD value, returns to zero with the blank hole.Sample OD value is positive more than or equal to 2.1 times of negative control OD values, and sample OD value is negative less than 2.1 times of negative control OOD values.
Two, result
1.oipA the structure of genetic fragment recombinant expression plasmid
The PCR and the enzyme of recon (pET-42a/oipA1-6) are cut qualification result, the recombinant plasmid pcr amplification product, and size is about oipA1:860bp respectively; OipA2:800bp; OipA3:740bp; OipA4:680bp; OipA5:440bp; OipA6:200bp.As seen recombinant plasmid BamH I and EcoRl I double digestion product 1% agarose gel electrophoresis all have 2 bands, and big band all is in same position, greater than 3000bp; Little band position has nothing in common with each other, and reduces successively, and size variation is consistent with the corresponding target gene segment.
Cut through PCR, enzyme and to be accredited as positive recombinant, send order-checking, through the DNAMAN software analysis, consistent with corresponding sequence.
It is as follows to record sequence:
oipA1：
GGATTTTATTTAGGTTTAAATTTTCTAGAAGGAAGCTATATTCAAGGACAAGGTAGTATCGGCAAAAA
AGCTTTAGCAGAAAACACCTTAAATGAAGCGATCAATAACGCAAAAAATTCATTATTCCCCGAACAAA
ACACAAAAGCCATAAGAGATGCGCAAAACGCCTTAAATGCAGTGAAAGATTCAACAAAGATCGCTAAC
CGATTCGCAGGAAATGGCGGGTCGGGCGGTATTTTCAATGAACTCAGCTTGGGGTATAAATATTTTTT
GGGTAAAAAAGGGATTATAGGGTTTAGGCACTCTCTTTTTTTCGGTTACCAACTTGGTGGCGTTGGTT
CTGTTCCTGGCAGCGGTTTAATAGCTTTTTTACCCTATGGTTTCAATACGGATTTACTTATTAATTGG
ACTAACGATAAACGAGCGTCCCAAGAATATGTTGAACGAAGGGTAAAAGGGCTTTCTATATTTTACAA
AGATATGACCGGCAGAACGCTAGACGCTAACACATTAAAAAAAGCATCAAGGCACATAATCAGAAAAT
CTTCAGGACTTGTAATTGGCATGGATATAGGGGCTAGCACTTGGTTTGCAAGTAACAATCTCACCCCT
TTCAATCAAGTCAAGAGCCACACAATTTTTCAGTTACAAGGGAAATTTGGCGTTCGTTGGAGCGGTGA
TGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGGTTCTAGTGTTGAATTGGGGGTTA
AAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGGGAT^AATTGGATTATAAAAGAGTG
GTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
oipA2：
GGCAAAAAAGCTTTAGCAGAAAACACCTTAAATGAAGCGATCAATAACGCAAAAAATTCATTATTCCC
CGAACAAAACACAAAAGCCATAAGAGATGCGCAAAACGCCTTAAATGCAGTGAAAGATTCAACAAAGA
TCGCTAACCGATTCGCAGGAAATGGCGGGTCGGGCGGTATTTTCAATGAACTCAGCTTGGGGTATAAA
TATTTTTTGGGTAAAAAAGGGATTATAGGGTTTAGGCACTCTCTTTTTTTCGGTTACCAACTTGGTGG
CGTTGGTTCTGTTCCTGGCAGCGGTTTAATAGCTTTTTTACCCTATGGTTTCAATACGGATTTACTTA
TTAATTGGACTAACGATAAACGAGCGTCCCAAGAATATGTTGAACGAAGGGTAAAAGGGCTTTCTATA
TTTTACAAAGATATGACCGGCAGAACGCTAGACGCTAACACATTAAAAAAAGCATCAAGGCACATAAT
CAGAAAATCTTCAGGACTTGTAATTGGCATGGATATAGGGGCTAGCACTTGGTTTGCAAGTAACAATC
TCACCCCTTTCAATCAAGTCAAGAGCCACACAATTTTTCAGTTACAAGGGAAATTTGGCGTTCGTTGG
AGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGGTTCTAGTGTTGAATT
GGGGGTTAAAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGGGATAAATTGGATTATA
AAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
oipA3：
TTATTCCCCGAACAAAACACAAAAGCCATAAGAGATGCGCAAAACGCCTTAAATGCAGTGAAAGATTC
AACAAAGATCGCTAACCGATTCGCAGGAAATGGCGGGTCGGGCGGTATTTTCAATGAACTCAGCTTGG
GGTATAAATATTTTTTGGGTAAAAAAGGGATTATAGGGTTTAGGCACTCTCTTTTTTTCGGTTACCAA
CTTGGTGGCGTTGGTTCTGTTCCTGGCAGCGGTTTAATAGCTTTTTTACCCTATGGTTTCAATACGGA
TTTACTTATTAATTGGACTAACGATAAACGAGCGTCCCAAGAATATGTTGAACGAAGGGTAAAAGGGC
TTTCTATATTTTACAAAGATATGACCGGCAGAACGCTAGACGCTAACACATTAAAAAAAGCATCAAGG
CACATAATCAGAAAATCTTCAGGACTTGTAATTGGCATGGATATAGGGGCTAGCACTTGGTTTGCAAG
TAACAATCTCACCCCTTTCAATCAAGTCAAGAGCCACACAATTTTTCAGTTACAAGGGAAATTTGGCG
TTCGTTGGAGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGGTTCTAGT
GTTGAATTGGGGGTTAAAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGGGATAAATT
GGATTATAAAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
oipA4：
AAAGATTCAACAAAGATCGCTAACCGATTCGCAGGAAATGGCGGGTCGGGCGGTATTTTCAATGAACT
CAGCTTGGGGTATAAATATTTTTTGGGTAAAAAAGGGATTATAGGGTTTAGGCACTCTCTTTTTTTCG
GTTACCAACTTGGTGGCGTTGGTTCTGTTCCTGGCAGCGGTTTAATAGCTTTTTTACCCTATGGTTTC
AATACGGATTTACTTATTAATTGGACTAACGATAAACGAGCGTCCCAAGAATATGTTGAACGAAGGGT
AAAAGGGCTTTCTATATTTTACAAAGATATGACCGGCAGAACGCTAGACGCTAACACATTAAAAAAAG
CATCAAGGCACATAATCAGAAAATCTTCAGGACTTGTAATTGGCATGGATATAGGGGCTAGCACTTGG
TTTGCAAGTAACAATCTCACCCCTTTCAATCAAGTCAAGAGCCACACAATTTTTCAGTTACAAGGGAA
ATTTGGCGTTCGTTGGAGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGG
GTTCTAGTGTTGAATTGGGGGTTAAAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGG
GATAAATTGGATTATAAAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACA
TTAA
oipA5：
CGAGCGTCCCAAGAATATGTTGAACGAAGGGTAAAAGGGCTTTCTATATTTTACAAAGATATGACCGG
CAGAACGCTAGACGCTAACACATTAAAAAAAGCATCAAGGCACATAATCAGAAAATCTTCAGGACTTG
TAATTGGCATGGATATAGGGGCTAGCACTTGGTTTGCAAGTAACAATCTCACCCCTTTCAATCAAGTC
AAGAGCCACACAATTTTTCAGTTACAAGGGAAATTTGGCGTTCGTTGGAGCGGTGATGAATACGATAT
TGATCGCTATGGCGATGAAATCTATCTTGGGGGTTCTAGTGTTGAATTGGGGGTTAAAGTACCAGCGT
TTAAAGTCAATTACTATGGCGATGATTATGGGGATAAATTGGATTATAAAAGAGTGGTGAGCGTTTAT
CTCAACTATACATATAACTTTAAAAACAAACATTAA
oipA6：
GGCGTTCGTTGGAGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGGTTC
TAGTGTTGAATTGGGGGTTAAAGTACCAGCGTTTAAAGTC^ATTACTATGGCGATGATTATGGGG^TA
AATTGGATTATAAAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
2. the expression of helicobacter pylori oipA genetic fragment and product purification
2.1 protein expression: the prediction size after six oipA gene segments are expressed is respectively: 32KD; 30KD; 27KD; 25KD; 16KD; 7.5KD the fusion peptide section prediction size that contains GST and His is about 67KD respectively; 65KD; 62KD; 60KD; 51KD; 42KD.After IPTG induces, SDS-PAGE electrophoresis as seen, each bacterium of recombinating all has a band that express to increase, molecular weight is consistent with the fusion of expection; Measure through image analysis system, expression accounts for 30.10% of bacterial protein respectively; 30.22%; 30.01%; 30.48%; 30.58%; 44.44%.The fusion of expressing is called after 0ipA1 respectively; 0ipA2; 0ipA3; 0ipA4; OipA5; OipA6, empty carrier transformed bacteria albumen called after OipAK.
2.2 expression product is identified
Recombinant protein peptide section is through the SDS-PAGE electrophoresis and after changeing film, through relevant position on the chemiluminescent X-ray sheet of Western-Breeze a specific band is arranged respectively, as seen each protein peptides section all can be discerned by the GST monoclonal antibody, proves that expressed is the fusion peptide section of expection.
2.3 the optimization of expression condition
The IPTG of final concentration 0.5,1,1.5,2mmol/L all can induce Recombinant Protein Expression, SDS-PAGE electrophoretic analysis demonstration, and when the IPTG final concentration is 1.5mmol/L, the expression maximum.Induce 0.5,1,2,3,4,5 respectively, 6h, recombinant protein all has expression.With OipA6 is example, image analysis showed behind the SDS-PAGE electrophoresis, and expression accounts for bacterial protein 41.08% respectively; 46.8%; 49.3%; 52.47%; 54.33%; 47.74% and 46.87%.Wherein, to induce 4h, content 54.33% is for the highest.Promptly when induction time is 4h, Recombinant Protein Expression amount maximum.
2.4 the purifying of recombinant protein peptide section
Inclusion body slightly pure
The recombinant protein inclusion body is carried out preliminary purification, SDS-PAGE electrophoretic analysis demonstration, when urea concentration is 8mol/L, the solubleness maximum of inclusion body, the purity of each protein peptides section reaches 80% respectively; 82%; 84%; 83%; 81%; 90%.
Affinity purification (His-Tag)
Inclusion body through preliminary purification carries out affinitive layer purification, and respectively behind the wash-out 4 times, the SDS-PAGE electrophoretic analysis shows that purity can reach respectively: 93%-96%,
2.5 recombinant protein peptide section concentration determination
The concentration of the recombinant protein peptide section that records with the Bradford method sees Table 1.
Table 1: recombinant protein concentration
2.6 the antigenicity of recombinant protein peptide section
Western blot result shows that a specific band is respectively arranged on the NC film, and the band position is consistent with recombinant protein peptide fragment position.Illustrate that recombinant protein peptide section can be had antigenicity by the identification of goat-anti Hp polyclonal antibody.
2.7 the strong recombinant protein peptide section of screening antigenicity
Indirect elisa method detects the antigenicity of recombinant protein peptide section, the results are shown in Table 2.The absorbance maximum of positive control Hp NCTC11637 albumen, the absorbance minimum of negative control Escherichia coli BL-21 albumen, the absorbance of recombinant protein is followed successively by OipA6 from big to small〉OipA5〉OipA4〉OipA3〉OipA2〉OipA1.Show under the similarity condition that the antigenicity of OipA6 is the strongest.
Table 2: the absorbance of recombinant protein ELISA
3.OipA6 recombinant antigen detects serum corresponding antibodies and evaluation thereof
3.1 separating oipA gene signal region sequence, clinical samples analyzes
The clinical samples separation and Culture obtains 83 strain Hp, its oipA signaling zone gene of pcr amplification, and 66 strain bacteriums obtain positive findings, (showing 6 strain bacteria PCR results at random).The oipA gene PCR amplified production of 66 strain bacteriums is carried out sequential analysis, according to what of signaling zone AG (CT) repetition number, judge the on off state of oipA gene: when signaling zone has 6,9, (1+3), (2+3), (1+2), (1+1+1), when (1+1+2) individual CT dinucleotide repeats, gene is the open to the outside world state, codified OipA albumen makes body produce corresponding antibody; When signaling zone had 5 or 7 CT dinucleotides to repeat, gene was " closing " state, the OipA albumen of not encoding.Judge according to this that in 66 strain bacteriums gene is in 62 strains that have of open state; Gene is in 0 strain of closed condition; Can't judge 4 strains that have of on off state.The on off state such as the table 3 of the CT in corresponding signal district (AG) repetition number, sequence, gene.
Table 3:66 strain Hp signaling zone AG (CT) repetitive sequence analysis result
3.2 the susceptibility of Detection of antigen OipA antibody and specificity
Detecting 62 routine oipA signaling zone genes is that open state (is codified OipA, body can produce antibody) serum specimen, and signaling zone PCR result is negative, and (Hp does not cultivate with infecting Hp, serum Ca gA antibody, the OipA antibody of 48 examples (being functional oipA feminine gender) serum specimen gastric mucosa RUT detection while feminine gender), compare serum OipA antibody and oipA genetic test result, as table 4, the result shows, is 95.16% (59/62) with OipA6 as the susceptibility of Detection of antigen OipA antibody, specificity is 95.83% (46/48), youden index (Youden ' s index)=90.99%.
Table 4:OipA antibody test and oipA genetic test result are relatively
The invention has the beneficial effects as follows: the recon that obtains helicobacter pylori oipA virulence gene fragment one 0ipA6: oipA6-pET-42a (the oipA6 sequence is as follows), recon is transformed the BL-21 cell, the OipA6 fusion that acquisition efficiently expresses, molecular weight is: 42KD, have good antigenicity through evaluation, the susceptibility and the specificity that are used to detect patients serum OipA antibody reach 95.16% and 95.83% respectively.The oipA6 gene order:
GGCGTTCGTTGGAGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGGTTC
TAGTGTTGAATTGGGGGTTAAAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGGGATA
AATTGGATTATAAAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
Description of drawings
Below in conjunction with drawings and Examples the present invention is further described.
Fig. 1 is a recombinant plasmid PCR qualification result.
M:DNA Marker DL3000 among the figure;
1—6：pET-42a／oipA1—6；K：pET-42a。
Fig. 2 is that the recombinant plasmid enzyme is cut the product electrophoresis.
M:DNA Marker DL3000 among the figure; 1-6:pET-42a/oipA1-6.
Fig. 3 is the SDS-PAGE electrophoretogram of 0ipA1-6 fusion peptide section.
1～6:OipA1 among the figure～6, respectively; K:OipAK; M:Protein Marker.
Fig. 4 is the evaluation of recombination fusion protein peptide section.
1:OipA12:OipA2:3:OipA3 among the figure; 4:OipA4; 5:OipA5; 6:OipA6.
Fig. 5 is the expression that different time is induced OpA6.
0:induced for Oh among the figure; 0.5:induced for 0.5h;
1～6： induced?for?1～6h?respectively。
Fig. 6 is a recombinant protein peptide section inclusion body preliminary purification.
K:OipAK after induction among the figure; K ': inclusion body of OipAK; 1～6:OipA1～6 afterinduction; 1 '～6 ': inclusion body of 0ipA1-6:M:Marker.
Fig. 7 is a recombinant protein peptide section affinity purification.
Among the figure 1,5,6:0ipA1,5,6 after induction;
1’，5’，6’：OipA1、5、6after?affinity?purification
Fig. 8 is that recombinant protein peptide section antigenicity detects.
1:OipA1 among the figure; 2:OipA2; 3:OipA3;
4：OipA4；5：OipA5；6：OipA6。
Fig. 9 is an oipA gene signal district pcr amplification product.
M:Marker among the figure; 1～6:clinical sample.
Embodiment
Embodiment 1:
One, material and method
1. bacterial strain, plasmid: helicobacter pylori NCTC11637 is available from CDC infectious disease research institute, and Escherichia coli BL-21, carrier pET-42a are available from Invitrogen company
2. primer: company limited is synthetic by the rich inferior bioengineering in Shanghai.The full-length gene order of the oipA that announces according to GeneBank, through homology analysis, design has six pairs of primers of restriction enzyme site within open reading frame, and the downstream is identical, and the upstream difference is blocked six different segments for reducing successively with the oipA gene.PCR product and corresponding primer thereof are respectively: oipA1:pF-1/pR; OipA2:pF-2/pR; OipA3:pF-3/pR; OipA4:pF-4/pR; OipA5:pF-5/pR; OipA6:pF-6/pR.The pcr amplification product size is respectively: oipA1:863bp; OipA2:803bp; OipA3:743bp; OipA4:683bp; OipA5:443bp; OipA6:204bp.Primer, sequence is as follows:
pF-1：5′CGGGATCCGGATTTTATTTAGGTTTA3′
pF-2：5′CGGGATCCGGCAAAAAAGCTTTAGCAG3′
pF-3：5′CGGGATCCTTATTCCCCGAACAAAACAC3′
pF-4：5′CGGGATCCAAAGATTCAACAAAGATCGC3′
pF-5：5′CGGGATCCCGAGCGTCCCAAGAATATGTTG3′
pF-6：5′CGGGATCCGGCGTTCGTTGGAGCGGTG3′
pR： 5′CGGAATTCATGTTTGTTTTTAAAGTTA3′
Other designs oipA signaling zone primer SF/SR
oipA?SF5′TCTTAAAACCAAAGAAAAACC3′
SR5′ACAGAACCAACGCCACCAA3′
3. the structure of helicobacter pylori oipA gene segment prokaryotic expression recon
3.1oipA the acquisition of gene segment: with helicobacter pylori NCTC11637DNA is template, obtains the oipA gene segment by the PCR method.According to last marine Ke Kairui Engineering Co., Ltd's glue recovery kit recovery and purified pcr product, standby in-20 ℃ of preservations.
3.2 the acquisition of expression vector: the bacterial strain line separation that will contain plasmid pET-42a is inoculated in LB and selects on the nutrient culture media, cultivates 10h for 37 ℃.Picking list colony inoculation is selected in the nutrient solution in an amount of LB, shaken cultivation 8-10h.Use marine Ke Kairui Engineering Co., Ltd plasmid extraction kit, extract plasmid pET-42a.
3.3oipA the enzyme of gene segment and carrier is cut and the carrier dephosphorylation
With BamH I and EcoRl I double digestion oipA gene segment and pET-42a carrier.Cut product according to last marine Ke Kairui Engineering Co., Ltd purification kit purifying enzyme.The carrier dephosphorylation of purifying, reaction system: CIP1 μ l, carrier 25 μ l, Buffer35 μ l, ddH
2O19 μ l, total50 μ l, reaction conditions: 37 ℃ of water-bath 1h; 65 ℃ of water-bath 20min cessation reactions are carried out purifying with the carrier of purification kit after to dephosphorylation.
3.4 genes of interest is connected with expression vector: respectively get purpose fragment and carrier 100V electrophoresis 20min in 1% Ago-Gel behind the 3 μ l purifying, roughly determine the coupled reaction system according to electrophoretic band, carrier and the mol ratio 3:1 that inserts fragment are to 1:3.The coupled reaction system:
oipA1 oipA2 oipA3 oipA4 oipA5 oipA6
Carrier 8 μ l 6 μ l 6 μ l 7 μ l 8 μ l 4 μ l
T4Ligase 1μl 1μl 1μl 1μl 1μl 1μl
T4Ligase?Bufferlμl 2μl 2μl 2μl 2μl 2μl 2μl
ddH
2O 5μl 8μl 8μl 5μl 1μl 11μl
total 20μl 20μl 20μl 20μl 20μl 20μl
Reaction conditions: 4 ℃, 16h; 65 ℃ of water-bath 10min cessation reactions.
Connecting product is respectively: pET-42a/oipA1; PET-42a/oipA2; PET-42a/oipA3; PET-42a/oipA4; PET-42a/oipA5; PET-42a/oipA6.
3.5 the conversion of recon and screening: 6 recombinant plasmids with above-mentioned acquisition, be transformed into competent cell BL-21 respectively, several transform single bacterium colony picking, use marine Ke Kairui plasmid extraction kit and extract recombinant plasmid.With the recombinant plasmid is template, the template of the negative contrast of pET-42a, the template of the positive contrast of HpNCTC11637; With pF-1/pR; PF-2/pR; PF-3/pR; PF-4/pR; PF-5/pR; PF-6/pR is a primer, and pcr amplification is identified recombinant plasmid, and recombinant plasmid is identified with BamH I and EcoR I double digestion simultaneously, PCR and enzyme is cut all positive recon of evaluation serve the order-checking of Hai Boya Bioisystech Co., Ltd.
4. the expression of helicobacter pylori oipA genetic fragment and product purification
4.1 the expression of recon, evaluation and expression condition optimization
Induce the expression of above-mentioned 6 recons with IPTG (final concentration is 1.0mmol/L), after inducing, collect bacterium liquid, 10000rpm, centrifugal 10min, supernatant discarded.Bacterial precipitation (1.0ml bacterium liquid measure) adds the resuspended mixing of 1XSDS sample-loading buffer, boiling water bath 10min, the centrifugal 2min of 10000g.Get supernatant 20 μ l and carry out SDS-PAGE electrophoresis (resolving gel concentration 10%), with the protein band electrotransfer on the gel to cellulose nitrate (NC) film, with anti-GST Tag antibody, Western Breeze chemoluminescence method kit detects the GST label in the fusion.
IPTG with final concentration 0.5,1,1.5,2mmol/L induces recon to express 4h respectively, collects thalline and carries out the SDS-PAGE electrophoresis, and image analysis system is analyzed expression, determines best IPTG concentration.
Induce the expression of recon respectively with the IPTG of final concentration 1.5mmol/L, induction time is decided to be 0.5,1,2,3,4,5 respectively, 6h, collects thalline and carries out the SDS-PAGE electrophoresis, and image analysis system is analyzed expression, determines best induction time.
4.2 the purifying of recombinant protein peptide section
IPTG with final concentration 1.5mmol/L induces recon to express 4h, extracts the bacterium inclusion body, thoroughly dissolves inclusion body with 8mol/L urea lysis buffer.The centrifugal 20min of 10000g, abandon precipitation (containing) not by the urea solvent components, supernatant adds 2XSDS sample-loading buffer mixing, carry out the SDS-PAGE electrophoretic analysis behind 100 ℃ of water-bath 10min, then use Ni-NTA His.Bind resin affinity purification, measure the concentration of the recombinant protein of purifying with the Bradford method.
4.3 the antigenicity of recombinant protein peptide section is identified
With Western-blot method, detect the antigenicity of recombinant protein peptide section with goat-anti Hp polyclonal antibody.The recombinant protein of getting abduction delivering carries out SDS-PAGE electrophoresis, transfer, Ponceaux dyeing; The NC film spends the night with 4 ℃ of sealings of 5% skim milk; With 5% skim milk 1:400 dilution goat-anti Hp polyclonal antibody, 37 ℃, hatch 2h; With the anti-sheep IgG of rabbit of 5% skim milk 1:2000 dilution AP mark, 37 ℃, hatch 1h; Add colour developing liquid NBT/BCIP and hatch several min, band the back occurs with the distilled water rinsing for several times.
4.4 the strong recombinant protein peptide section of screening antigenicity
Detect the antigenic power of recombinant protein peptide section with indirect elisa method.Recombinant protein peptide section with purifying, Hp NCTC11637 poach albumen (positive control) and Escherichia coli BL-21 poach albumen (negative control) are adjusted to same concentrations with coating buffer, respectively get 100 μ l bag by enzyme mark reacting hole, done blank with 100 μ l coating buffer bags by an enzyme mark reacting hole simultaneously.Place 4 ℃ of bags by 24h.Discard coating buffer, add 37 ℃ of sealings of confining liquid 2h, fill it up with hole washing 3 times with cleansing solution, each 3min abandons the liquid in the most hole as far as possible.Goat-anti Hp polyclonal antibody is done the 1:500 dilution with PBS, get 100 μ l and add enzyme mark reacting hole, hatch 1h for 37 ℃, wash 3 times, each 3min does the 1:4000 dilution with the anti-sheep IgG of the rabbit of AP mark with PBS, gets 100 μ l and adds reacting hole, hatch 40min for 37 ℃, wash every hole and add 100 μ l NBT/BCIP colour developing liquid, room temperature reaction 10-15min adopts the 450nm wavelength, measure the OD value, return to zero with the blank hole.
5.OipA6 recombinant antigen detects serum corresponding antibodies and evaluation thereof
5.1 collection clinical samples
Collect 285 parts of biopsy gastric tissue samples and corresponding serum specimen, collect patient's clinical data simultaneously
(sex, age, clinical diagnosis, the past disease of digestive tract history) and pathological diagnosis result.Male 157 examples, women 128 examples in 285 parts of samples, 44.4 years old mean age.Biopsy specimen is got stomach hole portion mucosal tissue, and portion is done RUT experiment (routine clinical inspection), and portion is put and is used for bacterium separation and Culture (conventional separation and Culture and evaluation) in the 0.5ml Bu Shi nutrient solution.Extract corresponding patient's peripheric venous blood 5ml simultaneously, centrifugal collection serum, after the packing-20 ℃ of preservations standby, be used to detect serum antibody.
5.2Hp clinical isolates strain oipA and cagA gene PCR detect
Hp (83 strain) DNA that obtains with above-mentioned separation is a template, obtains oipA gene signal district DNA by the PCR method.Reaction system:
10Xbuffer 5μl
dNTP(10mmol/L?each) 1μl
primer?SF(20—40μmol/L) 0.5μl
primer?SR(20—40μmol/L) 0.5μl
template(0.15μg) 5μl
DNA?Polymerase(5u/μl) 0.5μl
MgCL
2(25mmol/L) 4μl
ddH
2O 33.5μl
total 50μl
Reaction conditions: 94 ℃ of 5min, (94 ℃ of 30s, 55 ℃ of 1min, 72 ℃ of 1min) * 30,72 ℃ of 5min
5.3oipA signaling zone PCR product sequencing analysis
Use the marine Ke Kairui PCR of Engineering Co., Ltd purification kit oipA signaling zone PCR product is carried out purifying, the PCR product behind the purifying is served Hai Boya Bioisystech Co., Ltd and is measured sequence, and sequencing result is analyzed with Clustalx and Bioedit software.
5.4 patients serum OipA antibody
Serum OipA antibody test: with the OipA6 protein peptides section (0.95mg/ml) of purifying, each 100 μ l bag of Hp11637 poach albumen (positive control), Escherichia coli BL-21 poach albumen (negative control) and coating buffer (blank) is by enzyme mark reacting hole; One anti-hatching: the serum specimen of collecting is done the 1:100 dilution with PBS, get 100 μ l and add reacting hole, hatch 1h for 37 ℃; Two anti-hatching: the anti-human IgG of HRP mark is done the 1:4000 dilution with PBS, get 100 μ l and add reacting hole, hatch 40min for 37 ℃; Colour developing and result judge: be colour developing liquid with TMB, every hole adds 100 μ l reaction, 10-15min, after obvious change color appears in the positive control hole, adds 50 μ l stop buffer cessation reactions immediately, adopts the 450nm wavelength, measures the OD value, returns to zero with the blank hole.Sample OD value is positive more than or equal to 2.1 times of negative control OD values, and sample OD value is negative less than 2.1 times of negative control OD values.
Two, result
1.oipA the structure of genetic fragment recombinant expression plasmid
Fig. 1,2 is respectively the PCR and the enzyme of recon (pET-42a/oipA1-6) and cuts qualification result, the recombinant plasmid pcr amplification product, and size is about oipA1:860bp respectively; OipA2:800bp; OipA3:740bp; OipA4:680bp; OipA5:440bp; OipA6:200bp is with the genes of interest segment size basically identical of gained before.As seen recombinant plasmid BamH I and EcoRl I double digestion product 1% agarose gel electrophoresis all have 2 bands, and big band all is in same position, greater than 3000bp; Little band position has nothing in common with each other, and reduces successively, and size variation is consistent with the corresponding target gene segment.
Cut through PCR, enzyme and to be accredited as positive recombinant, send order-checking, through the DNAMAN software analysis, consistent with corresponding sequence.
It is as follows to record sequence:
oipA1：
GGATTTTATTTAGGTTTAAATTTTCTAGAAGGAAGCTATATTCAAGGACAAGGTAGTATCGGCAAAAA
AGCTTTAGCAGAAAACACCTTAAATGAAGCGATCAATAACGCAAAAAATTCATTATTCCCCGAACAAA
ACACAAAAGCCATAAGAGATGCGCAAAACGCCTTAAATGCAGTGAAAGATTCAACAAAGATCGCTAAC
CGATTCGCAGGAAATGGCGGGTCGGGCGGTATTTTCAATGAACTCAGCTTGGGGTATAAATATTTTTT
GGGTAAAAAAGGGATTATAGGGTTTAGGCACTCTCTTTTTTTCGGTTACCAACTTGGTGGCGTTGGTT
CTGTTCCTGGCAGCGGTTTAATAGCTTTTTTACCCTATGGTTTCAATACGGATTTACTTATTAATTGG
ACTAACGATAAACGAGCGTCCCAAGAATATGTTGAACGAAGGGTAAAAGGGCTTTCTATATTTTACAA
AGATATGACCGGCAGAACGCTAGACGCTAACACATTAAAAAAAGCATCAAGGCACATAATCAGAAAAT
CTTCAGGACTTGTAATTGGCATGGATATAGGGGCTAGCACTTGGTTTGCAAGTAACAATCTCACCCCT
TTCAATCAAGTCAAGAGCCACACAATTTTTCAGTTACAAGGGAAATTTGGCGTTCGTTGGAGCGGTGA
TGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGGTTCTAGTGTTGAATTGGGGGTTA
AAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGGGATAAATTGGATTATAAAAGAGTG
GTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
oipA2：
GGCAAAAAAGCTTTAGCAGAAAACACCTTAAATGAAGCGATCAATAACGCAAAAAATTCATTATTCCC
CGAACAAAACACAAAAGCCATAAGAGATGCGCAAAACGCCTTAAATGCAGTGAAAGATTCAACAAAGA
TCGCTAACCGATTCGCAGGAAATGGCGGGTCGGGCGGTATTTTCAATGAACTCAGCTTGGGGTATAAA
TATTTTTTGGGTAAAAAAGGGATTATAGGGTTTAGGCACTCTCTTTTTTTCGGTTACCAACTTGGTGG
CGTTGGTTCTGTTCCTGGCAGCGGTTTAATAGCTTTTTTACCCTATGGTTTCAATACGGATTTACTTA
TTAATTGGACTAACGATAAACGAGCGTCCCAAGAATATGTTGAACGAAGGGTAAAAGGGCTTTCTATA
TTTTACAAAGATATGACCGGCAGAACGCTAGACGCTAACACATTAAAAAAAGCATCAAGGCACATAAT
CAGAAAATCTTCAGGACTTGTAATTGGCATGGATATAGGGGCTAGCACTTGGTTTGCAAGTAACAATC
TCACCCCTTTCAATCAAGTCAAGAGCCACACAATTTTTCAGTTACAAGGGAAATTTGGCGTTCGTTGG
AGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGGTTCTAGTGTTGAATT
GGGGGTTAAAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGGGATAAATTGGATTATA
AAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
oipA3：
TTATTCCCCGAACAAAACACAAAAGCCATAAGAGATGCGCAAAACGCCTTAAATGCAGTGAAAGATTC
AACAAAGATCGCTAACCGATTCGCAGGAAATGGCGGGTCGGGCGGTATTTTCAATGAACTCAGCTTGG
GGTATAAATATTTTTTGGGTAAAAAAGGGATTATAGGGTTTAGGCACTCTCTTTTTTTCGGTTACCAA
CTTGGTGGCGTTGGTTCTGTTCCTGGCAGCGGTTTAATAGCTTTTTTACCCTATGGTTTCAATACGGA
TTTACTTATTAATTGGACTAACGATAAACGAGCGTCCCAAGAATATGTTGAACGAAGGGTAAAAGGGC
TTTCTATATTTTACAAAGATATGACCGGCAGAACGCTAGACGCTAACACATTAAAAAAAGCATCAAGG
CACATAATCAGAAAATCTTCAGGACTTGTAATTGGCATGGATATAGGGGCTAGCACTTGGTTTGCAAG
TAACAATCTCACCCCTTTCAATCAAGTCAAGAGCCACACAATTTTTCAGTTACAAGGGAAATTTGGCG
TTCGTTGGAGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGGTTCTAGT
GTTGAATTGGGGGTTAAAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGGGATAAATT
GGATTATAAAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
oipA4：
AAAGATTCAACAAAGATCGCTAACCGATTCGCAGGAAATGGCGGGTCGGGCGGTATTTTCAATGAACT
CAGCTTGGGGTATAAATATTTTTTGGGTAAAAAAGGGATTATAGGGTTTAGGCACTCTCTTTTTTTCG
GTTACCAACTTGGTGGCGTTGGTTCTGTTCCTGGCAGCGGTTTAATAGCTTTTTTACCCTATGGTTTC
AATACGGATTTACTTATTAATTGGACTAACGATAAACGAGCGTCCCAAGAATATGTTGAACGAAGGGT
AAAAGGGCTTTCTATATTTTACAAAGATATGACCGGCAGAACGCTAGACGCTAACACATTAAAAAAAG
CATCAAGGCACATAATCAGAAAATCTTCAGGACTTGTAATTGGCATGGATATAGGGGCTAGCACTTGG
TTTGCAAGTAACAATCTCACCCCTTTCAATCAAGTCAAGAGCCACACAATTTTTCAGTTACAAGGGAA
ATTTGGCGTTCGTTGGAGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGG
GTTCTAGTGTTGAATTGGGGGTTAAAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGG
GATAAATTGGATTATAAAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACA
TTAA
oipA5：
CGAGCGTCCCAAGAATATGTTGAACGAAGGGTAAAAGGGCTTTCTATATTTTACAAAGATATGACCGG
CAGAACGCTAGACGCTAACACATTAAAAAAAGCATCAAGGCACATAATCAGAAAATCTTCAGGACTTG
TAATTGGCATGGATATAGGGGCTAGCACTTGGTTTGCAAGTAACAATCTCACCCCTTTCAATCAAGTC
AAGAGCCACACAATTTTTCAGTTACAAGGGAAATTTGGCGTTCGTTGGAGCGGTGATGAATACGATAT
TGATCGCTATGGCGATGAAATCTATCTTGGGGGTTCTAGTGTTGAATTGGGGGTTAAAGTACCAGCGT
TTAAAGTCAATTACTATGGCGATGATTATGGGGATAAATTGGATTATAAAAGAGTGGTGAGCGTTTAT
CTCAACTATACATATAACTTTAAAAACAAACATTAA
oipA6：
GGCGTTCGTTGGAGCGGTGATGAATACGATATTGATCGCTATGGCGATGAAATCTATCTTGGGGCTTC
TAGTGTTGAATTGGGGGTTAAAGTACCAGCGTTTAAAGTCAATTACTATGGCGATGATTATGGGGATA
AATTGGATTATAAAAGAGTGGTGAGCGTTTATCTCAACTATACATATAACTTTAAAAACAAACATTAA
2. the expression of helicobacter pylori oipA genetic fragment and product purification
2.1 protein expression: the prediction size after six oipA gene segments are expressed is respectively: 32KD; 30KD; 27KD; 25KD; 16KD; 7.5KD the fusion peptide section prediction size that contains GST and His is about 67KD respectively; 65KD; 62KD; 60KD; 51KD; 42KD.After IPTG induces, the SDS-PAGE electrophoresis as seen, each bacterium of recombinating all has a band that express to increase, molecular weight is consistent with the fusion of expection; Measure through image analysis system, expression accounts for 30.10% of bacterial protein respectively; 30.22%; 30.01%; 30.48%; 30.58%; 44.44%, as Fig. 3.The fusion of expressing is called after OipA1 respectively; OipA2; OipA3; OipA4; OipA5; OipA6, empty carrier transformed bacteria albumen called after OipAK.
2.2 expression product is identified
Recombinant protein peptide section is through the SDS-PAGE electrophoresis and after changeing film, through relevant position on the chemiluminescent X-ray sheet of Western-Breeze a specific band is arranged respectively, as seen each protein peptides section all can be discerned by the GST monoclonal antibody, proves that expressed is the fusion peptide section of expection.As Fig. 4.
2.3 the optimization of expression condition
The IPTG of final concentration 0.5,1,1.5,2mmol/L all can induce Recombinant Protein Expression, SDS-PAGE electrophoretic analysis demonstration, and when the IPTG final concentration is 1.5mmol/L, the expression maximum.Induce 0.5,1,2,3,4,5 respectively, 6h, recombinant protein all has expression.With OipA6 is example, image analysis showed behind the SDS-PAGE electrophoresis, and expression accounts for bacterial protein 41.08% respectively; 46.8%; 49.3%; 52.47%; 54.33%; 47.74% and 46.87%.Wherein, to induce 4h, content 54.33% is for the highest.Promptly when induction time is 4h, Recombinant Protein Expression amount maximum.As Fig. 5.
2.4 the purifying of recombinant protein peptide section
Inclusion body slightly pure
The recombinant protein inclusion body is carried out preliminary purification, SDS-PAGE electrophoretic analysis demonstration, when urea concentration is 8mol/L, the solubleness maximum of inclusion body, the purity of each protein peptides section reaches 80% respectively; 82%; 84%; 83%; 81%; 90%.As Fig. 6.
Affinity purification (His-Tag)
Inclusion body through preliminary purification carries out affinitive layer purification, and respectively behind the wash-out 4 times, the SDS-PAGE electrophoretic analysis shows that purity can reach respectively: 93%-96%, and as Fig. 7.
2.5 recombinant protein peptide section concentration determination
The concentration of the recombinant protein peptide section that records with the Bradford method sees Table 1.
Table 1: recombinant protein concentration
2.6 the antigenicity of recombinant protein peptide section
Western blot result shows that a specific band is respectively arranged on the NC film, and the band position is consistent with recombinant protein peptide fragment position.Illustrate that recombinant protein peptide section can be had antigenicity by the identification of goat-anti Hp polyclonal antibody.As Fig. 8.
2.7 the strong recombinant protein peptide section of screening antigenicity
Indirect elisa method detects the antigenicity of recombinant protein peptide section, the results are shown in Table 2.The absorbance maximum of positive control Hp NCTC11637 albumen, the absorbance minimum of negative control Escherichia coli BL-21 albumen, the absorbance of recombinant protein is followed successively by OipA6 from big to small〉OipA5〉OipA4〉OipA3〉OipA2〉OipA1.Show under the similarity condition that the antigenicity of OipA6 is the strongest.
Table 2: the absorbance of recombinant protein ELISA
3.OipA6 recombinant antigen detects serum corresponding antibodies and evaluation thereof
3.1 separating oipA gene signal region sequence, clinical samples analyzes
The clinical samples separation and Culture obtains 83 strain Hp, its oipA signaling zone gene of pcr amplification, and 66 strain bacteriums obtain positive findings.The oipA gene PCR amplified production of 66 strain bacteriums is carried out sequential analysis, according to what of signaling zone AG (CT) repetition number, judge the on off state of oipA gene: when signaling zone has 6,9, (1+3), (2+3), (1+2), (1+1+1), when (1+1+2) individual CT dinucleotide repeats, gene is the open to the outside world state, codified OipA albumen makes body produce corresponding antibody; When signaling zone had 5 or 7 CT dinucleotides to repeat, gene was " closing " state, the OipA albumen of not encoding.Judge according to this that in 66 strain bacteriums gene is in 62 strains that have of open state; Gene is in 0 strain of closed condition; Can't judge 4 strains that have of on off state.The on off state such as the table 3 of the CT in corresponding signal district (AG) repetition number, sequence, gene.
Table 3:66 strain Hp signaling zone AG (CT) repetitive sequence analysis result
3.2 the susceptibility of Detection of antigen OipA antibody and specificity
Detecting 62 routine oipA signaling zone genes is that open state (is codified OipA, body can produce antibody) serum specimen, and signaling zone PCR result is negative, and (Hp does not cultivate with infecting Hp, serum Ca gA antibody, the OipA antibody of 48 examples (being functional oipA feminine gender) serum specimen gastric mucosa RUT detection while feminine gender), compare serum OipA antibody and oipA genetic test result, as table 4, the result shows, is 95.16% (59/62) with OipA6 as the susceptibility of Detection of antigen OipA antibody, specificity is 95.83% (46/48), youden index (Youden ' s index)=90.99%.
Table 4:OipA antibody test and oipA genetic test result are relatively
SEQUENCE?LISTING
＜110〉Medical University Of Fujian
＜120〉preparation of detecting reagent of helicobacter pylori high virulence
<160>1
<170>PatentIn?version3.1
<210>1
<211>203
<212>DNA
<213>Helicobacter?pylori
<400>1
Claims (3)
1.oipA6 gene order is characterized in that this sequence is SEQ ID No.1.
2. by the described oipA6 gene order of claim 1 encoded protein peptide section.
3. detecting reagent of helicobacter pylori high virulence, it comprises the described protein peptides section of claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710009200 CN101082623B (en) | 2007-07-12 | 2007-07-12 | Preparation of detecting reagent of helicobacter pylori high virulence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710009200 CN101082623B (en) | 2007-07-12 | 2007-07-12 | Preparation of detecting reagent of helicobacter pylori high virulence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101082623A CN101082623A (en) | 2007-12-05 |
| CN101082623B true CN101082623B (en) | 2011-11-16 |
Family
ID=38912303
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200710009200 Expired - Fee Related CN101082623B (en) | 2007-07-12 | 2007-07-12 | Preparation of detecting reagent of helicobacter pylori high virulence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101082623B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102636641B (en) * | 2012-03-26 | 2014-06-25 | 上海凯创生物技术有限公司 | Detection kit of helicobacter pylori emulsion method and preparation process thereof |
| CN115267208B (en) * | 2022-09-27 | 2023-01-03 | 上海芯超生物科技有限公司 | Antigen and kit for detecting helicobacter pylori antibody and preparation method thereof |
| CN116120408B (en) * | 2022-12-09 | 2023-10-20 | 扬州大学 | B cell epitope target antigen carrying helicobacter pylori virulence factor, expression vector and application thereof |
-
2007
- 2007-07-12 CN CN 200710009200 patent/CN101082623B/en not_active Expired - Fee Related
Non-Patent Citations (6)
| Title |
|---|
| Takahiko Kudo et al.Correlation between Helicobacter pylori OipA Protein Expression and oipA Gene Switch Status.《 Journal of Clinical Microbiology》.2004,第42卷(第5期),第2279-2281页. * |
| Yoshio Yamaoka et al.A Mr 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori.《PNAS》.2000,第97卷(第13期),第7533-7538页. * |
| YoshioYamaokaetal.AMr34 000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori.《PNAS》.2000 |
| 张静等.在真核细胞中表达的幽门螺杆菌UreC OipA 抗原性的检测及其对细胞的作用.《中国免疫学杂志》.2005 |
| 张静等.在真核细胞中表达的幽门螺杆菌UreC,OipA 抗原性的检测及其对细胞的作用.《中国免疫学杂志》.2005,第21卷第682-686页. * |
| 李妮等.幽门螺杆菌致病因子OipA 及其研究进展.《福建医科大学学报》.2006,第40卷(第4期),第406-409页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101082623A (en) | 2007-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108148138A (en) | African swine fever virus multi-epitope fusion diagnosis antigen and its preparation method and application | |
| CN101948521B (en) | Recombinant antigenic protein for diagnosing echinococcosis granulosus, preparation method thereof and use thereof | |
| CN111217920A (en) | N-S dominant epitope fusion protein of new coronavirus, preparation method and application thereof, expression protein, microorganism, application thereof and kit | |
| CN105452864B (en) | For detecting the method for helicobacter pylori infections | |
| WO2008029981A1 (en) | Diagnostic formulation for tsutsugamushi disease | |
| CN104862285A (en) | Porcine epidemic diarrhea virus antibody capture based ELISA detection method and application | |
| CN101624422A (en) | Schistosoma japonicum recombinant multi-epitope antigens, method for expressing and purifying same and application thereof | |
| CN101082623B (en) | Preparation of detecting reagent of helicobacter pylori high virulence | |
| CN102721815A (en) | Detection kit for helicobacter pylori virulence protein antibody and detection method by using the same | |
| CN106589082A (en) | Screening and application of active tuberculosis diagnosis molecules | |
| CN107304231B (en) | Mycobacterium tuberculosis fusion protein and application thereof | |
| Long et al. | Detection and evaluation of antibodies against neutrophil-activating protein of Helicobacter pylori in patients with gastric cancer | |
| Yoo et al. | Recent research on bovine paratuberculosis in South Korea | |
| CN112500494B (en) | Antigen for detecting novel coronavirus and preparation method thereof | |
| Verbon et al. | Characterization of B cell epitopes on the 16K antigen of Mycobacterium tuberculosis | |
| CN105753980B (en) | A kind of HPV18 E6 monoclonal antibody and its preparation method and application | |
| Ng et al. | Helicobacter pylori heat shock protein A: serologic responses and genetic diversity | |
| CN100567492C (en) | Sheep coenurosis specific gene and separation thereof and evaluation | |
| Dumke et al. | Characterisation of subtype-and variant-specific antigen regions of the P1 adhesin of Mycoplasma pneumoniae | |
| RU2514230C1 (en) | Recombinant chimeric polypeptides, carrying epitopes of various immunodominant proteins of spirochaeta of borrelia burgdorferi sensu lato complex, and serum diagnostic technique for ixodic tick-borne borreliosis | |
| CN113248578B (en) | Novel coronavirus (2019-nCoV) recombinant antigen and polyclonal antibody | |
| Altanbayar et al. | Characterization of the cagA-gene in Helicobacter pylori in Mongolia and detection of two EPIYA-A enriched CagA types | |
| CN107530414B (en) | Mycobacterium tuberculosis antigen for distinguishing active tuberculosis infection and latent tuberculosis infection and application thereof | |
| González et al. | Cloning and expression of a recombinant CagA-gene fragment of Helicobacter pylori and its preliminary evaluation in serodiagnosis | |
| Pathak et al. | Cloning, expression and purification of virB10 protein of Brucella melitensis and evaluation of its role as a serological marker for Brucella infection in experimental and natural host |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111116 Termination date: 20150712 |
|
| EXPY | Termination of patent right or utility model |