CN101044152A - Methods and compositions for combination rnai therapeutics - Google Patents

Methods and compositions for combination rnai therapeutics Download PDF

Info

Publication number
CN101044152A
CN101044152A CNA2005800119560A CN200580011956A CN101044152A CN 101044152 A CN101044152 A CN 101044152A CN A2005800119560 A CNA2005800119560 A CN A2005800119560A CN 200580011956 A CN200580011956 A CN 200580011956A CN 101044152 A CN101044152 A CN 101044152A
Authority
CN
China
Prior art keywords
sirna
composition
vegf
experimenter
target
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CNA2005800119560A
Other languages
Chinese (zh)
Inventor
B·－J·李
P·Y·卢
M·C·伍德尔
F·Y·谢
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Silence Therapeutics PLC
Original Assignee
Intradigm Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Intradigm Corp filed Critical Intradigm Corp
Publication of CN101044152A publication Critical patent/CN101044152A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/17—Immunomodulatory nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)

Abstract

Compositions and methods containing mixtures of siRNA molecules that target genes associated with disease are provided. The mixtures of siRNA molecules provide greater efficacy in reducing expression of disease-associated genes than individual siRNA molecules.

Description

The method and composition of combination rnai therapeutics
The application requires the right of priority of the U.S. Provisional Application series number 60/541,776 of submission on February 5th, 2004, and its content integral body by reference is attached to herein.
Invention field
The invention provides the method and composition that uses the RNAi drug regimen.This method comprises the therapeutics of cancer, transmissible disease and inflammation.Combination rnai medicine of the present invention can comprise i.e. " trans " (separate species, the i.e.in " trans ") of kind separately, or single kind is " cis " (single species, i.e.in " cis ").In one embodiment, described combination is to contain the siRNA oligonucleotide cocktail (cocktail) of the short dsRNA duplex of a plurality of drug targets of a plurality of targets (siRNA-OC).
The present invention is based on following two important understanding: (1) RNAi comprises by certain section that can mate targeted drug but has the very effective exonuclease treatment medicine that the sequence (21-23nt or 24-25nt or 26-29nt) of identical chemical property is formed; (2) most of diseases are controlled by a plurality of biochemical route, and these biochemical route are controlled by a plurality of genes and protein usually, and often by endogenous and Combination Control extrinsic factor.Therefore and since the chemical uniformity of siRNA duplex and a plurality of disease initiating radical because of the synergistic effect that produces of downward modulation, use the combination of the RNAi medicine of a plurality of disease controlling genes of target to represent favourable methods of treatment.According to the present invention, siRNA-OC is the combination of the siRNA sequence of a plurality of genes of target, described combination is different ratios in some cases, has multiple physical aspect (for example solution or powder) in some cases, and use simultaneously by identical approach in some cases, use by different approaches or at different time in other cases.
Background of invention
Human diseases is the pathologic process of a complexity, shows as the different disease symptoms of severity.Many human diseasess be by from human body self and/or from the disease initiating radical of exogenous infection biology because of or the unusual overexpression of disease controlling gene cause.The development of progression of disease and drug resistance can get around the effect of single medicine treatment.A strategy that overcomes these obstacles is to use the combination of a plurality of medicines.
Being combined in of medicine medically is the way of standard, and often the doctor by each patient carries out.This is particularly evident in oncology, and chemotherapeutic being combined in of wherein developing for each class cancer obtained significant improvement on the anticancer function, and toxicity reduces.An example is the use of docetaxel, ifosfamide and cisplatin combined treatment, with the multiple bone metastatic carcinoma (2) of treatment oropharynx cancer companion prostate cancer generation.Another example is to treat ulcerative colitis (3) with the combination of reflunomide, metronidazole and vancomycin.Also having an example is rosiglitazone to be added in the combination of glimepiride and N1,N1-Dimethylbiguanide therapy treat control insufficient type ii diabetes (4).Though these clinical studyes have demonstrated significant treatment benefit because different pharmaceutical has this facts of different chemical character, pharmacokinetics, pharmacodynamics etc., toxicity and unfavorable interactional potential may be a main problem all the time.Therefore, how benefiting from the combination of medicine is problem after the medicine listing, and this has been ignored by the medical practitioner.But recently, the retrovirus drug regimen has been obtained clinical benefit for the treatment of AIDS in single product.This combination still depends on the mixture of the medicine with different chemical and pharmacological property, and this makes its exploitation become complicated, and continues patient is caused risk.Therefore, have the demand to the method for the many aspects of control disease, this method is earlier based on the Research of Animal Model for Study of disease, and then carries out clinical study or enter the listing latter stage of drug use.This will reduce the unfavorable interactional risk that pharmacology (for example pharmacokinetics and the pharmacodynamics) difference that causes because of the different chemical character of used medicine in the combination causes.This demand can satisfy by the mixture of medicine, and wherein said medicine has consistent drug effect.
Summary of the invention
Therefore, a target of the present invention provides the composition that can be used for for example treating disease, and wherein said composition contains the combination of the siRNA duplex of energy inhibition of gene expression.
Another target of the present invention provides improving one's methods with the combined therapy disease of the siRNA duplex of energy inhibition of gene expression.
According to these targets, the invention provides the composition that contains at least two siRNA duplexs and medicine effective carrier, wherein the double-stranded physical efficiency of each siRNA suppresses the expression of gene relevant with lysis.Described gene can be different genes.
In one embodiment, described composition comprises at least three siRNA duplexs, and the double-stranded physical efficiency of described siRNA for example suppresses at least three gene orders, comprises the expression of three open reading-frame (ORF)s and three mRNA.Described gene can be endogenous people's gene and/or they can be the foreign gene of one or more pathogenic agent.
Described composition can be used to treat and is selected from following disease: cancer, autoimmune disease and inflammatory diseases and the other diseases that is caused or increased the weight of by the unusual overexpression of a plurality of genes.
In another embodiment, the siRNA duplex can be the chemosynthesis form, contains the chemically modified RNA base of natural RNA base and/or RNA base analogue.
For example, described composition can give by local injection, suction, local creme, skin patch, perhaps sends by intravenously (IV), intraperitoneal (IP) or intramuscular (IM) injecting systems.
In one embodiment, described composition can contain aagctcctaattacactcaac; Aaggatgaggaaggcaattta; Aaggataagtcagctcaatgc; And aactggcacactacttgtcga, and can be used for for example treating the intravital coronavirus of experimenter.
In another embodiment, described composition can contain AAGCCGTCCTGTGTGCCGCTG; AACGATGAAGCCCTGGAGTGC; AAGTTAAAAGTGCCTGAACTG; AAGCAGGCCAGACTCTCTTTC; AAGCTCAGCACACAGAAAGAC; And AATGCGGCGGTGGTGACAGTA, and can for example be used for the treatment of illness in eye.
In a further embodiment, described composition can contain the combination of the siRNA duplex of the expression that can suppress VEGF, VEGF R2 and VEGF R1, wherein said duplex is selected from Figure 17, and described disease can for example be selected from eye neovascularization diseases such as moist age-related macular degeneration (AMD), diabetic retinopathy and stromal keratitis, various types of cancer, rheumatoid arthritis and lung blood vessel generation disease.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of VEGF, VEGF R1 and VEGF R2, described duplex is selected from Figure 17 SS1, SS2 and SS3, and can for example be used for the treatment of cancer, eye neovascularization such as moist age-related macular degeneration, diabetic retinopathy, peripheral retina neovascularization or glaucoma.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of EGF acceptor, VEGF and FGF, described duplex is selected from Figure 17 SS1, SS2 and SS3.In another embodiment, described composition can contain the combination of the siRNA duplex of energy target EGF acceptor, vegf receptor and FGF receptor mRNA sequence, and described duplex is selected from Figure 17 SS1, SS2 and SS3.These compositions can for example be used for the treatment of in experimenter's the method for cancer.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of androgen receptor, VEGF and AMACR, described duplex is selected from Figure 17 SS2 and SS53, described disease can be prostate cancer.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of VEGF, c-Met and PCDP10, described duplex is selected from Figure 17 SS2, SS4 and SS5, described disease can be liver cancer, lung cancer and colorectal carcinoma.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of HGF, c-Met and VEGF, described duplex is selected from Figure 17 SS2, SS3, described disease can be liver cancer.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of EGF acceptor, VEGF and p53 mutant, described duplex is selected from Figure 17 SS1, SS2 and SS3, described disease can be lung cancer.
In another embodiment, described composition can contain can target HPV 16 and the combination of the siRNA duplex of the mRNA sequence of E6, the E7 of HPV18 and human P 53 mutant, and described disease can be cervical cancer.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of MMP-2, PDGF-R and α v β 3 integrins, described disease can be cancer.
In another embodiment, described composition can contain the combination of the siRNA duplex of energy target TNF α, IL-1 and IL-1 receptor mRNA sequence, described disease is an inflammatory diseases, for example rheumatoid arthritis, uveitis, psoriasis or Crohn disease.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of IL-9, IL-4 and IL-5, described disease can be asthma, pulmonary fibrosis or ARDS.
In another embodiment, described composition can contain can target RSV virus virus nucleocapsid albumen, non-glycosylated in the combination of siRNA duplex of mRNA sequence of virion protein and transmembrane glycoprotein (F), described duplex is selected from Figure 17 SS6, and described disease can be rsv infection.
In another embodiment, described composition can contain can target the combination of siRNA duplex of mRNA sequence of spike protein, RNA polymerase and rna replicon enzyme of SARS-CoV, described duplex is selected from Figure 17 SS7, described disease can be SARS.
In another embodiment, the invention provides by testing experimenter's above-mentioned composition and measuring the method that changes in gene expression among the experimenter is carried out target validation.
The accompanying drawing summary
External the striking to the VEGF pathway gene of Fig. 1 .siRNA mediation subtracts effect.RAW264.7NO (-) cell (A) in the 35-mm hole and SVR cell (B) use the siRNA (two target sequence a+b etc. molar mixture) of target mVEGFA and mVEGFR1 with the indicatrix transfection respectively.293 cells (C) with the plasmid of the siRNA of target mVEGFR2 (molar mixture that waits of two target sequence a+b is used for subsequently experiment) and expression mVEGFR2 with the indicatrix cotransfection.Cell RNA 24 hours (RT-PCR) or 48 hours (RS-PCR) after transfection separates, and the situation of subtracting of striking of the endogenous expression of mVEGFA or mVEGFR1 or the heterogenous expression of mVEGFR2 is measured by RT-PCR (mVEGFA) or RS-PCR (mVEGFR1 and mVEGFR2).
Fig. 2. the siRNA of local delivery target VEGF pathway gene can suppress CpG ODN inductive blood vessel to be taken place.In the little bag of mouse cornea, implant CpG ODN (1_g) after 24 hours, give mouse (every of 10 μ g) siLacZ, siVEGFA, siVEGFR1, siVEGFR2 or siVEGF mixture (total siRNA of target VEGF pathway gene etc. molar mixture) by subconjunctival injection.Implanted (every group of four mouse) back the 4th day and the 7th day measurement blood vessel generation area at CpG microballoon (pellet).A: each the group between observe the angiogenic area have statistical significant difference ( *, P＜0.05; *, P＜0.01).B: implant the back at the CpG microballoon and passed through stereo micrography imaging system pickup image on the 7th day.Original magnification x40.
Fig. 3. system's delivery needle can suppress the generation of CpG ODN inductive blood vessel to the siRNA of VEGF pathway gene.At the mixture of the single siRNA of VEGF pathway gene or total siRNA, induce at CpG ODN and to send by tail vein injection with TargeTran in back 6 hours and 24 hours.Implanted (every group of four mouse) back the 4th day and the 7th day measurement blood vessel generation area at the CpG microballoon.A: each the group between observe the angiogenic area have statistical significant difference ( *, P＜0.05; *, P＜0.01).B: implant the back at the CpG microballoon and passed through stereo micrography imaging system pickup image on the 7th day.Original magnification * 40.
Fig. 4. polymkeric substance is to the raising and the dose response experiments of siRNA system delivery efficiency.The mixture of siVEGF pathway gene or siLuc contrast (40 μ g) is induced back 6 hours and 24 hours to contrast with polymkeric substance or PBS at CpG ODN and is sent.Implanted (every group of four mouse) back the 4th day and the 7th day measurement blood vessel generation area at the CpG microballoon.A: each the group between observe the angiogenic area have statistical significant difference ( *, P＜0.05).Mixing siRNA with target VEGF pathway gene has carried out dose response (10,20,40 and 80 μ g siRNA) experiment with the polymkeric substance in system's delivery system.After implanting CpG ODN the 4th day and measured each blood vessel generation area of every group of four mouse, the anti-angiogenic efficient between the more different siRNA dosage on the 7th day.
Fig. 5. the siRNA that gives target VEGF pathway gene has reduced HSK severity and angiogenic reaction.Mouse is with 1 * 10 5PFU HSV-1RE/ eye infects, and the 1st day and the 3rd day are sent by part or system with polymkeric substance with siVEGF mixture or siLuc and handled after infection.Average HSK mark (A) and the angiogenic mark (B) of damaging of calculating in the 10th day behind virus infection.Each point is represented the clinical scores of eyes.The mean value that numeral in horizontal bar and the bracket is every group.Data obtain from two independent experiment compilations being made up of every group of six eyes. *, observe HSK or blood vessel generation mark has statistical significant difference (P＜0.05) between each group.In the 14th day discovery blood vessel hypertrophy and ulcer phenomenon in the infected cornea of siLuc processing mouse after the infection.The mouse of C:siVEGF mixture process shows lower neovascularization near the corneal limbus zone.
Fig. 6. infected and descend by VEGF mRNA level in the cornea of part or system's delivery process with the siVEGF mixture.With 1 * 10 5PFU HSV-1RE infecting mouse, (10 μ g are under the conjunctiva by topical administration the 1st day and the 3rd day after infection; S/C) or system give (40 μ g, tail vein) and handle with the siRNA of target VEGF pathway gene, after infection, from mouse, collected two subtended angle films in the 4th day or the 7th day, then by RT-PCR (A) or quantitatively PCR in real time (B) measure VEGF mRNA level.
Fig. 7. infected and descend by vegf protein level in the cornea of part or system's delivery process with the siVEGF mixture.After infection, handled every mouse two subtended angle films on the 7th day, to measure the vegf protein level.Press described in material and the method, estimate to infect and with the VEGF level of the cornea lysate supernatant of the mouse of the siRNA processing of target VEGF pathway gene with HSV-1 by antibody capture ELISA.The result represents with the average SD of four independent mouse (every mouse two subtended angle films). *, observing the vegf protein level between each group has statistical significant difference (P＜0.05).
Fig. 8. after host cell was handled with siRNA duplex SC2, SC5, SC14 and SC15 then with the sars coronavirus infection, sars coronavirus output changed.
Fig. 9. according to the mensuration of RT-PCR to viral genome copy, compare with single siRNA inhibitor, even compare with increasing dosage, the combination of siRNA inhibitor causes the sars coronavirus inhibitor that obtains to be improved.
Figure 10. according to the plaque test mensuration to virus titer, compare with single siRNA inhibitor, even compare with increasing dosage, the combination of siRNA inhibitor causes the sars coronavirus inhibitor that obtains to be improved.
The tumor growth of Figure 11 .siRNA mediation suppresses.Send to strike by administration in the tumour with the ICT-1053 specific siRNA and to subtract PDCD 10 and express, cause tumor growth to be suppressed.
The tumor growth of Figure 12 .siRNA mediation suppresses.Send to strike by administration in the tumour with the ICT-1052 specific siRNA and to subtract c-Met, cause tumor growth to be suppressed.
The tumor growth of Figure 13 .siRNA mediation suppresses.Send to strike by administration in the tumour with the ICT-1027 specific siRNA and to subtract Grb2 genetic expression, cause tumor growth to be suppressed.
Figure 14. siRNA subtracts striking of ICT1052 and ICT-1053 gene and causes cell-proliferation activity significantly to be suppressed in cell culture (MDA-MB-435 cell) research.
The activation of the apoptosis of tumor cells of Figure 15 .siRNA mediation.Strike with the ICT-1027 specific siRNA and to subtract Grb2 genetic expression, cause transfection after 48 hours apoptosis be activated.
Figure 16. combination siRNA inhibitor (SC2 and SC5) suppresses the SARS symptom in the model of rhesus monkey.(a) the following expression of the medial temperature of every group of every day: (IC) opening circle, (NS) open squares, (PL) rhombus of remaining silent, (CD) the remain silent square and (PE) trilateral of remaining silent.Every group of raw data that regression analysis marks from figure calculated.Every group mean body temperature from 4 individual calculating, calculates from 2 individualities later on before 7d.p.i..(b) the comfortable 10d.p.i. of anti-SCV antibody test organizes the serum sample of collecting from control group and PL.Titre increases to 19d.p.i. always, and this moment, the sample of CD group and PE group also transferred the positive to.(c) compared the average lung tissue disease mark of science of each control group and treatment group.( *) expression P＜0.05.(D) quantitative comparison of SCV cells infected counting between each group.( *) expression P＜0.05.
Figure 17 (appendix II) shows used siRNA target sequence in the combination treatment.
Detailed Description Of The Invention
The invention provides the group of the RNAi medicine of a plurality of molecular entities or individual molecule entity form Close, with the treatment disease. Most of diseases are controlled by a plurality of biochemical route, and most of biochemical way The footpath is controlled by a plurality of factors (normally gene and protein) usually. The invention provides these diseases Sick effectively RNAi combination, described combination comprises a plurality of biochemical route or single biochemical route A plurality of factors or both effective RNAi. In one embodiment, described a plurality of biochemical way The footpath is endogenous mammal approach or factor; In another embodiment, described biochemical route With factor across mammal approach and infective virus approach; In another embodiment, Described biochemical route and factor belong to infective virus fully. As mentioned below, side of the present invention Method can be used to treat the various diseases that relates to a plurality of approach.
Cancer:
Cancer is the disease that is caused by multiple inherent cause and environmental hazard. Intrinsic oncogene and former Oncogene mutation is the main priming factors of various types of cancers. Many these genes are complete Identified come out: K-ras, c-Myc, a-raf and Bcl-2 etc. Various growth factor FGF-2s, The overexpression of VEGF, PDGF, EGF and sudden change tumor suppressor genes Rb and p53 is to dislike The characteristic feature of sex organization. Growth often is the result of hyperplasia sexual cell pathology before cancer or the cancer, Be commonly called malignant tumour. Local organization can be invaded and destroy to malignant tumour. Some is pernicious swollen Knurl is diffused into system by blood or lymphatic system, and malignant tumour is unpredictable and uncontrolled Growth is so that malignant cancer is dangerous and even in many cases fatal. This tumour is on morphology Not that original structure is peculiar, and not besieged. Malignant tumour is back and forth past behind excision Send out. Therefore, the treatment of proliferative disease generally is target hyperplasia sexual cell activity, as pernicious The cytoactive that occurs in cancer or the malignant tumour, purpose are to intervene the hyperplasia process. Some is thin Born of the same parents' biochemical route is activated in the different phase of hyperplasia process.
Hypoxemia (hypoxgia) is the early stage priming factors of a kind of key of blood vessel generation, and hypoxemia causes Produce nitric oxide synthase, be responsible for control vascular tone and the growth regulation factor such as blood vessel endothelium Being subjected to of growth factor (VEGF), angiogenesis hormone, fibroblast growth factor and they Body. Participate in the gene of matrix metabolism, comprise that matrix metalloproteinase, activator of plasminogen are subjected to Body and inhibitor and collagen prolyl hydroxylase also have been reported as in the blood vessel generating process Important participant. By using the RNAi inhibitor, the earth to the utmost has promoted particular blood vessel is sent out Give birth to the function of the specific function of the factor and confirm that described RNAi inhibitor can disclose and relate to VEGF Mutual work between the network of the early stage activation of approach, matrix metalloproteinase and the adhesion molecule With, cause signal transduction pathway to be conditioned. Tumor angiogenesis because of its growth of solid tumor and Developing effect, its importance are by extensively approval (5). Generally acknowledge that now blood vessel takes place not only for swollen Knurl growth institute is essential, and involve by front malignant tumour to the initial stage progress of invasive cancer with Involve the dormancy micrometastasis and shift the growth that damages to clinical the detection.
The factor in the VEGF approach
VEGF family is by the member composition of five energy combinations and three unique acceptors of activation.
VEGF-A is in conjunction with VEGFR1 and VEGFR2 and placenta growth factor (PIGF), VEGF-B Only in conjunction with VEGFR1. VEGF-C and VEGF-D are in conjunction with VEGFR2 and VEGFR3. Permitted Many disease associations process plays the effect of raising vegf expression. Transcription factor HIF-1 is hypoxemia The crucial decisive factor of the gene expression of regulating. Suppressing HIF-1 α with specific siRNA obviously cuts Weak luring Heme oxygenase I (HO-1), phosphoglyceric kinase (PGK) and vegf expression Lead (6), show the effect of HIF-1 α in oxygen dependence sexual cell periodic adjustment. PgR (PR) Effect in the preferential adjusting of B vegf expression in breast cancer cell gets with specific siRNA To identify (7). By finding based on the test of cell, with the siRNA duplex the HeLa cell, But specificity is struck and is subtracted VEGF in ovarian cancer cell and the melanoma cells165Expression (8). In addition A research in, the specific siRNA duplex can make the inhibition splice variant of VEGF (VEGF165b) silence, although VEGF antibody can not be distinguished this variant and other VEGF165The difference of isotype (9). Use these specific siRNAs, the merit of this inhibition splice variant Can further be characterized, though just in the glomerulus VEGF output height can not lead yet The hyperamization pipe takes place. The existence that this montage of vegf expression is changed the mechanism has represented uses siRNA Inhibitor carries out the intervention point that merit attention for the treatment of of cancer. At the MDA-435 heteroplastic transplantation model In to have proved that siRNA duplex by intra-tumor delivery target VEGF can suppress mammary gland swollen Knurl growth (10). In the PC-3 heteroplastic transplantation model, use atelocollagen (atelocollagen) conduct The delivery vector of administration is also observed Tumor angiogenesis and growth in the VEGF-siRNA tumour Be suppressed (11). For other a kind of disease indication, will in the Rat retina model The inhibitor of the CNV (CNV) that VEGF-siRNA induces as laser photocoagulation (12). By being administered systemically, can make the anti-blood of siRNA mediation with the nano particle of part guiding The active symptom that can suppress the infection induced eye neovascularization of HSV in the mouse takes place in pipe (13).
When striking with Shb-siRNA when subtracting SH2 domain adapter protein (Shb), VEGF relies on The sexual cell migration reduces, and causes the stimulation of phosphatidyl-inositol 3-kinase, the phosphoric acid of focal adhesion kinase Change, stick together the generation of spot and the stress fiber of response VEGF and form reduction (14). Another kind exists The protein IQGAP 1 that expresses in the endothelial cell (EC) is found to mediate by siRNA IQGAP1 strikes the ROS production, Akt phosphorylation, the endothelium that subtract effect participation VEGF stimulation and moves Move and breed (15). The eye that uses neuroblastoma homology tumor model (16) and HSV to induce Neovascularization model (13) has specific siRNA duplex to press down to mouse VEGFR2 Blood vessel generation phenotype processed causes tumor growth and neovasculature area significantly to reduce. Equally, There have specific siRNA duplex also can show in the mouse phantom eye to mouse VEGFR1 to be anti-Blood vessel have an effect (13).
Above result shows, by suppress with the specific siRNA oligonucleotides HIF-1 α, Shb, IQGAP1, VEGF-A, VEGF-B, VEGF-C, VEGF-D, VEGF-R1 With the expression of VEGF-R2, people can be in mammalian cell cultures and various animals Obtain anti-angiogenic having an effect in the disease model.
Matrix metalloproteinase and adhesion molecule
Although most of blood vessel BM compositions can be kept growth, survival and the health of blood vessel endothelium, But occurred having an effect and the matrix gold of anti-angiogenic crucial amboceptor of having an effect as blood vessel Proteases (MMP) and blood vessel integrin. Proved that MMP9 and MMP2 are for hidden The mobilization of VEGF and the initiation of Tumor angiogenesis are important (17), and in integrin is What take place between chrotoplast and the BM composition can activate integrin-receptor signal conduction and cell merit The interactional main amboceptor (18) of can as breed.
Strike with specific siRNA and to subtract MMP-9 (19) and follow and cause surperficial E-cadherin water Flat improve, beta-catenin associates in the redistribution of plasma membrane and with the physics of E-cadherin Effect. In the cell culture test, ox main artery smooth muscle cell (BASMC) and condition training The foster base together minimizing of its migration of causing of incubation can to MMP-2 (not be by siRNA MM-9) specificity of expressing is struck and is subtracted effect and reverse (20) fully. For indirect is lived to MMP The property induce, regulate base with the matrix metalloproteinase that the downward modulation of siRNA duplex specificity is novel Because of RECK (21). It is suppressed that the decline that RECK expresses causes MMP-2 to activate. Other In the research, siRNA mediation to endogenous and all over striking at Mint isotype albumen Mint-3 Subtract effect and cause film 5 type matrix metalloproteinase (MT5-MMP) activity inhibited (22), hint Mints is as the adapter protein of the transportation of regulating MT-MMP.
CD44---a kind of cell surface that participates in cell-cell interaction, cell adhesion and migration The cutting of glycoprotein helps migration and the intrusion of tumour cell. It can be pressed down by metalloproteinases The inhibitor of organizing of Formulation K B-R7785 and metalloproteinases s-1 (TIMP-1) suppresses, but can quilt Metalloproteinases-de-connect albumin A DAM10 catalysis, this is subtracted by the striking of siRNA mediation and acts on With proof (23). Another kind of different cell surface molecule CD 13/ amino peptide N (CD 13/APN) Be accredited as effective instrumentality that blood vessel takes place, its transcribing by VEGF in endothelial cell Induce by the RAS/MAPK approach. When reducing Ets-2mRNA with the Ets-2 specific siRNA During with protein, disclosed the effect (24) of Ets-2 in the inducing of CD 13/APN. Another kind of Metalloproteinases-de-connect albumin A DAM12 in the C2C12 sarcoblast, to be situated between by siRNA Striking of leading subtracts effect and obtains characterizing, show the ADAM12 mediation stick together and/or the signal conduction exists Play crucial effect (25) in the sarcoblast atomization in the decision in reserve cell storehouse. This Protein also is confirmed to be and involves film grappling proHB-EGF dependence EGFR trans-activation work With the key enzyme (26) that comes off of extracellular domain. When in the HT1080 cell, using Pacsin 3 ( Plant the protein in conjunction with ADAM12) when specific siRNA was arranged, this endogenous gene was struck Subtract and to weaken coming off of proHB-EGF that TPA and Angiotensin II induce. Sticking together spot swashs Enzyme (FAK) with the sticking together of collagen in play crucial effect. Use the FAK specific siRNA Strike and subtract FAK and express, cause to collagen I stick together and with collagen iv and fibronectin Stick together obviously bigger inhibitory action (27).
The integrin molecule in the born of the same parents of signal directly can being transduceed, and can with other membrane receptor-mediated Signal pathway (comprising TGF β 1 approach) cooperation. When assessment cell in the stomach cancer cell variant sticks That that Erk1/2 to TGF β 1 mediation regulates does the time spent (28), and Smad2-siRNA is transfected into carefully Disclose the effect that Smad albumen activates at the Erk1/2 that strengthens TGF β 1 mediation in the time of among the born of the same parents. Smad albumen is the signal transduction egg of regulating a plurality of cell processes such as cell proliferation, apoptosis and differentiation White and transcript regutation protein. The crosslinked glass of carcinomebryonic antigen relevant cell adhesion molecule 6 (CEACAM6) Connect albumen (av β 3 integrins) and fibronectin (alpha 5 beta 1 integrin) to cancer of pancreas and the outer base of born of the same parents The effect of the cell interaction of matter composition is with causing the ECM composition to stick together the siRNA of raising The CEACAM6 of mediation strikes to subtract to act on and obtains characterizing (29). Integrin coupling kinases (ILK) By stimulating HIF1 α albumen table with PKB/Akt dependence and mTOR/FRAP dependence mode Reach to stimulate the expression of VEGF. When specific siRNA strikes when subtracting ILK and expressing, can be observed Endothelial cell migration, the external capillary of HIF-1 α and vegf expression and VEGF mediation Blood vessel is subjected to remarkable inhibition (30) in formation and the body. These digital proofs ILK in tumour The important function of two critical aspects that blood vessel takes place: the vegf expression of tumour cell and VEGF The vascularization that stimulates. What is interesting is, find a kind of vinculin PINCH-1 of wide expression Can form ternary complex (31) with ILK and α-parvin. Use striking of siRNA mediation to subtract, Find PINCH-1 and ILK, but be not α-parvin, for impelling cellular invasion and motion to be Essential.
PDGFr and the synergy of α v β 3 integrins in the spongioblastoma cell migration By PDGF the spread effect that vitronectin sticks together cell is studied, described spread effect is led Cause and promote the specificity of α v β 3 integrins is raised (32). Stick together in the cell at vitronectin, Lck/yes be correlated with novel protein (Lyn) in the situation that exists and do not exist PDGF to stimulate all Preferential and α v β 3 integrins contact. Cause with specific siRNA downward modulation Lyn expression The cell migration that α v β 3 integrins in the PDGF irritation cell mediate is significantly suppressed. Take place in the fibrotic liver, the destiny of sternzellen is by the centre of α v β 3 integrins Effect is affected by extracellular matrix, and this point is by making α (v) subunit silence obtain with siRNA Proof (33). In an other research, find α v β 3 integrins in microfilament and the endothelial cell Protein positive sticks together spot and engages. When Vimentin is suppressed by siRNA, the cell dress Join less than sticking together normally spot, demonstrate substrate sticked together decline (34). Study with siRNA The work of laminin adhesion receptor alpha 6 beta 4 integrin in the intrusion phenotype of many cancers With. The siRNA inhibitor of arbitrary subunit of target alpha 6 beta 4 integrin can reduce this The cell surface expression of integrin reduces the intrusion of MDA-MB-231 breast cancer cell (35).
Above the results show suppresses following various with the specific siRNA oligonucleotides The expression of film correlation factor: α v β 3 integrins, alpha 6 beta 4 integrin, Lyn, PDGFr, ILK, CEACAM6, Smad2, FAK, Pacsin 3, ADAM12, Ets-2, ADAM10, Mint-3, MMP-2 and MMP-9 will cause in the various cell types angiogenic active in lower Transfer.
Other participate in the acceptor that blood vessel takes place
Except VEGF and pdgf receptor, EGF-R ELISA (EGFR or erbB1) Downward modulation is showing anti-angiogenic chance of occurrence likely. When using RNAi in A431 people's epidermoid carcinoma Specificity and when (90%) strikes the expression that subtracts endogenous erbB1 in large quantities in the cell, the junket that EGF induces The propylhomoserin phosphorylation is suppressed, and cell proliferation reduces (36) because of inducing of apoptosis. On the other hand, Use the Her-2/neu-siRNA of retroviruse mediation to shift, infected mammary gland and ovary are swollen Oncocyte demonstrates that slack-off, the apoptosis of propagation increases, G0/G1 stagnates and increases and tumor growth reduces (37). It is also anti-with anti-angiogenic factor blood platelet that siRNA subtracts effect to striking of Her-2/neu expression It is relevant with the vegf expression minimizing to answer albumen-1 to express increase, shows that Her-2/neu can partly pass through Regulate blood vessel and stimulate tumor growth. When expressing S100A10 (outside the born of the same parents one of cell surface Kind of crucial plasminogen receptor) the pSUPER plamid vector transfection of specific siRNA is arranged During to colorectum (CCL-222) cancer cell, the downward modulation of S100A10 causes plasminogen in conjunction with damage Lose 45%, plasminogen dependent cell invasiveness completely loses (38). Use can be induced RNAi The mediation to endogenous CXCR4 (a kind of at blood vessel generation, host immune response, go back to the nest and tumour Play the protein of multiple-effect effect in the transfer) strike and subtract effect, cause the external migration of breast cancer cell Be subjected to remarkable inhibition (39).
When siRNA strikes to subtract and causes anoikis suppressed what pro apoptotic protein Bim (40) expressed After, Bim is accredited as the important amboceptor of endothelial cell anoikis. Participate in EGF for disclosing G protein coupled receptor (GPCR) signal transducting system of the cell surface protein enzymolysis of sample precursor And the communication between EGF acceptor (EGFR) signal transducting system, suppress to assess with siRNA The effect of amphiregulin (AR), the EGFR junket that described siRNA inhibition causes GPCR to induce Propylhomoserin phosphorylation, downstream mitogenesis signal conduction event, cell proliferation, survival amboceptor Migration and the activation of Akt/PKB are hindered. (41) make with siRNA in identical research Metalloproteinases-de-connect albumen TNF α invertase (TACE) silence, can suppress GPCR stimulates AR discharge, EGFR activates and downstream events.
Above the results show, with the specific siRNA oligonucleotides suppress following other The expression of receptor associated factor: TACE, amphiregulin, CXCR4, S100A10, Her-2/neu And ErbB-1, will raise epithelial apoptosis activity, blocking-up cell proliferation.
The factor in the signal transduction pathway
In general, VEGF is that activation by the activation signal pathway comes stimulating endothelial Migration, propagation and tissue, thus promote what blood vessel took place. VEGF is to sheath propylhomoserin kinases (SPK) Stimulation not only affect endothelial cell signal conduction, and affect the tumour of express VEGF receptors Cell (42). In the T24 bladder cancer cells, VEGF processes and has reduced cellular sheath propylhomoserin water Flat, improve simultaneously sheath propylhomoserin-1-phosphoric acid level. The SiRNA of target SPK1 rather than SPK2 Ras-GTP and phosphoric acid ERK accumulation that VEGF induces can be blocked, but EGF can not be blocked The phosphoric acid ERK1/2 accumulation of inducing. Give birth to liver cell for disclosing diacylglycerol kinases-α (Dgk α) Participation situation in the cell migration that the long factor (HGF) stimulates finds that siRNA is to the spy of Dgk α The opposite sex is struck and is subtracted effect and can weaken at the external blood vessel that makes, and this shows that Dgk α is for to VEGF Proliferative and animal migration to reply institute essential, and prove that it has consisted of and carry out blood vessel control takes place Novel medicine target (43) of science. In an other research, siRNA leads the inhibition of Mcl-1 Cause the minimizing of propagation and inducing of apoptosis, this has supported following opinion, and namely VEGF induces MM cell proliferation and survival be by Mcl-1 mediation, and for develop target Mcl-1 and/or The novel therapeutic drug provision of VEGF clinical front framework to improve multiple myeloma patients Final result (44). Growth retardation specific proteins 1 (Gasl) can be by the junctional membrane albumen in 293 cells Matter is that blood vessel endothelium cadherin (VEC) raises. Cell culture and allantois organ cultures In the anti-apoptotic effect of Gasl siRNA inducing endothelial cell opposing VEGF. Therefore, Gasl Represented another drug targets (45) that participates in the blood vessel generating process.
A key factor in the downstream signal transduction pathway of vegf receptor is that B-Raf swashs Enzyme, its constitutive activation MEK/ERK approach. This B-Raf and melanoma cells propagation Raising is reduced (46) strongly by the eliminating institute of the sudden change B-Raf albumen that siRNA mediates. When at the beginning of Make focal adhesion kinase (FAK) with siRNA in level human colon cancer cell and the SW620 colon cell When reticent, sticking together of Pressure stimulation is prevented from, the FAK397 of pressure activation, Src and FAK576 Phosphorylation also is eliminated (47). ILKAP is that the integrin associated kinase is in conjunction with serine/threonine Phosphatase 2C can optionally engage with integrin associated kinase ILK, and is thin to regulate Born of the same parents are sticked together with growth factor signal and are conducted. When suppressing ILKAP with specific siRNA, cell Entering the S phase increases these consistent with the ILK antagonism (48). IP2 polyphosphate (DIP) Effect also obtained characterizing by the downward modulation of siRNA mediation, after the EGF stimulation that prove in membrane portions DIP makes the Rho inactivation and activates Rac (49). Suppress Disabled-2 albumen with siRNA (DAB2) expression in the K562 cell causes the adjusting of cell-cell adhesion and mitogen to swash Protein kinase (MAPK) phosphorylation (50) of living. The SiRNA inhibitor strikes that to subtract PDK1 be 3-Phosphoinositide deopendent protein kinase-1 proves PDK1 and keeps stable state phosphorylation MEK level Relevant with Growth of Cells (51). What is interesting is that the downward modulation of PDK1 has reduced MEK and MAPK Activity, but can not prolong the MAPK signal conduction duration. (thryoid receptor is mutual for TRIP6 Effect albumen 6)/phase of ZRP-1 (zyxin associated protein 1) and lysophosphatidic acid (LPA) acceptor Mutual effect is subjected to resetting, stick together the spot assembling LPA's relevant with cell migration with actin Induce (52). When TRIR6 in the SKOV3 ovarian cancer cell is reticent by siRNA, its Effect in the cell migration that LPA induces obtains disclosing.
Above experimental result proves, uses the specific siRNA oligonucleotide to suppress the expression of the following various signal transduction factors: TRIP6, PDK1, DAB2, ILKAP, B-Raf, Mcl-1, Dgk α and SPK1 will cause blocking VEGF inductive blood vessel to take place.
The anti-VEGF siRNA of treatment cancer
There are three kinds of diverse ways to obtain cancer therapy with anti-angiogenesis inhibitor activity: (A) to activate the endogenous angiogenesis inhibitor factor; (B) external source is sent the angiogenesis inhibitor factor; (C) send inhibitor to reduce the activity of endogenous short angiogenesis factor.RNAi tires because of the height that it carries out in the sequence-specific mode, is to suppress the active useful especially means of drug targets, and this is well proved in the active cell culture studies of angiogenesis inhibitor.But the treatment of RNAi is used and will could be realized (53) after the angiogenesis inhibitor effect in the body that obtains the siRNA medicine with feasible clinically delivery system.
Adopt the intra-tumor delivery of anti-VEGF siRNA, in the xenotransplantation tumor model of several end user's breast cancer cell MDA-435 and MCF-7, observe tumor growth and be suppressed (10).Those siRNA medicines that activity in vivo is confirmed give lotus neuroblastoma mouse with the further system of nano particle carrier that part leads, and are causing significant tumor inhibition effect (16) behind the dosed administration repeatedly.The local delivery that has recognized that antitumor drug is confined to a few tumor type, and clinical correlation is very low.Therefore, people profoundly recognize, it is the prescription formula of passing of feasible clinically treatment metastatic carcinoma that the system of siRNA duplex sends.In the tumour of endogenous expression thrombospondin-1 (TSP1) and VEGF, when downward modulation VEGF sends in the system that adopts thick anti-VEGFsiRNA, can make the effect of the TSP 1 that reduces neovascularization and tumor growth be restored (54).In identical report, curious is when siRNA is delivered locally to tumour, does not observe vegf expression and change.In an other research, adopt delivery system in the tumour and be the siRNA that carrier gives the people VEGF that target expresses from the subcutaneous xenotransplantation tumour of PC-3 with end collagen, cause tumor vessel to take place and tumor growth by significantly inhibition (11).More than clinical before efficacy study represented exploitation based on the unremitting effort of the treating malignant tumor of siRNA with the angiogenesis inhibitor medicine.
Be angiogenesis inhibitor effect in the body that obtains multiple siRNA inhibitor, have and above-mentionedly variously pass drug carrier and approach can be supplied usefulness.SiRNA is carried out intra-tumor delivery with chemosynthesis reagent such as liposome, polymkeric substance or other aqueous solution or with 5% g/s damping fluid, carry out electroporation, supersound process or other enhancement process then, this is to allow the effective ways of siRNA inhibitor transfection in the tumour cell.Use contains RGD part guiding nano particle this system binary target (neovasculature target and short blood vessel producer target) the siRNA delivering method of multiple siRNA inhibitor, be feasible clinically, can be used to send the siRNA medicine with the treatment human cancer.
There are other approach in tumor growth, to play important effect, for example somatomedin, cytokine, kinases and transcription factor.Many in tumor tissues by the factor that relates to relational approach of overexpression, will be that siRNA cancers mediated treatment is with striking the good targets that subtracts effect.Reduce a plurality of oncogene of same approach or different approaches with multiple siRNA inhibitor, can realize stronger efficacy of anti-cancer.The clinical standard of current cancer therapy often relates to be combined different methods of treatment with different medicine modalities.
Inflammatory diseases
Rheumatosis
Rheumatosis such as rheumatoid arthritis, scleroderma, lupus, polymyositis, dermatomyositis, fibromyalgia, psoriatic arthritis, rhizomelic spondylitis, conjunctivo-urethro-synovial syndrome and adolescency rheumatoid arthritis are modal autoimmune diseases.They comprise the serious kidney disease that influences developed country's 1% above population (accounting for millions of patients in the whole world).This disease is caused by the local inflammation reaction, causes pain and infringement normal organ function to exercise, and influences patient's daily routines.
The key of performance therapeutic efficiency is the RNAi medicine is delivered to the assembly of affected skin area and/or musculoskeletal system; The RNAi medicine must be had an effect in the disease location part could be effectively.The present invention relates to several realizations and pass the strategy of medicine to skin and musculoskeletal system.Since protein also meant for musculoskeletal disease (as osteoarthritis, osteoporosis, osteomyelitis, ridge is narrow, the inherited disease of reticular tissue, the bone forming disease, handkerchief Jie Teshi disease, shellfish Sai Teshi disease, bursitis/tendonitis, gout, Di Xienashi muscular dystrophy, myotonia atrophica, limb-girdle muscular dystrophy, several diseases of muscle ionic channel or contractile protein and neoplastic disease) and dermatosis (as vitiligo, psoriasis, alopecia circumscripta, the imperfection wound is repaiied, neoplastic disease, pemphigus, pemphigoid, acne, ischemic necrosis, atopic dermatitis, scleroderma, acne erythematosa, the inherited disease of reticular tissue, skin infections and inflammation, pruritus and Hypertrophic scar and keloid) possible target, we have been confirmed sends the RNAi medicine and to ability hint the present invention of these tissues and reticent specified protein the symptom of these disease categories is alleviated.
There is the medicine of several inhibition as the inflammation outbreak incident of the feature of these diseases.Regrettably, these medicines may lack effect or cause serious side effects, and the tolerance to its therapeutic action may occur.Not only effectively but also can avoid side effect maybe can select (as reflunomide, antibody, antisense therapy, gene therapy, soluble receptors, trapping type acceptor, receptor antagonist or agonist etc.) to replenish the new medicine of rheumatosis of additional benefit, will mean tangible health advantages for other treatment.The siRNA inhibitor can be used to strike TNF, IL-1 and the acceptor thereof that subtracts overexpression in the mammalian cell.Subtract several these cytokines and acceptor thereof by striking simultaneously, inflammatory activity capable of blocking, thus palliate a disease the symptom progress.
Illness in eye
Eye neovascularization (NV) is the abnormality proliferation of neovascularity in the eyes, is the early stage pathology step of many illness in eye, is to cause permanent blind common cause at US and European.Several main illness in eye are arranged, can impel unusual neovascularization and eyes are caused further infringement.
A diabetic retinopathy (DR) can take place when suffering damage for the tiny blood vessels of retina oxygen supply.Described infringement can allow blood and body fluid escape in the retina, but also causes the neovascularity growth.These neovascularity are more crisp, tend to hemorrhage in eye vitreous.The patient who suffers from the DR of severe form does not add treatment will the material risk that causes the severe visual forfeiture.In these diseases, neovascularization is the result of disease, and can make things worse.All are all caused by multiple harmful expression of some disease gene.
The outstanding symptom of these illness in eye is eye neovascularizations, and this is the major cause that patient loses one's sight.The neovascularization process is the result of vegf protein and acceptor overexpression thereof.Therefore, strike that to subtract these short blood vessel producers are a kind of effective meanss, be used in combination multiple siRNA inhibitor and can obtain stronger effect.
Virus infection can be treated by striking the expression that subtracts virogene or the cytokine gene by regulating patient.
Transmissible disease
Numerous disease is to infect the perhaps infected result who increases the weight of.The exploitation virus infection methods of treatment aspect making progress, even but to any virus research for many years after, treatment means still be the deficiency.When new virus infection occurs,, need new methods of treatment as sars coronavirus.The present invention relates to transmissible disease and infect the disease increase the weight of such as the combined therapy of HPV cervical cancer.The disease combination that method and composition described below can be applicable to treat infection and hereinafter do not have to describe, so the virus of not being familiar with as yet treated.
The target sars coronavirus is with treatment SARS
In the long river of human history, there are many transmissible diseases to seize people's life.SARS epidemic situation in China and Canada's appearance has made hundreds of people cause death recently.Scientist in the many laboratories in Asia, Europe and North America attempts to determine the cause of disease of SARS always in diligent work.Not separated before, order-checking by the coronavirus among understanding patient SARS, and in monkey model, test.This new coronavirus is first the candidate's cause of disease that causes SARS, by World Health Organization's called after sars coronavirus.Sars coronavirus is a kind of have justice and single stranded RNA, can cause one of human most popular transmissible disease.The virulence of sars coronavirus is produced by following reason: i) it is propagated by aerosol and other interpersonal touching indirectly easily; ii) it can be by (the antigenic drift of frequent change virus antigen; as influenza virus) escape from protective immunity, iii) reprovision or mix RNA section (antigenic drift) the new virulent strain of virus is occurred rapidly between two virus not of the same race.The threat of this new strain of sars coronavirus is very serious, although because people have done great effort, but still does not have effective therapy or vaccine to prevent and treats sars coronavirus and infect.SARS CoV proteinogen (proprotein) replicative enzyme 1 (ppl) is to be first kind and unique a kind of gene product of template expression with the viral RNA genome.(Fig. 1 a) is further processed into about 12 Nonstructural Proteins for Ppla and pplb.Nsp-1 may be the ripe important protein enzyme to virus protein.Nsp-9 is the synthetic RNA RNA-dependent polysaccharase of catalysis viral RNA.We predict that the siRNA sequence of target nsp-1 and nsp-9 coding region will be SARS CoV rna transcription and the most effective inhibitor that duplicates.Being positioned at the lip-deep spike protein of virion is responsible for the identification of the tropism of neutralizing antibody, acceptor, cell absorption and induces.Therefore the furcella coding region becomes effective target of the propagation of blocking virus infection probably.
Target RSV is with the treatment respiratory tract infection
The infection that is caused by respiratory syncytial virus (RSV) is another example that the present invention is wanted the Respirovirus disease of target.Rsv infection be serious paediatrics respiratory tract disease main diseases because of.Nearly 2/3rds baby infects RSV in birth in back 1 year, and two years old baby almost 100% infected.Rsv infection often breaks out, and the lasting several months.In fact, for most of viral respiratory tract infections, still there is not the specific medicine can greatly reduce viral load among the patient.For example, even the anti-RSV monoclonal antibody Synagis of nearest listing (Medimmune, Inc), the inpatient who accepts Synagis compares with the patient who accepts placebo, and the severity of rsv infection does not alleviate yet.This can to small part owing to antibody can not be effectively in and virus in the infected cell.The effect of antiviral drug (ICN Pharma.) is disputable always.With regard to RSV and other virus infectiones,, help the effective and safe modality of the host factor of falling ill to have great demand thereby effectively suppress virus replication or inhibition to the virus in can cell killing.
To virus replication cycle and viral pathogenetic description, the basis of using siRNA treatment rsv infection is according to above: siRNA early stage at virus replication promptly before virus infection or just, can be applied to cell/tissue.SiRNA can degrade at " primary transcription " step synthetic mRNA, rather than secondary transcription causes mRNA to increase severely by the time.SiRNA is the most effective for the degraded of subgenomic mRNA rather than geneome RNA, because the former is not sealed by N albumen.Target is rational near genomic 5 ' terminal ORF.The ORF of L for example.Its expression amount lacks than other ORF, and it is constantly worked with catalytic amount; Therefore its silence needs the siRNA of less dosage.For suppressing virus replication or the protection cell/tissue is avoided virus infection, have reason at first four key genes (L, F, G and P) to be used as candidate's target of the silence of siRNA mediation.Though the preliminary study in tissue culture has been tested the silence of protein F and P, do not have other genes to be reported, and do not have the siRNA of the same gene of more target to be reported.Because N albumen is erected protectiveness " fireproof brickwork " around geneome RNA; make RNA have extreme resistance to the RNA enzyme; some researchists assert that it also can be blocked siRNA and enter in the viral genome, make the reticent possibility of virus thereby limited with siRNA by suppressor gene group RNA or cis-acting elements.But, transcribing/reproduction process in, 3 '-terminal N-RNA complex body dissociates and/or RNA unwinds, thereby geneome RNA or cis-acting elements are come out, can be suppressed by siRNA.
When using the siRNA technology, can adopt multiple target strategy.That is to say that the not homotactic siRNA of target uses simultaneously in external or body in once using.These targets that are used for this strategy comprise two notions: a plurality of target sequences of term single gene and a plurality of gene target (virogene or virogene add host gene).
SiRNA can be delivered to treatment rsv infection in " respiratory tract (respiratory tree) ".Can send siRNA by nasal mist or inhalation.Because nasopharynx is the main place that infects the performance of commitment virus, for preventative and early treatment treatment, upper airway delivery siRNA is just enough.Can carry out more deep siRNA and send, for example when transmission of infection arrives the lower region of respiratory tissues.In this case, can adopt tracheal instillation method and aerosolized solution inhalation.Also can use the method that rheuminess thing or mucus form the physical barriers that siRNA sends that overcomes.
Therefore, strike and subtract a plurality of virus mRNA and can strengthen the blanketing that virus protein is produced, cause virus infection and duplicate effectively being suppressed.Proved that these regional siRNA duplexs of target have suppressed sars coronavirus really and infected and duplicate in the non-human primate cell culture.In the present invention, the combination of the anti-SARS siRNA of multiple activity is more effective than single siRNA.
The RNAi medicine
RNA disturbs being applied in cell culture and model animals such as fruit bat, nematode, the line spot fish of (RNAi) to obtain development at full speed.Research to RNAi finds, and long dsRNA is by cutting enzyme (a kind of cell rnase iii) processing, produce with 3 '-about 21nt duplex of overhang, be called short interfering rna (siRNA), its mediation sequence-specific mRNA degrades.Because RNAi is chosen to be " breakthrough achievements in 2002 " by the Science magazine, scientists is believed, to the mechanism of RNAi and the understanding of the quick application that enlarges thereof, has represented the important breakthrough of biomedical sector over past ten years.
The present invention relates to several modalities of RNAi medicine.In one embodiment, the invention provides the combination of siRNA oligonucleotide.In another embodiment, the invention provides the DNA or the RNA of the RNAi oligonucleotide of expression activity form.In another embodiment, the invention provides single molecular entity, the operability molecule takes place by siRNA and nucleic acid (in one case), chemically conjugated thing (in another case, by " justice is arranged " chain) and hydrophilic polymer (under a kind of situation also) and is connected and constitutes in described molecular entity.The another kind of modality of RNAi is to transcribe the inhibition specific gene by control.A kind of modality of the RNAi that controlling gene is transcribed relates to and has stem-the miRNA oligonucleotide of environment-development folder (base mispairing is only arranged in the stem).The method and composition of RNAi medicine is known for those skilled in the art.The present invention includes the combination of RNAi medicine.
The siRNA oligonucleotide
Using the siRNA duplex disturbs the expression of specific gene to need following knowledge: the target accessibility, and siRNA effectively sends to target cell, and for some biologic applications, the long period of activity of siRNA in cell.Along with relevant siRNA as rapidly the increasing of the document of functional genome's instrument, people continue to bring out the interest that siRNA is used for the treatment of.The prescription method is passed by the part and the system of the optimization of treatment application need.Using siRNA is because its specificity, stability and mechanism of action as the advantage of medicine.Because each 21nt double-stranded RNA oligonucleotides has its unique sequence-specific, the combination of a plurality of siRNA duplexs can be reduced a plurality of target genes, causes obtaining synergy.But a plurality of genes of numerous combination targets of siRNA, these combinations can suppress native gene or foreign gene or both expression.In the present invention, the combination of a plurality of siRNA of a plurality of genes of target provides effective disease to suppress or therapeutic action.
RNAi medicine based on siRNA can use other oligonucleotide forms, comprise bob folder oligonucleotide, long dsRNA, flush end dsRNA oligonucleotide and mutual coupling or with other parts (moiety) link coupled oligonucleotide.The invention provides the combination and the siRNA medicine of the RNAi medicine that those skilled in the art are familiar with.
Expressed rna i medicine
The RNAi medicine can produce active intermediate to suppress target gene with expression cassette, comprises plasmid DNA, virus vector and mRNA.The sequence-specific that the expression of RNAi active intermediate produces target gene suppresses.Be coupled at or be coupled at the medicine of operability if the combination of expressed rna i medicine of the present invention comprises with a molecular entity with a plurality of molecular entity operability.Described operability coupling can be used internal ribosome entry site (IRES), perhaps can use multiple promoter, perhaps can use the operability coupling also to take place expressed rna is cut into the ribozyme sequence of viable rna i medicine.
Those of skill in the art will recognize that combination of the present invention is not limited to these embodiments.Specific embodiment is described hereinafter.
1. be used for genetic expression and strike siRNA duplex or the 21nt double-stranded RNA oligonucleotides that subtracts,, all can synthesize identical chemical species no matter what gene institute's target is.Therefore, no matter what its effect to target gene of this medicine modality is, its mechanism of action is all same or similar.Multiple siRNA duplex is combined in the drug dose, has reduced the risk of unexpected unfavorable or toxic side effect.
2. according to the present invention, use the combination of the siRNA of the different control disease pathological gene of target, have better result of treatment than the siRNA that uses the individual gene in the target disease pathology.Combination also can have the advantage that allows to reduce dosage, and this has shown the additivity or the synergetic property effect of the combination of a plurality of medicine target genes of target.
3. eye neovascularization is the typical pathological symptom of many illness in eye.The siRNA of target VEGF A, VEGF R1 and VEGF R2 gene provides and has struck the inhibitor that subtracts corresponding gene, and described gene is all known to play crucial effect, so is the target of the medicine of blocking-up blood vessel generating process.When sending each siRNA separately,, induce the blood vessel of generation to take place all obviously to be suppressed no matter be that administration is sent by local delivery or system.When the combination of using siRNA, thus simultaneously during all three genes of target, though the dosage of each siRNA reduce, thereby total siRNA dosage is remained unchanged, more effective to the restraining effect of blood vessel generation pathology.
The combination of above-mentioned the 3rd the multiple siRNA inhibitor of explanation can effectively suppress a plurality of native genes in the same VEGF approach.As shown in generation reduces as inflammatory HSV DNA inductive pathologic vessels, striking of these a plurality of genes subtracted striking of any one short angiogenesis factor of comparison subtract more effectively with stronger.
SiRNA target sequence can comprise the zone that contains 21nt in the middle of the mRNA sequence of goal gene.Described target sequence is at first selected by the various algorithms that design for the siRNA Sequence Identification as Figure 17 is specified.Then these sequences are screened with various biological tests, for example the gene silencing effect in mammalian cell cultures: read or western blotting or ELISA, protein function or physiological function etc. with RT-PCR, as embodiment 1 and 2 example explanations.The most effective siRNA duplex picked out carry out further preclinical study and clinical study.
That selects has specific each siRNA duplex to use together to each specific gene, perhaps can independently Yu to other genes have specific other siRNA duplexs to be used in combination.This means at least three siRNA duplexs are arranged in the combination of three genes of each target.
The ratio of each siRNA duplex of a specific gene of target can equate (with regard to molecular weight) in the combination, and perhaps when the mRNA that by the target sequence is goal gene expressed with different levels, described ratio can be different.
Because the sequence-specific problem of different tests biology, though the sequence of promptly different biological homologous geneses homology sometimes is high but normally different, find out can the target human sequence again can target experimental animal sequence siRNA sequence (Figure 17 SS1, SS2, SS3 and SS4 etc.) be the optimum method that obtains to can be used for the siRNA inhibitor of preclinical study and clinical study two aspects.
Perhaps, if in cell culture studies, confirm, can the target human sequence again can target experimental animal sequence the effect of siRNA duplex not as siRNA duplex that can only the target human sequence, the selected siRNA inhibitor for clinical trial will be the siRNA inhibitor that is verified and supports for the animal model data (when the different siRNA of same gene usefulness target experimental animal suppress) in people's cell cultures.
The invention provides the combination of the multiple siRNA inhibitor of a plurality of genes of target, and the additional step that carries out the siRNA sequences Design is provided.The every other standard of RNAi medicinal design step of the present invention in comprising RNAi design (reduce as far as possible the homology of missing the target, to the specificity of target sequence, be fit to RISC (the reticent mixture of RNA inducibility) in conjunction with etc.), also comprise between the selected RNAi sequence of checking lacking sequence homology.The available information biology instrument of described checking carries out, and perhaps the method for knowing according to the technician is done directly relatively to carry out to each sequence.
In the same approach other VEGF approach factors mRNA sequence being had the various combination of specific different siRNA inhibitor also will be effectively, as the siRNA inhibitor combination of the following factor of target:
VEGF-A, VEGF-B and VEGF-R2
VEGF-A, VEGF-B and PIGF
VEGF-B, VEGF-R1 and VEGF-R2
VEGF-A, PIGF and VEGF-R2
Perhaps other combinations of the above-mentioned factor of target.
It also is effectively that the mRNA sequence of the factor of matrix metalloproteinase and adhesion molecule is had the various combination of specific different siRNA inhibitor, as the siRNA inhibitor combination of the following factor of target:
MMP-2, MMP-9 and PDGF-R
α v β 3 integrins, α v β 5 integrins and alpha 6 beta 4 integrin
Lyn, PDGFr and ILK
CEACAM6, Smad2 and FAK
Pacsin 3, ADAM12 and Ets-2
Mint-3, MMP-2 and MMP-9
Perhaps other combinations of the above-mentioned factor of target.
The various combination that the mRNA sequence of other factors of the different receptor pathways that participate in the blood vessel generating process is had specific different siRNA inhibitor, for treatment cancer, eye neovascularization diseases, inflammatory diseases also will be effectively, as the siRNA inhibitor combination of the following factor of target:
EGF, FGF and VEGF
EGF, VEGF and HGF
ErbB-1, Her-2 and VEGF-R2
ErbB-1, VEGF-R2 and FGF-R
TACE, amphiregulin and CXCR4
S100A10, Her-2/neu and FGF-R
Perhaps other combinations of the above-mentioned factor of target.
The mRNA sequence of other factors of the signal transduction pathway that participates in the blood vessel generating process is had the various combination of specific different siRNA inhibitor, also will be effectively for cancer therapy, as the siRNA inhibitor combination of the following factor of target:
TRIP6, Grb-2 and PDK1
DAB2, ILKAP and B-Raf
C-Raf, Mcl-1 and Dgka
A-Raf, Grb-2 and SPK1
Perhaps other combinations of the above-mentioned factor of target.
The mRNA sequence of other factors of the plastosome associated protein of apoptosis involvement process is had the various combination of specific different siRNA inhibitor, also will be effectively for cancer therapy, as the siRNA inhibitor combination of the following factor of target:
Bcl-2, BCL2L1 and Trail
Trail, Bcl-2 and Fas
Perhaps other combinations of the above-mentioned factor of target.
Some combination that target is urged the siRNA inhibitor of angiogenesis factor, short multiplicaiton factor and anti-apoptosis factor will be very effective for some cancer therapy.For example, the combination of the siRNA inhibitor of target VEGF, EGF and FGF and acceptor thereof be the active drug of treatment lung cancer, kidney and colorectal carcinoma, and the combination of the siRNA inhibitor of target VEGF, Her-2 and sudden change p53 is the active drug of treatment mammary cancer.
Some combination of the siRNA inhibitor of the particular sequence of the promotion sensitivity gene of target sudden change has high selectivity downward modulation effect to the specific polymorphism of various oncogene.For example, the combination of the siRNA inhibitor of selectively targeted K-ras mutant, ERCC1 mutant and BRCA1, very effective for the treatment of mammary cancer.
In cervical cancer, HPV (human papillomavirus) and endogenous oncogene and proto-oncogene have been accredited as the main cause of disease.Therefore, used siRNA inhibitor target HPV (several strains, for example E6 and E7 sequence) and p53 simultaneously in the combination.Make up as follows: E6, E7 and p53, wherein E6 and E7 gene are the sequences from HPV16 strain or HPV18 strain, p53 is people's mutant nucleotide sequence.
In prostate cancer, the combination of the siRNA inhibitor of target androgen receptor, VEGF R2 and Alpha-Methyl acyl group-CoA racemase (AMACR) is effective medicine.
For oncology applications, the combination of the siRNA inhibitor of target a plurality of (being equal to or greater than 3) gene order is the part of supplement therapy scheme.For example, the combination of siRNA inhibitor is used with monoclonal antibody drug, antibiotic medicine (chemotherapy) and other small-molecule drugs (Gleevec) etc., with the treatment cancer.
The mRNA sequence that participates in other factors that inflammatory diseases rather than blood vessel take place is had the various combination of specific different siRNA inhibitor, also is effective medicine of these diseases, as the siRNA inhibitor combination of the following factor of target:
TNF-α, TNF-β and IL-1
TNF-α, IL-1 and IL-1r
IL-β, GG2-1 and TNF-α
CIAS1, Ark and TNF-α
TNF-β, IL-1 α and IL-1 β
NF-κ B, TNF-α and IL-1
Perhaps other combinations of the above-mentioned factor of target.
The eye stromal keratitis is the infection induced inflammatory diseases of human herpes simplex vicus (HSV).The siRNA inhibitor combination of target HSV sequence, pro-inflammatory cytokine (for example IL-17, IL-12) and angiogenesis factor (VEGF or VEGF R2) is effective medicine.
Though infecting and be replicated in the tire RhMK cell (FRhK-4), SARS virus is suppressed, but respectively 4 siRNA duplex SC2, SC5, SC14 and SC15 of target nonspecific proteins (nsp-1, nsp-9 and nsp-10) and spike protein only show that (cell is at first used the siRNA transfection to strong effective prophylactic effect to virus infection, use virus infection then), and a little less than the therapeutic action relatively (cell is at first used virus infection, uses the siRNA transfection then).When various active siRNA duplexs are made up with different ratios, can significantly improve result of treatment.
SiRNA inhibitor combination with target virus-virus nucleocapsid protein (N), non-glycosylated interior virion protein (M) and transmembrane glycoprotein (F) gene order suppresses rsv infection by respiratory tract administration, is an effective means.
Can use siRNA oligonucleotide cocktail (siRNA-OC)---the multiple siRNA duplex of a plurality of genes of target, the expression of reducing Disease-causing gene or disease controlling gene.The combination of siRNA oligonucleotide will be to being had identical at least or better effect by the disease of target.
Depend on effective downward modulation by the requirement of the gene of target and disease condition, each siRNA components in proportions can be different.The present invention advises that the siRNA-OC preparation contains at least 3 siRNA duplexs, but the quantity of siRNA duplex can be more, from 4 to 5,6,7,8,9,10 or more a plurality of.
Be can be the gene of endogenous expression by the Disease-causing gene of target or from the genes of infective bacterial, virus and protozoon etc.The chemical species of siRNA duplex can be identical or different.SiRNA-OC can the part or system send.
SiRNA-OC can be used for preventing purpose or therapeutic purpose or both.SiRNA-OC can be used for treating cancer, autoimmune disease and inflammatory diseases.SiRNA-OC acceptable salts solution or other solution are sent: liposome, polymkeric substance and nano particle.SiRNA-OC can be powdered mixture.SiRNA-OC also can with the other drug combinations of substances.
Embodiment
Following examples further specify the present invention, but should not be construed as restriction the present invention.
Embodiment 1
SiRNA duplex combination in order to the target VEGF pathway gene of treatment eye neovascularization
1) our proof recently, it is vascular endothelial growth factor (VEGF) that the HSV DNA that is rich in the bioactive CpG of containing motif can induce effective angiogenesis factor, with the antibody neutralize VEGF HSV inductive blood vessel is minimized.Also set up a model easily, the wherein bioactive CpG of containing oligodeoxynucleotide (ODN) also shows and can induce neovascularization by inducing VEGF.This model is used for proving that RNA disturbs (RNAi) to suppress vegf expression and reactive therapeutic value.
2) material and method
Reagent
Thiophosphoric acid ODN is supplied by Dennis M.Klinman (U.S. FDA center for biologic evaluation and research) favour.The sequence that is used for the pungency ODN of this research is: 1466, and TCAACGTTGA and 1555, GCTAGACGTTAGCGT.Research subsequently with ODN1466 and 1555 etc. molar mixture carry out.
The molecular designing of gene target and siRNA
Three mVEGF approach of RNAi target factor---mVEGF A and two mVEGF acceptors (mVEGFR1 and mVEGFR2).For each gene target, the different positions on same mRNA is determined two target sequences.SiRNA is designed to corresponding with above target sequence.These siRNA design (14,15) according to the guilding principle that Tuschl proposes.The siRNA that designs (sense strand and antisense strand duplex) is synthetic by Qiagen (Valencia, California, USA).All siRNA are 21 Nucleotide long dsrna oligonucleotide, at 3 ' prime end 2 Nucleotide (TT) overhang are arranged.The target sequence of mVEGFA is (a) AAGCCGTCCTGTGTGCCGCTG and (b) AACGATGAAGCCCTGGAGTGC.The target sequence of mVEGFR1 is (a) AAGTTAAAAGTGCCTGAACTG and (b) AAGCAGGCCAGACTCTCTTTC.The target sequence of mVEGFR2 is (a) AAGCTCAGCACACAGAAAGAC and (b) ATGCGGCGGTGGTGACAGTA.Synthesized irrelevant siRNA contrast, i.e. LacZ and Photinus pyralis LUC two target sequences separately.They are LacZ (a) AACAGTTGCGCAGCCTGAATG and (b) AACTTAATCGCCTTGCAGCAC, Luc (a) AAGCTATGAAACGATATGGGC and (b) AACCGCTGGAGAGCAACTGCA.Research subsequently with a of each siRNA and b etc. molar mixture carry out.
Mouse
Female 5-6 week BALB/c mouse in age (H-2d) is available from Harlan Sprague-Dawley (Indianapolis, IN, USA), stable breeding routinely.All researchs are all carried out according to the guilding principle of the treatment council of the laboratory animal resource under the life science council of U.S. National Research Board (National Research Council) (Commissionof Life Sciences) (Committee on the Careof Laboratory Animals Resources).It is qualified fully that the animal facility of University of Tennessee (tennessee,USA Knoxville) is taken care of federation (AmericanAssociation of Laboratory Animal Care) evaluation through U.S. laboratory animal.
Virus
HSV-1 RE strain (doctor RobertLausch of the University of Alabama favour by U.S.'s Alabama Mobile supplies) is used for all programs.At Vero cell monolayer (catalog number (Cat.No.) CCL81; Virginia, USA Manassas American Type Culture Collection (ATCC)) growth virus in, titration, with aliquots containig be preserved in-80 ℃ standby.
The external effect of siRNA
For the external effect of test siRNA, used following clone: RAW264.7gammaNO (-) cell, ATCC CRL-2278 is for expressing the mouse macrophage of endogenous mVEGF-A; And SVR, ATCC CRL-2280 is the mouse endothelial cell line of lotus mVEGF acceptor.With cell bed board in six orifice plates (in the RPMI that contains 10% foetal calf serum), put 37 ℃, 5%CO 2In spend the night.The cell bed board is used siVEGFA or siLuc (be respectively 0,0.1,0.5, the 1.0 or 2.0 μ g/2ml/ holes) transfectional cell of Lipofectamine 2000 (Invitrogen, Carlsbad, California, USA) with different concns one day after.After 24 hours,, extract and RT-PCR for ThermoScript II-polymerization ribozyme from these cell extraction RNA.(CRL-2280 ATCC) tests the siVEGFR1 specificity of the VEGFR1 gene of constitutive expression on these cells is struck the efficient that subtracts effect with the SVR cell.With cell bed board in six orifice plates (in the improved Eagle substratum of the Dulbecco that contains 5% foetal calf serum), put 37 ℃, 5%CO 2In spend the night.The cell bed board one day after, with siVEGFR1 or siLuc (be respectively 0,0.1, the 0.5 or 1.0 μ g/2ml/ holes) transfectional cell of Lipofectamine 2000 with different concns.After 48 hours, RNA carries out RSPCR from these cell extraction, to detect VEGFR1 (extracting and the NATemplate specific PCR referring to RNA) (RS-PCR).(CRL-1573 ATCC) is used for being expressed the transfection of the plasmid of mVEGFR2, to detect the situation of subtracting of striking of external source mVEGFR2 to 293 cells.With cell bed board in six orifice plates (in the improved Eagle substratum of the Dulbecco that contains 5% foetal calf serum), put 37 ℃, 5%CO 2In spend the night.The cell bed board one day after, with Lipofectamine2000 with plasmid pCI-VEGFR2 (0.2 μ g/2ml/ hole) and siVEGFR2 (a, b, a+b) or siLuc (being respectively 0,0.1,0.5 or 1.0 μ g/ holes) cotransfection cell.After 48 hours, RNA carries out RS-PCR from these cell extraction, to detect VEGFR2.
Little bag of test of cornea
The general scheme that Kenyon and colleagues propose is abideed by in the little bag of test of cornea that is used for this research.For ethanolic soln (the 120mg/l ml ethanol that is inserted into CpG ODN, sucralfate (sucralfate) (10mg, Bulch Meditec, Vaerlose, Denmark) and the hydron polymkeric substance of microballoon by share known quantity in the cornea; Interferon Sciences, the new Boulogne Zwick of N.J.) and make 15mm on the gained mixture 2Composite screen (Sefar America, Inc., KansasCity, Missouri, USA) prepare.After mixture is air-dry, the fiber of screen cloth is ripped, obtained containing the microballoon of 1 μ g CpG ODN.Under stereoscopic microscope (Leica Microsytems, Wetzlar, Germany), producing little bag (every group of four eyes) from the place of the about 1mm of corneal limbus, the microballoon that will contain CpG ODN then is inserted in little bag.Implanted the back the 4th day and the 7th day at microballoon, a situation arises by stereoscopic microscope assessment blood vessel with calipers (Biomedical Research Instruments, Maryland, USA Rockville).Measure 4 to originating from towards the length of the neovascularity of the edge vascular circle of cornea central authorities and with the neovascularity width that cornea circumference hour number is described.Each hour number equals 30 ° of circumference.The angiogenic area calculates by oval formula.The A=[(hour number) * 0.4 (length of vessel mm) * π]/2.
Send in the body of siRNA
For carrying out local delivery, siRNA (every of 10 μ g/10 μ l) is diluted in the phosphate-buffered saline (PBS), send under the conjunctiva.Implanted back 6 hours and 24 hours at the CpG microballoon, perhaps behind the virus infection 1 day or 3 days, at avertin (Pittman Moore, Illinois, USA Mondelein) use 32-gauge Hamilton syringe (HamiltonCo., Nevada, USA Reno) to carry out subconjunctival injection under the dark anesthesia of inductive.SiRNA is injected in corneal limbus 2mm afterwards.For carrying out system's injection, siRNA (40 μ g/100 μ l/ mouse) is mixed with polymkeric substance (TargeTran), intravenously is sent.After the CpG microballoon is implanted back 6 hours and 24 hours or virus infection 1 day or 3 days, carry out tail vein injection with the 32-gauge syringe.
Cornea HSV-1 infects
The corneal infection of all mouse groups is carried out under the dark anesthesia of avertin (St. Louis) inductive.Scratch the mouse cornea gently with the 30-gauge pin, will contain 1 * 10 5The 2-μ l medicine of the HSV-1RE of plaque forming unit (PFU) drips and is applied in the eye, massages (every group of six mouse) gently with eyelid.
Clinical observation (HSK severity and angiogenic scoring)
The different dates are by the development of slit lamp biomicroscope's inspection (Kawa Company, Japan Nagoya) inspection eyes clinical lesion, the clinical severity of keratitis of the mouse of the independent scoring of record after infection.The scoring system is as follows: 0, and normal cornea; + 1, the slight corneal opacity; + 2, the moderate cornea is opaque or scab; + 3, the opaque but iris of severe corneal as seen; + 4, opaque cornea and keratohelcosis; + 5, keratorhexis and gangrenosum acne SK.The severity that blood vessel takes place is carried out record as previously mentioned.4 briefly, and the specific quadrant scoring of eyes is 4 to represent the entad growth of 1.5mm towards cornea central authorities.Then the mark of four quadrants of eyes is added and, obtain the neovascularization index (scope 0-16) 4 of every eye particular point in time.
Statistical study
Significant difference between each group is assessed with Student ' s t-test.P＜0.05 is considered as between each group significant difference being arranged.
3) result
SiRNA is external to subtract effect to striking of VEGF pathway gene
Three independent siRNA have been developed.They are siVEGFA, siVEGFR1 and siVEGFR2.They each in different cell in vitro systems, test, to measure its gene silencing efficient.SiVEGFA can test 18 in RAW NO (-) scavenger cell of endogenous generation VEGFA.With siVEGFA or the contrast siLuc siRNA transfection of cell with various dose, RT-PCR is carried out in transfection after 24 hours.Shown in Figure 1A, the expression of 120 and 164 isotypes of VEGF is all reduced in the dose-dependently mode by siVEGFA.The effect of siVEGFR1 reagent can assessed in the SVR cell of endogenous express VEGF receptors 1.Shown in Figure 1B, the VEGFR1 that 48 hours RS-PCR measure after the transfection expresses and descends in the dose-dependently mode, and the contrast siLuc siRNA of all concentration all causes the VEGFR1 signal of similar level.At last, test siVEGFR2 reagent in 293 cells of the plasmid external source transfection of using coding VEGFR2.For measuring the reticent effect of siVEGFR2, the siVEGFR2 of various dose and the cotransfection method of VEGFR2 DNA have been carried out using.293 cells are with the siRNA of the target mVEGFR2 (0.1,0.5,1.0 μ g/ hole) of various concentration and express plasmid (the 0.2 μ g/ hole) cotransfection of mVEGFR2.Cotransfection is isolation of RNA after 48 hours, measures the heterogenous expression situation of mVEGFR2 by RS-PCR.Fig. 1 C shows that the VEGFR2 expression is reduced by siVEGFR2, but is not reduced by contrast siRNA molecule.These results show that all tested siRNA all can be at the gene of vitro inhibition institute target.
SiRNA by local delivery target VEGF pathway gene suppresses the generation of CpG inductive blood vessel
Previous studies have shown that, is encapsulated in the ODN that contains CpG in the hydron microballoon in being inserted into the little bag of cornea the time, can induce the blood vessel generation of VEGF mediation.Measure the inhibition effect that topical administration is designed to the siRNA preparation of target VEGF and two acceptor (VEGFR1 and 2) with this system.All use the single dose of 10 μ g siRNA (in PBS) in all cases.This contains behind little bag of CpG ODN 24 hours and gives by subconjunctival injection in foundation.SiRNA is tested separately and with 1: 1: 1 mixture of all three siRNA (siVEGFA, siVEGFR1 and siVEGFR2).Microballoon implanted the back the 4th day and the 7th day monitoring angle film edge in neovascularization.As shown in Figure 2, implanted the back the 4th day at microballoon, and contrast comparing of siLacZ, all three tested siRNA cause cornea rebirth blood vesselization significantly to be suppressed (p＜0.05).The combination of three tested siRNA is effective inhibitors, causes neovascularization to reduce about 60% (p＜0.01).
The siRNA that sends target VEGF pathway gene by system suppresses CpG inductive neovascularization
The efficient of sending for the anti-angiogenic effect of testing single target siRNA and the siRNA of system, implanted back 6 hours and 24 hours at microballoon, vein has the 40 μ g siRNA (mixture that contains siVEGFA, siVEGFR1, siVEGFR2 or three) or the contrast siLacZ of little bag the mouse single dose that contains CpG ODN.In these trials, show in the research before the priority of use effective polymkeric substance (" Targetran ") is taken place tumor vessel, send outward with the blood vessel that promotes siRNA.Implant the back the 4th day and the 7th day at microballoon, measure the degree that blood vessel takes place.As shown in Figure 3, implanted the back the 4th day at microballoon, compare with the siLacZ treatment group, all reagent that use are separately all induced the remarkable restraining effect (p＜0.05) to neovascularization.As observed arriving in local delivery, the mixture of three kinds of tested reagent provides the most effective restraining effect (average 40% suppresses p＜0.01).In other experiment, the function of polymer support is assessed by the anti-neovascularization activity of the tested mixture that relatively is suspended in the polymkeric substance or gives in PBS.These test announcement, and that uses anti-neovascularization effect that polymer support produces and show when using the PBS carrier is more effective, although the result is remarkable (p＜0.05) (Fig. 4 A) of experimental stage in early days only.These results prove, eye neovascularization can be controlled by the siRNA that vein gives target VEGF system gene, and the use of " TargeTran " vehicle can strengthen the effect of therapeutic action.
Send effective anti-angiogenic dosage of middle siRNA for determining system, implanted back 6 hours and 24 hours at microballoon, with TargeTran is vehicle, and 10,20,40, the 80 μ g that vein has little bag the mouse single dose that contains CpG ODN contain the siRNA of siVEGFA, siVEGFR1, siVEGFR2 three's mixture or contrast siLuc.Shown in Fig. 4 B, giving siRNA can suppress the generation of CpG inductive blood vessel in the dose-dependently mode.
The treatment of siRNA in the HSK model at the VEGF pathway gene used
Previous research proves that VEGF is the important angiogenic factor of inducing HSV specificity blood vessel to take place in the HSK model.Whether the siRNA that gives target VEGF pathway gene for assessment can suppress the development of HSK, after the cornea of mouse is scratched, with 1 * 10 5HSV-1RE infects.Behind virus infection the 1st day and the 3rd day then is that carrier gives the 10 μ g (local delivery is carried out in subconjunctival injection) of mouse single dose or 40 μ g (tail vein injection carries out system's body and send) siRNA mixture (siVEGFA, siVEGFR1 and siVEGFR2 etc. molar mixture) with the polymkeric substance.As shown in Fig. 5, and to compare with the animal of siLuc control treatment, its blood vessel of mouse that the siRNA of the target VEGF pathway gene that gives with part or system handles takes place and the severity of HSK significantly reduces (p＜0.05).When the eyes of siLuc control treatment had 80% to develop clinically obvious impairment (was 2 or higher at the 10th day p.i. mark), the eyes of handling with the siRNA of target VEGF pathway gene had only 42% (local delivery) or 50% (system sends) to develop this damage.In addition, earlier than the 10th day p.i., in 12 contrast eyes, 9 blood vessel generation marks are arranged, but have only 5 blood vessel generation marks greater than 6 in 12 eyes of siRNA with target VEGF pathway gene by the mouse of part or system's delivery process greater than 6.These the results are summarized in together and show, the siRNA that gives at the VEGF pathway gene can be by suppressing the development that HSK takes place to reduce blood vessel.
SiRNA treatment back VEGF mRNA level with target VEGF pathway gene in the cornea that HSV-1 infects descends
Use siRNA for research and handle the level that whether can reduce VEGFmRNA, with 1 * 10 at the VEGF pathway gene 5Pfu HSV-1RE infecting mouse and behind virus infection the 1st day and the 3rd day handle with the siRNA of target VEGF pathway gene, collect cornea at the 4th day or the 7th day p.i. from mouse.VEGF mRNA level is by RT-PCR or quantitatively PCR in real time measurement.As shown in Figure 6A, after infection the 4th day and the 7th day, compare with the contrast eyes, use the expression of VEGF mRNA in the cornea that the siRNA at the VEGF pathway gene handles to descend.In addition, in RT-PCR, find similar, at the 7th day p.i., and compare with the cornea of siLuc control treatment, the cornea of using the siRNA at the VEGF pathway gene to handle shows that VEGF genetic expression is obviously suppressed (Fig. 6 B).
The vegf protein level descends after using at the siRNA of VEGF pathway gene in the cornea that HSV-1 infects
Be that assessment handles the generation that whether can reduce vegf protein with the siRNA of target VEGF pathway gene, we measured with HSV-1 infect and after infection the 7th day with the vegf protein in the cornea of siRNA processing.As shown in Figure 7, compare with the contrast of polymkeric substance, accept its vegf protein level of cornea lower (p＜0.05) of the siRNA of target VEGF pathway gene with being given siLuc.Give the siRNA of target VEGF pathway gene and the production that polymkeric substance can suppress its target gene in the HSK cornea once more.
Embodiment 2
Target sars coronavirus sequence is with the siRNA duplex combination of treatment SARS
1) multiple siRNA is combined in and suppresses the prophylactic effect that sars coronavirus infects and duplicates in the tire RhMK cell (FRhK-4).Fig. 1. SARS CoV there is the prophylactic effect of specific combination siRNA duplex.Tested the stronger inhibiting strategy that uses active siRNA duplex to make up to realize to virus replication.The FRhK-4 cell carries out transfection and infection as described in Figure 2.Behind the virus infection the 36th hour, collecting cell and substratum carried out QRT-PCR and TCID 50Measure.A. active siRNA duplex combination minimizing viral genome copy.The restraining effect of combination siRNA duplex is measured by real-time Q-RT-PCR, found that stronger than the restraining effect of single siRNA.B. carry out time-histories research with combination S C2 and SC5 siRNA.Combination siRNA reaches 72 hours most to the prophylactic effect of SARS virus and is well kept after transfection.The number of each combination group: SC2+SC5+SC14; SC14+SC15; SC14+SC5; SC14+SC2; SC5+SC14+SC15; 3xSC2:0.9 μ g SC2 siRNA/ hole; 3XSC5:0.9 μ g SC5 siRNA/ hole and contrast: the negative control of no siRNA transfection.
2) make up the therapeutic action that the siRNA duplex infects and duplicates sars coronavirus in the tire RhMK cell (FRhK-4).Fig. 2. SARS CoV there is the therapeutic action of specific combination siRNA duplex.Measured active siRNA duplex combination.The FRhK-4 cell infected with the SARS CoV of 3PFU/ cell, used the siRNA duplex transfection of various combination behind the p.i. at one hour.After the transfection the 36th hour, collecting cell and substratum carried out Q-RT-PCR and virus titer respectively and measure.A. measured as descending by viral genome copy number in the tenuigenin of infected FRhK-4 cell, combination siRNA duplex can significantly improve restraining effect (P＜0.05).SC2+SC5; SC14+SC15; SC14+SC5; SC14+SC2; SC5+SC15; SC2+SC5+SC14+SC15; SC2+SC5+SC14; 2XSC2:0.6 μ g SC2/ hole; 2XSC5:0.6 μ g SC5 siRNA/ hole; 3XSC5:0.9 μ g SC5 siRNA/ hole; 4XSC5:1.2 μ g siRNA/ hole and contrast: the negative control of no siRNA transfection.
The reference table look-up
1.Li, Baojian, P.Lu and M.Woodle (2004) .SiRNA Oligo Cocktail forTreatment of Cancer, Infectious and inflammatory Diseases (the SiRNA oligonucleotide mixture of treatment cancer, transmissible disease and inflammatory diseases) .Rn:38147-0045. U.S. Provisional Application.
2.Watanabe A, Taniguchi M. (2005) .A case of oropharyngeal cancerwith multiple bone metastases from prostate cancer that respondedto docetaxel, ifosfamide and cisplatin combination therapy (the multiple bone metastatic carcinoma case that the example companion oropharynx cancer companion prostate cancer that docetaxel, ifosfamide and cis-platinum combination treatment are reacted produces) .Gan To Kagaku Ryoho.32 (1): 65-7.
3.Miner J, Gillan MM, Alex P, Centola M. (2005) .Steroid-RefractoryUlcerative Colitis Treated with Corticosteroids, Metronidazole andVancomycin:a Case Report is (with reflunomide, metronidazole and vancomycin treatment steroid intractable ulcer colitis: case report) .BMC Gastroenterol.5 (1): 3.
4.Orbay E, Sargin M, Sargin H, Gozu H, Bayramicil OU, Yayla A. (2004) .Addition of rosiglitazone to glimepirid and metformin combinationtherapy in type 2 diabetes (rosiglitazone being joined in the glimepiride and N1,N1-Dimethylbiguanide combination treatment of type ii diabetes) .Endocr is (6): 521-7. J.51
5.Kerbel, R.and Folkman, J. (2002) Clinical translation of angiogenesisinhibitors (the clinical translation of angiogenesis inhibitor) .Nat.Rev.Cancer.2:727-739.
6.McManus, M.T.and P.A.Sharp (2002) Gene silencing in mammals bysmall interfering RNAs (gene silencing that siRNA causes in Mammals) .Nature Review, Genetics.3 (10): 737-747.
7.Lu, P.Y.et al. (2003) siRNA-mediated antitumorigenesis for drugtarget validation and therapeutics (being used for the siRNA mediation antitumorgienesis that drug targets is confirmed and treated) .Current Opinion in Molecular Therapeutics.5 (3): 225-234.
8.Hanze J.et al (2003) RNA interference for HIF-1 α lpha inhibits itsdownstream signaling and affects cellular proliferation (RNA of HIF-1 α disturbs and suppresses its downstream signal conduction and influence cell proliferation) .Biochem BiophysRes Commun.312 (3): 571-7.
9.Wu J.et al. (2004) Progestin-dependent induction of vascularendothelial growth factor in human breast cancer cells:preferentialregulation by progesterone receptor B (induce: the preferred adjusting of PgR B) .Cancer Res.64 (6): 2238-44. by the Progesterone dependency of human breast cancer cell medium vessels endothelial cell growth factor (ECGF)
10.Yin J.Q.et al (2003) siRNA agents inhibit oncogene expression andattenuate human tumor cell growth (the siRNA medicine suppresses oncogene expression and weakens growth of human tumor cells) .J Exp Ther Oncol.3 (4): 194-204.
11.Cui T.G.et al (2004) Differentiated human podocytes endogenouslyexpress an inhibitory isoform of vascular endothelial growth factor (VEGF165b) mRNA and protein (endogenous expression vascular endothelial growth factor (VEGF165b) mRNA of people's podocyte of differentiation and proteinic inhibition isotype) .Am JPhysiol Renal Physiol.286 (4): F767-73.
12.Lu, P.Y.et al (2002) Tumor inhibition by RNAi-mediated VEGFand VEGFR2 down regulation in xenograft models (VEGF of RNAi mediation and VEGFR2 downward modulation are to the restraining effect of tumour in the heteroplastic transplantation model) .CancerGene Therapy.10 (supplementary issue)) and S4.
13.Takei, Y.et al (2004) A small interfering RNA targeting vascularendothelial growth factor as cancer therapeutics (as the siRNA of the target vascular therapy endothelial cell growth factor (ECGF) of cancer treatment drugs) .Cancer Res.64 (10): 3365-70.
12.Reich, S.J.et al. (2003) Small interfering RNA (siRNA) targetingVEGF effectively inhibits ocular neovascularization in a mousemodel (siRNA of target VEGF (siRNA) effectively suppresses the eye neovascularization in the mouse model) .Mol Vis.9:210-6.
13.Kim, B.et al (2004) Inhibition of ocular angiogenesis by siRNAtargeting vascular endothelial growth factor-pathway genes; The therapeutic strategy for herpetic stromal keratitis (restraining effect that the siRNA of target vascular therapy endothelial cell growth factor (ECGF) pathway gene takes place the eye blood vessel; The therapeutic strategy of herpetic stromal keratitis) .Am.J.Pathol.165 (6): 2177-85.
14.Holmqvist K.et al. (2004) The adaptor protein shb binds to tyrosine1175 in vascular endothelial growth factor (VEGF) receptor-2 andregulates VEGF-dependent cellular migration (adapter protein shb is in conjunction with the tyrosine in vascular endothelial growth factor (VEGF) acceptor-2 1175 and regulate the migration of VEGF dependent cell) .J Biol Chem.279 (21): 22267-75.
15.Yamaoka-Tojo M.et al. (2004) QGAP1, a novel vascular endothelialgrowth factor receptor binding protein, is involved in reactiveoxygen species-dependent endothelial migration and proliferation (the conjugated protein QGAP1 of novel vascular endothelial growth factor receptor participates in reactive oxygen intermediate dependency endothelial migration and propagation) .Circ Res.95 (3): 276-83.
16.Schiffelers, R.M.et al. (2004) Cancer siRNA Therapy by TumorSelective Delivery with Ligand-Targeted Sterically-StablilizedNanoparticle (carrying out the cancer siRNA therapy that tumor-selective is sent) .Nucleic Acid Research with part target steric stabilization nano particle, 32 (19): e149.
17.Bergers, G.et al. (2000) Matrix metalloproteinase-9 triggers theangiogenic swith during careinogenesis (matrix metalloproteinase-9 causes the angiogenic conversion in the oncogenesis process) .Nature Cell Biol.2:734-744.
18.Raghu Kalluri (2003) Basement membranes:structure, assemblyand role in tumor angiogenesis (basement membrane: structure, assembling and the effect in tumor vessel takes place) .Nature Review Cancer.3:422-433.
19.Sanceau J, et al. (2003) Matrix metalloproteinase-9 silencing byRNA interference triggers the migratory-adhesive switch in Ewing ' ssarcoma cells (RNA disturb the matrix metalloproteinase-9 cause is reticent to cause migration in the Ewing sarcoma cell-stick together conversion) .J Biol Chem, 278:36537-46.
20.Offenberg Von et al. (2004) Sweeney N2004 Cyclic strain-inducedendothelial MMP-2:role in vascular smooth muscle cell migration (Sweeney N2004 ring-type strain inductive endothelium MMP-2: the effect in vascular smooth muscle cells migration) .Biochem Biophys Res Commun.320 (2): 325-33.
21.Liu L.T.et al. (2003) Histone deacetylase inhibitor up-regulatesRECK to inhibit MMP-2 activation and cancer eell invasion (histone deacetylase inhibitor raises RECK and activates and the cancer cells intrusion to suppress MMP-2) .Cancer Res.63 (12): 3069-72.
22.Wang P.et al. (2004) Mint-3 regulates the retrieval of theinternalized membrane-type matrix metalloproteinase, MT5-MMP, to the plasma membrane by binding to its carboxyl end motif EWV (Mint-3 regulates its extraction to plasma membrane by the C-terminal motif EWV in conjunction with the matrix metalloproteinase MT5-MMP of internalization film type) .J Biol Chem.279 (19): 20461-70.
23.Murai T.et al (2004) Engagement of CD44 promotes Rac activationand CD44 cleavage during tumor cell migration (enabling of CD44 promotes that Rac activates and the CD44 cutting in the tumor cell migration process) .J Biol Chem.279 (6): 4541-50.
24.Petrovic N.et al. (2003) CD13/APN transcription is induced byRAS/MAPK-mediated phosphorylation of Ets-2 in activatedendothelial cells (CD 13/APN transcribes by the Ets-2 phosphorylation of RAS/MAPK mediation and induces in the activation endotheliocyte) .J Biol Chem.278 (49): 49358-68.
25.Cao, Y.et al. (2003) Role of metalloprotease disintegrin ADAM12in determination of quiescent reserve cells during myogenicdifferentiation in vitro (metalloprotease de-connects the effect in the static reserve cell of albumin A DAM12 in measuring external myogenic atomization) .Mol Cell Biol.23 (19): 6725-38.
26.Mori, S.et al. (2003) PACSIN3 binds ADAM12/meltrin alpha andup-regulates ectodomain shedding of heparin-binding epidermalgrowth factor-like growth factor (PACSIN3 de-connects proteolytic enzyme α in conjunction with ADAM12/ and comes off with the extracellular domain of rise heparin in conjunction with epidermal growth factor-like growth factor) .J BiolChem.278 (46): 46029-34.
27.Walsh, M.F.et al (2003) Absence of adhesion triggers differentialFAK and SAPKp38 signals in SW620 human colon cancer cells thatmay inhibit adhesiveness and lead to cell death (shortage of sticking together causes the differentiation FAK and the SAPKp38 signal that can suppress tackyness and cause necrocytosis in the SW620 human colon cancer cell) .Cell Physiol Biochem.13 (3): 135-46.
28.Lee, M.S.et al. (2004) Smad2 mediates Erk1/2 activation by TGF-betal in suspended, but not in adherent, gastric carcinoma cells (Smad2 mediation Erk1/2 in the stomach cancer cell that suspends rather than stick together activates) .Int JOncol.24 (5): 1229-34.
29.Duxbury, M.S.et al (2004) c-Src-dependent cross-talk betweenCEACAM6 and alphavbeta3 integrin enhances pancreaticadenocarcinoma cell adhesion to extracellular matrix components (the c-Src dependency communication between CEACAM6 and α v β 3 integrins strengthens sticking together of pancreatic cancer cell and extracellular matrix composition) .Biochem Biophys Res Commun.317 (1): 133-41.
30.Tan, C.et al (2004) Regulation of tumor angiogenesis by integrin-linked kinase (ILK) (adjusting that integrin associated kinase (ILK) takes place tumor vessel) .Cancer Cell.5 (1): 79-90.
31.Fukuda, T.et al (2003) PINCH-1 is an obligate partner of integrin-linked kinase (ILK) functioning in cell shape modulation, motility, and survival (PINCH-1 is the obligate partner of integrin associated kinase (ILK) performance function in cell shape adjusting, mobility and survival) .J Biol Chem.278 (51): 51324-33.
32.Ding, Q.et al (2003) The pattern of enhancement of Src kinaseactivity on platelet-derived growth factor stimulation ofglioblastoma cells is affected by the integrin engaged (the Src kinase activity is subjected to the influence of the integrin employed to the enhancement mode of the Thr6 PDGF BB hormesis of spongioblast oncocyte) .J Biol Chem.278 (41): 39882-91.
33.Zhou, X.et al (2004) Murphy FR, Gehdu N, Zhang J, Iredale JP, Benyon RC.Engagement of alphavbeta3 integrin regulatesproliferation and apoptosis of hepatic stellate cells (propagation and the apoptosis of hepatic stellate cell regulated in the linking effect of α v β 3 integrins) .J Biol.Chem.279 (23): 23996-4006.
34.Tsuruta, D.and Jones J.C. (2003) The vimentin cytoskeletonregulates focal contact size and adhesion of endothelial cellssubjected to shear stress (the vimentin cytoskeleton is regulated sticking together the spot size and sticking together of the endotheliocyte stand shear-stress) .J Cell Sci.116 (Pt 24): 4977-84.
35.Lipscomb, E.A.et al. (2003) Use of RNA interference to inhibitintegrin (alpha6beta4)-mediated invasion and migration of breastcarcinoma cells (purposes that RNA disturbs the breast cancer cell of inhibition of integrins (alpha 6 beta 4) mediation to invade and move) .Clin Exp Metastasis.20 (6): 569-76.
36.Nagy, P.et al (2003) Small interfering RNAs suppress theexpression of endogenous and GFP-fused epidermal growth factorreceptor (erbB1) and induce apoptosis in erbB1-overexpressing cells (siRNA suppresses the expression of endogenous and the EGF-R ELISA (erbB1) that GFP merges and induces the apoptosis of erbB1 overexpression cell) .Exp Cell Res.285 (1): 39-49.
37.Yang, G.et al (2004) Inhibition of breast and ovarian tumor growththrough multiple signaling pathways by using retrovirus-mediatedsmall interfering RNA against Her-2/neu gene expression (using retrovirus mediation siRNA to suppress mammary gland and ovarian tumor growth) .J.Biol Chem.279 (6): 4339-45. by a plurality of signal transduction paths at Her-2/neu genetic expression
38.Zhang, L et al. (2004) RNA interference-mediated silencing of theS100A10 gene attenuates plasmin generation and invasiveness ofColo 222 colorectal cancer cells (the plasmin production and the invasivenesses of S100A10 gene silencing weakening Colo 222 colorectal cancer cells that mediated rnai is led) .J Biol Chem.16:279 (3): 2053-62.
39.Chen, Y.et al (2003) Down-regulation of CXCR4 by inducible smallinterfering RNA inhibits breast cancer cell invasion in vitro (can induce siRNA the downward modulation of CXCR4 to be suppressed the external intrusion of breast cancer cell) .CancerRes.63 (16): 4801-4.
40.Reginato, M.J.et al. (2003) Integrins and EGFR coordinatelyregulate the pro-apoptotic protein Bim to prevent anoikis (the collaborative pro apoptotic protein Bim that regulates of integrin and EGFR is to prevent anoikis) .Nat Cell Biol, 5 (8): 733-40.
41.Gschwind A.et al (2003) TACE cleavage of proamphiregulinregulates GPCR-induced proliferation and motility of cancer cells (mobility of GPCR inductive propagation and cancer cells is regulated in the TACE cutting of short amphiregulin) .EMBO is (10): 2411-21. J.22
42.Shu, X.et al (2002) Sphingosine kinase mediates vascularendothelial growth factor-induced activation of ras and mitogen-activated protein kinases (the kinase mediated vascular endothelial growth factor inductive of sheath propylhomoserin ras activates and mitogen activated protein kinase) .Mol Cell Biol.22 (22): 7758-68.
43.Baldanzi, G.et al. (2004) Activation of diacylglycerol kinase alpha isrequired for VEGF-induced angiogenic signaling in vitro (activation of diacylglycerol kinases α is that the external angiogenic signal conduction of VEGF inductive institute is necessary) .Oncogene.23 (28): 4828-38.
44.Le Gouill, S.et al. (2004) VEGF induces MCL-1 upregulation andprotects multiple myeloma cells against apoptosis (VEGF induces last mediation of MCL-1 to protect many myeloma cells to avoid apoptosis) .Blood.104 (9): 2886-92.
45.Spagnuolo, R.et al (2004) Gas1 is induced by VE-cadherin andvascular endothelial growth factor and inhibits endothelial cellapoptosis (Gas1 induced and suppress endothelial cell apoptosis) .Blood.103 (8): 3005-12. by VE-cadherin and vascular endothelial growth factor
46.Calipel, A.et al. (2003) Mutation of B-Raf in human choroidalmelanoma cells mediates cell proliferation and transformationthrough the MEK/ERK pathway (sudden change of B-Raf is by MEK/ERK approach mediated cell propagation and conversion in people's choroid melanoma cells) .J Biol Chem.278 (43): 42409-18.
47.Thamilselvan, V.and Basson M.D. (2004) Pressure activates coloncancer cell adhesion by inside-out focal adhesion complex and actincytoskeletal signaling (pressure sticks together spot mixture and actin cytoskeleton signal conduction activation colon cancer cell inside and sticks together by turning up) .Gastroenterology.126 (1): 8-18.
48.Kumar, A.S.et al. (2004) ILKAP regulates ILK signaling andinhibits anchorage-independent growth (ILKAP regulates the conduction of ILK signal and suppresses the anchorage dependence growth) .Oncogene.23 (19): 3454-61.
49.Meng W.et al. (2004) DIP (mDia interacting protein) is a keymolecule regulating Rho and Rac in a Src-dependent manner (DIP (mDia interaction protein) is a key molecule of regulating Rho and Rac in Src dependency mode) .EMBO is (4): 760-71. J.23
50.Tseng, C.P.et al (2003) Disabled-2 small interfering RNAmodulates cellular adhesive function and MAPK activity duringmegakaryocytic differentiation of K562 cells (the Disabled-2 siRNA is regulated cell adhesion function and MAPK activity in the megalokaryocyte atomization of K562 cell) .FEBS Lett.541 (1-3): 21-7.
51.Sato, S.et al. (2004) Involvement of 3-phosphoinositide-dependentprotein kinases-1 in the MEK/MAPK signal-transduction pathway (participation of 3-phosphoinositide deopendent protein kinase 1 in the MEK/MAPK signal transduction pathway) .J Biol Chem.279 (32): 33759-67.
52.Xu, J.et al. (2004) TRIP6 enhances lysophosphatidic acid-inducedcell migration by interacting with the lysophosphatidic acid 2receptor (TRIP6 strengthens the cell migration of Ultrapole L inductive by with Ultrapole L 2 acceptors interaction taking place) .J Biol Chem.279 (11): 10459-68.
53.Lu, P.Y.and M.Woodle (2005) Delivering siRNA in vivo Forfunctional genomics can novel therapeutics (but sending siRNA development of new medicine) .In RNA Interference Technology.Cambridge University Press.P 303-317. in the functional genomics body
54.Filleur, S.et al (2003) SiRNA-mediated inhibition of vascularendothelial growth factor severely limits tumor resistance toantiangiogenic thrombospondin-1 and slows tumor vascularizationand growth (restraining effect to vascular endothelial growth factor of SiRNA mediation seriously limits tumour to the resistance of anti-angiogenic thrombospondin-1 and slow down tumor neogenetic blood vesselsization and growth) .Cancer Res.63 (14): 3919-22.
55.Beale, G.et al (2003) Gene silencing nucleic acids designed byscanning arrays:anti-EGFR activity of siRNA, ribozyme and DNAenzymes targeting a single hybridization-accessible region using thesame delivery system (by the gene silencing nucleic acid of scanning array design: with the anti-EGFR activity of siRNA, ribozyme and the DNA enzyme of the single hybridization accessible area of same delivery system target) .J Drug Target.11 (7): 449-56.
56.Aoki, Y.et al (2003) RNA interference may be more potent thanantisense RNA in human cancer cell lines (RNA disturbs may be more effective than sense-rna in the human carcinoma cell line) .Clin Exp Pharmacol Physiol.30 (1-2): 96-102.
57.Zheng, B.J.et al (2004) Prophylactic and therapeutic effects ofsmall interfering RNA targeting SARS-coronavirus (prevention of the siRNA of target sars coronavirus and therapeutic action) .Antiviral Therapy.9:365-374.
58.Han, S.W.et al. (2004) VEGF gene polymorphisms andsusceptibility to rheumatoid arthritis (VEGF gene pleiomorphism and to the susceptibility of rheumatoid arthritis) .Rheumatology (Oxford) .43 (9): 1173-7.
59.Gudbjornsson, B.et al. (2004) Synovial concentrations of theangiogenic peptides bFGF and VEGF do not discriminaterheumatoid arthritis from other forms of inflammatory arthritis (synovial membrane angiogenic peptide bFGF and VEGF concentration can not region class rheumatic arthritis and other forms of inflammatory arthritis) .Scand J Clin Lab Invest.64 (1): 9-15.
60.Grosios, K.et al. (2004) Angiogenesis inhibition by the novel VEGFreceptor tyrosine kinase inhibitor, PTK787/ZK222584, causessignificant anti-arthritic effects in models of rheumatoid arthritis (novel vegf receptor tyrosine kinase inhibitor PTK787/ZK222584 causes significant arthritis effect to the restraining effect that blood vessel takes place in the rheumatoid arthritis model) .Inflamm Res.53 (4): 133-42.
61.Klimiuk, P.A.et al. (2004) Reduction of soluble adhesion molecules (siCAM-1, sVCAM-1, and sE-selectin) and vascular endothelialgrowth factor levels in serum of rheumatoid arthritis patientsfollowing multiple intravenous infusions of infliximab (solubility adhesion molecule (siCAM-1 in the rheumatoid arthritis human serum behind the venous perfusion infliximab repeatedly, sVCAM-1, with the sE-selectin) and the decline of vascular endothelial growth factor level) .Arch Immunol Ther Exp (Warsz) .52 (1): 36-42.
62.Zhang, H.G.et al (2004) Novel tumor necrosis factor alpha-regulated genes in rheumatoid arthritis (gene that novel tumor necrosis factor α regulates in the rheumatoid arthritis) .Arthritis Rheum.50 (2): 420-31.
63.Miyashita, T.et al (2003) Akt is an endogenous inhibitor towardtumor necrosis factor-related apoptosis inducing ligand-mediatedapoptosis in rheumatoid synovial cells (Akt is the endogenous inhibitor at the tumor necrosin relative death of inducing ligand mediated apoptosis among the rheumatoid synovial cell) .Biochem Biophys Res Commun.312 (2): 397-404.
64.Dowds, T.A.et al. (2004) Cryopyrin-induced interleukin 1betasecretion in monocytic cells:enhanced activity of disease-associatedmutants and requirement for ASC (cryopyrin inductive interleukin-11 β secretion in the monocyte: the enhanced activity of disease-related mutant and the requirement of ASC) .J BiolChem.279 (21): 21924-8.
65.Schiffelers, R.M.et al. (2004) Pharmaceutical Prospects for RNAinterference (RNA interferential pharmacy prospect) .Pharmaceutical Research, 21:1-7.
66.Jackson, A.et al (2003) Expression profiling reveals off-target generegulation by RNAi (expressing the generegulation of missing the target that profile analysis discloses RNAi) .NatBiotechnol.21,635-637.
67.Sledz, C.A.et al. (2003) Activation of the interferon system byshort-interfering RNAs (short interfering rna is to the activation of interferon system) .NatureCell Biol.5,834-39.
68.Kariko, K.et al (2004) Small interfering RNAs mediate sequence-independent gene suppression and induce immune activation bysignaling through toll-like receptor 3 (siRNA activates by signal conduction mediation sequence-independent manner gene inhibition effect and the induction of immunity that toll sample acceptor 3 carries out) .J.Immunol 172,6545-9.
Heidel, J.D.et al. (2004) Lack of interferon response in animals tonaked siRNAs (lacking ifn response in the animal) .Nature Biotech.22 (12): 1579-82. to naked siRNA

Claims (43)

1. composition that comprises at least two siRNA duplexs and medicine effective carrier, wherein the double-stranded physical efficiency of each described siRNA suppresses the expression of gene relevant with lysis.
2. the composition of claim 1, wherein said gene is different gene.
3. the composition of claim 1, wherein said composition comprises at least three siRNA duplexs.
4. the composition of claim 1, the double-stranded physical efficiency of wherein said siRNA suppresses the expression of at least three gene orders, comprises three open reading-frame (ORF)s and three mRNA.
5. the composition of claim 1, wherein said gene is endogenous people's gene.
6. the composition of claim 1, wherein said gene is the foreign gene of one or more pathogenic agent.
7. the composition of claim 1, wherein said siRNA duplex is the chemosynthesis form, comprises the chemically modified RNA base of natural RNA base and/or RNA base analogue.
8. method for the treatment of experimenter's disease, described method comprises the composition that gives described experimenter's claim 1.
9. target validation method, described method comprise the composition of testing experimenter's claim 1 and the variation of measuring genetic expression among the described experimenter.
10. the method for claim 8, wherein said composition are sent by local injection, suction, local creme, skin patch or by intravenously (IV), intraperitoneal (IP) or intramuscular (IM) injecting systems and are given.
11. the composition of claim 1, described composition comprises aagctcctaattacactcaac; Aaggatgaggaaggcaattta; Aaggataagtcagctcaatgc; And aactggcacactacttgtcga.
12. a method for the treatment of the coronavirus among the experimenter, described method comprises the composition that gives described experimenter's claim 1.
13. the composition of claim 1, described composition comprises AAGCCGTCCTGTGTGCCGCTG; AACGATGAAGCCCTGGAGTGC; AAGTTAAAAGTGCCTGAACTG; AAGCAGGCCAGACTCTCTTTC; AAGCTCAGCACACAGAAAGAC; And AATGCGGCGGTGGTGACAGTA.
14. a method for the treatment of experimenter's illness in eye, described method comprises the composition that gives described experimenter's claim 13.
15. a composition that comprises the siRNA duplex combination of the expression that can suppress VEGF, VEGF R2 and VEGF R1, wherein said duplex is selected from Figure 17.
16. the method for claim 8, wherein said disease are selected from eye neovascularization diseases such as moist age-related macular degeneration, diabetic retinopathy and stromal keratitis, various types of cancer, rheumatoid arthritis and lung blood vessel generation disease.
17. the other diseases that the method for claim 8, wherein said disease are selected from cancer, autoimmune disease and inflammatory diseases and are caused or increased the weight of by the unusual overexpression of a plurality of genes.
18. the composition of claim 1, the mRNA sequence of the double-stranded physical efficiency target of wherein said siRNA VEGF, VEGF R1 and VEGF R2, and be selected from Figure 17 SS1, SS2 and SS3.
19. method for the treatment of blood vessel generation relative disease, described method comprises the composition that gives claim 18, and wherein said disease is cancer, eye neovascularization such as moist age-related macular degeneration, diabetic retinopathy, peripheral retina neovascularization or glaucoma.
20. the composition of claim 1, the mRNA sequence of the double-stranded physical efficiency target of wherein said siRNA EGF acceptor, VEGF and FGF, and be selected from Figure 17 SS1, SS2 and SS3.
21. the composition of claim 1, the double-stranded physical efficiency target of wherein said siRNA EGF acceptor, vegf receptor and FGF receptor mRNA sequence, and be selected from Figure 17 SS1, SS2 and SS3.
22. a method for cancer for the treatment of the experimenter, described method comprise the composition that gives described experimenter's claim 20 or 21.
23. the composition of claim 1, the mRNA sequence of the double-stranded physical efficiency target of wherein said siRNA androgen receptor, VEGF and AMACR, and be selected from Figure 17 SS2 and SS53.
24. a method for the treatment of experimenter's prostate cancer, described method comprises the composition that gives described experimenter's claim 23.
25. the composition of claim 1, the mRNA sequence of the double-stranded physical efficiency target of wherein said siRNA VEGF, c-Met and PCDP10, and be selected from Figure 17 SS2, SS4 and SS5.
26. a method for the treatment of experimenter's liver cancer, lung cancer or colorectal carcinoma, described method comprises the composition that gives described experimenter's claim 25.
27. the composition of claim 1, the mRNA sequence of the double-stranded physical efficiency target of wherein said siRNA HGF, c-Met and VEGF, and be selected from Figure 17 SS2, SS3.
28. a method for the treatment of experimenter's liver cancer, described method comprises the composition that gives described experimenter's claim 27.
29. the composition of claim 1, the mRNA sequence of the double-stranded physical efficiency target of wherein said siRNA EGF acceptor, VEGF and p53 mutant, and be selected from Figure 17 SS1, SS2 and SS3.
30. a method for the treatment of experimenter's lung cancer, described method comprises the composition that gives described experimenter's claim 29.
31. the composition of claim 1, the double-stranded physical efficiency target HPV16 of wherein said siRNA and E6, the E7 of HPV18 and the mRNA sequence of human P 53 mutant.
32. a method for the treatment of experimenter's cervical cancer, described method comprises the composition that gives described experimenter's claim 31.
33. the composition of claim 1, the mRNA sequence of the double-stranded physical efficiency target of wherein said siRNA MMP-2, PDGF-R and α v β 3 integrins.
34. a method for cancer for the treatment of the experimenter, described method comprises the composition that gives described experimenter's claim 33.
35. the composition of claim 1, the double-stranded physical efficiency target of wherein said siRNA TNF α, IL-1 and IL-1 receptor mRNA sequence.
36. a method for the treatment of experimenter's inflammatory diseases, described method comprises the composition that gives described experimenter's claim 35.
37. the method for claim 36, wherein said disease are rheumatoid arthritis, uveitis, psoriasis or Crohn disease.
39. the composition of claim 1, the mRNA sequence of the double-stranded physical efficiency target of wherein said siRNA IL-9, IL-4 and IL-5.
40. a method for the treatment of experimenter's asthma, pulmonary fibrosis or ARDS, described method comprises the composition that gives described experimenter's claim 39.
41. the composition of claim 1, the mRNA sequence of the virus nucleocapsid albumen of the double-stranded physical efficiency target of wherein said siRNA RSV virus, non-glycosylated interior virion protein and transmembrane glycoprotein (F), and be selected from Figure 17 SS6.
42. a treatment suffers the experimenter's of rsv infection method, described method comprises the composition that gives described experimenter's claim 41.
43. the composition of claim 1, the mRNA sequence of spike protein, RNA polymerase and the rna replicon enzyme of the double-stranded physical efficiency target of wherein said siRNA SARS-CoV, and be selected from Figure 17 SS7.
44. a method for the treatment of experimenter's SARS, described method comprises the composition that gives described experimenter's claim 43.
CNA2005800119560A 2004-02-05 2005-02-07 Methods and compositions for combination rnai therapeutics Pending CN101044152A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US54177604P 2004-02-05 2004-02-05
US60/541,776 2004-02-05

Publications (1)

Publication Number Publication Date
CN101044152A true CN101044152A (en) 2007-09-26

Family

ID=34860217

Family Applications (1)

Application Number Title Priority Date Filing Date
CNA2005800119560A Pending CN101044152A (en) 2004-02-05 2005-02-07 Methods and compositions for combination rnai therapeutics

Country Status (5)

Country Link
EP (1) EP1713819A4 (en)
CN (1) CN101044152A (en)
AU (1) AU2005213485A1 (en)
CA (1) CA2555531A1 (en)
WO (1) WO2005076999A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111620939A (en) * 2019-10-25 2020-09-04 南京市妇幼保健院 Polypeptide ZYX for treating or assisting in treating ovarian cancer36-58
CN114196785A (en) * 2020-09-18 2022-03-18 北京大学人民医院 Biomarker for susceptibility of cytomegalovirus to megakaryocytes after allogeneic hematopoietic stem cell transplantation and application thereof
CN114452393A (en) * 2022-02-22 2022-05-10 南方科技大学 Application of PINCH-1 protein as target in preparation of medicine for treating pulmonary fibrosis
WO2023174356A1 (en) * 2022-03-17 2023-09-21 圣诺生物医药技术(苏州)有限公司 Nucleic acid interference pharmaceutical composition, and drug for treating colorectal cancer, gastric cancer, and prostate cancer

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8491914B2 (en) * 2004-02-13 2013-07-23 Ibc Pharmaceuticals, Inc. Dock-and-lock (DNL) complexes for delivery of interference RNA
US8691781B2 (en) 2004-11-05 2014-04-08 Sirnaomics, Inc. Compositions for treating respiratory viral infections and their use
EP2487243A3 (en) 2005-01-07 2013-08-28 Alnylam Pharmaceuticals Inc. RNAI modulation of RSV and therapeutic uses thereof
KR20080041145A (en) * 2005-04-12 2008-05-09 인트라디그엠 코오포레이션 Composition and methods of rnai therapeutics for treatment of cancer and other neovascularization diseases
CA2619950A1 (en) * 2005-08-26 2007-03-01 Henry Ford Health System Methods and compositions for investigation and treatment of cancer using a g-protein coupled eicosanoid receptor
EP1970078A4 (en) * 2006-01-11 2010-11-17 Kyowa Hakko Kirin Co Ltd Composition inhibiting the expression of target gene in eyeball and remedy for disease in eyeball
CA2664271A1 (en) * 2006-11-27 2008-06-12 Enzon Pharmaceuticals, Inc. Polymeric short interfering rna conjugates
CN101583715A (en) * 2006-12-21 2009-11-18 因特拉迪格姆公司 Inhibitory polynucleotide compositions and methods for treating cancer
PT2308514E (en) 2007-03-23 2013-09-06 To Bbb Holding B V Conjugates for targeted drug delivery across the blood-brain barrier
US8486904B2 (en) * 2007-10-01 2013-07-16 Isis Pharmaceuticals, Inc. Antisense modulation of fibroblast growth factor receptor 4 expression
CN101917846B (en) 2007-11-06 2014-06-25 圣诺制药公司 Multi-targeted RNAI therapeutics for scarless wound healing of skin
WO2009151539A1 (en) 2008-05-24 2009-12-17 Sirnaomics, Inc. COMPOSITIONS AND METHODS USING siRNA MOLECULES FOR TREATMENT OF GLIOMAS
WO2010078517A2 (en) 2008-12-31 2010-07-08 Sirnaomics, Inc. Compositions and methods using sirna molecules and sirna cocktails for the treatment of breast cancer
US9642873B2 (en) 2010-05-04 2017-05-09 Sirnaomics, Inc. Combinations of TGFβ and COX-2 inhibitors and methods for their therapeutic application
WO2012016139A2 (en) 2010-07-29 2012-02-02 Sirnaomics, Inc. Sirna compositions and methods for treatment of hpv and other infections
CA2839437A1 (en) 2011-06-16 2012-12-20 Isis Pharmaceuticals, Inc. Antisense modulation of fibroblast growth factor receptor 4 expression
CN103007291B (en) * 2011-09-26 2015-04-29 苏州圣诺生物医药技术有限公司 Composition for treating eye diseases by double-target/multi-target small nucleic acid and applications of composition
CN102399820B (en) * 2011-09-27 2013-06-12 天津佰思普生物科技有限公司 Small interfering RNA directed at HPV16 E7 gene and its application
WO2014011512A1 (en) 2012-07-08 2014-01-16 Sirnaomics, Inc. Compositions and methods for "resistance-proof" sirna therapeutics for influenza
US20180036404A1 (en) 2015-03-02 2018-02-08 180 Therapeutics Lp Method of treating a localized fibrotic disorder using a tnf receptor 2 antagonist
CN110177544A (en) 2016-11-29 2019-08-27 普尔泰克健康有限公司 For delivering the excretion body of therapeutic agent
CN106771252A (en) * 2017-01-13 2017-05-31 福建医科大学 Application and kit of the AMACR albumen in prognosis evaluation reagent kit after preparing Liver Cancer Operation
EP4093511A4 (en) * 2020-01-23 2023-10-18 Sirnaomics, Inc. Composition and methods of rnai prophylactics and therapeutics for treatment of severe acute respiratory infection caused by 2019 novel coronavirus (2019-ncov)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040033602A1 (en) * 2002-06-12 2004-02-19 Ambion, Inc. Methods and compositions relating to polypeptides with RNase III domains that mediate RNA interference
CA2523658A1 (en) * 2003-04-25 2005-03-03 Intradigm Corporation Rnai agents for anti-sars coronavirus therapy

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111620939A (en) * 2019-10-25 2020-09-04 南京市妇幼保健院 Polypeptide ZYX for treating or assisting in treating ovarian cancer36-58
CN111620939B (en) * 2019-10-25 2021-01-01 南京市妇幼保健院 Polypeptide ZYX for treating or assisting in treating ovarian cancer36-58
CN114196785A (en) * 2020-09-18 2022-03-18 北京大学人民医院 Biomarker for susceptibility of cytomegalovirus to megakaryocytes after allogeneic hematopoietic stem cell transplantation and application thereof
CN114452393A (en) * 2022-02-22 2022-05-10 南方科技大学 Application of PINCH-1 protein as target in preparation of medicine for treating pulmonary fibrosis
WO2023174356A1 (en) * 2022-03-17 2023-09-21 圣诺生物医药技术(苏州)有限公司 Nucleic acid interference pharmaceutical composition, and drug for treating colorectal cancer, gastric cancer, and prostate cancer

Also Published As

Publication number Publication date
CA2555531A1 (en) 2005-08-25
WO2005076999A2 (en) 2005-08-25
EP1713819A4 (en) 2007-11-14
AU2005213485A1 (en) 2005-08-25
WO2005076999A3 (en) 2006-07-06
EP1713819A2 (en) 2006-10-25

Similar Documents

Publication Publication Date Title
CN101044152A (en) Methods and compositions for combination rnai therapeutics
CN1189562C (en) Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
CN1836042A (en) Conserved HBV and HCV sequences useful for gene silencing
CN1604906A (en) Antisense antiviral agent and method for treating ssRNA viral infection
CN1918292A (en) Oligomeric compounds for the modulation of bcl-2
CN1177378A (en) Stabilized external guide sequences
CN1934255A (en) Combination therapy for the treatment of ocular neovascular disorders
CN1268980A (en) Novel screening methods to identify agents that selectively inhibit hepatitis C virus replication
CN1780922A (en) Compositions and methods for the treatment of severe acute respiratory syndrome (SARS)
CN1203632A (en) P16 expression constructs and their application in cancer therapy
CN105903036A (en) Use of miR-130a antisense nucleic acid and its derivatives in Hippo-YAP signal path inhibitor
US20220042020A1 (en) Pharmaceutical composition that inhibits production of hepatitis b virus protein and screening method
CN1784242A (en) A method of treating a malignancy in a subject via direct picornaviral-mediated oncolysis
CN1718194A (en) Oligonucleotide medicine for treating myophagism
CN1302107C (en) Oligonucleotide sequences complementary to thioredoxin or thioredoxin reductase genes and methods of using same to modulate cell growth
CN1701077A (en) Use of antisense oligonucleotides to inhibit the expression of Akt-1
CN1793359A (en) HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof
CN105899238B (en) Treatment of hepatitis virus infection by modulation of microRNAMIR-130 a, miR-130b, miR-204 or miR-1236
Bhosle et al. Evaluation of cellular determinants required for in vitro xenotropic murine leukemia virus-related virus entry into human prostate cancer and noncancerous cells
CN1948483A (en) SiRNA for inhibiting human Rabj gene expression and its application
TW200808361A (en) RNAi-mediated inhibition of histamine receptor H1-related conditions
CN101054591A (en) Oligonucleotide for targeted activation of chronic granulocyte leukaemia protein kinase PKR and application thereof
CN1809583A (en) Antisense oligonucleotides that inhibit expression of hif-1
US8722875B2 (en) Means for inhibiting the expression of Orc-1
CN1599627A (en) Therapeutically useful triethyleneglycol cholesteryl oligonucleotides

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Open date: 20070926