CN101020910A - Flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application - Google Patents
Flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application Download PDFInfo
- Publication number
- CN101020910A CN101020910A CN 200710051360 CN200710051360A CN101020910A CN 101020910 A CN101020910 A CN 101020910A CN 200710051360 CN200710051360 CN 200710051360 CN 200710051360 A CN200710051360 A CN 200710051360A CN 101020910 A CN101020910 A CN 101020910A
- Authority
- CN
- China
- Prior art keywords
- rape
- sequence
- transgenic
- exogenous
- event
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Ms1 with transgenic rape Ms1Rf1 as material. Of the flanking sequence, the 1-330 places bases are the same of that of the inserted vector sequence, and the 331-2446 places bases have no homology with that of the inserted vector sequence and are rape genome sequence. The present invention establishes the specific quantitative and qualitative detection method of exogenous event for transgenic rape Ms1 for the other specific event PCR detection of transgenic rape Ms1Rf1 and Ms1Rf2.
Description
Technical field
The present invention relates to the detection of transgene rape in the technical field of bioengineering, specifically, relate to a kind of flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 and application thereof.
Background technology
In recent years, genetically modified crops such as corn, soybean, cotton, rape and tomato are got permission plantation and production in a lot of countries, and what have is processed to food, feed or is used as foodstuff additive.Because the ecological safety and the edible safety of transgenic product are controversial always, more than 30 countries and regions are implemented transgenic product sign system in succession.
According to the sequence information of foreign gene in the transgenic product, the array mode of foreign gene on transgenic constructs, and the integration site of construct on genome can adopt the detection method of gene specific, carrier specificity and event-specific.
1, gene specific detection method
Because a large amount of transgene carriers used identical foreign gene, so gene specific detection method and be not suitable for the reality that current transgenic product continues to bring out.
2, carrier specificity detection method
The carrier specificity detection method is utilized the border sequence feature between the gene element, can effectively identify the different constructs that use similar gene element, and the characteristics that exist sequence information to obtain easily, is therefore used by Many researchers.But, may obtain the transformant of a more than different qualities by same construct, even may be transformed in the different species, and these transformants may not all pass through safety assessment.Therefore the carrier specificity detection method can not be discerned different transgenic strains, can not differentiate this transgenic strain and whether pass through safety assessment.
3, the detection method of event-specific
The basis that event-specific detects is that the integration site of transgenic constructs on genomic dna sequence has high degree of specificity, even identical carrier repeatedly transforms, the position of integration and integration site feature also are unrepeatable.Therefore, according to unrepeatable integration site characteristic sequence, the specific detection method of the incident of having developed.Compare with preceding two kinds of methods, event-specific detects has the highest specificity, the most suitable qualitative and detection by quantitative of doing transgenic product.But the complete information of transgenic constructs is difficult to obtain usually, and known sequence gene element may have suitable distance apart from the border, and in the process of integrating, complicated reorganization may take place between carrier and the genome, therefore, separate flanking sequence and become the key that event-specific detects.In February, 2000, European Union has subsidized Qpcrgmofood European Project project for this reason, and this project is now successfully separated a plurality of kind flanking sequences of acquisition and is used to set up the event-specific detection method.Current, the event-specific detection method has been used to transgenosis Roundup Ready soybean, the detection of a series of transgenosis commercialization kinds such as Mon810 maize.
Through retrieval, do not find any about flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 with utilize this sequence to set up the report that event-specific is qualitative, quantitative PCR (polymerase chain reaction) detects as yet to existing patent and other documents.
Summary of the invention
The objective of the invention is to overcome the deficiency that prior art exists in detecting transgenic rape Ms 1 incident and transgene rape kind Ms1Rf1 and Ms1Rf2, a kind of flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 and application thereof are provided.
The object of the present invention is achieved like this:
The present invention is a material with transgene rape kind Ms1Rf1, utilize the GenomeWalker of Invitrogen company test kit to make up genomic library, and utilize primer: RB1:5 ' GGATCCCCCGATGAGCTAAGCTAGC 3 ' and RB2:5 ' GCTTGGACTATAATACCTGACTTG 3 ' and the joint primer that test kit provides, obtain Ms1 with round pcr (polymerase chain reaction) amplification and integrate incident right border sequence SEQ N0.1.
The feature of flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 is:
(1) the 1st to 330 bases derive from the exogenous insertion vector sequence;
(2) the 331st to 2446 bases derive from the rape genome sequence;
(3) origin the 331st to 2446 base coming from the 1st to 330 base of exogenous insertion vector and derive from the rape genome sequence formed the rape Ms 1 flanking sequence of exogenous event inserting vector jointly.
The applied research of above-mentioned flanking sequence of exogenous event inserting vector for transgenic rape Ms 1:
(1) utilize this sequence signature to design the event-specific qualitative PCR detection method of transgene rape exogenous origin gene integrator incident Ms1;
(2) utilize this sequence signature to design the event-specific quantitative PCR detecting method of transgene rape exogenous origin gene integrator incident Ms1;
(3) utilize this sequence signature to design the strain specificity qualitative PCR detection method of transgene rape kind Ms1Rf1;
(4) utilize this sequence signature to design the strain specificity quantitative PCR detecting method of transgene rape kind Ms1Rf1;
(5) utilize this sequence signature to design the strain specificity qualitative PCR detection method of transgene rape kind Ms1Rf2;
(6) utilize this sequence signature to design the strain specificity quantitative PCR detecting method of transgene rape kind Ms1Rf2.
Compared with prior art, the advantage and the effect that have of the present invention is as follows:
1, the present invention's announcement flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 that checks order first.
2, the present invention analyzes and confirms the source of different bases in the flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 first, and the joint site of definite exogenous insertion vector sequence and rape genome sequence.
3, the sequence signature that utilizes the present invention to find is set up qualitative, the quantitative PCR detecting method of event-specific of transgenic rape Ms 1 incident and transgene rape kind Ms1Rf1 and Ms1Rf2.
4, the present invention is applicable to the aspects such as other event-specifics PCR detection method of setting up transgenic rape Ms 1 incident and transgene rape kind Ms1Rf1 and Ms1Rf2.
Description of drawings
Fig. 1-transgenic rape Ms 1 incident right margin binding site, its binding site characteristic sequence;
Fig. 2-transgenic rape Ms 1 event-specific qualitative PCR amplification,
Wherein:
M-molecular weight Marker;
1-transgenic rape Ms 8 Rf3 genomic dna template;
2-transgenic rape Ms 1 Rf1 genomic dna template;
3-transgenic rape Ms 1 Rf2 genomic dna template;
4-transgene rape Oxy-235 genomic dna template;
5-transgene rape T45 genomic dna template; 6:
Transgene rape Topas 19/2 genomic dna template;
7-transgene rape RT45 genomic dna template:
Oily 821 templates in the 8-non-transgenic rape;
Fig. 3-transgenic rape Ms 1 event-specific quantitative pcr amplification.
Embodiment
1, the pcr amplification of flanking sequence of exogenous event inserting vector for transgenic rape Ms 1
Earlier 20%SDS is preheating to 65 ℃, gets 15ml SDS extracting buffer (0.1TrisHCl, 0.05MEDTA, 1M NaCl pH8.0) and join the 50ml centrifuge tube, add 2.5 μ l beta-mercaptoethanols again, mixing; Blade about liquid nitrogen grinding 3g goes to 50ml with powder and contains in the 50 ml centrifuge tubes of extracting buffer, and the mixing that vibrates on vibrator adds the 20%SDS of 2ml preheating, mixing, and 65 ℃ of water-baths at least 30 minutes will be shaken test tube therebetween gently; After the water-bath, rapidly centrifuge tube is placed on ice, add 3ml 3M KAc, mixing was placed 30 minutes on ice; 4 ℃ of centrifugal 5min of 5000g; Supernatant is transferred in the new 50ml centrifuge tube, added the Virahol of 2/3 volume, mixing is placed more than the 30min for-20 ℃; 6000g, 4 ℃ of centrifugal 15min outwell supernatant, wash one time with 75%7 ethanol, and the ultrapure water dissolving DNA is used in vacuum-drying, after the dissolving, solution is transferred in the centrifuge tube of 15ml; Add Proteinase K by 1% of DNA volume of dissolution, 55 ℃ of water-bath 30min; Add equal-volume phenol, mixing, jog 30min, the centrifugal 10min of 8000g; Shift supernatant to new tube, add isopyknic phenol-chloroform-primary isoamyl alcohol (25: 24: 1), jog 20min, the centrifugal 15min of 8000g; Shift supernatant to new tube, add isopyknic chloroform-primary isoamyl alcohol (24: 1), jog 20min, the centrifugal 15min of 8000g; Draw supernatant, every pipe adds 5 μ l RNase, mixing, 37 ℃ of water-bath 1hr degradation of rna; With isopyknic phenol extracting once, jog 20min, the centrifugal 15min of 8000g; Shift supernatant to new centrifuge tube, add isopyknic chloroform-primary isoamyl alcohol (24: 1), jog 20min, the centrifugal 15min of 8000g; Suct and reset and add into 1/10 volume 3M NaAC, mixing adds the equal-volume Virahol, and-20C places 30min, deposit D NA; 6000g, 4 ℃ of centrifugal 15min outwell supernatant, wash 2 times with 75% ethanol, centrifugally remove 75% ethanol, vacuum-drying; After the drying, standby with the ultrapure water dissolving DNA.
Utilizing the GenomeWalker of Invitogen company test kit, is material with rape Ms 1 Rf1 genomic dna, and the method that provides according to test kit makes up rape Ms 1 Rf1 genomic library.
The synthetic primer sequence is as follows: RB1:5 ' GGATCCCCCGATGAGCTAAGCTAGC 3 ' and RB2:5 ' GCTTGGACTATAATACCTGACTTG 3 '.
With the Ms1Rf1 genomic library is template, and the joint primer AP1 and the RB1 that utilize test kit to provide carry out pcr amplification.In the 50ul reaction system, get Ms1Rf1 genomic library DNA 1ul, other each component final concentrations are KOD Plus Buffer 1x, every kind of 200uM of dNTPs, MgSO
41mM, each 100nM of primer, KOD Plus enzyme 1u.Reaction conditions is, 94 ℃ of pre-sex change in 2 minutes, 94 ℃ 15 seconds, 68 ℃ 3 minutes, circulate 68 ℃ of insulations 7 minutes 45 times.Get 1ul PCR product, 50 times of dilute with waters are therefrom got 1ul as second template of taking turns PCR.Second to take turns reaction be primer with AP2 and the RB2 that test kit provides, and reaction system is identical with the first round.Reaction conditions is, 94 ℃ of pre-sex change in 2 minutes, 94 ℃ 15 seconds, 68 ℃ 3 minutes, circulate 68 ℃ of insulations 7 minutes 25 times.The agarose electrophoresis DNA isolation, the EB evaluation of dyeing.
With the QIAquick PCR Purification Kit of QIAGEN company purified pcr product.
PZero2 (Invitrogen) carrier that PCR product and EcoRV enzyme are cut is connected.Linked system: DNA mixture 22 μ l; 2.5 μ l 10 * T4 DNA Ligase Buffer with 1mM ATP; 0.5 μ lT4 DNA Ligase (NEB).22 ℃ connect 1hr at least.
The method that provides according to " molecular cloning experiment guide " prepares intestinal bacteria TOP10 (Invitrogen) competent cell, and transforms to connect product.The picking mono-clonal carries out bacterium colony PCR with the mutational site special primer and detects recon.With the clone's enlarged culturing that filters out, prepare plasmid in a small amount, enzyme is cut checking.
Send the order-checking of order-checking company with the clone who filters out.With the sequence information that obtains, the Blastn software that utilizes NCBI to provide is analyzed the source of different piece sequence, thereby judges the binding site of genome and carrier.
2, application method
1) utilizes the event-specific qualitative PCR detection method that sequences Design transgenic rape Ms 1 incident and transgene rape kind Ms1Rf1 and Ms1Rf2 are provided among the present invention
The synthetic primer sequence is as follows: Ms1RG:5 ' ATCTCTGGTTAAACATTCCATCTTTG 3 ' and Ms1RV:5 ' CGAGCTTTCTAATTTCAAACTATTCGG 3 '.
Get transgene rape kind Ms8Rf3 respectively, Ms1Rf1, Ms1Rf2, Oxy-235, T45, Topas 19/2, GT73; Oil 821 in the non-transgenic rape variety, and Arabidopis thaliana, Chinese cabbage, wild cabbage, leaf mustard, soybean, paddy rice, corn, cotton genomic dna are template, utilize the Ms1RG/Ms1RV combination of primers to carry out pcr amplification respectively.In the 25ul reaction system, be template with 100ng different sources genomic dna, other each component final concentrations are PCR Buffer 1x (containing 10mM TrisHCl pH8.3, KCl 50mM), every kind of 200uM of dNTPs, MgCl
22.5mM, each 250nM of primer, Hot Start Taq enzyme 1u.Reaction conditions is, 94 ℃ of pre-sex change in 2 minutes, 94 ℃ 15 seconds, 60 ℃ 30 seconds, 72 ℃ 30 seconds, circulate 72 ℃ of insulations 2 minutes 35 times.The PCR product separates with agarose gel electrophoresis, and EB dyeing back identifies whether there is amplified production.
2) utilize the event-specific quantitative PCR detecting method that sequences Design transgenic rape Ms 1 incident and transgene rape kind Ms1Rf1 and Ms1Rf2 are provided among the present invention
Synthetic TaqMan probe sequence is as follows: Ms1RP:5, FAM-TGGATAGGTTCTTCAGCATCATCACACC-TAMRA 3 '.
Primer, probe combinations at the Ms1 incident are used to the quantitative fluorescent PCR analysis.The quantitative fluorescent PCR analysis is carried out on MJR DNA Engine Opticon 2 Continuous Fluorescence Detector, and detection and analysis software are Opticon Monitor 2 Version 2.02.
Ms1 incident detection by quantitative reaction volume 20ul contains template DNA 100ng, and other component concentrations are: and TaqMan Buffer 1x (50mM KCl, 10mM.Tris-HCl, 10mM EDTA, pH8.3), MgCl
23.5mM, primer Ms1RG/Ms1RV 300uM, probe Ms1RP 150uM, each 200uM of dATP dCTP dGTP, dUTP 400uM, Amperase Uracil N-glycosylase (UNG) 0.2u, AmpliTaq Gold 1.25u.
The TaqMan reaction conditions is: after 50 ℃ of 2 minutes and 95 ℃ of pre-sex change in 10 minutes, carry out 50 PCR circulations: 95 ℃ of sex change in 15 seconds, plate is read in 60 ℃ of annealing in 1 minute and extending.
Result according to typical curve is optimized utilizes the PCR reaction conditions identical with setting up typical curve, is with reference to the amount of measuring Ms1Rf1 in the mixed rape DNA sample that contains Ms1Rf1 or Ms1Rf2 genomic dna or Ms1Rf2 genomic dna with the typical curve.Getting the 100ng genomic dna is template, utilize the different content standard model to do typical curve, according to the typical curve that obtains and the Ct value of transgenosis sample, calculate the quality of Ms1Rf1 or Ms1Rf2 genomic dna, thereby calculate Ms1Rf1 or the content of Ms1Rf2 in sample.All fluorescent quantitation reactions all repeat 3 times.
3. experimental result
1) pcr amplification of flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 and sequencing analysis
Utilize AP1/RB1 and AP2/RB2 combination of primers, the GenomeWalker library that makes up with the Ms1Rf1 genomic dna is a template, and successfully amplification obtains the 2446bp amplified production.To PCR product order-checking, and analyze through Blastn, find wherein 330 base pairs and different sources carrier sequence homology, its right margin tumor-necrosis factor glycoproteins is lost, and all the other 2116 base pairs and Chinese cabbage genome sequence homology are considered to the rape genome sequence.Concrete flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 is seen SEQ N0.1.
According to above analysis, the sequence that the present invention separates acquisition comprises transgenic rape Ms 1 incident right margin binding site, and its binding site characteristic sequence as shown in Figure 1.
2) utilize the event-specific qualitative PCR detection method that sequences Design transgenic rape Ms 1 incident and transgene rape kind Ms1Rf1 and Ms1Rf2 are provided among the present invention
With different sources transgene rape, non-transgenic rape genomic dna is template, utilizes Ms1 event-specific combination of primers Ms1RG/Ms1RV, carries out pcr amplification, result such as Fig. 2.Have only Ms1Rf1 and Ms1Rf2 genomic dna can amplify special PCR product, and other transgenosiss and non-transgenic rape DNA all there are not amplified production can be observed when doing template, comprise the Ms8Rf3 kind with similar gene element and sequence.Be template with other non-rape plant genome DNAs simultaneously, also do not have the visible pcr amplification product.Therefore, we think that this combination of primers has good specificity, are suitable for the detection of event-specific.
3) utilize the event-specific quantitative PCR detecting method that sequences Design transgenic rape Ms 1 incident and transgene rape kind Ms1Rf1 and Ms1Rf2 are provided among the present invention
According to the gradient dilution template, the fluorescence curve information that repeats to obtain for 3 times is established at the specificity fluorescent quantitative PCR reaction normal curve of Ms1 incident, as shown in Figure 3, and its R
2Value is 0.995, shows that the copy number of foreign gene and fluorescence intensity all have good corresponding relation, are suitable for the accurate quantification of foreign gene.
In order to verify the accuracy of the quantivative approach of setting up in this research, we have used the genomic dna that extracts from standard transgenic rape Ms 1 Rf1 and Ms1Rf2 product to be diluted to certain content with non-transgenic rape genomic dna, and do contrast with the same amount genomic dna that does not contain transgenic rape Ms 1 Rf1 or Ms1Rf2 genomic dna, template as the real-time fluorescence quantitative PCR reaction, and, calculate the total content of transgene rape Ms1Rf1 and Ms1Rf2 genomic dna in the different samples according to the typical curve that the same terms obtains down.
With the non-transgenic rape genomic dna that do not contain transgenic rape Ms 1 Rf1 or Ms1Rf2 is template, does not have amplified production to be detected.For mixed laboratory sample, detect with setting up Ms1 event-specific fluorescence quantitative detecting method in this research, all very approaching with theoretical value, error is less than 15%.
Above result as can be seen, the present invention has been for the quantitative detecting analysis of transgene rape incident Ms1 and transgenic rape Ms 1 Rf1 and Ms1Rf2 provides based on simple, measuring method reliably, can be used for the mixed product transgenic rape Ms 1 incident of different sources, different content and transgene rape kind Ms1Rf1 and Ms1Rf2 quantitatively.The present invention provides a kind of useful reference for transgenosis sign, provides necessary means to the control of transgenic product.
Sequence table
＜110〉Inst. of Oil Crops, Chinese Academy of Agriculture
＜120〉flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 and application thereof
<160>1
<210>1
<211>2446
<212>DNA
＜213〉rape (Brassica napus cv.Ms1Rf1; Brassica napus cv.Ms1Rf2)
<400>
gcttggacta?taatacctga?cttgttattt?tatcaataaa?tatttaaact?atatttcttt 60
caagatggga?attaacatct?acaaattgcc?ttttcttatc?gaccatgtac?gtaagcgctt 120
acgtttttgg?tggacccttg?aggaaactgg?tagctgttgt?gggcctgtgg?tctcaagatg 180
gatcattaat?ttccaccttc?acctacgatg?gggggcatcg?caccggtgag?taatattgta 240
cggctaagag?cgaatttggc?ctgtagacct?caattgcgag?ctttctaatt?tcaaactatt 300
cgggcctaac?ttttggtgtg?atgatgctga?agaacctatc?catgaaactc?acaaaaacat 360
catcacctga?gaattctctg?gaatctaagt?ccaaagatgg?aatgtttaac?cagagatttc 420
tccaacgttt?tgataaaacg?cttgtgcaaa?cggattcctt?ggtggaaaag?tcagagagta 480
tcttgcataa?caaggaatca?ggcagattgc?ttaacctatc?aaagttcctt?tgtttctctt 540
taacaccggt?ttcaccatcc?atgtctaagg?cctaagtctg?agatttaaca?tgtaaaccgg 600
agatcgcaaa?attagtagaa?agtcaacgca?agatctccat?gaactaaaaa?aaacaaacaa 660
acatagatga?gctactgaaa?ttaccttccg?agtaagacag?aaaccaccgt?aagttctccg 720
gcaaaacacc?acactgattt?tctaggtggg?gaagaagaag?aagaagagga?agaaactctc 780
agttcgtcgg?tctgcgcgat?tttaaacatt?ggcaacggca?tttctcatag?caccaaccat 840
tgtttaatac?agttattatc?taaatacatc?gctgacgtgg?cactgaacgt?caagggttaa 900
acatgtataa?catcccaatg?atcccatgat?ccaaataagc?gttaatggtc?actttcatcg 960
cgaataaaaa?atgtttgtgt?tacatcacga?agtaagaaac?aaaaaggtga?attttaacaa 1020
aacacactga?aggcaatacc?gtcagaacac?aaagctggct?cgactaatcc?attaggacca 1080
tttctcacaa?taaatctcag?tgtggtttgc?atcatgcaca?catggagaca?ccacatcgtc 1140
aggtatacac?tctatttgaa?gctctttagg?gactgggacg?cacacgcaca?gcttccagag 1200
aatcatcaca?acggactatg?gttaactcct?cgagaacagg?acagctggat?attaaaatct 1260
ccagagtcga?atcaccaccg?tcgtatatga?ccatccatag?atgcataatc?ttgacacaag 1320
gcaaagatac?agattcagga?tgatccaaga?agacgcagcg?gagatctaag?ttgaccaatc 1380
tctcacatga?atagagagat?ggaggcatct?taactaacgt?atcttcatcc?acctcattac 1440
aaagactgag?atgaagaatc?ccgcgcctag?tcacggcatc?gatccaggac?ttgaaacgag 1500
ttgcatcatg?ttcacgaacc?cgatagcaca?gcttgaatgt?ctccaagtgt?tgctcatttt 1560
cagaacacag?aaacctatcc?atgaaactca?caaaggcatc?atcacctctg?attcctgagg 1620
aatctaagtc?cagagatgga?acattcaatc?agaggtttct?ccatcgtttt?attagaagcc 1680
gactttttta?aataaccata?tcccactata?atatcttctc?atttgctaaa?cccgcagtgt 1740
gctaaagtgc?gacccaaaca?caatccatta?ttactatttt?tgttagaatt?ttcgaaaaat 1800
ataagaacct?atatctgtat?tgatttcgtg?gacgtaaatt?atttaaaaga?gaaattaaat 1860
taatttacgt?gggcgcacac?gtggaaattg?tagctgtttc?ccactacgct?tgtagtttct 1920
gaattatttt?attttattag?acttttggct?gtgagaatat?tatttgtctt?tgtttgggga 1980
atcgaattcg?tgtagaactg?ggaaactgat?ggtgggatag?tgaggactca?attattagat 2040
aattttttta?atatataaat?ttcaggagaa?aaatcaatca?tagaattgta?gatttagaca 2100
taatttcaaa?gagtgatatt?gtaataaaat?acactataac?aaaacttttg?ttgtgtcttc 2160
ctttacatat?ttacaaagaa?aaaaaaaact?gaataaacaa?ccaacaacct?tattggatat 2220
tgcaacatgt?ctctcggcac?cattgtattg?tataaaaaaa?caaatagtat?aaatttattc 2280
tcgtccaaaa?agagaaatac?atgaattaaa?aatataatta?taaaatttca?agttaggaat 2340
ttggccatct?tttaaacctc?agggacggtg?gattttggaa?gctttgcaat?aagttgtgtg 2400
gcggagaatc?caaaaagaag?aaagagtaac?caatagagga?gctgat 2446
Claims (2)
1, a kind of flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 is characterized in that:
(1) the 1st to 330 bases derive from the exogenous insertion vector sequence, SEQ NO.1;
(2) the 331st to 2446 bases derive from the rape genome sequence, SEQ NO.1;
(3) origin comes from the 1st to 330 base of exogenous insertion vector and derives from the common dna sequence dna of forming of the 331st to 2446 base of rape genome sequence, flanking sequence of exogenous event inserting vector for transgenic rape Ms 1;
2, the application of flanking sequence of exogenous event inserting vector for transgenic rape Ms 1 is characterized in that:
(1) utilize this sequence signature to design the event-specific qualitative PCR detection method of transgene rape exogenous origin gene integrator incident Ms1;
(2) utilize this sequence signature to design the event-specific quantitative PCR detecting method of transgene rape exogenous origin gene integrator incident Ms1;
(3) utilize this sequence signature to design the strain specificity qualitative PCR detection method of transgene rape kind Ms1Rf1;
(4) utilize this sequence signature to design the strain specificity quantitative PCR detecting method of transgene rape kind Ms1Rf1;
(5) utilize this sequence signature to design the strain specificity qualitative PCR detection method of transgene rape kind Ms1Rf2;
(6) utilize this sequence signature to design the strain specificity quantitative PCR detecting method of transgene rape kind Ms1Rf2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2007100513604A CN100529092C (en) | 2007-01-24 | 2007-01-24 | Flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2007100513604A CN100529092C (en) | 2007-01-24 | 2007-01-24 | Flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101020910A true CN101020910A (en) | 2007-08-22 |
| CN100529092C CN100529092C (en) | 2009-08-19 |
Family
ID=38708787
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2007100513604A Expired - Fee Related CN100529092C (en) | 2007-01-24 | 2007-01-24 | Flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100529092C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967478A (en) * | 2010-10-20 | 2011-02-09 | 江苏省农业科学院 | Transgenic high oleic acid oilseed rape W-4 event foreign insert border junction fragment and application thereof |
| CN102888398A (en) * | 2011-07-22 | 2013-01-23 | 中国农业科学院生物技术研究所 | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof |
| CN109825633A (en) * | 2019-04-03 | 2019-05-31 | 深圳出入境检验检疫局食品检验检疫技术中心 | Reagent, kit and the detection method of transgene rape strain Ms1 detection |
-
2007
- 2007-01-24 CN CNB2007100513604A patent/CN100529092C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967478A (en) * | 2010-10-20 | 2011-02-09 | 江苏省农业科学院 | Transgenic high oleic acid oilseed rape W-4 event foreign insert border junction fragment and application thereof |
| CN101967478B (en) * | 2010-10-20 | 2012-01-04 | 江苏省农业科学院 | Transgenic high oleic acid oilseed rape W-4 event foreign insert border junction fragment and application thereof |
| CN102888398A (en) * | 2011-07-22 | 2013-01-23 | 中国农业科学院生物技术研究所 | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof |
| CN109825633A (en) * | 2019-04-03 | 2019-05-31 | 深圳出入境检验检疫局食品检验检疫技术中心 | Reagent, kit and the detection method of transgene rape strain Ms1 detection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100529092C (en) | 2009-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nadal et al. | A new PCR‐CGE (size and color) method for simultaneous detection of genetically modified maize events | |
| CN102453749B (en) | Method for detecting transgene component in food | |
| CN106995841B (en) | Multiplex PCR (polymerase chain reaction) kit for detecting transgenic soybeans and detection method | |
| CN100558902C (en) | Transgene rape exogenous origin gene integrator incident Rf1 exogenous insertion vector flanking sequence and application thereof | |
| CN101020902B (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application | |
| CN102162012B (en) | Qualitative PCR detection method for transgenic rice kefeng No. 6 | |
| CN101974649A (en) | Molecular marking method for distinguishing Jian carps | |
| CN100529092C (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application | |
| CN101016554B (en) | Transgene rape Rf3 event exogenesis insertion carrier side sequence and application thereof | |
| CN100529089C (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Topas-19/2 and its application | |
| CN101020903B (en) | Left boundary flanking sequence of exogenous event inserting vector for transgenic rape Oxy-235 and its application | |
| CN100529090C (en) | Left boundary flanking sequence of exogenous event inserting vector for transgenic rape T45 and its application | |
| CN103146824A (en) | Recombinant standard plasmid and kit for PCR (Polymerase Chain Reaction) detection of transgenic rice | |
| CN106701968B (en) | Primer for simultaneously detecting botryococcus and application thereof | |
| CN100552032C (en) | Transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof | |
| CN115992284B (en) | Kit and method for rapidly detecting transgenic product based on RPA-CRISPR-Cas12a system | |
| CN101864489B (en) | Method for gathering foreign DNA in transgenosis product | |
| CN100552033C (en) | Flaking sequence of exogenous event inserting vector for transgenic rape Rf 2 and application thereof | |
| CN100529091C (en) | Right boundary flanking sequence of exogenous event inserting vector for transgenic rape T45 and its application | |
| CN105039516B (en) | The fluorescence PCR detecting method and its primer and kit of a kind of clostridium difficile toxin gene | |
| CN112359098A (en) | Method for detecting content of herbicide-tolerant transgenic soybean J12 by real-time fluorescence quantitative PCR | |
| CN102409080A (en) | Two-gene standard plasmid molecule used for detecting genetically modified soybeans and building method thereof | |
| CN109628632A (en) | A kind of primer combination, probe, kit and method for transgenic corns MON87419 event-specific detection | |
| CN116411106B (en) | Flanking sequence of rice GAT transformation event GATV-34-3 and detection primer and application thereof | |
| CN102586242A (en) | Transgenic soybean BPS-CV127-9 transformation event exogenous insertion carrier flanking gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090819 Termination date: 20130124 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |