CN100552032C - Transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof - Google Patents
Transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof Download PDFInfo
- Publication number
- CN100552032C CN100552032C CNB2007100513534A CN200710051353A CN100552032C CN 100552032 C CN100552032 C CN 100552032C CN B2007100513534 A CNB2007100513534 A CN B2007100513534A CN 200710051353 A CN200710051353 A CN 200710051353A CN 100552032 C CN100552032 C CN 100552032C
- Authority
- CN
- China
- Prior art keywords
- oxy
- sequence
- rape
- transgene rape
- exogenous
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof, relate to the detection of transgene rape in the technical field of bioengineering.The present invention is a material with transgene rape kind Oxy-235, obtains the Oxy-235 right boundary flanking sequence of exogenous event inserting vector, and sequence is SEQNO.1.Wherein the 1-777 bit base is identical with insertion carrier sequence, and the 778-1109 bit base does not have homology with the insertion carrier, is the rape genome sequence.According to the joint sequence of inserting carrier sequence and rape genome sequence, the present invention has set up the event-specific qualitative and quantitative analysis method of transgene rape exogenous origin gene integrator incident Oxy-235.Be used to set up other event-specifics PCR detection method research of transgene rape Oxy-235.
Description
Technical field
The present invention relates to the detection of transgene rape in the technical field of bioengineering, specifically, relate to exogenous insertion vector right boundary flanking sequence and the application thereof of a kind of transgene rape exogenous origin gene integrator incident Oxy-235.
Background technology
In recent years, genetically modified crops such as corn, soybean, cotton, rape and tomato are got permission plantation and production in a lot of countries, and what have is processed to food, feed or is used as foodstuff additive.Because the ecological safety and the edible safety of transgenic product are controversial always, more than 30 countries and regions are implemented transgenic product sign system in succession.
According to the sequence information of foreign gene in the transgenic product, the array mode of foreign gene on transgenic constructs, and the integration site of construct on genome can adopt the detection method of gene specific, carrier specificity and event-specific.
1, gene specific detection method
Because a large amount of transgene carriers used identical foreign gene, so gene specific detection method and be not suitable for the reality that current transgenic product continues to bring out.
2, carrier specificity detection method
The carrier specificity detection method is utilized the border sequence feature between the gene element, can effectively identify the different constructs that use similar gene element, and the characteristics that exist sequence information to obtain easily, is therefore used by Many researchers.But, may obtain the transformant of a more than different qualities by same construct, even may be transformed in the different species, and these transformants may not all pass through safety assessment.Therefore the carrier specificity detection method can not be discerned different transgenic strains, can not differentiate this transgenic strain and whether pass through safety assessment.
3, the detection method of event-specific
The basis that event-specific detects is that the integration site of transgenic constructs on genomic dna sequence has high degree of specificity, even identical carrier repeatedly transforms, the position of integration and integration site feature also are unrepeatable.Therefore, according to unrepeatable integration site characteristic sequence, the specific detection method of the incident of having developed.Compare with preceding two kinds of methods, event-specific detects has the highest specificity, the most suitable qualitative and detection by quantitative of doing transgenic product.But the complete information of transgenic constructs is difficult to obtain usually, and known sequence gene element may have suitable distance apart from the border, and in the process of integrating, complicated reorganization may take place between carrier and the genome, therefore, separate flanking sequence and become the key that event-specific detects.In February, 2000, European Union has subsidized Qpcrgmofood European Project project for this reason, and this project is now successfully separated a plurality of kind flanking sequences of acquisition and is used to set up the event-specific detection method.Current, the event-specific detection method has been used to transgenosis Roundup Ready soybean, the detection of a series of transgenosis commercialization kinds such as Mon810 maize.
Through retrieval, do not find any about transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector with utilize this sequence to set up the report that event-specific is qualitative, quantitative PCR (polymerase chain reaction) detects as yet to existing patent and other documents.
Summary of the invention
The objective of the invention is to overcome the deficiency that prior art exists in detecting transgene rape Oxy-235 incident and transgene rape kind Oxy-235, a kind of transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof are provided.
The object of the present invention is achieved like this:
The present invention is a material with transgene rape kind Oxy-235, utilize the GenomeWalker of Invitrogen company test kit to make up genomic library, and utilize primer: OXYRB-1:5 ' ACTCGCTCGATCCCACGGGCCACTAT 3 ' and OXYRB-2:5 ' GCAACGGCAGCCTGCGGTGTCAGAAGT 3 ' and the joint primer that test kit provides, obtain Oxy-235 right boundary flanking sequence of exogenous event inserting vector SEQ NO.1 with round pcr (polymerase chain reaction) amplification.
The feature of transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector is:
(1) the 1st to 777 bases derive from the exogenous insertion vector sequence;
(2) the 778th to 1109 bases derive from the rape genome sequence;
(3) origin the 778th to 1109 base coming from the 1st to 777 base of exogenous insertion vector and derive from the rape genome sequence formed rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector jointly.
The applied research of above-mentioned transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector:
(1) utilize this sequence signature to design the event-specific qualitative PCR detection method of transgene rape exogenous origin gene integrator incident Oxy-235;
(2) utilize this sequence signature to design the event-specific quantitative PCR detecting method of transgene rape exogenous origin gene integrator incident Oxy-235;
(3) utilize this sequence signature to design the strain specificity qualitative PCR detection method of transgene rape kind Oxy-235;
(4) utilize this sequence signature to design the strain specificity quantitative PCR detecting method of transgene rape kind Oxy-235.
Compared with prior art, the advantage and the effect that have of the present invention is as follows:
1, the present invention checks order first and announces transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector.
2, the present invention analyzes and confirms the source of different bases in the transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector first, and the joint site of definite exogenous insertion vector sequence and rape genome sequence.
3, the sequence signature that utilizes the present invention to find is set up qualitative, the quantitative PCR detecting method of event-specific of transgene rape Oxy-235 incident and transgene rape kind Oxy-235.
4, the present invention is applicable to the aspects such as other event-specifics PCR detection method of setting up transgene rape Oxy-235 incident and transgene rape kind Oxy-235.
Description of drawings
Fig. 1-transgene rape Oxy-235 incident right margin binding site, its binding site characteristic sequence.
Fig. 2-transgene rape Oxy-235 event-specific qualitative PCR amplification,
Wherein:
M-molecular weight Marker;
1-transgenic rape Ms 8 Rf3 genomic dna template;
2-transgenic rape Ms 1 Rf1 genomic dna template;
3-transgenic rape Ms 1 Rf2 genomic dna template;
4-transgene rape Oxy-235 genomic dna template;
5-transgene rape T45 genomic dna template;
6-transgene rape Topas 19/2 genomic dna template;
7-transgene rape RT45 genomic dna template;
Oily 821 templates in the 8-non-transgenic rape.
Fig. 3-transgene rape Oxy-235 event-specific quantitative pcr amplification.
Embodiment
1, the pcr amplification of transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector
Earlier 20%SDS is preheating to 65 ℃, gets 15ml SDS extracting buffer (0.1TrisHCl, 0.05MEDTA, 1M NaCl pH8.0) and join the 50ml centrifuge tube, add 2.5 μ l beta-mercaptoethanols again, mixing; Blade about liquid nitrogen grinding 3g goes to 50ml with powder and contains in the 50ml centrifuge tube of extracting buffer, and the mixing that vibrates on vibrator adds the 20%SDS of 2ml preheating, mixing, and 65 ℃ of water-baths at least 30 minutes will be shaken test tube therebetween gently; After the water-bath, rapidly centrifuge tube is placed on ice, add 3ml 3M KAc, mixing was placed 30 minutes on ice; 4 ℃ of centrifugal 5min of 5000g; Supernatant is transferred in the new 50ml centrifuge tube, added the Virahol of 2/3 volume, mixing is placed more than the 30min for-20 ℃; 6000g, 4 ℃ of centrifugal 15min outwell supernatant, wash one time with 75% ethanol, and the ultrapure water dissolving DNA is used in vacuum-drying, after the dissolving, solution is transferred in the centrifuge tube of 15ml; Add Proteinase K by 1% of DNA volume of dissolution, 55 ℃ of water-bath 30min; Add equal-volume phenol, mixing, jog 30min, the centrifugal 10min of 8000g; Shift supernatant to new tube, add isopyknic phenol-chloroform-primary isoamyl alcohol (25: 24: 1), jog 20min, the centrifugal 15min of 8000g; Shift supernatant to new tube, add isopyknic chloroform-primary isoamyl alcohol (24: 1), jog 20min, the centrifugal 15min of 8000g; Draw supernatant, every pipe adds 5 μ l RNase, mixing, 37 ℃ of water-bath 1hr degradation of rna; With isopyknic phenol extracting once, jog 20min, the centrifugal 15min of 8000g; Shift supernatant to new centrifuge tube, add isopyknic chloroform-primary isoamyl alcohol (24: 1), jog 20min, the centrifugal 15min of 8000g; Suct and reset and add into 1/10 volume 3M NaAC, mixing adds the equal-volume Virahol, places 30min, deposit D NA for-20 ℃; 6000g, 4 ℃ of centrifugal 15min outwell supernatant, wash 2 times with 75% ethanol, centrifugally remove 75% ethanol, vacuum-drying; After the drying, standby with the ultrapure water dissolving DNA.
Utilizing the GenomeWalker of Invitogen company test kit, is material with rape Oxy-235 genomic dna, and the method that provides according to test kit makes up rape Oxy-235 genomic library.
The synthetic primer sequence is as follows: OXYRB-1:5 ' ACTCGCTCGATCCCACGGGCCACTAT 3 ' and OXYRB-2:5 ' GCAACGGCAGCCTGCGGTGTCAGAAGT 3 '.
With the Oxy-235 genomic library is template, and the joint primer AP1 and the OXYRB-1 that utilize test kit to provide carry out pcr amplification.In the 50ul reaction system, get Oxy-235 genomic library DNA 1ul, other each component final concentrations are KOD Plus Buffer 1x, every kind of 200uM of dNTPs, MgSO
41mM, each 100nM of primer, KOD Plus enzyme 1u.Reaction conditions is, 94 ℃ of pre-sex change in 2 minutes, 94 ℃ 15 seconds, 68 ℃ 3 minutes, circulate 68 ℃ of insulations 7 minutes 45 times.Get 1ul PCR product, 50 times of dilute with waters are therefrom got 1ul as second template of taking turns PCR.Second to take turns reaction be primer with AP2 and the OXYRB-2 that test kit provides, and reaction system is identical with the first round.Reaction conditions is, 94 ℃ of pre-sex change in 2 minutes, 94 ℃ 15 seconds, 68 ℃ 3 minutes, circulate 68 ℃ of insulations 7 minutes 25 times.The agarose electrophoresis DNA isolation, the EB evaluation of dyeing.
With the QIAquick PCR Purification Kit of QIAGEN company purified pcr product.
PZero2 (Invitrogen) carrier that PCR product and EcoRV enzyme are cut is connected.Linked system: DNA mixture 22 μ l; 2.5 μ l 10 * T4 DNA Ligase Buffer with 1mM ATP; 0.5 μ lT4 DNA Ligase (NEB).22 ℃ connect 1hr at least.
The method that provides according to " molecular cloning experiment guide " prepares intestinal bacteria TOP10 (Invitrogen) competent cell, and transforms to connect product.The picking mono-clonal carries out bacterium colony PCR with the mutational site special primer and detects recon.With the clone's enlarged culturing that filters out, prepare plasmid in a small amount, enzyme is cut checking.
Send the order-checking of order-checking company with the clone who filters out.With the sequence information that obtains, the Blastn software that utilizes NCBI to provide is analyzed the source of different piece sequence, thereby judges the binding site of genome and carrier.
2, application method
1) utilizes the event-specific qualitative PCR detection method that sequences Design transgene rape Oxy-235 incident and transgene rape kind Oxy-235 are provided among the present invention
The synthetic primer sequence is as follows: OXYRG:5 ' GATAGATGGTGGTGTGAGTCTTGT 3 ' and OXYRV:5 ' CCTAACTTTTGGTGTGATGATGCT 3 '.
Get transgene rape kind Ms8Rf3 respectively, Ms1Rf1, Ms1Rf2, Oxy-235, T45, Topas 19/2, GT73; Oil 821 in the non-transgenic rape variety, and Arabidopis thaliana, Chinese cabbage, wild cabbage, leaf mustard, soybean, paddy rice, corn, cotton genomic dna are template, utilize the OXYRG/OXYRV combination of primers to carry out pcr amplification respectively.In the 25ul reaction system, be template with 100ng different sources genomic dna, other each component final concentrations are PCR Buffer 1x (containing 10mM TrisHCl pH8.3, KCl 50mM), every kind of 200uM of dNTPs, MgCl
22.5mM, each 250nM of primer, Hot Start Taq enzyme 1u.Reaction conditions is, 94 ℃ of pre-sex change in 2 minutes, 94 ℃ 15 seconds, 60 ℃ 30 seconds, 72 ℃ 30 seconds, circulate 72 ℃ of insulations 2 minutes 35 times.The PCR product separates with agarose gel electrophoresis, and EB dyeing back identifies whether there is amplified production.
2) utilize the event-specific quantitative PCR detecting method that sequences Design transgene rape Oxy-235 incident and transgene rape kind Oxy-235 are provided among the present invention
Synthetic TaqMan probe sequence is as follows: OXYRP:5 ' FAM-TGCCATCAGCTGACACGCCGTGC-TAMRA 3 '.
Primer, probe combinations at the Oxy-235 right boundary flanking sequence of exogenous event inserting vector are used to the quantitative fluorescent PCR analysis.The quantitative fluorescent PCR analysis is carried out on MJR DNA Engine Opticon 2 ContinuousFluorescence Detector, and detection and analysis software are Opticon Monitor 2 Version2.02.
Oxy-235 incident detection by quantitative reaction volume 20ul contains template DNA 100ng, and other component concentrations are: TaqMan Buffer 1x (50mM KCl, 10mM.Tris-HCl, 10mM EDTA, pH 8.3), MgCl
24.5mM, primer OXYRG and OXYRV 300uM, probe OXYRP 150uM, each 400uM of dATP dCTP dGTP, dUTP 800uM, Amperase Uracil N-glycosylase (UNG) 0.2u, AmpliTaq Gold 1.25u.
The TaqMan reaction conditions is: after 50 ℃ of 2 minutes and 95 ℃ of pre-sex change in 10 minutes, carry out 50 PCR circulations: 95 ℃ of sex change in 15 seconds, plate is read in 60 ℃ of annealing in 1 minute and extending.
Transgene rape Oxy-235 genomic dna is diluted to different content by same concentrations non-transgenic rape 821 DNA, is template with the mixed rape genomic dna of 100ng, carries out the quantitative fluorescent PCR reaction.Different extension rates contain 100,13,1.3,0.13,0.013 respectively, and the mixed DNA sample of 0.0065ng Oxy-235 genomic dna is used to set up typical curve.All fluorescent quantitation reactions all repeat 3 times.
Result according to typical curve is optimized utilizes the PCR reaction conditions identical with setting up typical curve, is with reference to the amount of measuring Oxy-235 genomic dna in the mixed rape DNA sample that contains the Oxy-235 genomic dna with the typical curve.Getting the 100ng genomic dna is template, utilizes the different content standard model to do typical curve, according to the typical curve that obtains and the Ct value of transgenosis sample, calculates the quality of Oxy-235 genomic dna, thereby calculates the content of Oxy-235 in sample.All fluorescent quantitation reactions all repeat 3 times.
3. experimental result
1) pcr amplification of transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and sequencing analysis
Utilize AP1/OXYRB-1 and AP2/OXYRB-2 combination of primers, the GenomeWalker library that makes up with the Oxy-235 genomic dna is a template, and successfully amplification obtains the 1109bp amplified production.To PCR product order-checking, and analyze through Blastn, find wherein 777 base pairs and different sources carrier sequence homology, its right margin tumor-necrosis factor glycoproteins is lost, and all the other 332 base pairs and Chinese cabbage genome sequence homology are considered to the rape genome sequence.Concrete transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector is seen SEQ NO.1.
According to above analysis, the sequence that the present invention separates acquisition comprises transgene rape Oxy-235 exogenous event inserting vector right margin binding site, and its binding site characteristic sequence as shown in Figure 1.
2) utilize the event-specific qualitative PCR detection method that sequences Design transgene rape Oxy-235 incident and transgene rape kind Oxy-235 are provided among the present invention
With different sources transgene rape, non-transgenic rape genomic dna is template, utilizes Oxy-235 right boundary flanking sequence of exogenous event inserting vector Auele Specific Primer combination OXYRG/OXYRV, carries out pcr amplification, result such as Fig. 2.Have only the Oxy-235 genomic dna can amplify special PCR product, and other transgenosiss and non-transgenic rape DNA all there are not amplified production can be observed when doing template.Be template with other non-rape plant genome DNAs simultaneously, also do not have the visible pcr amplification product.Therefore, we think that this combination of primers has good specificity, are suitable for the detection of event-specific.
3) utilize the event-specific quantitative PCR detecting method that sequences Design transgene rape Oxy-235 incident and transgene rape kind Oxy-235 are provided among the present invention
According to the gradient dilution template, the fluorescence curve information that repeats to obtain for 3 times is established at the specificity fluorescent quantitative PCR reaction normal curve of Oxy-235 incident, as shown in Figure 3, and its R
2Value is 0.989, shows that the copy number of foreign gene and fluorescence intensity all have good corresponding relation, are suitable for the accurate quantification of foreign gene.
In order to verify the accuracy of the quantivative approach of setting up in this research, we have used the genomic dna that extracts from standard transgene rape Oxy-235 product to be diluted to certain content with non-transgenic rape genomic dna, and do contrast with the same amount genomic dna that does not contain transgene rape Oxy-235 genomic dna, template as the real-time fluorescence quantitative PCR reaction, and, calculate the content of transgene rape Oxy-235 genomic dna in the different samples according to the typical curve that the same terms obtains down.
With the non-transgenic rape genomic dna that do not contain transgene rape Oxy-235 is template, does not have amplified production to be detected.For mixed laboratory sample, detect with setting up Oxy-235 event-specific fluorescence quantitative detecting method in this research, all very approaching with theoretical value, error is less than 15%.
Above result as can be seen, the present invention has been for the quantitative detecting analysis of transgene rape incident Oxy-235 and transgene rape Oxy-235 provides based on simple, measuring method reliably, can be used for the mixed product transgene rape Oxy-235 incident of different sources, different content and transgene rape kind Oxy-235 quantitatively.The present invention provides a kind of useful reference for transgenosis sign, provides necessary means to the control of transgenic product.
Sequence table
＜110〉Inst. of Oil Crops, Chinese Academy of Agriculture
＜120〉transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof
<160>1
<210>1
<211>1109
<212>DNA
＜213〉rape (Brassica napus cv.Oxy-235)
<400>
gcaacggcag?cctgcggtgt?cagaagttat?cgactcaaac?ggtgacgagg?acccgagagc 60
agcatgcgag?cccgacgagg?ggggatcgtg?aggtcgtaat?ctctacggca?ataggggttc 120
taccccgtta?ttgcggacat?tcctaataaa?aagagacacg?ttgtaccaaa?ggggtgttca 180
tgtccagacg?cagaaaatat?agcccagagt?taaaacgcga?agccatcgct?ttaacccgtc 240
cggtaccggg?catgcaagct?tgggctgcag?gtcgactcta?ggcgatgatt?atcatataat 300
ttctgttgaa?ttacgttaag?catgtaataa?ttaacatgta?atgcatgacg?ttatttatga 360
gatgggtttt?tatgattaga?gtcccgcaat?tatacattta?atacgcgata?gaaaacaaaa 420
tatagcgcgc?aaactaggat?aaattatcgc?gcgcggtgtc?atctatgtta?ctagatcgat 480
cgggaattga?tccctgaaag?cgacgttgga?tgttaacatc?tacaaattgc?cttttcttat 540
cgaccatgta?cgtaagcgct?tacgtttttg?gtggaccctt?gaggaaactg?gtagctgttg 600
tgggcctgtg?gtctcaagat?ggatcattaa?tttccacctt?cacctacgat?ggggggcatc 660
gcaccggtga?gtaatattgt?acggctaaga?gcgaatttgg?cctgtagacc?tcaattgcga 720
gctttctaat?ttcaaactat?tcgggcctaa?cttttggtgt?gatgatgctg?actggcaagt 780
taatctagtt?tccggttatg?aagcacggcg?tgtcagctga?tggcaagtta?atctccccga 840
agtcgacaag?actcacacca?ccatctatcg?aagatggagc?agaactgtcg?tcagcgcgtc 900
ggacctcgcc?gtatccatag?tagagtcttt?taaaacggga?ccttgtcggg?atgaaggtgg 960
tggttgtgaa?tcgaggtgag?attgtccata?tcaaccaaaa?tgcttccaga?tctgaacggc?1020
gggtcaagcg?tggagcccca?cagacagcag?acgttcggtc?accggaaact?aaaggcggaa?1080
ggaggacttg?cggtggaagg?gaggaagag 1109
Claims (2)
1, a kind of transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector is characterized in that:
(1) the 1st to 777 bases derive from the exogenous insertion vector sequence, SEQ NO.1;
(2) the 778th to 1109 bases derive from the rape genome sequence, SEQ NO.1;
(3) origin comes from the 1st to 777 base of exogenous insertion vector and derives from the common dna sequence dna of forming of the 778th to 1109 base of rape genome sequence, is transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector.
2, the application of transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector as claimed in claim 1 is characterized in that:
(1) utilize this sequence signature to design the event-specific qualitative PCR detection method of transgene rape exogenous origin gene integrator incident Oxy-235;
(2) utilize this sequence signature to design the event-specific quantitative PCR detecting method of transgene rape exogenous origin gene integrator incident Oxy-235;
(3) utilize this sequence signature to design the strain specificity qualitative PCR detection method of transgene rape kind Oxy-235;
(4) utilize this sequence signature to design the strain specificity quantitative PCR detecting method of transgene rape kind Oxy-235.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2007100513534A CN100552032C (en) | 2007-01-24 | 2007-01-24 | Transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2007100513534A CN100552032C (en) | 2007-01-24 | 2007-01-24 | Transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101020904A CN101020904A (en) | 2007-08-22 |
| CN100552032C true CN100552032C (en) | 2009-10-21 |
Family
ID=38708780
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2007100513534A Expired - Fee Related CN100552032C (en) | 2007-01-24 | 2007-01-24 | Transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100552032C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212540B (en) * | 2011-03-31 | 2013-03-20 | 中华人民共和国上海出入境检验检疫局 | Standard molecule simultaneously adapting to specificity detection on seven transgene rape strains |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1420181A (en) * | 2002-10-11 | 2003-05-28 | 覃文 | Probe sequence and kit for real time fluorescence PCR detection of transgenic rapeseed |
| CN1480538A (en) * | 2002-09-04 | 2004-03-10 | 中华人民共和国上海出入境检验检疫局 | Quantitative measuring transgene component in transgene rapeseed and processed product |
-
2007
- 2007-01-24 CN CNB2007100513534A patent/CN100552032C/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1480538A (en) * | 2002-09-04 | 2004-03-10 | 中华人民共和国上海出入境检验检疫局 | Quantitative measuring transgene component in transgene rapeseed and processed product |
| CN1420181A (en) * | 2002-10-11 | 2003-05-28 | 覃文 | Probe sequence and kit for real time fluorescence PCR detection of transgenic rapeseed |
Non-Patent Citations (1)
| Title |
|---|
| 中国转基因油菜的环境安全性分析. 卢长明等.农业生物科技学报，第13卷第3期. 2005 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101020904A (en) | 2007-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106995841B (en) | Multiplex PCR (polymerase chain reaction) kit for detecting transgenic soybeans and detection method | |
| CN100558902C (en) | Transgene rape exogenous origin gene integrator incident Rf1 exogenous insertion vector flanking sequence and application thereof | |
| CN101020902B (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application | |
| CN102634593A (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize EVENT98140 and derived varieties thereof | |
| CN101974649A (en) | Molecular marking method for distinguishing Jian carps | |
| CN101824411B (en) | Flanking sequence of transgenic rice Kefeng No. 6 and qualitative PCR detection method | |
| CN102162012B (en) | Qualitative PCR detection method for transgenic rice kefeng No. 6 | |
| CN101016554B (en) | Transgene rape Rf3 event exogenesis insertion carrier side sequence and application thereof | |
| CN101020903B (en) | Left boundary flanking sequence of exogenous event inserting vector for transgenic rape Oxy-235 and its application | |
| CN100529089C (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Topas-19/2 and its application | |
| CN100529092C (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application | |
| CN100529090C (en) | Left boundary flanking sequence of exogenous event inserting vector for transgenic rape T45 and its application | |
| CN100552032C (en) | Transgene rape Oxy-235 right boundary flanking sequence of exogenous event inserting vector and application thereof | |
| CN104419708B (en) | Nucleic acid and detection transgenic paddy rice EB7001S and its method for Derivative line and kit and application thereof | |
| CN102649976B (en) | LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method | |
| CN112442547A (en) | Development and application of SNP molecular marker of rice blast resistance gene Pita | |
| CN100552033C (en) | Flaking sequence of exogenous event inserting vector for transgenic rape Rf 2 and application thereof | |
| CN101864489B (en) | Method for gathering foreign DNA in transgenosis product | |
| CN103146824A (en) | Recombinant standard plasmid and kit for PCR (Polymerase Chain Reaction) detection of transgenic rice | |
| CN100529091C (en) | Right boundary flanking sequence of exogenous event inserting vector for transgenic rape T45 and its application | |
| CN101948926A (en) | Method for analyzing droplet polymerase chain reaction based on capillary gel electrophoresis detection | |
| CN115992284A (en) | Kit and method for rapidly detecting transgenic product based on RPA-CRISPR-Cas12a system | |
| CN107267503B (en) | Nucleic acid, method for detecting transgenic rice B1C893 and derivative line thereof, kit and application thereof | |
| CN112359098B (en) | Method for detecting content of herbicide-tolerant transgenic soybean J12 by real-time fluorescence quantitative PCR | |
| CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20091021 Termination date: 20130124 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |