CN101033486B

CN101033486B - Novel fluorescence quantitative PCR detection technique

Info

Publication number: CN101033486B
Application number: CN2006100244868A
Authority: CN
Inventors: 缪金明
Original assignee: Individual
Current assignee: Individual
Priority date: 2006-03-08
Filing date: 2006-03-08
Publication date: 2011-04-06
Anticipated expiration: 2026-03-08
Also published as: CN101033486A

Abstract

The invention relates to a new type of fluorescent quantitative PCR technology, in which, it directly marks the fluorescent molecular onto the 5' end of one primer, inserts an artificial sequence of 15-25 bp between the fluorescent molecule and primer sequence, in addition, designs a probe complementary to the sequence, which 3' end is marked with a quench molecular. Before starting PCR, the probe with quench combines the primer with label, the quench agent gets close to the fluorescent molecule to quench fluorescent. When PCR reaction begins, the primers with fluorescent are integrated into PCR product constantly, probe is replaced by PCR products which issue fluorescence signals, and the intensity of fluorescence has 1:1 linear relationship with the accumulated PCR product completely.

Description

A kind of fluorescent quantitative PCR detection method

Affiliated technical field

The present invention is a kind of quantitative fluorescent PCR (polymerase chain reaction) detection technique that relates to, and adopts the method for the direct labeled primer of fluorescence, simplicity of design, and cost reduces, and with commercial fluorescence quantitative PCR detection hardware compatibility, can be used for the detection by quantitative of range gene.

Background technology

Fluorescent quantitative PCR technique commonly used at present mainly contains three kinds:

The Taqman technology: this technology is representative with American AB I company.During pcr amplification, when adding a pair of primer, add a specific fluorescent probe.This probe is the oligonucleotide of a linear pattern, and two ends are fluorescence report group of mark and a fluorescent quenching group respectively, and when probe was complete, the reporter group fluorescent signal emitted was absorbed by quenching group, and the PCR instrument detects less than fluorescent signal; During pcr amplification (in the extension stage), 5 of Taq enzyme ' → 3 ' 5 prime excision enzyme activity is cut degraded with the probe enzyme, the report fluorophor is separated with the cancellation fluorophor, thereby the fluorescence monitoring system can receive fluorescent signal, it is DNA chain of every amplification, just have a fluorescence molecule to form, realized that the accumulation of fluorescent signal and PCR product form fully synchronously, this also is quantitative basic place.

The Beacon technology: this technology is representative with American Tagyi.Also be to have added fluorescent probe, but it is the cyclic oligonucleotide probe, form by stem and ring portion respectively, two ends are mark fluorescent reporter group and fluorescent quenching group respectively, under the situation of no target sequence, probe is ring-type all the time, and the fluorescence of reporter group is detected less than fluorescent signal fluorescence detector by the quenching group cancellation; And when target sequence was arranged, promptly the annealing stage probe at PCR combined with target sequence, made fluorescence report group and quenching group separately, and luminoscope can detect fluorescence like this, and what of target sequence are the power of fluorescent signal represented.

The FRET technology: this technology is representative with Roche (Roche Holding Ag).Its ultimate principle is: two linear pattern oligonucleotide probes, wherein one 3 ' end mark fluorescent excites group, another 5 ' end mark fluorescent detection moiety, under the situation of no target sequence, article two, probe separately, can't carry out the transmission of energy, luminoscope can not detect fluorescent signal like this; And when target sequence, promptly two probes of annealing stage at PCR combine with target sequence, make the fluorophor on two probes can carry out the transmission of energy, luminoscope just can detect fluorescent signal like this, and what of target sequence are the power of fluorescent signal represented.

Aforesaid method can both well reach the requirement of real-time quantitative, but aspect system design, all there is certain deficiency in reaction condition optimization aspect and cost consideration aspect.The special software that the employed Taqman probe of Taqman technology needs ABI company to provide designs, otherwise probe might be able to not be worked effectively, in addition the Taqman probe need 5 ' and 3 ' double-tagging, make that probe complex sign time lengthening, yield descend, cost rises; Beacon technology employed probe has adopted stem's series of the hair clip of the ring portion sequence of hybridization and formation, be allowed to condition at and form hairpin structure under the reaction conditions, to having relatively high expectations of experiment condition, therefore optimize also comparatively difficulty, the deficiency aspect complex sign is the same with the Taqman technology; And the FRET technology that Roche company is adopted needs suitable fluorescence excitation group and the corresponding group that absorbs, and is bigger to the selectional restriction of fluorescent substance, is difficult to make up the multi-fluorescence reaction system.

The present invention adopts another kind of technology, can reach same purpose, and can overcome the above-mentioned shortcoming of mentioning.Can adopt conventional primer design method and conventional PCR reaction conditions, design of primers cost and probe mark cost greatly reduce.

Summary of the invention

The common a pair of primer of PCR reaction needed, be upstream primer and downstream primer, can carry out the pulsating amplification of target sequence between guiding region, this invention is at 5 of a side primer (as the upstream primer) ' end mark fluorescent molecule 1, the artificial sequence 3 that between fluorescence molecule 1 and primer sequence 4, contains one section 15-25 base, constitute the structure (5 ' → 3 ') of fluorescence molecule-artificial sequence-primer sequence, it is referred to as fluorescent dye primer 10 here; Design in addition one with fluorescent dye primer 10 in artificial sequence

complementary sequence

6,3 of this complementary sequence 6 ' quencher molecule 2 of end mark is referred to as it cancellation probe 8 here.In the PCR reaction system, cancellation probe 8 can be hybridized with the artificial sequence 3 in the fluorescent dye primer 10, and fluorescence molecule 1 is spatially approaching mutually with quencher molecule 2, and fluorescence is by cancellation, and fluorescence detector detects less than fluorescent signal (Fig. 1).

When carrying out the PCR reaction; Fluorescent dye primer 10 and downstream primer 5 and quenching probes 8 pressed etc. that molar concentration is mixed or quenching probes concentration a little more than primer concentration; Be that fluorescent dye primer and quenching probes concentration are 1: 1 to 1: 1.05; The artificial sequence of free fluorescent dye primer and the sequence annealing that is marked with quencher molecule; Because the concentration of quencher molecule is a little more than the concentration of primer; Therefore in the reaction system this moment fluorescence of all free primers by cancellation; Fluorescence detector can't detect fluorescence signal

When having target sequence 13 to exist in the PCR reaction system, fluorescent dye primer 10 (upstream primer) and downstream primer 12 also combine with the corresponding site annealing of target sequence respectively, when the PCR reaction is extended, fluorescent dye primer is integrated in the pcr amplification product 14 and goes, and the artificial sequence in the fluorescent dye primer is also by the combination of new synthetic amplified production institute, cancellation probe 11 is ostracised, quencher molecule is separated with fluorescence molecule, fluorescence molecule sends fluorescence 15, and can be detected by fluorescence detector, amplified production is many more in the system, it is also many more to be separated fluorescence molecule, is 1: 1 corresponding relation fully with amplified production, has realized that the accumulation of fluorescent signal and PCR product form fully synchronously, by the intensity of fluorescence in the real-time detection reaction system, thereby can realize PCR product quantitative (Fig. 2) according to the amount of fluorescence.

When realizing that the PCR product is quantitative, common fluorescent quantitation mode according to real-time quantitative PCR, (be meant the cycle number that the interior fluorescence signal intensity of each reaction tubes 16 is experienced when arriving the thresholding of setting by the Ct value, C represents circulation 18Cycle, and t represents threshold value 17threshold) calculate the gene copy number (Fig. 3) of starting template.Because there is linear relationship in the logarithm of the initial copy number of the Ct value of each template and this template, initial copy number is many more, and the Ct value is more little.Utilize the standard substance of known initial copy number can make typical curve, wherein X-coordinate is represented the logarithm of initial copy number, and ordinate zou is for the Ct value.Therefore, as long as obtain the Ct value of unknown sample, can calculate the initial target sequence copy number of this sample from typical curve.

The reaction system of this quantitative fluorescent PCR, less demanding to DNA Taq enzyme, and do not require that the Taq enzyme has the function of 5 ' → 3 ' excision enzyme, even general archaeal dna polymerase all can be competent at.

The advantage of this invention is:

1. design of primers is convenient, can design with conventional primer-design software.

2. fluorescent mark is convenient, because be 5 ' end fluorescent mark, mark is convenient, and is one-sided mark, and yield relatively bilateral mark wants high;

3. highly versatile, the primer end has one section artificial sequence, and this artificial sequence and corresponding cancellation probe go for all detections;

4. less demanding to archaeal dna polymerase Taq enzyme, the Taq enzyme that general PCR uses can be suitable for;

5. for above-mentioned reasons, detecting cost greatly reduces.

6. combine with ARMS PCR (amplification retardance sudden change system polymerase chain reaction) technology, can be used for the detection of transgenation, adopts 4 ARMS PCR of 4 kinds of fluorescent substance marks primer can be in a pipe genotype in while 2 mutational sites.

Description of drawings

The structure of Fig. 1 primer, probe

Artificial sequence complementary in 1 fluorescent tag molecule 6 and the fluorescent dye primer

The cancellation probe sequence

2 fluorescent quenching molecules, 7 fluorescent dye primers and are after the cancellation probe separates

The fluorescent emission state

Artificial sequence 8 cancellation probes in 3 primers

4 upstream primer sequences, 9 downstream primers

5 downstream primers

The primer of Fig. 2 novel fluorescence quantitative PCR reaction and probe design and detection principle

The target sequence that 10 fluorescent dye primers 13 are amplified

11 cancellation probes 14 have been integrated the PCR product of primer

12 downstream primers, 15 fluorescent dye primers are integrated in the PCR product also

Send fluorescence

Fig. 3 Salmonellas Shigellae double fluorescent quantitative PCR detected result

16 fluorescence intensity levels, 19 Salmonellas InvA gene amplification curves

17 threshold lines, 20 23 SRNA amplification curves

18 quantitative fluorescent PCR cycle numbers, 21 Shigellae IpaH amplification curves

Embodiment

Example one: infectious intestinal disease pathogenic bacterium Salmonellas Shigellae Q-PCR combined detection kit

The bacterium combined detection kit of infectious intestinal disease is a kind of external detection method, is mainly used in the diagnosis of clinical infectious disease pathogens in summer, catering industry practitioner's health check-up etc., detects sample and is stool.Main bacterial detection is salmonella and Shigella kind.

By multianalysis, select this bacterium to belong to special gene fragment as detecting target fragment to Salmonellas Shigellae genomic dna.The employing fluorescent quantitative PCR technique detects salmonella and the Shigella in the sample simultaneously.The common invasin protein gene invA that selects Salmonellas has been contained all salmonellas as detecting target spot; Shigella has adopted the common antigen gene ipaH of the pathogenic big plasmid of will Hayes genus, and this gene has also been contained all bacteriums of all Shigellaes, and adopts fluorescent quantitative PCR technique to detect.Intestines invasion and attack type intestinal bacteria also contain the IpaH of Shigella, also be positive during detection, but, enteroinvasive E.Coli is ranged Shigellae be used for practical application because colibacillary biological property of intestines invasion and attack type and Clinical symptoms and Shigellae are closely similar.

1. the selection of target gene

InvA: Salmonellas invasin protein (invasion protein) Corynebacterium diphtheriae karyomit(e) contains four gene relevant with invasiveness: invA (coding 54KD albumen), invB (coding 64KD protein), invC (coding 47KD albumen) and invD (coding 30KD albumen).These genes were positioned at karyomit(e) the 58th minute, and wherein invABC is in same transcription unit, formed a complete operon.InvA is the distinctive gene of Salmonellas, selects can increase Salmonellas more than 98.6% of suitable primer.

IpaH: Shigellae invasin protein plasmid antigen H (invasion plasmid antigen H) IpaH is the invasin protein antigen of Shigellae, and is relevant with the distinctive bacteria attack virulence of Shigellae, by Shigellae peculiar.

(GenBank number: STYINVA) (GenBank number: sequences Design SHFIPAH) is used for the primer and the corresponding fluorescence labeling probe of double fluorescent quantitative PCR to this product with the IpaH gene according to the InvA gene.

2. the design of primer and probe

Sequence title primer title sequence

Primer sequence I Q-invA-F FAM-CGGCGGCGGCGGCGG-ACAATCCATCAGCAAGGTAGCA

Primer sequence II Q-invA-R CCAAGCTCCCGGAGTTTCTC

Primer sequence III Q-ipaH-F HEX-CGGCGGCGGCGGCGG-CCTTTTCCGCGTTCCTTGA

Primer sequence IV Q-ipaH-R ACGGAATCCGGAGGTATTGC

Primer sequence V Q-23S-F GGGCCATCGCTCAACG

Primer sequence VI Q-23S-R ROX-CGGCGGCGGCGGCGG-GAGCCGACATCGAGGTGC

Probe sequence I Q-Probe CCGCCGCCGCCGCCG-BHQ1

FAM (6-Carboxyfluorescein), HEX (4,7,2 ', 4 ', 5 ', 7 '-hexachloro-6-carboxyfluorescein), (5-(and 6)-Carboxy-X-rhodamine) is respectively the abbreviation of fluorescent substance to ROX, and the excitation/emission wavelength is respectively 494/518nm, 535/553nm and 587/607nm.BHQ1 (Black HoleQuencher) is the fluorescent quenching agent, when with above-mentioned fluorescence molecule near the time, can absorb the fluorescent signal that fluorescence sends.The mark of fluorescent substance and quencher all be service provider provide synthetic.

The InvA target gene of primer sequence I and primer sequence II amplification Salmonellas, primer sequence III and primer sequence IV amplification Shigellae IpaH target gene, and primer sequence V and the total 23SRNA gene of primer sequence VI amplification bacterium, as the internal reference gene that detects, can get rid of InvA and IpaH target sequence when negative not because reagent quality is former thereby cause.

Probe sequence is any artificial sequence, but 5 in the primer ' end artificial sequence is complementary with it.

3. the preparation of primer and probe reagent

Primer sequence I to VI and probe sequence I are made into 50 μ M mother liquors separately, aluminium-foil paper parcel lucifuge.Then primer sequence I to VI mother liquor is respectively got 20 μ l, probe sequence I mother liquor and got 60 μ l and mix, add Milli Q water (320 μ l), be made into 10 * PCR primer probe mixture, aluminium-foil paper parcel lucifuge to volume 500 μ l.

4.PCR reaction conditions

Detecting with human faecal mass Salmonellas, Shigellae is example, behind the natural defecation, chooses its purulence blood, mucus part 2-3g, and liquid manure removes floss 2-3ml, contains in sterilising vessel and inspects by ready samples.

In sample, add the sterile saline of 2 times of volumes, stir evenly natural sedimentation 10 minutes, the direct streak inoculation of supernatant liquor in the Mai Kangkai flat board, was cultivated 18-24 hour picking colony 5-10 for 35 ℃, be dissolved in the 0.5ml distilled water, mixing, bacterium liquid is directly used in pcr analysis.50 μ l PCR reaction systems comprise: 10 * real-time PCR reactions damping fluid, 5 μ l; Taq enzyme solution (5U/ μ l) 0.25 μ l; Mg++ solution (250mM) 1 μ l; DNTP, dUTP mixture 1 μ l; UDG enzyme (ura DNA glycosyl enzyme, 5U/ μ l) 0.25 μ l; 10 * primer/probe solution 5 μ l; Bacterial suspension (about 0.5OD) 2 μ l; Milli-Q water 35.5 μ l.In the reaction system, (the Brdurd base in can hydrolysis DNA makes dna break, loses the effect of template not adopt UDG, it is anti-pollution to be used for PCR) time, dNTP is 4 kinds of (dATP, dTTP, dGTP, dCTP), concentration respectively is 10mM, and final concentration is 0.2mM, when adding UDG in the system, be dATP, dGTP, each 10mM of dCTP adds the mixture of dUTP 20mM, final concentration dATP, dGTP, each 0.2mM of dCTP, dUTP are 0.4mM.

With ABI Prism 7000 quantitative real time PCR Instruments is example, the quantitative fluorescent PCR parameter is set on ABI Prism 7000, in fluorescent probe (Detector Manager), add FAM, HEX (or VIC) and ROX fluorescence, make instrument when detecting, can detect FAM, HEX and ROX fluorescence simultaneously, with reference to (Passive) fluorescence ROX cancellation (being set as None).The thermal circulation parameters reference value be 50 ℃ 2 minutes, 95 ℃ 10 minutes, be 95 ℃ 15 seconds, 60 ℃ (owing to be many fluoroscopic examinations, time can not less than 30 seconds) totally 40 circulations in 40 seconds then.

5. data analysis

During analytical results, baseline (baseline) and the desirable instrument default value of threshold value (threshold) (this value can be adjusted according to instrument and reagent situation).6-15 round-robin fluorescent signal is a baseline before getting generally speaking.When carrying out data analysis, generally need manually be provided with, the data longitudinal axis is changed into linearity, use the mouse drag threshold line, move to all more than the baseline, generally between 150-200, final report (FR) and observe the Ct result of every part of sample.

In fluorescence curve figure, under the normal circumstances, the Ct value of positive bacteria generally between 15-30, is indicated as feminine gender greater than 38 all less than 38.Every increment originally has a curve at least, is the amplification curve of the 23SRNA gene that all bacteriums are total, when Salmonellas or/and Shigellae when positive, 2 or 3 amplification curves (Fig. 3) can occur.

Claims

1. fluorescent quantitative PCR detection method, this method adopts fluorescent dye primer and cancellation probe to detect, fluorescent dye primer is by the fluorescence molecule of 5 ' end mark, the artificial sequence and the primer sequence of 15-25 base are formed, the cancellation probe is 3 ' end mark quencher molecule and with fluorescent dye primer in the complete complementary sequence of artificial sequence, before the PCR reaction beginning, fluorescent dye primer becomes the isoconcentration state with the cancellation probe, fluorescence molecule is by the quencher molecule cancellation, and after the PCR reaction beginning, the fluorescent dye primer that has a fluorescence molecule is integrated in the PCR product and sends fluorescent signal, fluorescence signal intensity fully and the accumulation of PCR product be 1: 1 linear relationship.