CN101050239A - Interfusion protein between diphtheria toxin and GM CSF mutant, coded gene and application - Google Patents

Abstract

This invention discloses fusion protein of diphtherin and GM-CSF, its coding gene, and its application. The fusion protein is selected from: (a) the protein shown in SEQ ID No.2; (b) the protein derived from SEQ ID No.2 by substituting, deleting and/or adding one or more amino acid residues, which can kill acute myeloid leukemia cells. The fusion protein can kill target cells, and has a high expression level.

Description

The fusion rotein of diphtheria toxin and GM-CSF and encoding gene thereof and application

Technical field

The present invention relates to fusion rotein and encoding gene and the application of diphtheria toxin and GM-CSF.

Background technology

(Acute Myeloid Leukemia is the high leukemia of sickness rate second among the highest, the children of sickness rate among the adult AML) to acute myeloid leukemia, and U.S.'s expection in 2006 new cases are 11,930 examples.Drug effect with chemotherapeutics such as cytosine arabinoside treatment AML is remarkable at present, and complete remission rate can reach 70%.But the Most patients long-term prescription produces resistance, finally can die from recurrence or treatment syndrome (complication of treatment).Number is several weeks or some months in recurrence and intractable AML patient's the survival, therefore is badly in need of avoiding the newtype drug multidrug resistance phenotype, that have unique treatment mechanism.At present known to 88%AML patient's leukemia cell surface overexpression granulocyte-macrophage colony stimutaing factor (Granulocyte Macrophage ColonyStimulating Factor, GM-CSF) high-affinity receptor (GM-CSFReceptor, GM-CSFR), and the normal hematopoiesis progenitor cell in the marrow, the pluripotential hemopoietic stem cell surface finds no GM-CSFR (Hogge DE, WillmanCL, Kreitman RJ, Berger M, Hall PD, Kopecky KJ, McLain C, Tagge EP, EavesCJ, Frankel AE.Malignant progenitors from patients with acute myelogenousleukemia are sensitive to a Diphtheria Toxin-Granulocyte-MacrophageColony-Stimulating Factor fusion protein.Blood, 1998,92 (2): 589-595).Therefore, GM-CSFR may become the drug targets of specific treatment AML.

Immunotoxin is as the targeted therapy medicine, utilizes targeting parts identification such as antibody, cytokine and in conjunction with specific target cell surface, after endocytosis entered cell, effects of toxins was partly brought into play its cytotoxicity, thus the specific killing target cell.Diphtheria toxin (Diphtheria toxin, DT) be a kind of biotoxin efficiently, total length 535aa, molecular weight are 58,330Da, it is enzymic activity district (Catalytic Domain, C district, DTA fragments) that structure can be divided into 3 structural domain independent of each other: N end 1-193aa, 205-378aa is transmembrane transport district (TransmembraneDomain, the T district), 386-535aa is cell-membrane receptor land (Receptor Binding Domain, a Zone R).These 3 structural domains do not intersect on primary structure, and are independently of one another on the tertiary structure yet.When preparation fusion protein immunization toxin, preserve C and T district, and Zone R is replaced with ligand molecular.The mechanism of cell is destroyed DNA with the traditional treatment medicine or fissional mechanism is different because diphtheria toxin para-immunity toxin is killed, be that ADP ribosyltransferase activity by the C district makes the protein translation elongation factor EF2 inactivation in the eukaryotic cell rrna, the accurate translation that suppresses cell protein, and the apoptosis of finally inducing target cell, so diphtheria toxin para-immunity toxin has the specific killing effect to tumour cell recurrence, anti-chemotherapeutics.At present unique immunotoxin through the drugs approved by FDA listing has promptly adopted the diphtheria toxin of brachymemma and the fusion rotein (DAB of IL2 ₃₉₀-IL2).Therefore, with GM-CSFR the targeted drug specific killing AML cell effectively of target, the hemopoietic function to body does not cause major injury simultaneously, thereby is expected to provide a kind of medicine novel, high specific for AML patient.Though clinical trial at present shows DT ₃₈₈-GMCSF has 10% validity, but the immunotoxin of finding the DT-GMCSF form has 2 important shortcomings: at first, its expression amount in intestinal bacteria is very low, be unfavorable for a large amount of suitability for industrialized production (Williams MD, Rostovtsev A, Narla RK, Uckun FM.Production of recombinant DT _CtGMCSF fusiontoxin in a baculovirus expression vector system for biotherapy ofGMCSF-receptor positive hematologic malignancies.Protein expr purif, 1998,13:210-221).Though someone finds can obtain high expression level in baculovirus expression system, owing to still there is not the approval that the protein drug of baculovirus expression obtains FDA up to now, the resistance ratios that may continue to develop is bigger.Secondly, in clinical study, find to have liver toxicity, may be that the withered of liver has the GMCSF acceptor and damage (the Frankel AE that causes than cell, Powell BL, Hall PD, Case LD, Kreitman RJ.Phase I trialof a novel diphtheria toxin/granulocyte macrophage colony-stimulating factorfusion protein (DT388GMCSF) for refractory or relapsed acute myeloid leukemia.Clin Cancer Res, 2002,8 (5): 1004-13; Westcott MM, Abi-Habib RJ, Cohen KA, Willingham MC, Liu S, Bugge TH, Leppla SH, Frankel AE.Diphtheria toxin-murinegranulocyte-macrophage colony-stimulating factor-induced hepatotoxicity ismediated by Kupffer cells.Mol Cancer Ther.2004,3 (12): 1681-9), so still need albumen is improved, to reduce intravital toxicity.

Summary of the invention

An object of the present invention is to provide fusion rotein and the encoding gene thereof of diphtheria toxin and GM-CSF.

The fusion rotein of diphtheria toxin provided by the present invention and GM-CSF, name is called GMCSF-DT ₃₈₆, be following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 2;

(b) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and to have an acute myeloid leukemia cell of killing and wounding active by (a) deutero-protein.

Wherein, the sequence in the sequence table 2 is made up of 520 amino-acid residues.The 1st-128 amino acids residue of N-terminal from sequence 2 is GM-CSF, is linker from the 129th-134 amino acids residue of N-terminal of sequence 2, is the diphtheria toxin fragment from the 135th-520 amino acids residue of N-terminal of sequence 2.

The replacement of described one or several amino-acid residue and/or disappearance and/or interpolation are meant and replace in the 1st-14 amino acids residue site of N-terminal of sequence 2 and/or lack and/or add.

Fusion rotein encoding gene (the GMCSF-DT of above-mentioned diphtheria toxin and GM-CSF ₃₈₆) also belong to protection scope of the present invention.

The encoding gene of the fusion rotein of described diphtheria toxin and GM-CSF, its nucleotide sequence are the proteinic polynucleotide of sequence 2 in the code sequence tabulation.

The encoding sequence of the encoding gene of the fusion rotein of described diphtheria toxin and GM-CSF can be the nucleotide sequence from 5 ' terminal the 1st to 1563 deoxyribonucleotides composition of sequence 1 in the sequence table.

The encoding gene of the fusion rotein of described diphtheria toxin and GM-CSF specifically can be following 1) or 2) gene:

1) its nucleotide sequence is the sequence 1 in the sequence table;

2) under stringent condition with 1) dna molecular of the dna sequence dna hybridization that limits and the fusion rotein of coding diphtheria toxin and GM-CSF.

Described stringent condition can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS,, and wash film with this solution 65 ℃ of hybridization down.

Sequence 1 in the sequence table is made up of 1563 deoxyribonucleotides.

Recombinant expression vector, transgenic cell line and the transformed host bacterium of encoding gene that contains the fusion rotein of above-mentioned diphtheria toxin and GM-CSF all belongs to protection scope of the present invention.

Another object of the present invention provides a kind of method of expressing the fusion rotein of above-mentioned diphtheria toxin and GM-CSF.

The method of the fusion rotein of above-mentioned diphtheria toxin of expression provided by the present invention and GM-CSF, it is fusion rotein encoding gene insertion procaryotic cell expression carrier with above-mentioned diphtheria toxin and GM-CSF, acquisition contains the recombinant expression vector of encoding gene of the fusion rotein of described diphtheria toxin and GM-CSF, again described recombinant expression vector is imported intestinal bacteria, screening obtains expressing the engineering cell of the fusion rotein of described diphtheria toxin and GM-CSF, cultivate described engineering cell, express the fusion rotein that obtains above-mentioned diphtheria toxin and GM-CSF.

Described procaryotic cell expression carrier can be existing can be at the carrier of expression in escherichia coli foreign gene, as pSE420, pET3a, pET11a, pET22a, pET30a, pRSET, pDOGA, pBV220.

Described intestinal bacteria can be colibacillus DH5 α, E.coli TB1 or E.coli BL21 (DE3) etc.

When described expression vector is pSE420, the fusion rotein encoding gene of described diphtheria toxin and GM-CSF inserts NcoI and the BamHI site of pSE420, described intestinal bacteria be e. coli bl21 (DE3, pLysS).

The present invention has obtained highly purified GMCSF-DT by Q-SepharoseFF ion-exchange chromatography and Superdex75 gel permeation chromatography purifying ₃₈₆, (P1, P2), purity reaches more than 90% to obtain two protein peaks with specific killing HL60 cytoactive.

The fusion rotein GMCSF-DT of diphtheria toxin of the present invention and GM-CSF ₃₈₆, expression amount height not only, the activity that has also kept killing and wounding target cell simultaneously.The fusion rotein GMCSF-DT of diphtheria toxin of the present invention and GM-CSF ₃₈₆, higher expression is arranged, for the 10-15% of bacterial strain total protein, than DT in intestinal bacteria ₃₈₆-GMCSF albumen be can't see the situation of band of expression on SDS-PAGE, be greatly improved.

The fusion rotein GMCSF-DT of diphtheria toxin of the present invention and GM-CSF ₃₈₆But the specific killing surface has the HL60 cell of the GM-CSFR of a large amount of high-affinities, IC ₅₀Be 1～5 * 10 ^-8Mol/L (MTS method), and the specific killing activity is mediated by GM-CSF.Simultaneously, under effective concentration at HL60, GMCSF-DT ₃₈₆To not or have a small amount of GM-CSFR 293, the basic nontoxicity of cell such as Vero.Adopting the NOD/SCID mouse of serious immune deficiency, is HL60 by inoculating cell, has set up people AML animal model, and administration GMCSF-DT386, find that it has the leukemic activity in vivo of treatment, than contrast, the mouse survival time of 10 and 50 μ g/day dosage groups is significantly increased.

Experimental result shows that excessive GM-CSF can stop the specific killing activity of toxin to the HL60 cell.Therefore, at GMCSF-DT ₃₈₆In the molecule, that play targeting is GM-CSF, and it also combines with the high-affinity receptor identification of HL60 cell surface, and the endocytosis that causes by acceptor enters cell, becomes endosome.DT ₃₈₆Effect be that allosteric takes place in the transit zone under the low pH condition of endosome, form passage, enter in the endochylema of cell for the enzymic activity fragment, the performance enzymic activity, the expression of arrestin causes apoptosis, thereby kills and wounds target cell.This result of study shows, GMCSF-DT ₃₈₆The apoptosis phenomenon has taken place in the cell of handling, and is identical with the effect of diphtheria toxin.

The fusion rotein GMCSF-DT of diphtheria toxin of the present invention and GM-CSF ₃₈₆Can be used as activeconstituents, the medicine of preparation treatment acute myeloid leukemia.

When needing, in described medicine, can also add one or more pharmaceutically acceptable carriers.Described carrier comprises thinner, vehicle, weighting agent, tackiness agent, wetting agent, disintegrating agent, absorption enhancer, tensio-active agent, absorption carrier of pharmaceutical field routine etc.

Medicine of the present invention can be made various ways such as injection liquid, tablet, pulvis, granula, capsule, oral liquid.The medicine of above-mentioned various formulations all can be according to the ordinary method preparation of pharmaceutical field.

Those skilled in the art can determine dosage according to practical situation, as can be 1-50 μ g GMCSF-DT ₃₈₆/ kg body weight/day, successive administration or administration every other day, be 3-7 days the course of treatment.

Description of drawings

Fig. 1 is DT ₃₈₆The enzyme of-GMCSF gene clone, expression plasmid is cut qualification result

Fig. 2 A is DT ₃₈₆The SDS-PAGE result that-GMCSF expresses

Fig. 2 B analyzes DT for Western blot ₃₈₆-GMCSF purification of samples

Fig. 3 A is pcDNAII/GFN, pcDNAII/DT ₃₈₆The HB enzyme is cut the evaluation collection of illustrative plates

Fig. 3 B is pSE420/GMCSF-DT ₃₈₆Enzyme cut the evaluation collection of illustrative plates

Fig. 4 A is for transforming recombinant plasmid pSE420/GMCSF-DT ₃₈₆The SDS-PAGE result of e. coli expression product

Fig. 4 B is GMCSF-DT ₃₈₆The expression that goes down to posterity in intestinal bacteria

Fig. 5 is GMCSF-DT ₃₈₆The tomographic map of expression product purifying

Fig. 6 is GMCSF-DT ₃₈₆The 12%SDS-PAGE gel analysis collection of illustrative plates of two eluting peak samples of expression product

Fig. 7 is GMCSF-DT ₃₈₆The Western blot analytical results of two eluting peak samples of expression product

Fig. 8 is GMCSF-DT ₃₈₆12% non-sex change PAGE collection of illustrative plates of two eluting peak samples of expression product

Fig. 9 is GMCSF-DT ₃₈₆The gel scanning purity check result of two eluting peak samples of expression product

Figure 10 is GMCSF-DT ₃₈₆The curve of P1 components influence mouse survival time

Figure 11 is the fluidic cell detected result of experiment mice

Figure 12 is GMCSF-DT ₃₈₆Bring out the apoptotic morphologic observation of HL60

Figure 13 is GMCSF-DT ₃₈₆Concentration is to the influence of HL60 apoptosis ratio

Figure 14 is GMCSF-DT ₃₈₆Bringing out apoptotic dna ladder of HL60 detects

Figure 15 is GMCSF-DT ₃₈₆To the HL60 Cytoplasmic Ca ²⁺The influence of concentration

Figure 16 is GMCSF-DT ₃₈₆Influence to HL60 cell mitochondrial membrane potential Δ Ψ m

Figure 17 is GMCSF-DT ₃₈₆Influence to the HL60 internal pH

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

Percentage composition among the following embodiment if no special instructions, is the quality percentage composition.

Embodiment 1, diphtheria toxin and GM-CSF fusion rotein DT ₃₈₆The expression of-GMCSF

One, the fusion rotein DT of diphtheria toxin and GM-CSF ₃₈₆The expression of-GMCSF

1, DT ₃₈₆The structure of-GMCSF expression plasmid

Synthetic is by the ORF of the molecular human GM-CSF gene of intestinal bacteria preference password (this gene is called GM-CSFm), and (Invitrogen, EcoR V site V40020) obtains recombinant vectors pcDNAII-GMCSFm to insert pcDNAII.Wherein, the nucleotide sequence of the ORF of GM-CSFm is sequence 3 in the sequence table (sequence 3 is made up of 390 Nucleotide).

With pcDNAII-GMCSFm is template, with primer GFS that has the SphI restriction enzyme site and the primer GFP14 that has BamH I restriction enzyme site, carries out pcr amplification.PCR product length is about 400bp, and flush end connects insertion pcDNAII plasmid EcoR V site.To show through Sph I and Bam HI double digestion and the qualification result that checks order, the fragment of inserting have nucleotide sequence be sequence 3 in the sequence table (sequence 3 be the ORF of GM-CSFm, is made up of 390 Nucleotide) hold the 4th recombinant plasmid to be called pcDNAII/GMCSFmSB from 5 ' to the 387th deoxyribonucleotide.PcDNAII/GMCSFmSB is carried out Sph I, Bam HI double digestion, obtain the GM-CSFmSB fragment, reclaim and be stored in-20 ℃.Wherein, the nucleotide sequence of primer GFS is: 5 '＞GGCATGCGCCT GCTCGT＜3 ', the nucleotide sequence of primer GFP14 is: 5 '＞TGGATCCCTATCACGCTT＜3 '.Swimming lane 3 among the Sph I of pcDNAII/GMCSFmSB and Bam HI double digestion qualification result such as Fig. 1.

With plasmid pGEM/DT (Zhang Xinjian, Li Jing, Zhang Baoyun, Deng efficiently expressing and the research of cytotoxicity of. diphtheria toxin/IL-6. Acta Biochimica et Biophysica Sinica, 1998,30 (2): 169-173.) be template, carry out pcr amplification, introduce 1 His codon among the DTS with the primer DT1N, the DTS that have Nde I and Sph I restriction enzyme site respectively.Wherein, the nucleotide sequence of DT1N is: 5 '＞GTC ATA TGG GCG CTG ATG＜3 ', the nucleotide sequence of DTS is: 5 '＞TGG GCA TGC GTT TTA TG＜3 '.PCR product length is about 1.2kb, and flush end connects insertion pcDNAII plasmid EcoR V site.To show through Nde I and Sph I double digestion and order-checking qualification result, the fragment of insertion be have nucleotide sequence be sequence 1 from the 403rd DT of 5 ' end to the 1560th deoxyribonucleotide ₃₈₆The segmental recombinant plasmid of NS is called pcDNAII/DT ₃₈₆NS.To pcDNAII/DT ₃₈₆NS carries out Nde I and Sph I double digestion, reclaims DT ₃₈₆The NS fragment.Wherein, pcDNAII/DT ₃₈₆The swimming lane 2 of the Nde I of NS and Sph I double digestion qualification result such as Fig. 1.

Double digestion GM-CSFmSB fragment and DT with above-mentioned recovery ₃₈₆The NS fragment was with 1: 1 mixed, and orientation is inserted through the plasmid pET11a of NdeI and BamHI double digestion (Novagen), Transformed E .coli DH5 α.Will be through NdeI or BamHI single endonuclease digestion and NdeI and the correct recombinant expression plasmid called after pET11a/DT of BamHI double digestion evaluation ₃₈₆-GMCSF.PET11a/DT ₃₈₆The NdeI single endonuclease digestion qualification result of-GMCSF such as the swimming lane 5 among Fig. 1, pET11a/DT ₃₈₆The BamHI single endonuclease digestion qualification result of-GMCSF such as the swimming lane 6 among Fig. 1, pET11a/DT ₃₈₆Swimming lane 8 among the NdeI of-GMCSF and BamHI double digestion qualification result such as Fig. 1.Among Fig. 1, swimming lane 1,4,7 are respectively dna molecular amount standard DL2000, DL2000+DL15000, DL2000+DL15000 (Takara).PET11a/DT ₃₈₆The sequencing result of-GMCSF shows that this plasmid contains the DT that nucleotide sequence is a sequence 4 in the sequence table ₃₈₆-GMCSF gene.PET11a/DT ₃₈₆-GMCSF express amino acid sequence is the fusion rotein DT of sequence 5 in the sequence table ₃₈₆-GMCSF is the diphtheria toxin fragment from the 1st-387 amino acids residue of N-terminal of sequence 5, is linker from N-terminal the 388th amino acids residue of sequence 5, is GM-CSF from the 389th-516 amino acids residue of N-terminal of sequence 5.

2, DT ₃₈₆The expression of-GMCSF

With pET11a/DT ₃₈₆-GMCSF transformed into escherichia coli expression strain BL21 (DE3, plysS), the positive single colony inoculation of picking contains in the LB nutrient solution of microbiotic (100 μ g/ml penbritin) in 5ml, 37 ℃ of enlarged culturing, carry out abduction delivering as follows: bacterial classification contains in the LB nutrient solution of 100 μ g/ml penbritins in 5ml by the volume ratio transferred species of 2-5%, continues to be cultured to about OD ₆₀₀0.4-0.6, add final concentration and carry out abduction delivering for 1mmol/L IPTG, behind the 3-6h, 8, the centrifugal 5min of 000rpm collects thalline.According to document (Sa nurse Brooker J, Ritchie EF not, Manny A Disi T work. Jin Dongyan, Li Mengfeng translates. the molecular cloning experiment guide, second edition, Beijing: Science Press, 1992.) method of describing in prepares the SDS-PAGE sample: with PBS solution washing and resuspended thalline, add isopyknic 2 * SDS-PAGE sample preparation liquid, boil 5min.And carry out 12% SDS-PAGE electrophoretic analysis according to above-mentioned literature method, observe the protein expression situation.The result shows and do not see that obvious band of expression is arranged shown in Fig. 2 A, only Western blot analysis revealed in position, the 57kDa left and right sides visible faint target protein band.Among Fig. 2 A, swimming lane 1 is a protein molecular weight standard, and 2 for transforming recombinant plasmid pET11a/DT ₃₈₆The intestinal bacteria of-GMCSF do not carry out IPTG inductive expression product, and 3 for transforming recombinant plasmid pET11a/DT ₃₈₆The intestinal bacteria of-6MCSF carry out IPTG inductive expression product.

3, DT ₃₈₆The purifying of-GMCSF

With DT ₃₈₆-GMCSF expression strain carries out a large amount of abduction deliverings as follows: picking transforms the E.coli that expression plasmid is arranged and expresses the single bacterium colony of bacterium, is inoculated in 5ml and contains in the LB nutrient solution of 100 μ g/ml penbritins, and 37 ℃ of jolting overnight incubation are as first order seed.First order seed inserts the LB nutrient solution (500ml container) that 100ml contains 100 μ g/ml penbritins with 1% volume ratio, and 37 ℃ of jolting overnight incubation are as secondary seed.Secondary seed inserts the LB nutrient solution (5L container) that 2L contains 100 μ g/ml penbritins with 2～5% volume ratios, cultivates about 3h for 37 ℃, and to OD600 0.4～0.6, adding final concentration is the IPTG of 1mmol/L, continues to cultivate 6h.8,000rpm, 4 ℃ of centrifugal 10min collect thalline.Get wet thallus 10g, ultrasonication cell, centrifugal collection supernatant liquor.With sample on the supernatant liquor to Q-SepharoseFF ion exchange column (40ml, Pharmacia), A liquid (20mmol/LTris-HCl, 1mmol/L EDTA is after pH7.4) the drip washing balance, (B liquid is the A liquid that contains 1.0mol/L NaCl with A liquid and B liquid, pH7.4) carry out gradient elution, collect the elution peak of 25% (volume ratio) B liquid, carry out Western blot and analyze, the result shown in Fig. 2 B, visible 57kDa target protein band.Among Fig. 2 B, swimming lane 1-2 is the DT of Q-SepharoseFF reinforcing yin essence ion chromatography column purification ₃₈₆-GMCSF, swimming lane 3 is a protein molecular weight standard, 4 is diphtheria toxin-interleukin II (DAB ₃₈₉-IL2).Be used for determination of activity after the freeze-drying of Q-SepharoseFF purification of samples concentrated.

Wherein, it is one anti-that Western blot analyzes with diphtheria toxin A fragment (DTA) antibody, and according to document " Sa nurse Brooker J; Ritchie EF not; Manny A Disi T work. Jin Dongyan, Li Mengfeng translates. molecular cloning experiment guide, second edition; Beijing: Science Press, 1992. " in the method described carry out.Diphtheria toxin A fragment (DTA) and antibody thereof are according to document: " Ou Yangjing, Wang Jianwei, Wang Chunxiao, Guo Li; take off thick treasure, Cui Ting, turbulent waves. segmental expression and purification of diphtheria toxin A and Monoclonal Antibody; biotechnology journal, 2004,20 (5): 689-693 " in the method preparation described; Diphtheria toxin-interleukin II (DAB ₃₈₉-IL2) according to document: " Liu Yang, Wang Jianwei bend and found the state; Wang Chunxiao; turbulent waves. the diphtheria toxin-clonal expression of interleukin II reorganization chimeric toxin and the research of specific cell toxic action. and viral journal, 2001,17 (2): 117-121 " the middle method preparation of describing.

Two, GMCSF-DT _{386 expression}

1, GMCSF-DT ₃₈₆The structure of expression plasmid

With pcDNAII-GMCSFm is template, the primer GFNC1 (5 '＞TTTCCATGGCACCAGCTCGTTCTCCTT CTCCTTCTAC＜3 ') in band Nco I site carries out pcr amplification GMCSF fragment with the primer GFH2 (5 '＞TTTAAGCTTCCTGTACCGGTTCCCAGC＜3 ') that has Hind III site.The result is shown in swimming lane 1 among Fig. 3 A for pcr amplification GMCSFm fragment, shows that PCR product length is about 400bp, this PCR product is inserted the EcoR V site of pcDNAII.Nco I and Hind III double digestion and order-checking qualification result are shown, the fragment of insertion be have nucleotide sequence be sequence 3 in the sequence table (sequence 3 is made of the ORF of GM-CSFm 390 Nucleotide) hold the 1st recombinant plasmid to be called pcDNAII/GFN from 5 ' to the 384th deoxyribonucleotide.PcDNAII/GFN is carried out Nco I, Hind III double digestion, obtain GM-CSF fragment GFN.The Nco I of pcDNAII/GFN and Hind III double digestion result are shown in the swimming lane among Fig. 3 A 5.Among Fig. 3 A, swimming lane 2 is dna molecular amount standard DL2000, and swimming lane 4 is dna molecular amount standard DL2000+DL15000.

With plasmid pGEM/DT (Zhang Xinjian, Li Jing, Zhang Baoyun, Deng efficiently expressing and the research of cytotoxicity of. diphtheria toxin/IL-6. Acta Biochimica et Biophysica Sinica, 1998,30 (2): 169-173.) be template, carry out pcr amplification with primer LDTH (5 '＞TTTTCAAGCTTCTGGTGGTCCTGAGGGCGCT＜3 '), the DTB (5 '＞TGGGATCCTACGTTTTATG＜3 ') that has Hind III and Bam HI restriction enzyme site respectively with the Vent enzyme, wherein, LDTH has the junction fragment of one section 6 amino-acid residue.PCR result is shown in swimming lane 3 among Fig. 3 A, and PCR product length is about 1.2kb, this PCR product is inserted the EcoR V site of pcDNAII.To show that the fragment of insertion is to have the DT to the 1563rd deoxyribonucleotide from the 5 ' 383rd that nucleotide sequence is a sequence 1 through HindIII and BamHI double digestion and the qualification result that checks order ₃₈₆The segmental recombinant plasmid of HB is called pcDNAII/DT ₃₈₆HB.To pcDNAII/DT ₃₈₆HB carries out HindIII and BamHI double digestion, reclaims DT ₃₈₆The HB fragment.Wherein, pcDNAII/DT ₃₈₆The swimming lane 6 of the HindIII of HB and BamHI double digestion qualification result such as Fig. 3 A.With above-mentioned GFN fragment and DT ₃₈₆The HB fragment is with 1: 1 mixed, between the NcoI and BamHI site of directed insertion pSE420 (Invitrogen).

To cut through the BamHI enzyme and obtain about 6.2kb fragment and cut obtaining about 390bp fragment, 1200bp fragment and the segmental recombinant expression plasmid called after of 4.6kb pSE420/GMCSF-DT through HindIII and BamHI and NcoI three enzymes ₃₈₆PSE420/GMCSF-DT ₃₈₆The BamHI enzyme cut qualification result shown in the swimming lane among Fig. 3 B 2, pSE420/GMCSF-DT ₃₈₆HindIII and the qualification result cut of BamHI and NcoI three enzymes shown in the swimming lane among Fig. 3 B 4.Among Fig. 3 B, swimming lane 1,3 is respectively dna molecular amount standard DL2000+DL15000.

Sequencing result shows, pSE420/GMCSF-DT ₃₈₆Containing nucleotide sequence is the GMCSF-DT of sequence 1 in the sequence table ₃₈₆Gene.PSE420/GMCSF-DT ₃₈₆The express amino acid sequence is the fusion rotein GMCSF-DT of sequence 2 in the sequence table ₃₈₆

2, GMCSF-DT ₃₈₆Expression

With pSE420/GMCSF-DT ₃₈₆Transformed into escherichia coli expression strain BL21 (DE3, plysS), the positive single colony inoculation of picking contains in the LB nutrient solution of microbiotic (100 μ g/ml penbritin) in 5ml, 37 ℃ of enlarged culturing, carry out abduction delivering as follows: bacterial classification contains in the LB nutrient solution of 100 μ g/ml penbritins in 5ml by the volume ratio transferred species of 2-5%, continues to be cultured to about OD ₆₀₀0.4-0.6, add final concentration and carry out abduction delivering for 1mmol/L IPTG, behind the 3-6h, 8, the centrifugal 5min of 000rpm collects thalline.According to document (Sa nurse Brooker J, Ritchie EF not, Manny A Disi T work. Jin Dongyan, Li Mengfeng translates. the molecular cloning experiment guide, second edition, Beijing: Science Press, 1992.) method of describing in prepares the SDS-PAGE sample: with PBS solution washing and resuspended thalline, add isopyknic 2 * SDS-PAGE sample preparation liquid, boil 5min.And carry out 12% SDS-PAGE electrophoretic analysis according to above-mentioned literature method, observe the protein expression situation.The result shows to obtain tangible abduction delivering band about 57KD shown in Fig. 4 A, is GMCSF-DT ₃₈₆, the expression amount of target protein accounts for the 10-15% of bacterial protein in the expression strain.Among Fig. 4 A, swimming lane 1 is a protein molecular weight standard, and 2 for transforming recombinant plasmid pSE420/GMCSF-DT ₃₈₆Intestinal bacteria do not carry out IPTG inductive expression product, 3 for transforming recombinant plasmid pSE420/GMCSF-DT ₃₈₆Intestinal bacteria carry out IPTG inductive expression product.

3, GMCSF-DT ₃₈₆Express the mensuration of bacterium genetic stability

Expression strain has been carried out the research of expression stability.Expression strain is seeded in the 100 μ g/ml penbritin (Amp that contain that draw wired lattice ⁺) the LB flat board, choosing single bacterium colony line every day goes down to posterity, per 5 generations at random 10 single bacterium colonies of picking carry out enlarged culturing according to the method described above, use the IPTG abduction delivering, per 5 substitute its protein expression situation of 12%SDS-PAGE electrophoresis detection, altogether continuous passage 50 times of accumulative total, the result is shown in Fig. 4 B, and the result shows continuous biography GMCSF-DT after 50 generations ₃₈₆Expression amount does not have noticeable change, shows that expression plasmid can be stablized to go down to posterity and express in intestinal bacteria.Among Fig. 4 B, swimming lane 1 and 11 is a protein molecular weight standard, swimming lane 2 and 12 is for transforming the e. coli expression product of empty plasmid pSE420, swimming lane 3-10 is respectively the expression product that the 1st, 5,10,15,20,25,30,35 representatives reach bacterial strain, and swimming lane 13-18 is respectively the expression product that the 40th, 45,50,50,50,50 representatives reach bacterial strain.

4, GMCSF-DT ₃₈₆Purifying

With the 50th generation GMCSF-DT ₃₈₆Expression strain carries out a large amount of abduction deliverings as follows: picking transforms the E.coli that expression plasmid is arranged and expresses the single bacterium colony of bacterium, is inoculated in 5ml and contains in the LB nutrient solution of 100 μ g/ml penbritins, and 37 ℃ of jolting overnight incubation are as first order seed.First order seed inserts the LB nutrient solution (500ml container) that 100ml contains 100 μ g/ml penbritins with 1% volume ratio, and 37 ℃ of jolting overnight incubation are as secondary seed.Secondary seed inserts the LB nutrient solution (5L container) that 2L contains 100 μ g/ml penbritins with 2～5% volume ratio, cultivates about 3h for 37 ℃, and to OD600 0.4～0.6, adding final concentration is the IPTG of 1mmol/L, continues to cultivate 6h.8,000rpm, 4 ℃ of centrifugal 10min collect thalline.Get wet thallus 10g,, obtain inclusion body (IB) precipitation and weigh and be about 1g through cytoclasis and washing.Inclusion body is carried out sex change, renaturation according to a conventional method with 8mol/L urea.With sample on the renaturing inclusion bodies liquid to Q-Sepharose FF ion exchange column (column capacity 40ml, Pharmacia), A liquid (20mmol/L Tris-HCl, 1mmol/L EDTA, pH7.4) after the drip washing balance, (B liquid is the A liquid that contains 1.0mol/L NaCl, pH7.4) carries out gradient elution, collects the elution peak of 25% (volume ratio) B liquid with A liquid and B liquid.Sample is splined on Q-SepharoseFF post (column capacity 3ml) with 4 ℃ of dialysis of A liquid, and (B liquid is the A liquid that contains 1.0mol/L NaCl, pH7.4) carries out gradient elution, collects the elution peak of 50% (volume ratio) B liquid with A liquid and B liquid.(0.15mol/L NaCl, 0.1mol/L phosphate buffered saline buffer pH7.4) are dialysed, and (column capacity 24ml Pharmacia), collects 8-12ml, and 16-20ml protein flows out the peak to be splined on the Superdex75 gel-filtration column with PBS with the protein concentrate sample.

The tomographic map that renaturation solution carries out purifying through Q-Sepharose FF reinforcing yin essence ion chromatography post, Superdex75 post as shown in Figure 5, arrow shows GMCSF-DT ₃₈₆Protein peak.Among Fig. 5, A is the column purification of Q-Sepharose FF ion-exchange for the first time, and B is the column purification of Q-Sepharose FF ion-exchange for the second time, and C is a Superdex75 gel-filtration column purification.

Renaturation solution is through Q-Sepharose FF reinforcing yin essence ion chromatography column purification and concentrated, the SDS-PAGE gel analysis, purity has reached more than 80%, further carry out the gel-filtration purifying through the Superdex75 post, find that two protein flow out the peak and all the HL60 cell had cytotoxicity, lay respectively at 8-12ml, 16-20ml protein outflow peak, be labeled as peak 1 (P1), peak 2 (P2) (Fig. 5).

The purification of samples of two eluting peaks carries out 12% SDS-PAGE gel analysis, and the result shows that the molecular weight of major protein band is about 57KD as shown in Figure 6, accounts for more than 90% of protein content.P1 has 3 less important protein bands respectively about 37KD and 20KD, P2 also has more weak less important protein band relatively about 37KD.Among Fig. 6,1: protein molecular weight standard; 2-5: be respectively the 8ml at peak 1,8.5ml, 9ml, 12ml protein flows out the peak part; 6: the 17mL protein at peak 2 flows out the peak part.

With diphtheria toxin A fragment (DTA) antibody or anti-human GM-CSF polyclonal antibody (available from Ji Taikelian biotech development center, Beijing) is that an anti-Western blot that carries out is hybridized.Wherein, 12% SDS-PAGE and Western blot analytical procedure are the same; DTA and antibody thereof are according to document: " Ou Yangjing, Wang Jianwei, Wang Chunxiao, Guo Li takes off thick treasure, Cui Ting, turbulent waves. segmental expression and purification of diphtheria toxin A and Monoclonal Antibody, biotechnology journal, 2004,20 (5): 689-693 " in the method preparation described.

Diphtheria toxin A fragment (DTA) antibody or anti-human GM-CSF polyclonal antibody carry out Western blot analytical results and show that the 57kDa of P1 and P2 and 37kDa protein band all have immune association reaction with the DTA monoclonal antibody, and not reaction (Fig. 7) of 20kDa.Among Fig. 7,1: protein molecular weight standard; The Western blot of 2-4 for carrying out with diphtheria toxin A fragment (DTA) antibody, the Westernblot of 5-7 for carrying out with anti-human GM-CSF polyclonal antibody, 2,7 is the 9ml protein outflow peak part at peak 1,3,6 is the 12ml protein outflow peak part at peak 1, and 4,5 is the 17ml protein outflow peak part at peak 2.

The non-sex change glue of 12% PAGE (Native PAGE) analysis shows, P1, P2 sample are except that a main band of 57kDa, do not have the less important protein band of 37kDa and 20kDa, but the high molecular band a little less than in the of occurs, show and contain a spot of polymer (Fig. 8) in the sample.Among Fig. 8,1: protein molecular weight standard; 2 is the 9ml protein outflow peak part at peak 1, and 3 is the 12ml protein outflow peak part at peak 1, and 4 is the 17ml protein outflow peak part at peak 2.

By molecular weight and Western blot analytical results as can be known, the major protein band of 57kDa is total length target protein GMCSF-DT ₃₈₆37KD and 20KD may be two fragments that full-length proteins is cut by proteolytic enzyme.The 12%SDS-PAGE of sample is carried out gel imaging scanning, and the purity method of calculation are carried out according to Pharmacia company specification sheets.12%SDS-PAGE gel scanning analysis shows, the purity at 57kDa major protein peak is about 95% (a), the purity at 57kDa major protein peak reaches 97% (b among Fig. 9) in the P2 peak point sample among Fig. 9 in the P1 peak point sample.

Embodiment 2, GMCSF-DT ₃₈₆Determination of activity

1, GMCSF-DT ₃₈₆Specific cell toxic action to HL60

HL60 clone belongs to promyelocytic leukemia cell, is the clone commonly used of carrying out leukemia research.Because of its cell surface has a large amount of GM-CSF acceptors, therefore can be used as the target cell of immunotoxin in this research, detect the cell killing activity of toxin.Adopt the MTS method to measure immunotoxin GMCSF-DT ₃₈₆P1 and the P2 purified components to the cytotoxicity of HL60.

The MTS method is operated according to the MTS of Promega company detection kit specification sheets.Collection is in the HL60 cell of logarithmic phase, is adjusted into 5 * 10 with the RPMI RPMI-1640 of 10%FCS ⁵Individual/ml, insert in the 96 porocyte culture plates with the 0.1ml/ hole, cultivate 24h, add the GMCSF-DT of 0.1ml ₃₈₆The P1 purified components or the GMCSF-DT of 0.1ml ₃₈₆The P2 purified components or the DT of 0.1ml ₃₈₆The DT of-GMCSF or 0.1ml ₃₈₆Or the His of 0.1ml ₆The PBS of the vincristine(VCR) of-DTA or 0.1ml or the pH of 0.1ml 7.4,0.1mol/L (0.1ml) acts on 60-72h.Wherein, the PBS of adding 0.1ml pH 7.4,0.1mol/L in contrast.Adopt the PBS that in the RPMI of 0.1ml 10%FCS RPMI-1640, adds 0.1ml pH7.4,0.1mol/L as blank simultaneously.Wherein every kind of sample, blank and contrast each 3-8 hole.Every hole adds the MTS solution of 20 μ l again, and 37 ℃, 5% (volume ratio) CO ₂Incubation 4h, with the light absorption value of microplate reader mensuration 495nm wavelength, the calculating cell survival rate (Survival Rate, SR): SR=(A _Sample-A _Blank)/(A _Contrast-A _Blank) * 100%.Draw the survival rate curve of cell after the effect of different concns fusion rotein purified components, cell survival rate be suppressed to 50% o'clock fusion rotein concentration be IC ₅₀

The result shows immunotoxin GMCSF-DT ₃₈₆, no matter be P1 or P2 component, to the IC of HL60 ₅₀(half-inhibition concentration) compares DT ₃₈₆The IC of-GMCSF ₅₀A high order of magnitude.The IC of P1 and P2 component ₅₀Differ 5 times, the supposition that fully shows preamble is correct, and promptly the two may form different conformations in renaturation process, and this Different Effects is to the cell efficient extremely of immunotoxin.But GMCSF-DT ₃₈₆Lethal effect than the DT of no receptor binding domain ₃₈₆With His ₆ High 2 orders of magnitude of-DTA.Wherein, DT ₃₈₆According to document " Ou Yangjing, Wang Jianwei bend to found the state, turbulent waves. diphtheria toxin DT ₃₈₆Segmental expression and purification and Study of cytotoxicity, Chinese biological engineering magazine, 2004,24 (6): 74-80 " the middle method preparation of describing, His ₆-DTA according to document " Ou Yangjing, Wang Jianwei, Wang Chunxiao, Guo Li takes off thick treasure, Cui Ting, turbulent waves. segmental expression and purification of diphtheria toxin A and Monoclonal Antibody, biotechnology journal, 2004,20 (5): 689-693 " in the method preparation described.

Table 1 immunotoxin compares the lethal effect of HL60 cell

GMCSF-DT 386

DT 386-GMCSF

DT 386

His-DTA

Vincristine(VCR)

	P1	P2
							IC
50	5×10 -8 mol/L	1×10 -8 mol/L	1×10 -9 mol/L	2×10 -6 mol/L	3×10 -6 mol/L	5×10 -7mg/ml

2, GMCSF-DT ₃₈₆Non-special toxicity to other cell

In theory, be that the diphtheria toxin immunotoxin of target should only just have cytotoxicity to the cell with GM-CSFR with GM-CSFR, there is not the cell of GM-CSFR not killed and wounded by immunotoxin.This experiment has been measured immunotoxin GMCSF-DT according to the MTS method of step 1 ₃₈₆To the toxicity of 6 kinds of cells, simultaneously with DT ₃₈₆And His ₆-DTA in contrast.Result such as table 2.In these cells, there are 42 GM-CSF high-affinity receptors on the surface of known LS-174-T, and other cells do not appear in the newspapers GM-CSFR.The result shows, GMCSF-DT ₃₈₆(2.9 μ g/ml) can not kill the cell that does not have GM-CSFR or a small amount of GM-CSFR is arranged under the concentration of killing the HL60 cell more than at least 50%, shows GMCSF-DT ₃₈₆The cell that a large amount of high-affinity GM-CSFR are arranged had the targeting specific cytotoxicity.But, the situation of killing and wounding of A549 is very special, and the change in concentration of immunotoxin just causes A549 from being killed and wounded (50-100%) in a large number to not killed and wounded fully in an order of magnitude.Its reason it be unclear that, may be relevant with some growth characteristics of lung carcinoma cell.Percentage ratio as molecule in the table 2 is the survival rate of cell; Denominator is the concentration of immunotoxin, and unit is μ g/ml.GMCSF-DT as " 10%/14 " expression 14 μ g/ml ₃₈₆The P2 component be 90% to the kill rate of A549 cell, the survival rate of A549 cell is 10%.The minimum working concentration 20 μ g/ml of P1 are equivalent to the IC of P1 on the HL60 cell ₅₀7 times.The Cmin 2.9 μ g/ml of P2 are equivalent to the IC of P2 on the HL60 cell ₅₀5 times.Clone in the table 2 is purchased white ATCC; LS174t, the U251 cell cultures is in the RIPM1640 nutrient solution, Vero, HEK 293, A549, the RD cell cultures all contains 10%FCS in the DMEM nutrient solution, 50U/ml penicillin and 50 μ g/ml Streptomycin sulphates.

Table 2, GMCSF-DT ₃₈₆Cytotoxicity

Clone	The cell source	GMCSF-DT 386		DT 386	His 6-DTA
						P1	P2
		293	The human embryo kidney (HEK) of 5 type adenovirus E 1 district's gene transformation					ND	a	100％/2.9	82％/5 c	100％/13
Vero	African green monkey kidney			100％/20	ND	11％/500	100％/130
		A549	People's lung cancer					0％/200， 100％/50	10％/14	0％/500， 72％/50	56％/130， 100％/13
LS-174-T	The human colon adenocarcinoma			80％/100 c	ND	36％/5	100％/13
		U251	People's astroglioma					ND		100％/2.9	100％/5	100％/13
RD	The pernicious embryo's rhabdomyoma of people			ND		100％/2.9	99％/5						100％/13

Annotate: " ND " is expressed as and do not carry out this experiment.

3, the interior therapeutic activity of GMCSF-DT386

Adopt GMCSF-DT ₃₈₆The P1 component carry out the interior therapeutic determination of activity.

All animal operations are carried out according to the requirement of laboratory animal ethics management committee.Every group of 8-9 of NOD/SCID mouse (5-7 week age, mean body weight 19g) only available from laboratory animal institute of the Chinese Academy of Medical Sciences, and raises the degree in constant temperature 23-25, in the aseptic rearing-box of malleation, raises feed and high pressure acidifying water with sterilization.After a week conforms, give irradiation (killing and wounding the intravital remaining immunocyte of mouse) by 150cGy/ dosage.Mouse pressed 5 * 10 at the 0th day ⁶Individual cell/only with tail vein (i.v.) inoculation HL60 cell, at 1-5 days intraperitoneal administration GMCSF-DT ₃₈₆, 3 different dosage are respectively every 1,10 and 50 μ g/day.Observe model mice every day, and the record survival time.The isopyknic pH of control group mice abdominal injection is 7.4, the PBS solution (sterile filtration) of 0.1mol/L.

Dying mouse is carried out the euthanasia that CO2 sucks, and dissects, and gathers liver,kidney,spleen, the heart and marrow sample.Tissue sample is prepared into the painted pathological section of HE, and microscopically is observed.Marrow sample, abdominal tumor sample are hatched with the mouse monoclonal antibody (Becton Dickinson (BD) company) of anti-people CD13, CD33 and CD38 through separating treatment, carry out flow cytometry (FCM) and detect.Simultaneously in contrast with the HL60 cell.

Survival time utilization Kaplan-Meier method is added up, and the p value is calculated and carried out at survival curve, and its significant difference has adopted Log-Rank (Mantel-Cox) check.

The result shows that the median of control mice survival time is 24.5 days, scope 13～95 days.By survivorship curve (Figure 10) of relatively respectively organizing, find high dosage GMCSF-DT ₃₈₆Group is significantly increased than the survival condition of control group.50,10,1 μ g/day dosage group is than control group, and the p value is respectively 0.001,0.034, and 0.065.Each organizes mean survival time is 116 ± 52 (50 μ g/ days /), 83 ± 45 (10 μ g/ days/only), 71 ± 50 (1 μ g/ days/only) and 36 ± 28 days (contrasts).Among Figure 10, the control group of " ● " expression injection PBS, 1 μ g/ days/low dose group only of " * " expression, 10 μ g/ days/middle dosage group only of " ▲ " expression, 50 μ g/ days/high dose group only of " " expression.

In the marrow (BM) of 5 dying mouse of control group (Mice A, Mice B, Mice C, Mice D, Mice E), through the cell streaming technology, adopt anti-people CD13, the antibody test of CD33 and CD38 is to the human leukemia cell.By the cell of abdominal tumor piece preparation, detect through streaming, find that its cellular immunization phenotype is similar to HL60, show that tumour is from HL60 (Figure 11).

Because the transfer in vivo of HL60 cell is disseminated, the dying mouse of treatment group is similar to contrast, and visible tumour is dispersed in the health many places, and in belly, the visible tumor mass of head or ridge portion, and many organs find to have infiltration phenomenon.Treatment back long-term surviving mouse imposes euthanasia, dissect and do not see the bulk tumour, but the cell streaming of marrow detects the remnants of visible people AML cell.

Among Figure 11, BM contol is the medullary cell of normal NOD/SCID mouse, the serve as reasons cell of abdominal tumor piece preparation of NOD/SCID mouse of inoculation HL60 cell of cells from masses, Mice A, Mice B, MiceC, Mice D, Mice E are the medullary cell of the NOD/SCID mouse of 5 inoculations of control group HL60 cell, Mice1, Mice 10, Mice 50 are 3 inoculations of treatment group HL60 cell, again respectively with 1,10,50 μ g/ days/dosed administration GMCSF-DT only ₃₈₆The NOD/SCID bone marrow cells in mice of P1 component.

Embodiment 3, GMCSF-DT ₃₈₆The Cytotoxic mechanism of action

1, the morphology of apoptotic cell research

With the HL60 cell with 10 ⁵Individual/ml concentration inserts 25cm ²In culturing bottle or 6 orifice plates, cultivate 24h.Add GMCSF-DT ₃₈₆P1 purified components or GMCSF-DT ₃₈₆P2 purified components to final concentration be 0; 1 * 10 ^-9Mol/L; 1 * 10 ^-8Mol/L; 1 * 10 ^-7Mol/L effect 48h, 1,000rpm, 10min centrifugal collecting cell, PBS wash 1 time, and 1,000rpm, centrifugal 10min is suspended in the serum free medium again, with Hoechst 33342 dyeing of 10 μ g/ml.Cell after not dyeing or dyeing is dripped sheet, and fluorescent microscope is observed down and is taken pictures.

The diphtheria toxin killer cell is by making ADP-ribosylation EF-2 (elongation factor) inactivation, and suppresses the protein synthesis of cell, finally causes necrocytosis.This experiment is at first observed GMCSF-DT from morphology ₃₈₆Specific cytotoxic to the HL60 cell.Lysis under light microscopic presents many typical apoptotic bodies, and certain dosage correlation is arranged; From Hoechst 33342 coloration results, can see that chromosomal DNA ruptures and pyknosis becomes the fine and close dotted region of a plurality of light blues in the intact cell film, point out this toxin can cause the HL60 apoptosis.That Figure 12 shows is GMCSF-DT ₃₈₆The result of P1 purified components, GMCSF-DT ₃₈₆P1 purified components final concentration be 0 (use isopyknic pH7.4,0.1mol/L PBS handles cell) in 1; Be 1 * 10 in 2 ^-9Mol/L; Be 1 * 10 in 3 ^-8Mol/L; Be 1 * 10 in 4 ^-7Mol/L.

2, Flow cytometry GMCSF-DT ₃₈₆Influence to HL60 apoptosis ratio

Measure the hypodiploid peak of cell with PI dyeing.With the HL60 cell with 10 ⁵Individual/ml inserts 25cm ²In culturing bottle or 6 orifice plates, use 10%FCS, RIPM1640 nutrient solution (containing 50U/ml penicillin and 50 μ g/ml Streptomycin sulphates) is cultivated 24h.Add GMCSF-DT ₃₈₆P1 purified components or GMCSF-DT ₃₈₆P2 purified components to final concentration be after 0,20,40,60,80 or 100 μ g/ml handle 36h, 1, the centrifugal 10min collecting cell of 000rpm, PBS washes 3 times.In cell precipitation, add 70% ethanol 2ml then, fixedly be no less than 12h in-20 ℃.PBS washes 2 times, and (Propidium Iodide is PI) behind the dyeing 1h, with Coulter EPICS XL type cells were tested by flow cytometry percentage of cell apoptosis through iodate third ingot of 37 ℃ of 0.5mg/ml RNase A digestion 30min, 65 μ g/ml.Simultaneously with pH be 7.4, the PBS solution-treated of 0.1mol/L 36 hours in contrast.

The dna break of apoptotic cell, and leave cell along with the formation of apoptotic body, so nucleic acid substances lacks than Normocellular nucleic acid substances in the born of the same parents.This is " an A0 cell mass ", or the reason of " inferior G1 cell mass " formation.Utilize flow cytometry to detect and the quantitatively appearance of hypodiploid cell mass before the G0/G1 cell mass.This is apoptotic another sign.Figure 13 has provided the GMCSF-DT of different concns ₃₈₆The P1 purified components induce the apoptotic ratio of HL60, showing has extraordinary dose response linear relationship, the ratio that apoptotic cell is described is by GMCSF-DT ₃₈₆Concentration decision.Simultaneously, the contrast of HL60 cell (is not added GMCSF-DT ₃₈₆P1 purified components or GMCSF-DT ₃₈₆The HL60 cell of P2 purified components) spontaneous apoptosis of significant proportion also takes place after PBS handles 36h, may lack relevant with serum.

3, the agarose gel electrophoresis of apoptotic cell dna fragmentation detects

Important biochemical marker of apoptosis is that nucleus DNA is by Ca in the born of the same parents ²⁺-Mg ²⁺The dependency endonuclease is degraded into the fragment of 180-200bp at interval.Because this endonuclease enzyme selectivity cutting holds the DNA joining region between the karyomit(e) nucleosome, therefore the dna fragmentation length that cuts out all is 200 integral multiple, presents " dna ladder (DNA Ladder) " on sepharose.

With the HL60 cell with 10 ⁵Individual/ml inserts 25cm ²In culturing bottle or 6 orifice plates, use 10%FCS, RIPM1640 nutrient solution (containing 50U/ml penicillin and 50 μ g/ml Streptomycin sulphates) is cultivated 24h.Add GMCSF-DT ₃₈₆P1 purified components or GMCSF-DT ₃₈₆P2 purified components to final concentration be 10 or 100ug/ml effect 60h, 1000rpm, centrifugal 10min collecting cell.After PBS washes 3 times, be suspended in cell dissociation buffer (10mmol/L EDTA, 50mmol/LTris-Cl, 0.25%NP-40, the 0.5mg/ml Proteinase K, pH8.0) to cell concn be 10 ⁷Individual cell/0.5ml, 50 ℃ of digestion 1h.Add 0.25mg/ml RNaseA then and continue digestion 1h at 50 ℃.With digestion product room temperature 13, the centrifugal 10min of 000rpm, on reset and add 2 times of volume ethanol ,-20 ℃ of deposit D NA that spend the night, 13, the centrifugal 20min of 000rpm inhales and to abandon ethanol, and the DNA precipitation is dried, and with the dissolving of TE damping fluid, measures dna content.Getting 10 μ lDNA samples and 1/10 volume sample-loading buffer mixing, be splined on 1.5% sepharose, is electrophoretic buffer with TAE (1 *), and electrophoresis apparatus voltage is adjusted into 6V/cm glue, electrophoresis 3h, and EB dyeing is observed under the UV-light, is taken pictures.Simultaneously in contrast with the PBS solution-treated HL60 cell of pH7.4,0.1mol/L 60 hours.

GMCSF-DT ₃₈₆The P1 purified components the result as shown in figure 14, observe nuclear DNA fracture, control cells has the small amounts of cells apoptosis to present more shallow DNA Ladder.Undressed fresh HL60 cell only on distance the sample hole one macromolecular nucleic acid band is nearby arranged.This result has fully proved GMCSF-DT ₃₈₆The P1 purified components cause apoptotic effect.Among Figure 14, swimming lane 1 is dna molecular amount standard DL2000+DL15000; 2 is 100ug/mlGMCSF-DT ₃₈₆60 hours HL60 cell of P1 purified components effect, 3 is 10ug/ml GMCSF-DT ₃₈₆60 hours HL60 cell of P1 purified components effect, 4 is pH7.4,60 hours HL60 cell of 0.1mol/LPBS effect, 5 is fresh undressed HL60 cell contrast.

4, GMCSF-DT ₃₈₆Induce the apoptotic biophysics of HL60 to change

A series of biophysics has taken place in the apoptotic cell changed, as Ca ²⁺Increasing of concentration, the startup of apoptosis is all pointed out in the reduction of the rising of pH value and mitochondrial membrane potential Δ Ψ m.This experiment detects above-mentioned characteristic by Flow Cytometry, and the result conforms to expection, shows GMCSF-DT ₃₈₆The mechanism of killing and wounding the HL60 cell is to utilize the toxicity of diphtheria toxin, causes apoptosis.Concrete grammar and result are as follows:

(1) concentration of cytoplasm calcium ion is measured

Adopt the Ca of novel cell membrane permeability ²⁺Specific fluorescence dyestuff Fluo-3 can indicate Free Ca by the variation of fluorescence intensity ²⁺The size of concentration.

With the HL60 cell with 10 ⁵Individual/ml inserts 25cm ²In culturing bottle or 6 orifice plates, cultivate 24h.Add GMCSF-DT ₃₈₆P1 purified components or GMCSF-DT ₃₈₆P2 purified components to final concentration be 0,50 or 100 μ g/ml effect 36h, 1, the centrifugal 10min collecting cell of 000rpm, PBS washes 3 times.Again be suspended in serum-free RPMI 1640 substratum, adding calcium fluorescent probe Fluo-3/AM (Fluo 3-AM) respectively, to make its final concentration be 5 μ mol/L, Ca in 37 ℃ of incubation 40min, cells were tested by flow cytometry born of the same parents ²⁺Content (excitation wavelength 480nm, emission wavelength 530nm).

Figure 15 has shown at different concns GMCSF-DT ₃₈₆Under the effect of P1 purified components, the variation of HL60 intracellular calcium, visible GMCSF-DT ₃₈₆Concentration and Ca ²⁺Also exist between the concentration and present dose-response relationship.

(2) mitochondrial membrane potential is measured

Cationic fluorescent dyestuff Rhodamine123 can infiltrate complete plastosome makes it specific stain, if mitochondrial membrane potential Δ Ψ m changes, then fluorescence intensity changes thereupon.

With the HL60 cell with 10 ⁵Individual/ml inserts 25cm ²In culturing bottle or 6 orifice plates, cultivate 24h.Add GMCSF-DT ₃₈₆P1 purified components or GMCSF-DT ₃₈₆P2 purified components to final concentration be 0,50 or 100 μ g/ml effect 36h, 1, the centrifugal 10min collecting cell of 000rpm, PBS washes 3 times, again be suspended in serum-free RPMI 1640 substratum, adding Rodamine 123 respectively, to make its final concentration be 5 μ mol/L, 37 ℃ of incubation 60min, cells were tested by flow cytometry plastosome Δ Ψ m content (excitation wavelength 480nm, emission wavelength 530nm).

Figure 16 has shown at different concns GMCSF-DT ₃₈₆The effect of P1 purified components under, as seen also there is certain dose-response relationship in the variation of HL60 cell mitochondrial membrane potential Δ Ψ m.

(3) mensuration of pH value in the born of the same parents

Fluorescence dye BCECF-AM (BCECF/AM) is emission maximum light wavelength difference under condition of different pH, can use the variation of the fluorescence intensity ratio value representation intracellular ph value of 525nm/620nm emission wavelength.Ratio increases the expression alkalization, on the contrary acidifying.

With the HL60 cell with 10 ⁵Individual/ml inserts 25cm ²In culturing bottle or 6 orifice plates, cultivate 24h.Add GMCSF-DT ₃₈₆P1 purified components or GMCSF-DT ₃₈₆P2 purified components to final concentration be 0,20,40,60,80 or 100 μ g/ml effect 36h, 1,000rpm 10min centrifugal collecting cell, PBS are washed 3 times.Again be suspended in serum-free RPMI 1640 substratum, add the BCECF fluorescence dye respectively, final concentration is 5 μ mol/L, pH value (excitation wavelength 480nm, emission wavelength 525nm, 620nm) in 37 ℃ of incubation 60min, cells were tested by flow cytometry born of the same parents.

Figure 17 is presented at different concns GMCSF-DT ₃₈₆The effect of P1 purified components under, the acidifying gradually of HL60 cell, pH reduces in the born of the same parents, and has dosage correlation.

Sequence table

<160>5

<210>1

<211>1563

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>1

atggcgcctg ctcgttctcc gtcaccttct acacagcctt gggaacatgt taatgctatc 60

caagaggctc gccgtctgct taacctatct cgtgataccg cggctgagat gaatgaaacc 120

gttgaagtaa tctccgagat gttcgacctg caagaaccta catgtcttca gacccgcctg 180

gaactttata agcaaggtct tcgtggctct ctgacaaagc tgaaaggtcc tcttaccatg 240

atggcttcac actataaaca gcattgtcct ccgacccctg agacatcttg cgctacccag 300

acaatcacct tcgaatcctt taaagaaaac ctgaaagact tcctgcttgt tatcccgttt 360

gactgctggg aacctgttca agaagcttct ggtggtcctg agggcgctga tgatgttgtt 420

gattcttcta aatcttttgt gatggaaaac ttttcttcgt accacgggac taaacctggt 480

tatgtagatt ccattcaaaa aggtatacaa aagccaaaat ctggtacaca aggaaattat 540

gacgatgatt ggaaagggtt ttatagtacc gacaataaat acgacgctgc gggatactct 600

gtagataatg aaaacccgct ctctggaaaa gctggaggcg tggtcaaagt gacgtatcca 660

ggactgacga aggttctcgc actaaaagtg gataatgccg aaactattaa gaaagagtta 720

ggtttaagtc tcactgaacc gttgatggag caagtcggaa cggaagagtt tatcaaaagg 780

ttcggtgatg gtgcttcgcg tgtagtgctc agccttccct tcgctgaggg gagttctagc 840

gttgaatata ttaataactg ggaacaggcg aaagcgttaa gcgtagaact tgagattaat 900

tttgaaaccc gtggaaaacg tggccaagat gcgatgtatg agtatatggc tcaagcctgt 960

gcaggaaatc gtgtcaggcg atcagtaggt agctcattgt catgcataaa tcttgattgg 1020

gatgtcataa gggataaaac taagacaaag atagagtctt tgaaagagca tggccctatc 1080

aaaaataaaa tgagcgaaag tcccaataaa acagtatctg aggaaaaagc taaacaatac 1140

ctagaagaat ttcatcaaac ggcattagag catcctgaat tgtcagaact taaaaccgtt 1200

actgggacca atcctgtatt cgctggggct aactatgcgg cgtgggcagt aaacgttgcg 1260

caagttatcg atagcgaaac agctgataat ttggaaaaga caactgctgc tctttcgata 1320

cttcctggta tcggtagcgt aatgggcatt gcagacggtg ccgttcacca caatacagaa 1380

gagatagtgg cacaatcaat agctttatcg tctttaatgg ttgctcaagc tattccattg 1440

gtaggagagc tagttgatat tggtttcgct gcatataatt ttgtagagag tattatcaat 1500

ttatttcaag tagttcataa ttcgtataat cgtcccgcgt attctccggg tcataaaacg 1560

tag 1563

<210>2

<211>520

<212>PRT

＜213〉artificial sequence

<220>

<223>

<400>2

Met Ala Pro Ala Arg Ser Pro Ser Pro Ser Thr Gln Pro Trp Glu His

1 5 10 15

Val Asn Ala Ile Gln Glu Ala Arg Arg Leu Leu Asn Leu Ser Arg Asp

20 25 30

Thr Ala Ala Glu Met Asn Glu Thr Val Glu Val Ile Ser Glu Met Phe

35 40 45

Asp Leu Gln Glu Pro Thr Cys Leu Gln Thr Arg Leu Glu Leu Tyr Lys

50 55 60

Gln Gly Leu Arg Gly Ser Leu Thr Lys Leu Lys Gly Pro Leu Thr Met

65 70 75 80

Met Ala Ser His Tyr Lys Gln His Cys Pro Pro Thr Pro Glu Thr Ser

85 90 95

Cys Ala Thr Gln Thr Ile Thr Phe Glu Ser Phe Lys Glu Asn Leu Lys

100 105 110

Asp Phe Leu Leu Val Ile Pro Phe Asp Cys Trp Glu Pro Val Gln Glu

115 120 125

Ala Ser Gly Gly Pro Glu Gly Ala Asp Asp Val Val Asp Ser Ser Lys

130 135 140

Ser Phe Val Met Glu Asn Phe Ser Ser Tyr His Gly Thr Lys Pro Gly

145 150 155 160

Tyr Val Asp Ser Ile Gln Lys Gly Ile Gln Lys Pro Lys Ser Gly Thr

165 170 175

Gln Gly Asn Tyr Asp Asp Asp Trp Lys Gly Phe Tyr Ser Thr Asp Asn

180 185 190

Lys Tyr Asp Ala Ala Gly Tyr Ser Val Asp Asn Glu Asn Pro Leu Ser

195 200 205

Gly Lys Ala Gly Gly Val Val Lys Val Thr Tyr Pro Gly Leu Thr Lys

210 215 220

Val Leu Ala Leu Lys Val Asp Asn Ala Glu Thr Ile Lys Lys Glu Leu

225 230 235 240

Gly Leu Ser Leu Thr Glu Pro Leu Met Glu Gln Val Gly Thr Glu Glu

245 250 255

Phe Ile Lys Arg Phe Gly Asp Gly Ala Ser Arg Val Val Leu Ser Leu

260 265 270

Pro Phe Ala Glu Gly Ser Ser Ser Val Glu Tyr Ile Asn Asn Trp Glu

275 280 285

Gln Ala Lvs Ala Leu Ser Val Glu Leu Glu Ile Asn Phe Glu Thr Arg

290 295 300

Gly Lys Arg Gly Gln Asp Ala Met Tyr Glu Tyr Met Ala Gln Ala Cys

305 310 315 320

Ala Gly Asn Arg Val Arg Arg Ser Val Gly Ser Ser Leu Ser Cys Ile

325 330 335

Asn Leu Asp Trp Asp Val Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu

340 345 350

Ser Leu Lys Glu His Gly Pro Ile Lys Asn Lys Met Ser Glu Ser Pro

355 360 365

Asn Lys Thr Val Ser Glu Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe

370 375 380

His Gln Thr Ala Leu Glu His Pro Glu Leu Ser Glu Leu Lys Thr Val

385 390 395 400

Thr Gly Thr Asn Pro Val Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala

405 410 415

Val Asn Val Ala Gln ValIle Asp Ser Glu Thr Ala Asp Asn Leu Glu

420 425 430

Lys Thr Thr Ala Ala Leu Ser Ile Leu Pro Gly Ile Gly Ser Val Met

435 440 445

Gly Ile Ala Asp Gly Ala Val His His Asn Thr Glu Glu Ile Val Ala

450 455 460

Gln Ser Ile Ala Leu Ser Ser Leu Met Val Ala Gln Ala Ile Pro Leu

465 470 475 480

Val Gly Glu Leu Val Asp Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu

485 490 495

Ser Ile Ile Asn Leu Phe Gln Val Val His Asn Ser Tyr Asn Arg Pro

500 505 510

Ala Tyr Ser Pro Gly His Lys Thr

515 520

<210>3

<211>390

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>3

atggcgcctg ctcgttctcc gtcaccttct acacagcctt gggaacatgt taatgctatc 60

caagaggctc gccgtctgct taacctatct cgtgataccg cggctgagat gaatgaaacc 120

gttgaagtaa tctccgagat gttcgacctg caagaaccta catgtcttca gacccgcctg 180

gaactttata agcaaggtct tcgtggctct ctgacaaagc tgaaaggtcc tcttaccatg 240

atggcttcac actataaaca gcattgtcct ccgacccctg agacatcttg cgctacccag 300

acaatcacct tcgaatcctt taaagaaaac ctgaaagact tcctgcttgt tatcccgttt 360

gactgctggg aacctgttca agaagcgtga 390

<210>4

<211>1551

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>4

atgggcgctg atgatgttgt tgattcttct aaatcttttg tgatggaaaa cttttcttcg 60

taccacggga ctaaacctgg ttatgtagat tccattcaaa aaggtataca aaagccaaaa 120

tctggtacac aaggaaatta tgacgatgat tggaaagggt tttatagtac cgacaataaa 180

tacgacgctg cgggatactc tgtagataat gaaaacccgc tctctggaaa agctggaggc 240

gtggtcaaag tgacgtatcc aggactgacg aaggttctcg cactaaaagt ggataatgcc 300

gaaactatta agaaagagtt aggtttaagt ctcactgaac cgttgatgga gcaagtcgga 360

acggaagagt ttatcaaaag gttcggtgat ggtgcttcgc gtgtagtgct cagccttccc 420

ttcgctgagg ggagttctag cgttgaatat attaataact gggaacaggc gaaagcgtta 480

agcgtagaac ttgagattaa ttttgaaacc cgtggaaaac gtggccaaga tgcgatgtat 540

gagtatatgg ctcaagcctg tgcaggaaat cgtgtcaggc gatcagtagg tagctcattg 600

tcatgcataa atcttgattg ggatgtcata agggataaaa ctaagacaaa gatagagtct 660

ttgaaagagc atggccctat caaaaataaa atgagcgaaa gtcccaataa aacagtatct 720

gaggaaaaag ctaaacaata cctagaagaa tttcatcaaa cggcattaga gcatcctgaa 780

ttgtcagaac ttaaaaccgt tactgggacc aatcctgtat tcgctggggc taactatgcg 840

gcgtgggcag taaacgttgc gcaagttatc gatagcgaaa cagctgataa tttggaaaag 900

acaactgctg ctctttcgat acttcctggt atcggtagcg taatgggcat tgcagacggt 960

gccgttcacc acaatacaga agagatagtg gcacaatcaa tagctttatc gtctttaatg 1020

gttgctcaag ctattccatt ggtaggagag ctagttgata ttggtttcgc tgcatataat 1080

tttgtagaga gtattatcaa tttatttcaa gtagttcata attcgtataa tcgtcccgcg 1140

tattctccgg gtcataaaac gcatgcgcct gctcgttctc cgtcaccttc tacacagcct 1200

tgggaacatg ttaatgctat ccaagaggct cgccgtctgc ttaacctatc tcgtgatacc 1260

gcggctgaga tgaatgaaac cgttgaagta atctccgaga tgttcgacct gcaagaacct 1320

acatgtcttc agacccgcct ggaactttat aagcaaggtc ttcgtggctc tctgacaaag 1380

ctgaaaggtc ctcttaccat gatggcttca cactataaac agcattgtcc tccgacccct 1440

gagacatctt gcgctaccca gacaatcacc ttcgaatcct ttaaagaaaa cctgaaagac 1500

ttcctgcttg ttatcccgtt tgactgctgg gaacctgttc aagaagcgtg a 1551

<210>5

<211>516

<212>PRT

＜213〉artificial sequence

<220>

<223>

<400>5

Met Gly Ala Asp Asp Val Val Asp Ser Ser Lys Ser Phe Val Met Glu

1 5 10 15

Asn Phe Ser Ser Tyr His Gly Thr Lys Pro Gly Tyr Val Asp Ser Ile

20 25 30

Gln Lys Gly Ile Gln Lys Pro Lys Ser Gly Thr Gln Gly Asn Tyr Asp

35 40 45

Asp Asp Trp Lys Gly Phe Tyr Ser Thr Asp Asn Lys Tyr Asp Ala Ala

50 55 60

Gly Tyr Ser Val Asp Asn Glu Asn Pro Leu Ser Gly Lys Ala Gly Gly

65 70 75 80

Val Val Lys Val Thr Tyr Pro Gly Leu Thr Lys Val Leu Ala Leu Lys

85 90 95

Val Asp Asn Ala Glu Thr Ile Lys Lys Glu Leu Gly Leu Ser Leu Thr

100 105 110

Glu Pro Leu Met Glu Gln Val Gly Thr Glu Glu Phe Ile Lys Arg Phe

115 120 125

Gly Asp Gly Ala Ser Arg Val Val Leu Ser Leu Pro Phe Ala Glu Gly

130 135 140

Ser Ser Ser Val Glu Tyr Ile Asn Asn Trp Glu Gln Ala Lys Ala Leu

145 150 155 160

Ser Val Glu Leu Glu Ile Asn Phe Glu Thr Arg Gly Lys Arg Gly Gln

165 170 175

Asp Ala Met Tyr Glu Tyr Met Ala Gln Ala Cys Ala Gly Asn Arg Val

180 185 190

Arg Arg Ser Val Gly Ser Ser Leu Ser Cys Ile Asn Leu Asp Trp Asp

195 200 205

Val Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu Ser Leu Lys Glu His

210 215 220

Gly Pro Ile Lys Asn Lys Met Ser Glu Ser Pro Asn Lys Thr Val Ser

225 230 235 240

Glu Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe His Gln Thr Ala Leu

245 250 255

Glu His Pro Glu Leu Ser Glu Leu Lys Thr Val Thr Gly Thr Asn Pro

260 265 270

Val Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala Val Asn Val Ala Gln

275 280 285

Val Ile Asp Ser Glu Thr Ala Asp Asn Leu Glu Lys Thr Thr Ala Ala

290 295 300

Leu Ser Ile Leu Pro Gly Ile Gly Ser Val Met Gly Ile Ala Asp Gly

305 310 315 320

Ala Val His His Asn Thr Glu Glu Ile Val Ala Gln Ser Ile Ala Leu

325 330 335

Ser Ser Leu Met Val Ala Gln Ala Ile Pro Leu Val Gly Glu Leu Val

340 345 350

Asp Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu Ser Ile Ile Asn Leu

355 360 365

Phe Gln Val Val His Asn Ser Tyr Asn Arg Pro Ala Tyr Ser Pro Gly

370 375 380

His Lys Thr His Ala Pro Ala Arg Ser Pro Ser Pro Ser Thr Gln Pro

385 390 395 400

Trp Glu His Val Asn Ala Ile Gln Glu Ala Arg Arg Leu Leu Asn Leu

405 410 415

Ser Arg Asp Thr Ala Ala Glu Met Asn Glu Thr Val Glu Val Ile Ser

420 425 430

Glu Met Phe Asp Leu Gln Glu Pro Thr Cys Leu Gln Thr Arg Leu Glu

435 440 445

Leu Tyr Lys Gln Gly Leu Arg Gly Ser Leu Thr Lys Leu Lys Gly Pro

450 455 460

Pro Thr Met Met Ala Ser His Tyr Lys Gln His Cys Pro Pro Thr Pro

465 470 475 480

Glu Thr Ser Cys Ala Thr Gln Thr Ile Thr Phe Glu Ser Phe Lys Glu

485 490 495

Asn Leu Lys Asp Phe Leu Leu Val Ile Pro Phe Asp Cys Trp Glu Pro

500 505 510

Val Gln Glu Ala

515

Claims (9)

1, the fusion rotein of a kind of diphtheria toxin and GM-CSF is following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 2;

(b) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and to have an acute myeloid leukemia cell of killing and wounding active by (a) deutero-protein.

2, the encoding gene of the fusion rotein of described diphtheria toxin of claim 1 and GM-CSF.

3, gene according to claim 2 is characterized in that: the encoding gene of the fusion rotein of described diphtheria toxin and GM-CSF is following 1) or 2) gene:

1) its nucleotide sequence is the sequence 1 in the sequence table;

2) under stringent condition with 1) dna molecular of the fusion rotein of the dna sequence dna hybridization that limits and encode described diphtheria toxin and GM-CSF.

4, the recombinant expression vector, transgenic cell line and the transformed host bacterium that contain the fusion rotein encoding gene of claim 2 or 3 described diphtheria toxins and GM-CSF.

5, a kind of medicine for the treatment of acute myeloid leukemia, its activeconstituents are the fusion roteins of described diphtheria toxin of claim 1 and GM-CSF.

6, a kind of method of expressing the fusion rotein of described diphtheria toxin of claim 1 and GM-CSF, it is encoding gene insertion procaryotic cell expression carrier with the fusion rotein of described diphtheria toxin and GM-CSF, acquisition contains the recombinant expression vector of encoding gene of the fusion rotein of described diphtheria toxin and GM-CSF, again described recombinant expression vector is imported intestinal bacteria, screening obtains expressing the engineering cell of the fusion rotein of described diphtheria toxin and GM-CSF, cultivate described engineering cell, express the fusion rotein that obtains described diphtheria toxin and GM-CSF.

7, method according to claim 6 is characterized in that: described expression vector is pSE420, pET3a, pET11a, pET22a, pET30a, pRSET, pDOGA or pBV220.

8, method according to claim 6 is characterized in that: described intestinal bacteria are colibacillus DH5 α, E.coli TB1 or E.coli BL21 (DE3).

9, according to claim 6,7 or 8 described methods, it is characterized in that: described expression vector is pSE420, the fusion rotein encoding gene of described diphtheria toxin and GM-CSF inserts NcoI and the BamHI site of pSE420, described intestinal bacteria be e. coli bl21 (DE3, pLysS).

Images