CN101016544A - Method of establishing winter jujube genetic conversion system for receptor by using stem tip - Google Patents
Method of establishing winter jujube genetic conversion system for receptor by using stem tip Download PDFInfo
- Publication number
- CN101016544A CN101016544A CN 200710013249 CN200710013249A CN101016544A CN 101016544 A CN101016544 A CN 101016544A CN 200710013249 CN200710013249 CN 200710013249 CN 200710013249 A CN200710013249 A CN 200710013249A CN 101016544 A CN101016544 A CN 101016544A
- Authority
- CN
- China
- Prior art keywords
- winter jujube
- stem apex
- receptor
- establishing
- stem
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method to build winter jujube genetic inverting body system with stem tip as acceptor, which comprises the following steps: choosing winter jujube dormant bud germinal tender bough as material; isolated culturing; inducing reactivation of stem tip clump bud; cutting stem tip; growing on the extending culture; setting stem tip as acceptor; adopting agricillin inducing method; evacuating and exerting negative pressure; proceeding genetic inversion; getting the winter jujube inverting gene plant. The dipping environment increases the transforming frequency effectively under the condition of negative pressure at 0.95X105Pa-0.3X105Pa, which builds up a high effective winter jujube inverting gene technical system.
Description
Technical field
The present invention relates to a kind of establishment method of genetic conversion system, relate in particular to a kind of method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor, belong to agricultural biological technical field or plant genetic engineering field.
Background technology
Jujube (Ziziphus jujube Mill) is the Rhamnaceae jujube, and China is area of origin and the cultivation center of jujube tree, and germ plasm resource is very abundant.Jujube is the seventh-largest fruit tree of China and first dry fruit, and drought-resistant, barren-resistant, salt tolerant alkali, adaptability are strong, play an important role in the development of fruit tree.The winter jujube is the good late-maturing jujube kind of eating raw, unique flavor, and the output height with its extremely excellent quality, is rich in the nutritive substance of needed by human and extremely human consumer favor, in production of fruit trees, sell and have important value.Winter jujube main product is in the Huanghua in Shandong Zhanhua and Hebei, and also there is introducing a fine variety that scale do not wait provinces and regions such as Shanxi, Henan, Beijing, Shaanxi, Xinjiang.Zhanhua winter jujube is one of best winter jujube kind of fresh food quality, and main product is adapted at minuent and saline land grows in the our province Bay areas.Along with the adjustment optimization of development of market economy and fruit variety structure, Zhanhua winter jujube becomes many geographic first-selected kinds with its unique breediness, develops very rapid.
Yet the jujube ripening stage in winter concentrates, and storage period is short, only can preserve 6-7 days under the normal temperature, and fruit is less than normal, fruit stone is big, pericarp is thin, disease is serious.If can not in time capture these difficult problems, then can limit the development of winter jujube greatly, can't enlarge cultivation and sale region and enter the world market in a large number.Because the winter jujube flower is little, castrate difficulty, fruit drop is more serious, and embryo is degenerated easily, and winter jujube breeding at present only only limits to field seed selection elite plant strain.In addition, the winter research of jujube preservation and freshness starts from the mid-90, successively carries out preservation and freshness from the many complete equipments of external introduction.But methods such as conventional quick-frozen storage, ca cold storage, decompression storage, radiopreservation, bad after the fruit outbound, shelf-lives also have only 3-5 days.It seems and adopt existing preservation and freshness and breeding method, be difficult to solve preferably these difficult problems.
The winter zizyphus is in the non-transition type fruit of high respiratory intensity, ABA plays important effect to its after-ripening and the aging of storage phase, affecting the degradation rate and the hardness of the active and fruit storage material of enzyme classes in the jujube fruit after-ripening process, is to cause the really principal element of deliquescing aging of jujube.Therefore be the important channel that prolongs jujube fruit collection period and storage ﹠ fresh-keeping period by the synthetic intensity of the tissue-specific reduction of antisense gene technique ABA.Thereby utilizing plant gene engineering technology is the first-selection that effectively addresses these problems, and successful gene transformation at first depends on the foundation of good plant receptor system.
Because the difficulty of jujube tree tissue culture plant regeneration is bigger, lacks suitable regeneration system, compares with other fruit tree genetic transformations and makes slow progress, the relevant research report of several examples is only arranged so far.Hu Guibing (2001) has studied the influence of 4 kinds of microbiotic to Taiwan green jujube tender stem segments and loose callus growth, tentatively determines to carry out the screening method of bacteriostasis method and transformant in the agriculture bacillus mediated genetic transformation.He Yehua etc. (2003,2004) change ACC synthetic enzyme inverted defined gene over to the tender tip section of jujube and hypocotyl with the agrobacterium tumefaciens mediated method, have obtained transfer-gen plant.With respect to the Study on Genetic Transformation of other plant, the transgenosis work of jujube still is in the exploratory stage, for the method for utilizing stem apex for establishing winter jujube genetic conversion system for receptor, yet there are no report by retrieval.
Summary of the invention
At the deficiencies in the prior art, the purpose of this invention is to provide a kind of method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor.
The present invention is the genetic transformation acceptor with the stem apex of winter jujube tissue cultured seedling, with agrobacterium-mediated transformation foreign gene is imported recipient cell, through selecting to obtain transformant and plant.On this basis, Agrobacterium concentration, immerged time, the dark incubation time of suitable agriculture bacillus mediated genetic transformation have been established, and parameter such as reduced pressure treatment, effectively improved transformation frequency, set up a little winter jujube genetic conversion system of genotype restriction efficiently.
The method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor of the present invention, realized by following steps:
1) stem tip culture and the induced bundle regeneration of sprouting, 2) extension of the bud of growing thickly cultivates 3) to be acceptor with the stem apex carry out genetic transformation, 4 vacuumizing to apply under the negative pressure) little seedling rooting and transplanting, 5) the transfer-gen plant Molecular Detection; It is characterized in that:
Described stem tip culture of step 1) and induced bundle are sprouted to regenerate and are meant the water planting sprouting in 25-27 ℃ of incubator of winter jujube statoblast, the sprout of sprouting is cut into stem-segment with single bud, 70% alcohol pre-sterilizing 30s, 0.1% mercuric chloride sterilization 8-15min, aseptic water washing 3-4 time is seeded in additional 0.5-2mg L then
-1Plant hormones regulators,gibberellins and 0.1-1mg L
-1On the MS inducing culture of 6-benzyl purine, cultivate under temperature 25-27 ℃, intensity of illumination 3000-4000Lx, illumination 12h/ days condition, 35 days subcultures once;
Step 2) extension of the described bud of growing thickly is cultivated and to be meant step 1) regenerated budlet is seeded in and to be added with 1-3mg L
-1Plant hormones regulators,gibberellins, 0.1-0.5mg L
-16-benzyl purine and 100-500mg L
-1The MS of casein hydrolysate extends on the substratum with step 2) described condition cultivation, cut winter jujube stem apex afterwards, standby;
Step 3) is described, and to be acceptor with the stem apex carry out genetic transformation and be meant that the winter jujube stem apex of getting 2-8mm is that (the stem apex acceptor refers to ten to tens microns shoot apical meristem (shoot meristem) and big stem end (shoot tip) to several millimeters to acceptor vacuumizing to apply under the negative pressure, and shoot apical meristem is meant apical growth awl and contiguous leaf primordium thereof), evenly scratch the stem apex apical meristem with dissecting needle, the agrobacterium tumefaciens that will have plant expression vector pCAMBIA1300-als-betA is simultaneously made OD
600Value is the gradient bacterium liquid of 0.2-1.2, will scratch stem apex then and immerse respectively in the gradient bacterium liquid, contaminates 5-20mins, and contaminating environment attached therebetween is 0.95 * 10 with vacuum tightness
5Pa-0.3 * 10
5The condition of negative pressure of Pa is to improve the dip-dye efficient of Agrobacterium; After contaminating end, residue bacterium liquid on the stem apex is blotted, go to MS and extend in the substratum, the dark cultivation 2-8 days under 20-21 ℃ of temperature condition with aseptic filter paper; Dark cultivate finish after, stem apex with aseptic washing 2-3 time, is gone to then and contains 100mg L
-1Cephamycin MS extends on the substratum, and antibacterial cultivations 7-14 days carried out resistance screening containing on the grand MS extension substratum of the green sulphur of 0.5-3mg L-1 afterwards, step sizing 3-5 generation, per generation 7-10 days; Change over to then and contain 1mg L
-1Plant hormones regulators,gibberellins and 0.5mg L
-1The MS of 6-benzyl purine extends recovery cultivation on the substratum;
Described little seedling rooting of step 4) and transplanting are meant that the stem apex of surviving the back is cultivated in the described recovery of step 3) continues cultivation, after plant height to be grown to is 1.5-2cm, change in the Nitsh root media and take root, root growth moves into sand and vermiculite volume ratio and is continued growth in 1: 1 the matrix to 1.5-3cm;
Step 5) transfer-gen plant Molecular Detection is meant utilizes PCR, Southern blot, RT-PCR method that transfer-gen plant is detected, and according to whether the goal gene band being arranged, determines winter jujube transfer-gen plant.
Utilize in the method for stem apex for establishing winter jujube genetic conversion system for receptor stating: described winter jujube be meant the late-maturing Cultivar of Rhamnaceae jujube (because of in Cold Dew after ripening gain the name, high and stable yield, adaptability is strong, is to eat good jujube kind raw).
Wherein: the preferred Zhanhua winter jujube of described winter jujube.
Utilize in the method for stem apex for establishing winter jujube genetic conversion system for receptor stating: described preferred LBA4404 of agrobacterium tumefaciens or the AGLO that has plant expression vector pCAMBIA1300-als-betA.
Utilize in the method for stem apex for establishing winter jujube genetic conversion system for receptor stating: the preferred additional 0.8-1.5mg L of the stem-segment with single bud inoculation after the described mercuric chloride sterilization
-1Plant hormones regulators,gibberellins and 0.2-0.8mg L
-1The MS inducing culture of 6-benzyl purine.
Utilize in the method for stem apex for establishing winter jujube genetic conversion system for receptor stating: the described Agrobacterium bacterium of step 3) liquid is OD preferably
600Value is the gradient bacterium liquid of 0.4-1.0, the preferred 8-10mins of described immerged time, described dark incubation time preferred 4-6 days.
Different its preferable conversion parameters of agrobacterium strains are variant.As: when selecting LBA4404 for use, as bacterial concentration OD
600Value is 0.6-0.8, and when preferable infection time was 8-10mins, the result showed the survival rate height of stem apex in recovering cultivation, and the transfer-gen plant ratio is higher.
Utilize in the method for stem apex for establishing winter jujube genetic conversion system for receptor stating: the described condition of negative pressure of step 3) preferred 0.8 * 10
5Pa-0.5 * 10
5Pa.
Wherein: the described condition of negative pressure of step 3) most preferably 0.6 * 10
5Pa-0.5 * 10
5Pa.
Among the present invention, substratum and plant growth regulating substance pressure sterilizing; Microbiotic and weedicide isoreactivity composition filtration sterilization add behind medium sterilization.
Above-mentioned MS minimum medium is meant: modified MS medium (KNO
31900mgL
-1, NH
4NO
31650mgL
-1, CaCl
22H
2O 440mgL
-1, MgSO
47H
2O 370mgL
-1, KH
2PO
4H2O 170mgL
-1, FeSO
47H
2O 27.8mgL
-1, ZnSO
47H
2O 10mgL
-1, MnSO
44H
2O 22.3mgL
-1, H
3BO
310mgL
-1, KI 0.83mgL
-1, Na
2MoO
42 H
2O 0.5mgL
-1, CuSO
45H
2O 0.025mgL
-1, CoCl
26H
2O 0.025mgL
-1, vitamin 10.0mgL
-1, pyridoxine hydrochloride 1.0mgL
-1, nicotinic acid 1.0mgL
-1, glycine 2.0mgL
-1, inositol 100.0mgL
-1, vitamin H 0.05mgL
-1, casein hydrolysate 500mgL
-1), sucrose 30gL
-1, agar powder 6.5gL
-1, pH5.8-6.0.
Above-mentioned MS inducing culture is meant: be added with 0.5-2mgL
-1Plant hormones regulators,gibberellins (GA
3), 0.1-1mgL
-16-benzyl purine (6-BA) and 100-500mgL
-1The MS solid medium of casein hydrolysate;
Above-mentioned MS extends substratum and is meant: be added with 1-3mgL
-1Plant hormones regulators,gibberellins (GA
3), 0.1-0.5mgL
-16-benzyl purine (6-BA) and 100-500mgL
-1The MS solid medium of casein hydrolysate; Liquid nutrient medium then removes agar powder.
Above-mentioned Nitsh root media is meant: be added with 0.1-0.5mgL
-1Indolylacetic acid (IAA), 0.2-1mgL
-1The Nitsh solid medium of indolebutyric acid (IBA);
Above-mentioned agrobacterium strains is a biology field bacterial strain commonly used, can be available from the female willing biochemical industry in Shanghai company limited, in (CMO and BADH double gene expression vector structure and the expression in tobacco such as Liu Jun, Chinese biological engineering magazine, 2006,26 (8): 5-9) and (analysis of plant expression vector construction and transgene tobacco antiweed and salt tolerance, Journal of Agricultural Biotechnology such as Wang Xianyan, 2003,11 (6): 554-560) report of application is arranged in the research.The vector construction that adopts in the present invention's test is according to (analyses of plant expression vector construction and transgene tobacco antiweed and salt tolerance such as Wang Xianyan, Journal of Agricultural Biotechnology, 2003,11 (6): the methods involving of " molecular cloning experiment guide " (Science Press, 2003) that report 554-560) and Cold Spring Harbor Laboratory are published carries out.
The method of utilizing the present invention to set up winter jujube genetic conversion system can obtain a large amount of winter jujube stem apexs with very strong plant regeneration ability, and the regeneration plant somaclonal variation is little, and the transfer-gen plant majority grows normally.
Characteristics of the present invention are: 1) reduce genotype barrier, 2 significantly) the stem apex transformation frequency cultivated is higher, and 3) drawing materials is not subject to seasonal restrictions, and 4) the most good characteristics that keep the protogene type of transfer-gen plant.
Description of drawings
Fig. 1: the Agrobacterium bacterial concentration is to the broken line graph of winter jujube stem apex genetic transformation rate influence
On behalf of the Agrobacterium bacterial concentration, a wherein, b, c, d the significance of difference analysis of winter jujube stem apex genetic transformation rate is indicated, and it is not remarkable that same letter is illustrated on the P=0.05 level difference, and different letter representations are significant difference on the P=0.05 level.
Fig. 2: the During Agrobacterium time is to the broken line graph of winter jujube stem apex genetic transformation rate influence
On behalf of the Agrobacterium bacterial concentration, a wherein, b the significance of difference analysis of winter jujube stem apex genetic transformation rate is indicated, and it is not remarkable that same letter is illustrated on the P=0.05 level difference, and different letter representations are significant difference on the P=0.05 level.
Fig. 3: the PCR of winter jujube transformed plant betA gene detects figure
Embodiment
The invention will be further described below in conjunction with embodiment:
Grow thickly the inducing and succeeding transfer culture of bud: winter jujube statoblast water planting in 25-27 ℃ of incubator is sprouted, and the sprout of sprouting is cut into stem-segment with single bud, 70% alcohol pre-sterilizing 30s, and 0.1% mercuric chloride sterilization 12-15min, aseptic water washing 3 times is seeded in additional 0.5mgL then
-1, 1mgL
-1, 2mgL
-1Plant hormones regulators,gibberellins and 0.1mgL
-1, 0.5mgL
-1, 1mgL
-1On the MS inducing culture of 6-benzyl purine.Cultivate under temperature 25-27 ℃, intensity of illumination 3000-4000Lx, illumination 12h/ days condition, 35 days subcultures once;
Determining of selective agent concentration: behind weedicide chlorsulfuron (Shenyang Agricultural Chemicals Factory produces, effective constituent 25%) aqueous solution filtration sterilization, add (when the substratum temperature is lower than 50 ℃) and remove in the MS inducing culture of casein hydrolysate.Chlorsulfuron concentration is respectively 0,0.5mgL
-1, 1mgL
-1, 1.5mgL
-1, 2mgL
-1, 2.5mgL
-1, 3mgL
-17 concentration.The winter jujube stem apex of inducing generation is seeded in the MS that contains above-mentioned concentration chlorsulfuron extends on the substratum and cultivate, per 10 days succeeding transfer culture once, the step sizing three generations.According to the survival rate of screening back winter jujube stem apex, determine that the suitable chlorsulfuron concentration of resistance screening is 2mgL in the winter jujube genetic transformation process
-1
Agriculture bacillus mediated genetic transformation: the agrobacterium tumefaciens (as LBA4404) that will have plant expression vector pCAMBIA1300-als-betA is got mono-clonal, is inoculated into and contains 50mg L
-1Rifampin and 50mgL
-1YEP liquid nutrient medium (the yeast extract 10gL of kantlex
-1, peptone 10gL
-1, NaCl 5gL
-1, pH7.0) in, in 28 ℃, the 180-190r/min shaking culture.Bacterial concentration reaches 1.2 (OD
600) time with the centrifugal 15min of 4000rpm, outwell supernatant liquor, it is resuspended that bacterial precipitation extends substratum with liquid MS, contaminate the Syringylethanone that this bacterial suspension of forward direction adds 100 μ m (acetosyringone, AS).
Be of the influence of research Agrobacterium bacterial concentration to winter jujube genetic transformation rate, with extend cultivate 7 days on the substratum winter jujube stem apex as the genetic transformation acceptor, peel off the spire of stem end, evenly scratch the stem apex apical meristem with dissecting needle, the agrobacterium tumefaciens that will have plant expression vector pCAMBIA1300-als-betA is simultaneously made OD respectively
600Value is 0.2,0.4,0.6,0.8,1.0,1.2 gradient bacterium liquid, will scratch stem apex then and immerse different OD respectively
600In the value bacterium liquid, contaminate 10min.After contaminating end, residue bacterium liquid on the stem apex is blotted, go to MS and extend in the substratum, the dark cultivation 4 days under 20-21 ℃ of temperature condition with aseptic filter paper.Dark cultivate finish after, stem apex with aseptic washing 2-3 time, is gone to then and contains 100mgL
-1Cephamycin MS extends on the substratum, and antibacterial cultivation 7 days is containing 2mg L afterwards
-1The grand MS of green sulphur extends on the substratum and carries out resistance screening, 3 generations of step sizing, 7 days per generations; Change over to then and contain 1mgL
-1Plant hormones regulators,gibberellins and 0.3mgL
-1The MS of 6-benzyl purine extends recovery cultivation (see figure 1) on the substratum.
For of the influence of research During Agrobacterium time, use OD to winter jujube genetic transformation rate
600Value is 0.8 good winter jujube stem apex 5mins, 10mins, 15mins, the 20mins of Agrobacterium bacterium liquid difference dip dyeing treatment, after contaminating end, with aseptic filter paper residue bacterium liquid on the stem apex is blotted, go to MS and extend in the substratum, the dark cultivation 4 days under 20-21 ℃ of temperature condition.Dark cultivate finish after, stem apex with aseptic washing 2-3 time, is gone to then and contains 100mg L
-1Cephamycin MS extends on the substratum, and antibacterial cultivation 7 days is containing 2mg L afterwards
-1The grand MS of green sulphur extends on the substratum and carries out resistance screening, 3 generations of step sizing, 7 days per generations; Change over to then and contain 1mg L
-1Plant hormones regulators,gibberellins and 0.3mg L
-1The MS of 6-benzyl purine extends recovery cultivation (see figure 2) on the substratum.
For dark incubation time after the research During Agrobacterium is used OD to the influence of winter jujube genetic transformation rate
600Be 0.8 the good winter jujube stem apex 10mins of Agrobacterium bacterium liquid dip dyeing treatment, after contaminating end, with aseptic filter paper residue bacterium liquid on the stem apex is blotted, go to MS and extend in the substratum, the dark respectively cultivation of 20-21 ℃ of temperature condition 2 days, 4 days, 6 days, dark cultivate finish after, stem apex with aseptic washing 2-3 time, is gone to then and contains 100mg L
-1Cephamycin extends on the substratum, and antibacterial cultivation 7 days is containing 2mg L afterwards
-1The grand MS of green sulphur extends on the substratum and carries out resistance screening, 3 generations of step sizing, 7 days per generations; Change over to then and contain 1mg L
-1Plant hormones regulators,gibberellins and 0.3mg L
-1The MS of 6-benzyl purine extends recovery cultivation on the substratum.
For research During Agrobacterium environment attached with condition of negative pressure to the influence of winter jujube genetic transformation rate, use OD
600Value is 0.8 the good winter jujube stem apex 10mins of Agrobacterium bacterium liquid dip dyeing treatment, is aided with 0.95 * 10 in the dip-dye process
5Pa, 0.5 * 10
5Pa, 0.3 * 10
5The negative pressure of Pa is handled.After contaminating end, residue bacterium liquid on the stem apex is blotted, go to MS and extend in the substratum, the dark cultivation 4 days under 20-21 ℃ of temperature condition with aseptic filter paper; Dark cultivate finish after, young shoot with aseptic washing 2-3 time, is gone to then and contains 100mg L
-1Cephamycin MS extends on the substratum, and antibacterial cultivation 7 days is containing 2mg L afterwards
-1The grand MS of green sulphur extends on the substratum and carries out resistance screening, 3 generations of step sizing, 7 days per generations; Change over to then and contain 1mg L
-1Plant hormones regulators,gibberellins and 0.3mg L
-1The MS of 6-benzyl purine extends recovery cultivation on the substratum.
The winter jujube stem apex that above-mentioned different treatment recovers to cultivate grows to and goes to root media behind the 1.5-2cm height and take root, root growth is to 1.5-3cm, move into sand and vermiculite volume ratio and be continued growth in 1: 1 the matrix, beginning one is all seals maintenance humidity with sealing film with vessel port.Watered an amount of 1/2MS nutritive medium every 3 days, envrionment temperature is controlled at 25 ℃, relative humidity 60-70%.Growth moved in the soil after 15-20 days under the above-mentioned envrionment conditions, outdoor conditions growth down.The seedling of transplant survival is got young leaflet tablet and is used for molecular Biological Detection.(primer 1:CGCTACAGGGTAAAC GCTACA AC, primer 2: CCTCACGGCTGCGAATAAATCC), preferable Agrobacterium bacterial concentration is 0.8 (OD through detections such as PCR
600), the preferable During Agrobacterium time is 10mins, and dark incubation time is 4 days after the preferable During Agrobacterium, and preferable condition of negative pressure is 0.5 * 10
5Pa, winter jujube genetic transformation rate is higher reaches 4.3%～5.2% (see figure 3).
Transformation efficiency is for producing stem apex number * 100% of transfer-gen plant number/agroinfection among the present invention.
Above-mentioned MS minimum medium: be modified MS medium (KNO
31900mg L
-1, NH
4NO
31650mg L
-1, CaCl
22H
2O 440mg L
-1, MgSO
47H
2O 370mg L
-1, KH
2PO
4H2O 170mg L
-1, FeSO
47H
2O 27.8mg L
-1, ZnSO
47H
2O 10mg L
-1, MnSO
44H
2O 22.3mg L
-1, H
3BO
310mg L
-1, KI 0.83mg L
-1, Na
2MoO
42 H
2O 0.5mg L
-1, CuSO
45H
2O 0.025mg L
-1, CoCl
26H
2O 0.025mg L
-1, vitamin 10.0mg L
-1, pyridoxine hydrochloride 1.0mg L
-1, nicotinic acid 1.0mg L
-1, glycine 2.0mg L
-1, inositol 100.0mg L
-1, vitamin H 0.05mg L
-1, casein hydrolysate 500mg L
-1), sucrose 30g L
-1, agar powder 6.5g L
-1, pH5.8-6.0.
Above-mentioned inducing culture is meant: be added with 1.5mg L
-1Plant hormones regulators,gibberellins (GA
3), 0.5mg L
-16-benzyl purine (6-BA) and 100-500mg L
-1The MS solid medium of casein hydrolysate; Liquid nutrient medium then removes agar powder.
Above-mentioned extension substratum is meant: be added with 2mg L
-1Plant hormones regulators,gibberellins (GA
3), 0.2mg L
-16-benzyl purine (6-BA) and 100-500mg L
-1The MS solid medium of casein hydrolysate; Liquid nutrient medium then removes agar powder.
Above-mentioned root media is meant: be added with 0.3mg L
-1Indolylacetic acid (IAA), 0.2mg L
-1The Nitsh solid medium of indolebutyric acid (IBA);
Grow thickly the inducing and succeeding transfer culture of bud: winter jujube statoblast water planting in 25-27 ℃ of incubator is sprouted, and the sprout of sprouting is cut into stem-segment with single bud, 70% alcohol pre-sterilizing 30s, and 0.1% mercuric chloride sterilization 8-10min, aseptic water washing 4 times is seeded in additional 1.5mg L then
-1GA
3With 0.2mg L
-1On the MS inducing culture of 6-benzyl purine, cultivate under temperature 25-27 ℃, intensity of illumination 3000-4000Lx, illumination 12h/ days condition, 35 days subcultures once;
Agriculture bacillus mediated genetic transformation: the agrobacterium tumefaciens (as LBA4404) that will have plant expression vector pCAMBIA1300-als-betA is got mono-clonal, is inoculated into and contains 50mg L
-1Rifampin and 50mg L
-1The YEP liquid nutrient medium of kantlex (yeast extract 10g L
-1, peptone 10g L
-1, NaCl 5g L
-1, pH7.0) in, in 28 ℃, the 180-190r/min shaking culture.Bacterial concentration reaches 0.8 (OD
600) time with the centrifugal 15min of 4000rpm, outwell supernatant liquor, it is resuspended that bacterial precipitation extends substratum with liquid MS, contaminate the Syringylethanone that this bacterial suspension of forward direction adds 100 μ m (acetosyringone, AS).
The winter jujube young shoot of cultivating on subculture medium 7 days is used explant as contaminating, and peels off the spire of stem end, evenly scratches the stem apex apical meristem with dissecting needle.Winter jujube stem apex after the processing is at OD
600Value is to contaminate 10mins in 0.8 the agrobacterium suspension, and attached with 0.5 * 10
5The subnormal ambient of Pa.After contaminating end, residue bacterium liquid on the stem apex is blotted, go to MS and extend in the substratum, the dark cultivation 4 days under 20-21 ℃ of temperature condition with aseptic filter paper.Containing 100mg L afterwards
-1The stem of cephamycin extended in the substratum antibacterial 7 days, extended in the substratum 3 generations of screening, 7 days per generations at the MS that contains the 2mg/L chlorsulfuron then.The young shoot of screening back survival recovers to cultivate, and goes to root media after growing to the 1.5-2cm height.After taking root, move into sand and vermiculite volume ratio and be continued growth in 1: 1 the matrix, beginning one is all seals maintenance humidity with sealing film with vessel port.Watered an amount of 1/2MS nutritive medium every 3 days, envrionment temperature is controlled at 25 ℃, relative humidity 60-70%.Growth moved in the soil after 15-20 days under the above-mentioned envrionment conditions, outdoor conditions growth down.The seedling of transplant survival is got young leaflet tablet and is used for molecular Biological Detection.(primer 1:CGCTACAGGGTAAAC GCTACAAC, primer 2: CCTCACGGCTGCGAATAAATCC), the winter, jujube genetic transformation rate was for can reach 5.2% through the detection of PCR equimolecular method.
Basic skills such as embodiment 2, wherein the Agrobacterium bacterial concentration is 0.2 (OD
600), contaminate 10min, condition of negative pressure 0.95 * 10
5Pa.Containing 100mg L behind the dark cultivation 4d
-1The MS of cephamycin extended in the substratum antibacterial 7 days, was containing 2mg L then
-1Screened for 3 generations, 7 days per generations in the MS extension substratum of chlorsulfuron.The seedling of transplant survival is got blade and is used for molecular Biological Detection.Detect through PCR equimolecular method, winter jujube genetic transformation rate is about 0.6%.
Basic skills such as embodiment 2, wherein the Agrobacterium bacterial concentration is 1.2 (OD
600), contaminate 10mins, condition of negative pressure 0.80 * 10
5Pa.Containing 100mg L behind the dark cultivation 4d
-1The MS of cephamycin extended in the substratum antibacterial 7 days, was containing 2mg L then
-1Screened for 3 generations, 7 days per generations in the MS extension substratum of chlorsulfuron.The seedling of transplant survival is got blade and is used for molecular Biological Detection.Detect through PCR equimolecular method, winter jujube genetic transformation rate is about 1%.
Basic skills such as embodiment 2, wherein the Agrobacterium bacterial concentration is 0.8 (OD
600), contaminate 15mins, condition of negative pressure 0.85 * 10
5Pa.Containing 100mg L behind the dark cultivation 6d
-1The MS of cephamycin extended in the substratum antibacterial 7 days, was containing 2mg L then
-1Screened for 3 generations, 7 days per generations in the MS extension substratum of chlorsulfuron.The seedling of transplant survival is got blade and is used for molecular Biological Detection.Detect through PCR equimolecular method, winter jujube genetic transformation rate is about 2.2%.
Basic skills such as embodiment 2, wherein the Agrobacterium bacterial concentration is 1.2 (OD
600), contaminate 5mins, condition of negative pressure 0.3 * 10
5Pa.Containing 100mg L behind the dark cultivation 2d
-1The MS of cephamycin extended in the substratum antibacterial 7 days, was containing 2mg L then
-1Screened for 3 generations, 7 days per generations in the MS extension substratum of chlorsulfuron.The seedling of transplant survival is got blade and is used for molecular Biological Detection.Detect through PCR equimolecular method, winter jujube genetic transformation rate is about 2.1%.
Claims (8)
1. method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor, realized by following steps:
1) stem tip culture and the induced bundle regeneration of sprouting, 2) extension of the bud of growing thickly cultivates 3) to be acceptor with the stem apex carry out genetic transformation, 4 vacuumizing to apply under the negative pressure) little seedling rooting and transplanting, 5) the transfer-gen plant Molecular Detection; It is characterized in that:
Described stem tip culture of step 1) and induced bundle are sprouted to regenerate and are meant the water planting sprouting in 25-27 ℃ of incubator of winter jujube statoblast, the sprout of sprouting is cut into stem-segment with single bud, 70% alcohol pre-sterilizing 30s, 0.1% mercuric chloride sterilization 8-15min, behind aseptic water washing 3-4 time, be seeded in additional 0.5-2mg L
-1Plant hormones regulators,gibberellins and 0.1-1mg L
-1On the MS inducing culture of 6-benzyl purine, cultivate under temperature 25-27 ℃, intensity of illumination 3000-4000 Lx, illumination 12h/ days condition, 35 days subcultures once;
Step 2) extension of the described bud of growing thickly is cultivated and to be meant step 1) regenerated budlet is seeded in and to be added with 1-3mg L
-1Plant hormones regulators,gibberellins, 0.1-0.5mg L
-16-benzyl purine and 100-500mg L
-1The MS of casein hydrolysate extends on the substratum with step 2) described condition cultivation, cut winter jujube stem apex afterwards, standby;
Step 3) is described, and to be acceptor with the stem apex carry out genetic transformation and be meant that the winter jujube stem apex of getting 2-8mm is an acceptor vacuumizing to apply under the negative pressure, evenly scratch the stem apex apical meristem with dissecting needle, the agrobacterium tumefaciens that will have plant expression vector pCAMBIA1300-als-betA is simultaneously made OD
600Value is the gradient bacterium liquid of 0.2-1.2, will scratch stem apex then and immerse respectively in the gradient bacterium liquid, contaminates 5-20mins, and contaminating environment attached therebetween is 0.95 * 10 with vacuum tightness
5Pa-0.3 * 10
5The condition of negative pressure of Pa is to improve the dip-dye efficient of Agrobacterium; After contaminating end, residue bacterium liquid on the stem apex is blotted, go to MS and extend in the substratum, the dark cultivation 2-8 days under 20-21 ℃ of temperature condition with aseptic filter paper; Dark cultivate finish after, stem apex with aseptic washing 2-3 time, is gone to then and contains 100mg L
-1Cephamycin MS extends on the substratum, and antibacterial cultivation 7-14 days is containing 0.5-3mg L afterwards
-1The grand MS of green sulphur extends on the substratum and carries out resistance screening, step sizing 3-5 generation, per generation 7-10 days; Change over to then and contain 1mg L
-1Plant hormones regulators,gibberellins and 0.3mg L
-1The MS of 6-benzyl purine extends recovery cultivation on the substratum;
Described little seedling rooting of step 4) and transplanting are meant that the stem apex of surviving the back is cultivated in the described recovery of step 3) continues cultivation, after plant height to be grown to is 1.5-2cm, change in the Nitsh root media and take root, root growth moves into sand and vermiculite volume ratio and is continued growth in 1: 1 the matrix to 1.5-3cm;
Step 5) transfer-gen plant Molecular Detection is meant utilizes PCR, Southern blot, RT-PCR method that transfer-gen plant is detected, and according to whether the goal gene band being arranged, determines winter jujube transfer-gen plant.
2. according to the described method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor of claim 1, it is characterized in that: described winter jujube is meant the Cultivar that the Rhamnaceae jujube is late-maturing.
3. according to the described method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor of claim 2, it is characterized in that: described winter jujube is a Zhanhua winter jujube.
4. according to the described method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor of claim 1, it is characterized in that: the described agrobacterium tumefaciens that has plant expression vector pCAMBIA1300-als-bet4 is LBA4404 or AGL0.
5. utilize the method for stem apex for establishing winter jujube genetic conversion system for receptor according to claim 1, it is characterized in that: the stem-segment with single bud after the described mercuric chloride sterilization is seeded in additional 0.8-1.5mg L
-1Plant hormones regulators,gibberellins and 0.2-0.8mg L
-1On the MS inducing culture of 6-benzyl purine.
6. according to the described method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor of claim 1, it is characterized in that: the described Agrobacterium bacterium of step 3) liquid is OD
600Value is the gradient bacterium liquid of 0.4-1.0, and described immerged time is 8-10mins, and described dark incubation time is 4-6 days.
7. according to the described method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor of claim 1, it is characterized in that: the described condition of negative pressure of step 3) is 0.8 * 10
5Pa-0.5 * 10
5Pa.
8. according to the described method of utilizing stem apex for establishing winter jujube genetic conversion system for receptor of claim 7, it is characterized in that: the described condition of negative pressure of step 3) is 0.6 * 10
5Pa-0.5 * 10
5Pa.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710013249 CN101016544A (en) | 2007-01-19 | 2007-01-19 | Method of establishing winter jujube genetic conversion system for receptor by using stem tip |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710013249 CN101016544A (en) | 2007-01-19 | 2007-01-19 | Method of establishing winter jujube genetic conversion system for receptor by using stem tip |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101016544A true CN101016544A (en) | 2007-08-15 |
Family
ID=38725765
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200710013249 Pending CN101016544A (en) | 2007-01-19 | 2007-01-19 | Method of establishing winter jujube genetic conversion system for receptor by using stem tip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101016544A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321662A (en) * | 2011-07-14 | 2012-01-18 | 中国科学院植物研究所 | Method for transforming stem tips of plants and special tool thereof |
| CN103190347A (en) * | 2013-04-26 | 2013-07-10 | 北京林业大学 | Teapot dates tissue culturing method |
| CN105941154A (en) * | 2016-05-30 | 2016-09-21 | 沾化县冬枣研究所 | Comprehensive breeding method for superior winter jujube seedlings |
| CN115044606A (en) * | 2022-06-28 | 2022-09-13 | 西北农林科技大学 | Method for establishing agrobacterium rhizogenes-mediated jujube genetic transformation system |
| CN115530076A (en) * | 2022-11-10 | 2022-12-30 | 山东滨州国家农业科技园区管理服务中心(滨州黄河三角洲高效生态产业现代技术研究院) | Winter jujube tissue culture method |
-
2007
- 2007-01-19 CN CN 200710013249 patent/CN101016544A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321662A (en) * | 2011-07-14 | 2012-01-18 | 中国科学院植物研究所 | Method for transforming stem tips of plants and special tool thereof |
| CN103190347A (en) * | 2013-04-26 | 2013-07-10 | 北京林业大学 | Teapot dates tissue culturing method |
| CN105941154A (en) * | 2016-05-30 | 2016-09-21 | 沾化县冬枣研究所 | Comprehensive breeding method for superior winter jujube seedlings |
| CN115044606A (en) * | 2022-06-28 | 2022-09-13 | 西北农林科技大学 | Method for establishing agrobacterium rhizogenes-mediated jujube genetic transformation system |
| CN115044606B (en) * | 2022-06-28 | 2023-05-23 | 西北农林科技大学 | Method for establishing agrobacterium rhizogenes-mediated jujube genetic transformation system |
| CN115530076A (en) * | 2022-11-10 | 2022-12-30 | 山东滨州国家农业科技园区管理服务中心(滨州黄河三角洲高效生态产业现代技术研究院) | Winter jujube tissue culture method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Damm et al. | Regeneration of fertile plants from protoplasts of different Arabidopsis thaliana genotypes | |
| Atanassov et al. | Plant regeneration from suspension culture and mesophyll protoplasts of Medicago sativa L. | |
| CN101948867B (en) | Agrobacterium-mediated jatropha curcas gene transformation method | |
| CN101445808B (en) | Agrobacterium-mediated genetic transformation method with peanut seed domant bud hypocotyl as explant | |
| EP2142653A2 (en) | Methods for inducing cotton embryogenic callus | |
| CN111893133A (en) | Agrobacterium-mediated cabbage heart genetic transformation method | |
| CN102174562A (en) | Application of novel rooting method in soybean transgenic technology | |
| CN110982835A (en) | Method for reducing callus pollution of barley and highland barley microspores in agrobacterium transformation process | |
| CN101016544A (en) | Method of establishing winter jujube genetic conversion system for receptor by using stem tip | |
| KR100533120B1 (en) | Method of plant cell culture from cambium | |
| CN103053423B (en) | Method for establishing high-efficiency regeneration system by using broccoli microspore embryo as explant | |
| CN117004649B (en) | Agrobacterium-mediated broom corn millet efficient genetic transformation method | |
| CN102191269B (en) | Non tissue culture gene transferring method by using half of peanut seed as acceptor | |
| CN104087611B (en) | A kind of agriculture bacillus mediated Jatropha curcas genetic transforming method | |
| CN101948868B (en) | Genetic transformation method taking sweet sorghum young ear or young ear induced callus as explant | |
| CN101356895B (en) | Sweet-potato isolated culture adventitious-root germination method and use thereof | |
| CN102450214A (en) | Screening and preserving method for Lolium L. embryogenic callus | |
| CN103266130A (en) | Application of soybean aquaporin gene GmPIP1;2 | |
| CN103173487A (en) | Anniversary large-scale maize transformation method | |
| CN113881698B (en) | Method for transforming barley microspore callus by using agrobacterium | |
| CN102002512A (en) | Genetic transformation method for soybean | |
| CN1125878C (en) | Method for creating transgenic receptor system of corn and application of same | |
| CN1322136C (en) | Method of establishing early-maturing ripe hereditary transform system and application | |
| JPS59224688A (en) | Breeding of plant cell | |
| Liu et al. | Development of an in vitro grafting method for the enhancement of growth of isolated shoots and buds in soybean (Glycine max L.) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |