CN101063143A - Recombined cytomegalovirus gp52 protein and its application - Google Patents

Abstract

The invention discloses a retooling cytomegalovirus gp52 protein and appliance in preparing single antibody, multiple antibody, testing agent case and protein chip, which is characterized by the following: possessing strong specificity and high sensibility compare to same agent case at market; meeting the need of huge cell virus infected clinical diagnosis.

Description

A kind of recombined cytomegalovirus gp 52 protein and application thereof

Technical field

The present invention relates to the genetically engineered field, relate to a kind of recombined cytomegalovirus gp 52 protein and application thereof particularly.

Background technology

(cytomegalovirus CMV) belongs to simplexvirus β subfamily to cytomegalovirus, and it infects in the crowd and extensively exists.More and more evidences proves, it is to cause to infect in the fetus official and grow damaged major reason that the women is subjected to the CMV primary infection at the gestation initial stage, even thinks that its effect aspect teratogenesis is more even more important than rubella.CMV also is organ transplantation failure and acquired immune deficiency syndrome (AIDS) patient accompanying infection main causes of death, non-immune deficiency person is often caused long-term stealthy infection or non-special symptom occurs, even cause conversion, distortion or the canceration of cells infected, also the generation with kinds of tumors is relevant simultaneously, reaches ripple Ji sarcoma down as cervical cancer, prostate cancer, colorectal carcinoma.This virus can be propagated from number of ways.The key point that quick, the accurate detection method of setting up cmv infection is the prevention cmv infection.

At present, the cytomegalovirus infection diagnostic method mainly contains cast-off cells and tissue pathology checking, viral separation and Detection of antigen, molecular hybridization test and Serological testing, and the many antigens based on high specific of these methods are set up.The invention provides a kind of recombinant antigen of producing with gene engineering method, extract antigen component with virus commonly used and compare, that the detection that can be cytomegalovirus infection provides is more special, raw material accurately.

Summary of the invention

(1) technical problem that will solve

The purpose of this invention is to provide a kind of recombined cytomegalovirus gp 52 protein, another object of the present invention provides the application of this recombined cytomegalovirus gp 52 protein in preparation monoclonal antibody, many anti-, detection kit and protein chip.

(2) technical scheme

The invention provides a kind of recombinant DNA of the cytomegalovirus gp 52 protein of encoding, its nucleotide sequence is shown in SEQ ID NO:1.Recombined cytomegalovirus gp 52 protein by this recombinant DNA sequence coding is provided simultaneously, and its aminoacid sequence is shown in SEQ ID NO:2.

The present invention also provides a kind of expression vector pET-28a-gp52 of recombined cytomegalovirus gp 52 protein, and it is that the described recombinant DNA sequence of claim 1 is inserted into the recombinant plasmid that obtains on the plasmid pET-28a, and its plasmid map as shown in Figure 1.Expression vector pET-28a-gp52 is imported in the intestinal bacteria, obtain the engineering strain of express recombinant cytomegalovirus gp 52 protein.

The invention provides a kind of test kit that detects cytomegalovirus infection, the antigen in its component is described recombined cytomegalovirus gp 52 protein.Be used for the proteic marker of mark reorganization gp52 and be selected from one or more of enzyme, fluorescent substance, Radioactive colloidal gold, ordinary method well-known to those skilled in the art is adopted in the preparation of marker.Described test kit also comprises the solid phase of sessile antibody, and solid phase can be a solid phase commonly used well-known to those skilled in the art, and for example polystyrene, microtiter plate, immunochromatography are with filter paper etc.

Preferably, test kit of the present invention adopts enzyme-labelled antigen, and wherein, bag is the 100ng/ hole by the concentration of anti-human IgM antibody, and the working concentration of enzyme-labelled antigen is 4mg/mL; Coat system is formed pH=9.6 by the carbonate buffering of 0.05mol/L; Closed system is formed pH=7.2 by 0.01mol/L PBS, 10% calf serum and 0.1% merthiolate; The enzyme-labelled antigen diluent is formed pH=7.2 by 0.01mol/L PBS, 10% calf serum and 0.1% merthiolate.

The invention also discloses described recombined cytomegalovirus gp 52 protein in preparation monoclonal antibody, many anti-application that reaches in the protein chip.

(3) beneficial effect

Adopt the diagnostic kit of recombined cytomegalovirus gp 52 protein preparation provided by the invention, compare, have advantages such as high specificity, sensitivity height, well satisfied the needs of cytomegalovirus infection clinical diagnosis with the similar test kit on the market.

Description of drawings

The gel electrophoresis figure of Fig. 1 pcr amplification product;

Fig. 2 is the structure schema of expression plasmid pET-28a-gp52;

Fig. 3 is the 15%SDS-PAGE electrophorogram, and wherein M represents Marker, 1 and 2 expression target proteins.

Embodiment

Following examples are used to illustrate the present invention, but are not used for limiting protection scope of the present invention.

The preparation of embodiment 1 recombined cytomegalovirus gp 52 protein

1.1 screening of cytomegalovirus (CMV) gp52 proteantigen epi-position and goal gene clone

(phosphoprotein 150, pp150) whole aminoacid sequences (GENEBANK, ACCESSION:M16022 by Computer Analysis HCMV phosphorprotein 150; VERSION:M16022.1; GI:330643) filter out the interior strong antigen epi-position of pp150 albumen, promptly from 273 amino acid of the 2nd amino acid to the.The initiate dna sequence of its gene fragment is agtttgcagtttatcggtctacag, and the termination dna sequence dna is gtcaaggagctgcgcatgtgcctt, designs the pcr amplification primer with this:

Upstream primer: 5 ' CGGGATCCGCCAGCCGCAACGGTCTG contains Xho I restriction enzyme site;

Downstream primer: 5 ' CGAATTCTTACGTTACAGAATCCTCGCT contains EcoRI restriction enzyme site and TAA termination codon.

Get the supernatant liquor of 0.5ml CMV cell cultures, add 50 μ l Proteinase K (10mg/ml, available from sigma company), to 50 ℃ of digestion 4h, (concrete operations are referring to " molecular cloning " third edition, Science Press with phenol/chloroform purifying behind the mixing, publish in August, 2002), with the CMV genomic dna is template, carries out pcr amplification with above-mentioned primer, and (50 μ l) is as follows for amplification system:

ddH ₂O 35.3μl

10×buffer 5.0μl

dNTP 4.0μl

Upstream primer 2.0 μ l

Downstream primer 2.0 μ l

Template DNA 1.5 μ l

Taqplus 0.2μl(1U)

Amplified production detects through agarose gel electrophoresis, and the result as shown in Figure 1.Cutting contains the blob of viscose of target DNA band, and (lead to-Beijing TAKARA company name of product available from the six directions: TAKARA MiniBEST Plasmid purification) reclaim target DNA, operation is undertaken by product description with DNA fast purifying test kit.

1.2 the structure of expression vector pET-28a-gp52 and evaluation

Connection carrier pET-28a plasmid (available from magnificent Bioisystech Co., Ltd) has the kalamycin resistance, and carries Xho I, EcoRI restriction enzyme site.The pET-28a plasmid is transformed JM109 competent cell (available from magnificent Bioisystech Co., Ltd), choose single bacterium colony and cultivate, and with alkaline lysis extracting plasmid (concrete operations referring to " molecular cloning " third edition, Science Press, in August, 2002 publication).

Through Xho I and EcoRI enzyme double digestion, enzyme is cut system and is (50 μ l) with the goal gene of being cloned in pET-28a plasmid and 1.1:

10×buffer 5.0μl

Enzyme is cut substrate (pET-28a plasmid or clone's goal gene) 12 μ l

Xho I 15U

EcoRI 15U

DdH ₂O supplies 50 μ l.

Take out behind 37 ℃ of water-bath 6h, reclaim the enzyme of pET-28a plasmid and goal gene respectively and cut product (operation is reacted with the recovery in 1.1).

Carry out ligation then, linked system (20 μ l) is:

ddH ₂O 15.0μl

10×buffer 2.0μl

PET-28a plasmid enzyme restriction product 2.0 μ l

The goal gene enzyme is cut product 1.0 μ l

T ₄Dna ligase 20U.

Mixing, centrifugal behind the application of sample according to the above ratio, 14-16 ℃ of connection spent the night.The expression plasmid building process as shown in Figure 2.

From liquid nitrogen container, get 1 pipe JM109 competent cell (available from magnificent Bioisystech Co., Ltd) thawing and be placed on 10min in the ice-water bath.Get the above-mentioned connection product of 10 μ l and be incorporated in the 100 μ l escherichia coli jm109 competent cells, mixing carries out following processing: 0 ℃ of 30min, 42 ℃ of 2min, 0 ℃ of 2min successively.Add 400 μ l LB substratum then, mixing is at 37 ℃ of jog 45min; Centrifugal, discard 400 μ l supernatants, will precipitate suspension, mixing, shop LB agar plate (containing 50 μ g/ml kantlex) blots the back with the liquid on the flat board and is inverted, in 37 ℃ of overnight incubation.Get 1 μ l not the plasmid cut of enzyme do contrast, transform.The result connects and forms 83 bacterium colonies behind the product transformed competence colibacillus cell, 36 bacterium colony overnight incubation of random choose therefrom, alkaline lysis extracting plasmid.Select suspicious recombinant plasmid to carry out pcr amplification as template, the row agarose gel electrophoresis of going forward side by side, to recon plasmid that amplified production is arranged through Xho I and EcoRI double digestion, evaluation, the visible treaty 700bp DNA band of double digestion product that 3 recombinant plasmids are wherein arranged, then these 3 positive recons of recon.Select one to send match hundred victory companies order-checking from 3 positive recombinants, sequencing result shows and has inserted goal gene on this plasmid really, and direction of insertion is correct, with this recombinant plasmid called after expression plasmid pET-28a-gp52.

1.3 the structure of the proteic engineering bacteria of express recombinant gp52

With expression plasmid pET-28a-gp52 transformed into escherichia coli BL21 competent cell (available from magnificent Bioisystech Co., Ltd), shop LB agar plate (containing 50 μ g/ml kalamycins) is in 37 ℃ of overnight incubation.Choose single bacterium colony then in LB liquid nutrient medium (containing 50 μ g/ml kalamycins), 37 ℃ of overnight incubation.1% inoculum size is inoculated in fresh LB liquid nutrient medium (containing 50 μ g/ml kalamycins) by volume again, and 37 ℃ are cultured to logarithmic phase, add 0.4mmol/L IPTG and induce 4h.Induce thalline to analyze with 15%SDS-PAGE, the result expresses the proteic bacterial strain of gp52 and is required engineering strain as shown in Figure 3, with the freezing preservation of glycerine.

1.4 proteic preparation of recombinant C MV gp52 and purifying

Induce and expression condition optimization 1.4.1CMV gp52 is proteic

The engineering strain of going bail for and depositing melts, and transfering loop is got bacterium liquid streak inoculation LB agar plate (containing 50 μ g/ml kantlex), 37 ℃ of overnight incubation.Choose single bacterium colony in 5ml LB substratum (containing 50 μ g/ml kantlex), 37 ℃ of overnight incubation, 1% inoculum size is inoculated in 5ml LB substratum (containing 50 μ g/ml kantlex) by volume, 37 ℃ are cultured to logarithmic phase, different culture test tubes add different IP TG concentration induces, and induced concentration is respectively 0mmol/L, 0.2mmol/L, 0.4mmol/L, 0.6mmol/L, 0.8mmol/L, 1.0mmol/L.37 ℃ are continued to cultivate 3h, and centrifugal collection thalline is analyzed tropina with 15% SDS-PAGE.The result determines that with the expression amount maximum of 0.4mmol/L IPTG and 1.0mmol/L IPTG abduction delivering gp52 the IPTG induced concentration is 0.4mmol/L.

With the bacterium liquid of above-mentioned single bacterium colony incubated overnight by volume 1% inoculum size be inoculated in 20ml LB substratum (containing 50 μ g/ml kantlex), 37 ℃ are cultured to logarithmic phase, add IPTG 0.4mmol/L, 37 ℃ of cultivations, get 1.5ml bacterium liquid respectively at 0h, 1h, 2h, 3h, 4h, 5h, centrifugal collection thalline is analyzed tropina with 15% SDS-PAGE.Result's demonstration induces the 4h effect best.Induce 4h with 0.4mmol/L IPTG, the amount of the gp52 of expression accounts for the proteic 20-25% of whole cell.

CMV gp52 protein expression: inducing culture 100ml engineering bacteria as stated above, inductive condition is above-mentioned definite condition.The centrifugal 5min of 5000rpm, every g bacterium weight in wet base adds 3ml lysis buffer liquid [Tris.Cl (pH8.0) 50mmol/L, EDTA 1mmol/L, NaCl 100mmol/L], adds N,O-Diacetylmuramidase to 0.3mg/ml, and PMSF to 0.1mmol/L stirs 20min therebetween; The ultrasonic disruption thalline, power 50W, ultrasonic 1min, gap 1min, ultrasonic 10 times altogether; 4 ℃ of centrifugal 15min of 12000rpm, supernatant is a soluble part, is precipitated as inclusion body.With 2ml solubilization of inclusion bodies liquid [8M urea, 50mmol/LTris.Cl (pH8.0)] dissolving inclusion body.Get ultrasonic cleer and peaceful each 0.1ml of solubilization of inclusion bodies liquid supernatant of going up respectively, add 0.1ml 2 * SDS sample loading buffer, mixing, boiling water bath 3min analyzes with 15% SDS-PAGE.Proteins gel electrophoresis shows in inclusion body and the solubilization of inclusion bodies supernatant liquor a large amount of gp52.

1.4.2 the proteic purifying of CMV gp52

Shaking table shaking culture 2L bacterium liquid can obtain about 13.6g thalline, be used for the purifying preliminary experiment, determine that through experiment gp52 preparation technology is: induce bacterium liquid at the centrifugal 5min of 5000rpm, every g bacterium weight in wet base adds 3ml lysis buffer liquid [Tris.Cl (pH8.0) 50mmol/L, EDTA 1mmol/L, NaCl 100mmol/L], add N,O-Diacetylmuramidase to 0.3mg/ml, PMSF to 0.1mmol/L constantly stirs 20min therebetween; The ultrasonic disruption thalline, power 300W, ultrasonic 20sec, gap 20sec, ultrasonic 80 times altogether; 4 ℃ of centrifugal 15min of 12000rpm abandon supernatant, and precipitation is respectively washed inclusion body 1 time with the lysis buffer that contains 1% Triton-X100,2% Triton-X100,2% Triton-X100 respectively.20mmol/L Tris.Cl/8 M urea (pH8.0) dissolving inclusion body is put 4 ℃ to most of solubilization of inclusion bodies, descends 12 at 4 ℃ then, and the centrifugal 15min of 000rpm collects supernatant.

20mmol/L Tris.Cl/8 M urea (pH8.0) DEAE-52 counterion exchange column is splined on the DEAE-52 ion exchange column with solubilization of inclusion bodies liquid supernatant; Last sample finishes, and with the abundant unconjugated albumen of flush away of 20mmol/L Tris.Cl/8 M urea (pH8.0), uses 0.1M-0.3M NaCl gradient elution then, collects albumen simultaneously.The solution of the corresponding collection tube of SDS-PAGE electrophoresis detection elution peak, the collection tube that contains target protein merges, behind the dialysis desalting, go up the PEI ion column again, with 0.1M-0.5M NaCl gradient elution, 15% SDS-PAGE detects elution peak, contains the more and purer collection tube of target protein and merges, dialysis desalination renaturation.

1.5 the proteic character calibrating of recombinant C MV gp52

The Lowry method is surveyed protein concentration: engineering bacterium fermentation is cultivated, and the 13L nutrient solution can obtain 359.97g thalline weight in wet base, and the purified 447.5mg purity that obtains is at the reorganization gp52 albumen more than 90%.

Reorganization gp52 purity of protein: 20 μ l gp52 purified products add equal-volume 2 * sds gel sample loading buffer [SDS 4%, tetrabromophenol sulfonphthalein 0.2%, glycerine 20% for Tris.Cl (pH6.8) 100mM, DTT 200mM], boiling water bath 3min.Concentrate glue 5%, separation gel 12%; Continuous current 20mA electrophoresis.Application of sample amount 〉=10 μ g, gel is a protein band through coomassie brilliant blue staining and methyl alcohol-glacial acetic acid decolouring; Through scanning, the ratio that different crowd purifying gp52 account for total protein is respectively 96.2%, 97.14%, 95.8%.

High performance liquid phase is surveyed purity of protein: used instrument-chromatogram pump: Waters 600 Pump; Detector: PDA 966; Chromatographic column: Protein-pak 300SW; Chromatographic working station: Millnnium 2010.Testing conditions-detection wavelength: 280nm; Flow velocity: 0.5ml/min; Applied sample amount: 20 μ l; Moving phase: 0.05M phosphoric acid buffer; Sensitivity: 0.005 AUFS.It is respectively 97.5%, 97.3%, 97.1% that the area of its main peak of three crowdes of purifying gp52 accounts for the total area; 95% of main peak 〉=total area.

The ELISA method detects reorganization gp52 protein-specific: the giant cells infected patient serum of Italian import reagent box detects total susceptibility and is respectively 69.0%, 75.2%, and the reorganization gp52 Protein Detection serological specificity that the present invention obtains is respectively 97.1%, 94.3%.

The preparation of embodiment 2 cytomegalovirus IgM antibody detection kit and performance calibrating

2.1 the preparation of cytomegalovirus IgM antibody detection kit

The substrate that the reorganization gp52 albumen that embodiment 1 is made prepares as the test kit enzyme-labelled antigen is measured CMV IgM antibody with the ELISA method.

The development of this test kit and use as follows:

1) test kit principle: this strain is wrapped the microwell plate of quilt with anti-people IgM (μ chain), horseradish peroxidase (HRP) marker gene engineering recombined cytomegalovirus (CMV) antigen is tracer, the TMB Color Appearance System is used the anti-cytomegalovirus IgM antibody in prize law principle detection human serum or the blood plasma.

2) the main moiety of test kit:

A. wrap by plate in advance

B. enzyme conjugates

C. negative control

D. positive control

E. concentrate washing lotion (20 *)

F. substrate solution A

G. substrate solution B

H. stop buffer

3) test kit performance optimization:

Measure the best bag quilt and the enzyme-labelled antigen concentration of ELISA method of the present invention according to maximum combined, result such as table 1,2 can be found out by The above results, and bag is the 100ng/ hole by anti-people IgM (μ chain) antibody optimum concn, enzyme-labelled antigen best effort concentration 4mg/ml.

Table 1 optimum antibody bag is by the selection of concentration

Enzyme conjugates	Coated antibody concentration (ng/ hole)	Serum sample
								Positive
		1	Positive 2	Positive 3	Negative 1	Negative 2	Negative 3
5mg/ml	25							0.399	2.184	0.196	0.016	0.034	0.031
		50	0.787	2.421	0.382	0.018	0.067							0.048
	100							0.792	2.436	0.388	0.024	0.072	0.051
		200	0.794	2.369	0.387	0.045	0.081							0.057

The selection of table 2 enzyme-labelled antigen working concentration

Coated antibody concentration (ng/ hole)	Enzyme conjugates (mg/ml)	Serum sample
								Positive
		1	Positive 2	Positive 3	Negative 1	Negative 2	Negative 3
100	1							0.401	2.321	0.215	0.018	0.049	0.033
		2	0.769	2.380	0.377	0.022	0.065							0.050
	4							0.776	2.379	0.381	0.023	0.069	0.053
		8	0.783	2.387	0.386	0.031	0.074							0.057

According to three kinds of different coat system sensitivity, specificity and homogeneity result relatively, select the antibody sandwich buffering system, the results are shown in Table 3.The carbonate buffer solution coat system overall target of pH value 9.6 is more better than other two kinds of coat systems, therefore determines the coat system of carbonate buffer solution for test kit of the present invention.

The every performance index of the different coat systems of table 3 relatively

Coat system	The PH value	The sensitivity determination result			Specific assay result			Homogeneity
									Positive
		1	Positive 2	Positive 3	Negative 1	Negative 2	Negative 3	CV％
0.05mol/l, pH9.6 carbonate buffer system system	9.6								0.783	2.561	0.378	0.024	0.072	0.051	6.7％
		0.1mol/l, the pH7.2 phosphatebuffer buffer system	7.2	0.536	2.054	0.321	0.028	0.086								0.064	8.6％
0.05mol/l, pH8.0 Tris buffering system	8.0								0.532	2.123	0.301	0.035	0.094	0.074	6.2％

According to three kinds of different closed system sensitivity, specificity and homogeneity result relatively, select antibody sealing buffering system, the results are shown in Table 4.The damping fluid closed system overall target that contains calf serum is more better than other two kinds of coat systems, therefore determines to contain the closed system of the damping fluid closed system of calf serum for test kit of the present invention.

The every performance index of the different closed systems of table 4 relatively

Closed system	The PH value	The sensitivity determination result			Specific assay result			Homogeneity
									Positive
		1	Positive 2	Positive 3	Negative 1	Negative 2	Negative 3	CV％
PH7.2 0.01mol/l PBS, 0.2%BSA, 0.1% merthiolate	7.2								0.645	2.132	0.326	0.025	0.089	0.056	9.8％

PH7.2 0.01mol/l PBS, 0.2 % casein, 0.1% merthiolate	7.2	0.456	1.986	0.236	0.021	0.078	0.049	6.9％
									PH7.2 0.01mol/l PBS, 10% calf serum, 0.1% merthiolate	7.2	0.794	2.523	0.367	0.018	0.081	0.052	7.7％

Reach enzyme-labelled antigen thermostability comparative result according to the sensitivity of three kinds of different enzyme-labelled antigen diluents, specificity, variability, select antibody sealing buffering system, the results are shown in Table 5.The enzyme mark Laemmli buffer system Laemmli that contains calf serum is better to the thermostability provide protection of enzyme-labelled antigen; overall target is more better than other two kinds of coat systems, therefore selects for use the enzyme-labelled antigen damping fluid that contains 10% calf serum as test kit of the present invention enzyme-labelled antigen diluent.

The every performance index of the different enzyme-labelled antigen dilution systems of table 5 relatively

The enzyme-labelled antigen dilution system	Storage temperature	The sensitivity determination result			Specific assay result			Homogeneity
									Positive
		1	Positive 2	Positive 3	Negative 1	Negative 2	Negative 3	CV％
PH7.2 0.01mol/l PBS, 0.5%BSA, 0.1% merthiolate	4℃								0.654	2.012	0.295	0.033	0.102	0.056	8.6％
		37 ℃ 3 days	0.467	1.654	0.235	0.015	0.081	0.045								8.1％
	PH7.2 0.01mol/l PBS, 0.5% casein, 0.1% merthiolate								4℃	0.756	2.326	0.351	0.024	0.098	0.064		9.3％
37 ℃ 3 days		0.542	1.987	0.265	0.017	0.067	0.053	5.9％
									PH7.2 0.01mol/l PBS, 10% calf serum, 0.1% merthiolate	4℃	0.794	2.523	0.367	0.018	0.081	0.052	7.7％
37 ℃ 3 days	0.785	2.423	0.356	0.016	0.065	0.046	6.8％

4) preparation of test kit

The preparation of Sptting plate: wrap by blank plate with anti-people IgM (μ chain) antibody sandwich liquid (anti-people IgM (μ chain) antibody 100ng/ hole, 0.05mol/l, pH9.6 carbonate buffer system system), 100 μ l/ holes, 4 ℃ left standstill 16～24 hours.After the washing button is done, add confining liquid (PH7.2 0.01mol/l PBS, 10% calf serum, 0.1% merthiolate) 200 μ l/ holes, 37 ℃ left standstill 2 hours.Abandon liquid, the encapsulation of dry back.

The preparation of enzyme conjugates: enzyme mark binding substances strength of solution 4mg/ml, pH7.2 0.01mol/l PBS, 10% calf serum, 0.1% merthiolate buffering system.

5) test kit working method:

Balance: test kit is taken out from cold storage environment, put equilibrium at room temperature and use after 30 minutes.

Dosing: will concentrate washing lotion with distilled water or 20 times of diluted for use of deionized water.

Set: each test should be preset blank 1 hole (wouldn't add any liquid), negative control 3 holes, positive control 2 holes.

Application of sample: in each reacting hole, add the contrast of 20 μ l sample to be checked and positive and negative in order respectively.

Enzyme-added: as to add 100 μ l enzyme conjugates (the blank hole does not add) to every hole successively, the vibration mixing.

Incubation: on Sptting plate, add a cover the shrouding film, put in 37 ℃ of incubators or the water-bath, reacted 60 minutes.

Wash plate: liquid in the hole is dried, and the washings 300 μ l after each reacting hole adds dilution left standstill for 15 seconds, got rid of and abandoned washings; So washing is 5 times, detains the dry reaction plate for the last time.

Colour developing: every hole adds substrate A, each 50 μ l (comprising the blank hole) of B liquid successively, adds a cover the shrouding film, the vibration mixing, and 37 ℃ of lucifuges developed the color 15 minutes.

Stop: every hole adds each 50 μ l (comprising the blank hole) of stop buffer, vibration mixing termination reaction.

Measure:, and measure each hole OD value with the single wavelength 450nm of microplate reader as early as possible with the zeroing of blank hole.Also available dual wavelength 450nm/630-690nm measures each hole OD value.

Test-results is judged:

Threshold value (cut-off value) is calculated:

Threshold value=0.10+ negative control OD mean value (calculate by 0.05 negative control OD mean value≤0.05).

The result judges: when measuring sample OD value 〉=threshold value is anti-CMV antibody positive.

When measuring sample OD value＜threshold value is anti-CMV negative antibody.

2.2 test kit Performance Detection experiment

Specificity (accuracy) is measured: catch the ELISA measuring method by what previous experiments was determined, detect several other serum materials, the observing response specificity.The result shows, uses test kit of the present invention to detect 15 parts of negative serums (clinical definite), and coincidence rate is 100%; Detect 50 parts of Rheumatoid factors, polyclonal positive serum samples, 50 parts of hepatitis C positive serum samples, 50 parts of syphilis positive serum samples etc., none positive shows that Rheumatoid factors, polyclonal etc. can not cause the false positive of test kit substantially, and specificity is fine.

Sensitivity (specificity) is measured: catch the ELISA measuring method by what previous experiments was determined, detect the susceptibility of this test kit.Use test kit of the present invention to detect 15 parts of positive serums (clinical definite), coincidence rate is 100%.

Accuracy is measured: catch the ELISA measuring method by what previous experiments was determined, detect the accuracy of this test kit.Use test kit of the present invention that positive control, the negative control of 2 parts of anti-CMV strong positive serum, 1 part of positive serum, 1 part of negative serum and test kit are carried out every plate diplopore, the detection of totally 10 plates, result such as table 6, as seen the repeatability of test kit is good, and the CV that different serum are detected all is lower than 15%.

The accuracy of table 6 test kit

Serum	Average OD	Maximum OD	Minimum OD	CV(％)
					Strong positive 1	3.813	4.0	3.235	2.5
Strong positive 2	3.321	3.988	2.879	4.7
					Positive 1	2.335	2.687	1.854	9.3
Negative	0.012	0.123	0.001	6.3
					Positive control	2.673	3.120	2.015	7.2
Negative control	0.021	0.109	0.008	5.8

Comparison test with similar products at home and abroad: the comparative experiments result such as the table 7 of test kit of the present invention and 1430 parts of serum samples of Italian SORIN company's test kit detection.

The comparison detected result of table 7 and Italian SORIN company antibody assay kit

Beijing is now greatly up to CMV detection kit result	Italy SORIN company test kit detected result		Add up to
				Positive	Negative
	Positive negative the total	174 16 190				12 1228 1240	186 1244 1430

Verity and predictive value's computational analysis: sensitivity 91.6%, specificity 99.0%, false positive rate 0.97%, false negative rate 1.29%, crude agreement 98.0%.Show sensitivity of this test kit and the standard that specificity all reaches even be better than the import reagent box.

Sequence table

110〉Beijing modern times are up to Bioisystech Co., Ltd

＜120〉a kind of recombined cytomegalovirus gp 52 protein and application thereof

<130>GD0701

<160>2

<170>PatentIn version 3.3

<210>1

<211>726

<212>DNA

＜213〉cytomegalovirus (cytomegalovirus)

<400>1

agtttgcagt ttatcggtct gcagcgtcgc gatgtggtag ccctggtcaa ctttctgcgc 60

catctcacgc aaaagccgga cgtggatctc gaggcacacc cgaagatcct gaaaaaatgt 120

ggcgaaaaac gcctgcaccg tcgtacggtg ctgttcaacg agctcatgct ttggttgggc 180

tactaccgcg agctgcgttt tcacaacccg gacctctcct cagtgctcga ggagttcgag 240

gtgcgttgcg tggccgtggc gcgtcgcggc tacacttacc cgttcggtga tcgtggtaag 300

gcgcgtgacc acctggctgt gctggaccgt accgaattcg atacggacgt gcgccacgat 360

gccgagatcg tggaacgcgc gctcgtaagc gcggtcattc tggccaagat gtcggtgcgc 420

gagacgctgg tcaccgccat cggccagacg gaaccgatcg cctttgtgca cctcaaggat 480

acggaggtgc agcgcattga agaaaacctg gagggtgtgc gccgtaacat gttctgcgtg 540

aaaccgctcg accttaacct ggaccgtcac gccaacacgg cgctggtcaa cgccgtcaac 600

aagctcgtgt acacgggccg tctcatcatg aacgtgcgcc gttcttggga ggagctggag 660

cgcaaatgtc tggcgcgcat tcaggagcgc tgcaagctgc tggtcaagga gctgcgcatg 720

tgcctt 726

<210>2

<211>242

<212>PRT

＜213〉cytomegalovirus (cytomegalovirus)

<400>2

Ser Leu Gln Phe Ile Gly Leu Gln Arg Arg Asp Val Val Ala Leu Val

1 5 10 15

Asn Phe Leu Arg His Leu Thr Gln Lys Pro Asp Val Asp Leu Glu Ala

20 25 30

His Pro Lys Ile Leu Lys Lys Cys Gly Glu Lys Arg Leu His Arg Arg

35 40 45

Thr Val Leu Phe Asn Glu Leu Met Leu Trp Leu Gly Tyr Tyr Arg Glu

50 55 60

Leu Arg Phe His Asn Pro Asp Leu Ser Ser Val Leu Glu Glu Phe Glu

65 70 75 80

Val Arg Cys Val Ala Val Ala Arg Arg Gly Tyr Thr Tyr Pro Phe Gly

85 90 95

Asp Arg Gly Lys Ala Arg Asp His Leu Ala Val Leu Asp Arg Thr Glu

100 105 110

Phe Asp Thr Asp Val Arg His Asp Ala Glu Ile Val Glu Arg Ala Leu

115 120 125

Val Ser Ala Val Ile Leu Ala Lys Met Ser Val Arg Glu Thr Leu Val

130 135 140

Thr Ala Ile Gly Gln Thr Glu Pro Ile Ala Phe Val His Leu Lys Asp

145 150 155 160

Thr Glu Val Gln Arg Ile Glu Glu Asn Leu Glu Gly Val Arg Arg Asn

165 170 175

Met Phe Cys Val Lys Pro Leu Asp Leu Asn Leu Asp Arg His Ala Asn

180 185 190

Thr Ala Leu Val Asn Ala Val Asn Lys Leu Val Tyr Thr Gly Arg Leu

195 200 205

Ile Met Asn Val Arg Arg Ser Trp Glu Glu Leu Glu Arg Lys Cys Leu

210 215 220

Ala Arg Ile Gln Glu Arg Cys Lys Leu Leu Val Lys Glu Leu Arg Met

225 230 235 240

Cys Leu

Claims (10)

1, a kind of recombinant DNA of the cytomegalovirus gp 52 protein of encoding, its nucleotide sequence is shown in SEQ IDNO:1.

2, a kind of recombined cytomegalovirus gp 52 protein is characterized in that it by the described recombinant DNA sequence coding of claim 1, and its aminoacid sequence is shown in SEQ ID NO:2.

3, a kind of expression vector pET-28a-gp52 of recombined cytomegalovirus gp 52 protein is characterized in that it is that the described recombinant DNA sequence of claim 1 is inserted into the recombinant plasmid that obtains on the plasmid pET-28a, and its plasmid map as shown in Figure 1.

4, a kind of engineering strain of express recombinant cytomegalovirus gp 52 protein is characterized in that it contains the described expression vector pET-28a-gp52 of claim 3, and the host bacterium is intestinal bacteria.

5, a kind of test kit that detects cytomegalovirus infection is characterized in that the antigen in the component is reorganization gp52 albumen according to claim 2.

6, test kit according to claim 5, it is characterized in that wrapping by the concentration of anti-human IgM antibody is the 100ng/ hole, the working concentration of enzyme-labelled antigen is 4mg/mL.

7, test kit according to claim 5 is characterized in that coat system forms pH=9.6 by the carbonate of 0.05mol/L buffering.

8, test kit according to claim 5 is characterized in that closed system forms pH=7.2 by 0.01mol/L PBS, 10% calf serum and 0.1% merthiolate.

9, test kit according to claim 5 is characterized in that the enzyme-labelled antigen diluent forms pH=7.2 by 0.01mol/L PBS, 10% calf serum and 0.1% merthiolate.

10, recombined cytomegalovirus gp 52 protein according to claim 2 is in preparation monoclonal antibody, many anti-application that reaches in the protein chip.

Images