CN101008035A - ABO blood type gene and short tandem repeat composite amplification system - Google Patents
ABO blood type gene and short tandem repeat composite amplification system Download PDFInfo
- Publication number
- CN101008035A CN101008035A CNA2006101715929A CN200610171592A CN101008035A CN 101008035 A CN101008035 A CN 101008035A CN A2006101715929 A CNA2006101715929 A CN A2006101715929A CN 200610171592 A CN200610171592 A CN 200610171592A CN 101008035 A CN101008035 A CN 101008035A
- Authority
- CN
- China
- Prior art keywords
- primer sequence
- reverse primer
- blood group
- forward primer
- reverse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a blood type gene and short cascade gene composite augment checking system. It is characterized in that the system comprises ABO blood type gene and primer of STR gene, and augmentates through PCR reaction in the same augmentatino system. The invention is characterized in that it can save a large amount of cost, by over 50%, increase work efficiency, provides more genetic mark information, obviously increase check accuracy, and possesses better individual identifying ability and non- father removing rate. The invention is characterized by higher sensitivity, the lowest level is 0.05 ng DNA, and it can still check all 15 STR sites and judge sex and blood type under trace amount moudle.
Description
Technical field:
The invention belongs to biological technical field.Further, the present invention relates to detect genetic marker and the abo blood group gene that has polymorphism in the human genome.The present invention be more particularly directed to polymerase chain reaction in an amplification system, increase simultaneously a plurality of short tandem repeats and abo blood group gene.
Background technology:
STR (STR) is the repetition DNA fragment that is distributed in a large number in the human genome, can be by polymerase chain reaction (PCR) amplification product of obtaining being uneven in length, and amplified production can use radioactivity, silver dyeing or fluorescent method detection.And this class sequence has characteristics such as polymorphism, genetic stability, therefore is widely used in the genetic marker of purposes such as identification and paternity identification.When being used for individual recognition and paternity identification, need detect the recognition capability that a plurality of sites can reach to be needed simultaneously, the FBI of the U.S. (FBI) has set up a kind of DNA index system, has wherein comprised 13 str locus seat vWA, D21S11, D18S51, D5S818, D7S820, D13S317, D16S539, FGA, TH01, TPOX, D8S1179, D3S1358, CSF1PO.Amplification and detection for the str locus seat in early days realizes that by single PCR each reaction can only detect single site, and cost is very high, inefficiency.Therefore it is extremely important to detect a plurality of STR in a reaction system, can save cost and increase work efficiency again.But, only there are the Identifiler test kit of American AB I company and two kinds of products of PowerPlex16 test kit of U.S. Promega company to can be implemented in the str locus seat of amplification system kind detection more than 13 kinds at present in the world because technical requirements wherein is very high.
Blood group is identified also having important effect aspect identification and the paternity identification, especially for cracking of cases work.Compare with serological method, identify that with gene amplification method blood group can obtain more accurate result, and be suitable for sample (as bone, hair etc.) and trace detection that various serology can't be judged.1990 to 1993, clones such as Yamamoto obtain A, B, each allelotrope of O of blood group and have compared the difference of its nucleotide sequence, for identifying that at dna level the ABO genotype provides theoretical basis [Yamamoto F etc., J Biol Chem, 1990,265:1146].By the diversity sequence between the whole bag of tricks detection blood group gene, realize A, B, O gene type.Detection method comprises polymerase chain reaction-sequence specific primers (PCR-SSP), polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP), answer polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) [Procter J. etc., Tissue Antigens, 1997,50 (5): 475; S.P.Yip, Blood, 2000,95 (4): 1487; Carrll L etc., J Forensic Sci, 1996,41 (1): 134-137].Present U.S. G﹠amp; T company product can detect blood group by PCR method, but its product length big (surpassing 1000bp) be not suitable for using the fluorescent mark analysis, so detection sensitivity is lower.
Summary of the invention:
The present invention is directed to the defective in above-mentioned field, a kind of blood group gene and short tandem repeat composite amplification checking system are provided, blood group gene and a plurality of str locus seat are detected in a reaction simultaneously, increase work efficiency greatly, the more information amount can once be provided, significant for genetics such as identification, paternity identification and forensic application.
A kind of blood group gene and short tandem repeat composite amplification checking system is characterized in that this system comprises the primer of abo blood group gene and str locus seat, are reflected at amplification simultaneously in the amplification system by PCR.
Described abo blood group locus is A/0796, B796,0261, A/B261.
Described str locus seat is Amelogenin, vWA, D21S11, D18S51, Penta E, D5S818, D7S820, D13S317, D16S539, FGA, D3S1358, TH01, D8S1179, TPOX, CSF1PO, Penta D.
Described primer is respectively:
1) Amelogenin, forward primer sequence 5 '-3 ' is CCCTGGGCTCTGTAAAGAATAGTG; Amelogenin, reverse primer sequence 5 '-3 ' is ATCAGAGCTTAAACTGGGAAGCTG;
2) vWA, forward primer sequence 5 '-3 ' is CCCTAGTGGATAAGAATAATC; Reverse primer sequence 5 '-3 ' is GGACAGATGATAAATACATAG;
3) D21S11, forward primer sequence 5 '-3 ' is CTCAGTCTCCATAAATATGT; Reverse primer sequence 5 '-3 ' is TCTCCAGAGACAGACTAATAGGAGGT;
4) D18S51, forward primer sequence 5 '-3 ' is GAGCCATGTTCATGCCACTG; Reverse primer sequence 5 '-3 ' is TAACAAACCCGACTACCAGC;
5) Penta E, forward primer sequence 5 '-3 ' is CCGATGCAGGTGTATTACCTGAG; Reverse primer sequence 5 '-3 ' is CATGGAAAGAATTCTCTTATTTGGGTT
6) D5S818, forward primer sequence 5 '-3 ' is GCAAGTATGTGACAAGG; Reverse primer sequence 5 '-3 ' is CCACAGTTTACAACATTTGTATC
7) D7S820, forward primer sequence 5 '-3 ' is GAGACGGGGTTTCACCATGTTG; Reverse primer sequence 5 '-3 ' is TCATTGACAGAATTGCACC;
8) D13S317, forward primer sequence 5 '-3 ' is CATGGTATCACAGAAGTCT; Reverse primer sequence 5 '-3 ' is CCAAAAAGACAGACAGAAAGATAG;
9) D16S539, forward primer sequence 5 '-3 ' is CAGATGCTCGTTGTGCACA; Reverse primer sequence 5 '-3 ' is GCCTACAGAGTGATTCCATTTTTAT;
10) FGA, forward primer sequence 5 '-3 ' is CTGGCATTCATGGAAGGC; Reverse primer sequence 5 '-3 ' is CTTCAGGACTTCAATTCTGCTT;
11) D3S1358, forward primer sequence 5 '-3 ' is GCAGTCCAATCTGGGTGAC; Reverse primer sequence 5 '-3 ' is CTCATGAAATCAACAGAGGC;
12) TH01, forward primer sequence 5 '-3 ' is ATTCAAAGGGTATCTGGGCTCTG; Reverse primer sequence 5 '-3 ' is TGGGCTGAAAAGCTCCCGATTAT
13) D8S1179, forward primer sequence 5 '-3 ' is GGCCGGGCAACTTATATGTA; Reverse primer sequence 5 '-3 ' is TTGTGTTCATGAGTATAGTTT;
14) TPOX, forward primer sequence 5 '-3 ' is CACCCAGAACCGTCGACTGGC; Reverse primer sequence 5 '-3 ' is CCACACAGGTTAATTAAGA;
15) CSF1PO, forward primer sequence 5 '-3 ' is ACTCCAGGGCAGTGTTCCA; Reverse primer sequence 5 '-3 ' is AGCCCATTCTCCAGCCTCC
16) Penta D, forward primer sequence 5 '-3 ' is AAGTAGGATCACTTGAGCCTG; Reverse primer sequence 5 '-3 ' is CAAGTCCTTTTTTAGATATGTGA;
17) A/B261, forward primer sequence 5 '-3 ' is CTGTGGCGCTTCTGATGTCCTCGTGGTGA; Reverse primer sequence 5 '-3 ' is CTTGAGGATGTCGATGTTG;
18) 0261, forward primer sequence 5 '-3 ' is AACGATGTCCTCGTGGTAC; Reverse primer sequence 5 '-3 ' is CTTGAGGATGTCGATGTTG;
19) A/0796, forward primer sequence 5 '-3 ' is GCGTCTACTACCTGGGGGG; Reverse primer sequence 5 '-3 ' is TAGCATCTGGTCGACCATCATG;
20) B796, forward primer sequence 5 '-3 ' is GACTGCAGGGCGATTTCTACTACA; Reverse primer sequence 5 '-3 ' is TAGCATCTGGTCGACCATCATG.
Also include the fluorescent marker that detects primer in this checking system.
The fluorescent marker of described detection primer is A/B261,0261, and A/0796, B796, Amelogenin, vWA, D21S11, D18S51, the blue markings thing 6-FAM mark that primer adopted in sites such as Penta E.
The fluorescent marker of described detection primer is D5S818, D7S820, D13S317, D16S539, the Green Marker thing HEX mark that primer adopted in sites such as FGA.
The fluorescent marker of described detection primer is TH01, TPOX, D8S1179, D3S1358, the yellow marker TMR mark that CSF1PO, Penta D are adopted in the site.
The buffer system of described PCR reaction: 50mM KCI, 10mM Tris-HCI, 2.5mM MgCI
2, the dNTP of 1.0mg/ml BSA and each 200mM.
Described PCR reaction conditions is: 95 ℃ are incubated 5 minutes; 94 ℃ were incubated for 30 seconds, and 60 ℃ were incubated for 35 seconds, and 70 ℃ were incubated for 50 seconds, " moving 30 circulations "; 60 ℃ are incubated 30 minutes; 4-10 ℃ of insulation.
The present invention adopts polymerase chain reaction increase simultaneously a plurality of short tandem repeats and abo blood group gene in an amplification system, can increase in this reaction system 4 abo blood group genes, 1 sex decision bit point and 15 str locus seats, and can detect and somatotype by conventional means.
PCR method is analyzed the principle of STR and is identified that with PCR method the abo blood group principle is different, and reaction conditions and product length range also difference are very big, and this two individual system is merged very difficulty.Pcr analysis STR cardinal principle is that the upstream and downstream at tumor-necrosis factor glycoproteins designs suitable primer, make all fragment lengths (70-500bp) but in sensing range, and the amplified production length difference at different genes seat is in order to distinguish different genotype.The abo blood group gene order is highly similar, the sudden change of single Nucleotide is just arranged at indivedual positions, can't realize the fragment length difference by changing primer location, can only be by accurate primer of design and condition, the assurance primer can be discerned the difference of 1 Nucleotide, the product length range is similar to the former, also will be in the terminal length of regulating product with template bonded sequence of adding not of sequence-specific primer.Because principle difference, PCR reaction conditions also difference is very big, it is very harsh that PCR method identifies that ABO gene pairs reaction conditions requires, temperature of reaction changes 1 degree and all may cause non-specific product to produce, finally cause declaring the type mistake, make two kinds of detection architecture adapt to same reaction conditions needs and calculate in a large number and test.
The discriminating site that the present invention is used for the abo blood group gene is 261 (A, B gene are G, and the O gene lacks a Nucleotide herein) of the 6th exon and 796,802,803 (A, O gene are C/G/G, and the B gene is A/G/C herein) of the 7th exon.Adopt increase respectively A/B gene and O gene 261 of 4 pairs of primers, A/O and B gene 796,802,803, the characteristic fragment that obtains being uneven in length, can judge blood group [Jiang Xianhua etc. by reading fragment, the Chinese law medical journal, 2004,19 (1): 41-42].Judge that the ABO genotype can be according to following table.
| O261 | A/B261 | A/O796 | B796 | |
| AA | - | + | + | - |
| AO | + | + | + | - |
| AB | - | + | + | + |
| BB | - | + | - | + |
| BO | + | + | + | + |
| OO | + | - | + | - |
Str locus of the present invention is as all core sequences among the CODIS that comprises the FBI regulation, vWA, D21S11, D18S51, D5S818, D7S820, D13S317, D16S539, FGA, TH01, TPOX, D8S1179, D3S1358, CSF1PO.Comprise two 5 trinucleotide repeat sequences in addition, Penta D and Penta E, these two sites all have the height polymorphism in each clansman group of China, and shadow band seldom, is suitable for very much Chinese population individual recognition [Lv Dejian etc., Chinese law medical journal, 2003,18 (6): 332-334; Li Haiyan etc., Chinese law medical journal, 2004,19 (6): 330-333].
Str locus provided by the invention seat and blood group gene test primer adopt the fluorescent mark substance markers of 3 kinds of colors, ABO, Amelogenin, vWA, D21S11, D18S51, the primer in sites such as Penta E blue markings thing 6-FAM (Fluoresceincarboxylic acid) mark; D5S818, D7S820, D13S317, D16S539, the primer in sites such as FGA adopts Green Marker thing HEX (chlordene-6-methyl fluorescein) mark; TH01, TPOX, D8S1179, D3S1358, CSF1PO, PentaD etc. adopt in 6 sites yellow marker TMR (4-methyl-6-carboxyl-rhodamine) mark.
20 pairs of primers among the present invention can be in same reaction system, amplification simultaneously under the same reaction conditions.Concrete sequence sees Table 1.
Table 1 primer sequence
Site title primer direction sequence 5 '-3 '
Amelogenin Forward CCCTGGGCTCTGTAAAGAATAGTG
Amelogenin Reverse ATCAGAGCTTAAACTGGGAAGCTG
vWA Forward CCCTAGTGGATAAGAATAATC
vWA Reverse GGACAGATGATAAATACATAG
D21S11 Forward CTCAGTCTCCATAAATATGT
D21S11 Reverse TCTCCAGAGACAGACTAATAGGAGGT
D18S51 Forward GAGCCATGTTCATGCCACTG
D18S51 Reverse TAACAAACCCGACTACCAGC
Penta E Forward CCGATGCAGGTGTATTACCTGAG
Penta E Reverse CATGGAAAGAATTCTCTTATTTGGGTT
D5S818 Forward GCAAGTATGTGACAAGG
D5S818 Reverse CCACAGTTTACAACATTTGTATC
D7S820 Forward GAGACGGGGTTTCACCATGTTG
D7S820 Reverse TCATTGACAGAATTGCACC
D13S317 Forward CATGGTATCACAGAAGTCT
D13S317 Reverse CCAAAAAGACAGACAGAAAGATAG
D16S539 Forward CAGATGCTCGTTGTGCACA
D16S539 Reverse GCCTACAGAGTGATTCCATTTTTAT
FGA Forward CTGGCATTCATGGAAGGC
FGA Reverse CTTCAGGACTTCAATTCTGCTT
D3S1358 Forward GCAGTCCAATCTGGGTGAC
D3S1358 Reverse CTCATGAAATCAACAGAGGC
TH01 Forward ATTCAAAGGGTATCTGGGCTCTG
TH01 Reverse TGGGCTGAAAAGCTCCCGATTAT
D8S1179 Forward GGCCGGGCAACTTATATGTA
D8S1179 Reverse TTGTGTTCATGAGTATAGTTT
TPOX Forward CACCCAGAACCGTCGACTGGC
TPOX Reverse CCACACAGGTTAATTAAGA
CSF1PO Forward ACTCCAGGGCAGTGTTCCA
CSF1PO Reverse AGCCCATTCTCCAGCCTCC
PentaD Forward AAGTAGGATCACTTGAGCCTG
PentaD Reverse CAAGTCCTTTTTTAGATATGTGA
A/B261 Forward CTGTGGCGCTTCTGATGTCCTCGTGGTGA
A/B261 Reverse CTTGAGGATGTCGATGTTG
O261 Forward AACGATGTCCTCGTGGTAC
O261 Reverse CTTGAGGATGTCGATGTTG
A/O796 Forward GCGTCTACTACCTGGGGGG
A/O796 Reverse TAGCATCTGGTCGACCATCATG
B796 Forward GACTGCAGGGCGATTTCTACTACA
B796 Reverse TAGCATCTGGTCGACCATCATG
Amplified reaction carries out in certain buffer system.Comprise in the buffer system: 50mM KCI, 10mM Tris-HCI (pH8.3at25 ℃), 2.5mM MgCI
2, the dNTP of 1.0mg/ml BSA (bovine serum albumin) and each 200mM.DNTP is four kinds of deoxyribonucleotides molar mixtures such as (dATP, dTTP, dCTP, dGTP).
The program of amplification system below (as ABI9700, ABI2400, Bio-Rad iCycler etc.) on the various reaction thermal cyclers adopt can obtain result preferably: 95 ℃ are incubated 5 minutes; 94 ℃ were incubated for 30 seconds, and 60 ℃ were incubated for 35 seconds, and 70 ℃ were incubated for 50 seconds, " moving 30 circulations "; 60 ℃ are incubated 30 minutes; 4-10 ℃ of insulation.Amplified production should detect as early as possible, if can preserve about 1 week at 4 ℃, can preserve about January at-20 ℃.
Template DNA among the present invention is the human genome DNA.The template DNA that is extracted by various ordinary methods (such as methods such as paramagnetic particle method, phenol chloroform method, resin purifications) [the molecular cloning laboratory manual third edition, cold spring port press] can obtain result preferably.DNA can be by with undertissue or cell preparation: blood, seminal fluid, bone, hair, saliva, sweat contain the amniotic fluid of fetal cell etc.The dna profiling amount can access amplification preferably in the scope of 0.5ng to 4ng, too low some locus that may cause of template amount can not detect, and the too high meeting of template amount causes nonspecific amplified production to produce.
The present invention is owing to adopted fluorescently-labeled primer, amplified production also has fluorescent marker, and marker can send under laser excitation can be by the light of sequenator (as ABI377 DNA sequencer) or genetic analyzer (as ABI3130,3100 genetic analyzer) identification, so amplified production can be by carrying out electrophoresis and check and analysis on the instruments such as sequenator or genetic analyzer.
The present invention can save great amount of cost for detecting, and increases work efficiency.16 str locus seats can be detected in 1 reaction system, abo blood group can be detected simultaneously.Present general detection blood group and the str locus seat of adopting carries out respectively, and employing the present invention can save the cost more than 50%, and operation and reaction times minimizing 50%.
The present invention can provide more genetic marker information in primary first-order equation, obviously improve the accuracy that detects, and has higher individual recognition ability and parentage exclusion probability.
Reaction system of the present invention has higher sensitivity, can detect to be low to moderate 0.05ng DNA most, still can detect whole 15 STR sites and judge sex and blood group under this extremely micro-template situation.Detection to micro-template has very crucial effect aspect medical jurisprudence and the cracking of cases.
The present invention can be used for forensic analysis, paternity identification, monitoring bone marrow transplantation, linkage analysis and fields such as detection of genetic and cancer.The present invention has special advantages in forensic application, especially for cracking of cases, the present DNA database of China is set up not really perfect, and the blood group data are fairly perfect, when carrying out cracking of cases or combining related cases, often need to replenish the DNA data results by the blood group data, use the present invention can inquire about this two kinds of information simultaneously, for cracking of cases provides strong help.
Figure of description
Fig. 1 adopts the analysis collection of illustrative plates that obtains after the DNA amplification of the present invention
Fig. 2 adopts the analysis collection of illustrative plates that obtains after PowerPlex 16 DNA amplification
Embodiment
16 locus of embodiment 1 composite amplification and abo blood group gene are also used the fluoroscopic examination of ABI3130 genetic analyzer
Blood is contributed by the volunteer, verifies as O type blood through serology.Template DNA is by extracting with the chelex100 method in the blood.Amplified reaction carries out on the ABI9700 thermal cycler, detects the ABI3130 genetic analyzer, and GeneMapper v3.2 software is adopted in data analysis.Sample adopts PowerPlex 16 test kits of Promega company to detect simultaneously, and the result in contrast.
1.1. fluorescent dye primer is synthetic
According to the sequence that table 1 provides, chemical process is synthetic, and each has one to use the fluorescence molecule mark to primer.The synthetic fluorescent mark that reaches of primer is finished by the living worker's biotechnology in Shanghai company limited.Behind the synthetic and mark of primer, HPLC method purifying primer, PAGE glue detects purity, has only the band of clauses and subclauses.
1.2.chelex-100 method is extracted DNA (concrete grammar is with reference to Forensic DNA Protocol, Humana Press, 1998)
1) gets 3ul and add the blood of antithrombotics in 500 μ l centrifuge tubes
2) vibration mixing chelex solution fully suspends chelex, every pipe add 195 μ l5% chelex (200-300mesh,
Available from Bio-Rad company), add 5 μ l Proteinase Ks (20mg/ml is available from sky root biochemical technology company limited) again
3) vibration sample, 56 ℃ of temperature were bathed after 2 hours, took out sample vibration 2 minutes,
4) boil 8-10 minute, centrifugal 3 minutes of 13000rpm
5) the careful about 150 μ l supernatants of sucking-off are transferred in the new pipe, and 10 μ lPCR reaction systems are got 1 μ l as template
6) use in a short time, 4 ℃ of preservations, as the needs prolonged preservation, frozen at refrigerator-20 ℃
1.3. polymerase chain reaction (PCR) amplification gene
1) get damping fluid, primer, enzyme, be made into mixed solution according to following table, divide behind the vibration mixing to be filled in the PCR reaction tubes, every pipe 25 μ l add template DNA.
| 25 μ l | |
| Deionized water | |
| 10 * reaction buffer 25 * primer mixture dNTP Taq enzyme | 16.2 2.5 1 2 0.8 |
| Template DNA reaction cumulative volume | 2.5 25 |
2) according to following reaction conditions thermal cycling amplification instrument (PCR instrument) is set, the PCR reaction tubes is put into instrument begin the amplification base
Because of fragment.95 ℃ are incubated 5 minutes; 94 ℃ were incubated for 30 seconds, and 60 ℃ were incubated for 35 seconds, and 70 ℃ were incubated for 50 seconds,
" move 30 circulations "; 60 ℃ are incubated 30 minutes; 4 ℃ continue insulation, until taking out sample.
1.4. after amplified reaction finishes, take out reaction tubes, carry out electrophoresis and detection with the ABI3130 genetic analyzer
1) gets (mark+10 μ l deionized formamides in the 0.5 μ l molecular weight) * (sample number) and be made into mixed solution
2) packing behind the mixing, every pipe 10 μ l add 1 μ l amplified production and allelic ladder more respectively, brief centrifugal with liquid collecting to centrifuge tube pipe bottom
3) 95 ℃ of sex change of sample are 4 minutes, and rapid then cooled on ice 4 minutes makes the complete sex change of DNA and keeps denatured state
4) sample is put into the sample tray of genetic analysis instrument, instrument parameter (sample introduction voltage 3kV, sample injection time 10 seconds) is set, the beginning electrophoresis detection
5) after about 40 minutes, electrophoresis finishes, and obtains collection of illustrative plates and result with GeneMapper software analysis experimental data.See Fig. 1 and table 2, PowerPlex 16 test kit detected results are seen Fig. 2.
| The ABO gene | O | AB | AO | B |
| Signal | + | - | + | - |
This sample blood group is O, and the result is consistent with serology.
Table 2: the gene type result in 15 str locus seats of this sample and sex site
| The str locus seat | Amelogenin | vWA | D21S11 | D18S51 | Penta E |
| Genotype | X， |
16，19 | 29，32.2 | 14，20 | 12，14 5 |
| The str locus seat | D5S818 | D7S820 | D13S317 | | FGA |
| Genotype | |||||
| 11，13 | 11，11 | 11，12 | 10，11 | 24，26 |
| The str locus seat | D3S1358 | TH01 | D8S1179 | TPOX | | PentaD |
| Genotype | ||||||
| 15，16 | 7，9 | 14，15 | 8，9 | 11，11 | 12，12 |
Show from the detected result of Fig. 1 and table 2 and Fig. 2: this sample blood group gene O261 and A/O796 two bands are arranged as seen from Figure 1, so blood group is the O type, the result is consistent with serology.Each STR loci gene type of sample the results are shown in Table 2.In full accord with the somatotype result that PowerPlex 16 test kits obtain with table 2, see Fig. 2.
Claims (10)
1, a kind of blood group gene and short tandem repeat composite amplification checking system is characterized in that this system comprises the primer of abo blood group gene and str locus seat, are reflected at amplification simultaneously in the amplification system by PCR.
2, described blood group gene of claim 1 and short tandem repeat composite amplification checking system, described abo blood group locus is A/0796, B796,0261, A/B261.
3, described blood group gene of claim 2 and short tandem repeat composite amplification checking system, described str locus seat is Amelogenin, vWA, D21S11, D18S51, Penta E, D5S818, D7S820, D13S317, D16S539, FGA, D3S1358, TH01, D8S1179, TPOX, CSF1PO, Penta D.
4, described blood group gene of claim 1 and short tandem repeat composite amplification checking system, described primer is respectively:
1) Amelogenin, forward primer sequence 5 '-3 ' is CCCTGGGCTCTGTAAAGAATAGTG; Amelogenin, reverse primer sequence 5 '-3 ' is ATCAGAGCTTAAACTGGGAAGCTG;
2) vWA, forward primer sequence 5 '-3 ' is that CCCTAGTGGATAAGAATAATC reverse primer sequence 5 '-3 ' is GGACAGATGATAAATACATAG;
3) D21S11, forward primer sequence 5 '-3 ' is CTCAGTCTCCATAAATATGT; Reverse primer sequence 5 '-3 ' is TCTCCAGAGACAGACTAATAGGAGGT;
4) D18S51, forward primer sequence 5 '-3 ' is GAGCCATGTTCATGCCACTG; Reverse primer sequence 5 '-3 ' is TAACAAACCCGACTACCAGC;
5) Penta E, forward primer sequence 5 '-3 ' is CCGATGCAGGTGTATTACCTGAG; Reverse primer sequence 5 '-3 ' is CATGGAAAGAATTCTCTTATTTGGGTT
6) D5S818, forward primer sequence 5 '-3 ' is GCAAGTATGTGACAAGG; Reverse primer sequence 5 '-3 ' is CCACAGTTTACAACATTTGTATC
7) D7S820, forward primer sequence 5 '-3 ' is GAGACGGGGTTTCACCATGTTG; Reverse primer sequence 5 '-3 ' is TCATTGACAGAATTGCACC;
8) D13S317, forward primer sequence 5 '-3 ' is CATGGTATCACAGAAGTCT; Reverse primer sequence 5 '-3 ' is CCAAAAAGACAGACAGAAAGATAG;
9) D16S539, forward primer sequence 5 '-3 ' is CAGATGCTCGTTGTGCACA; Reverse primer sequence 5 '-3 ' is GCCTACAGAGTGATTCCATTTTTAT;
10) FGA, forward primer sequence 5 '-3 ' is CTGGCATTCATGGAAGGC; Reverse primer sequence 5 '-3 ' is CTTCAGGACTTCAATTCTGCTT;
11) D3S1358, forward primer sequence 5 '-3 ' is GCAGTCCAATCTGGGTGAC; Reverse primer sequence 5 '-3 ' is CTCATGAAATCAACAGAGGC;
12) TH01, forward primer sequence 5 '-3 ' is ATTCAAAGGGTATCTGGGCTCTG; Reverse primer sequence 5 '-3 ' is TGGGCTGAAAAGCTCCCGATTAT
13) D8S1179, forward primer sequence 5 '-3 ' is GGCCGGGCAACTTATATGTA; Reverse primer sequence 5 '-3 ' is TTGTGTTCATGAGTATAGTTT;
14) TPOX, forward primer sequence 5 '-3 ' is CACCCAGAACCGTCGACTGGC; Reverse primer sequence 5 '-3 ' is CCACACAGGTTAATTAAGA;
15) CSF1PO, forward primer sequence 5 '-3 ' is ACTCCAGGGCAGTGTTCCA; Reverse primer sequence 5 '-3 ' is AGCCCATTCTCCAGCCTCC
16) Penta D, forward primer sequence 5 '-3 ' is AAGTAGGATCACTTGAGCCTG; Reverse primer sequence 5 '-3 ' is CAAGTCCTTTTTTAGATATGTGA;
17) A/B261, forward primer sequence 5 '-3 ' is CTGTGGCGCTTCTGATGTCCTCGTGGTGA; Reverse primer sequence 5 '-3 ' is CTTGAGGATGTCGATGTTG;
18) 0261, forward primer sequence 5 '-3 ' is AACGATGTCCTCGTGGTAC; Reverse primer sequence 5 '-3 ' is CTTGAGGATGTCGATGTTG;
19) A/0796, forward primer sequence 5 '-3 ' is GCGTCTACTACCTGGGGGG; Reverse primer sequence 5 '-3 ' is TAGCATCTGGTCGACCATCATG;
20) B796, forward primer sequence 5 '-3 ' is GACTGCAGGGCGATTTCTACTACA; Reverse primer sequence 5 '-3 ' is TAGCATCTGGTCGACCATCATG.
5, described blood group gene of claim 4 and short tandem repeat meet the amplification checking system, also include the fluorescent marker that detects primer in the described checking system.
6, described blood group gene of claim 5 and short tandem repeat composite amplification checking system, the fluorescent marker of described detection primer is A/B261,0261, A/0796, B796, Amelogenin, vWA, D21S11, D18S51, the blue markings thing 6-FAM mark that primer adopted in sites such as Penta E.
7, described blood group gene of claim 5 and short tandem repeat composite amplification checking system, the fluorescent marker of described detection primer is D5S818, D7S820, D13S317, D16S539, the Green Marker thing HEX mark that primer adopted in sites such as FGA.
8, described blood group gene of claim 5 and short tandem repeat composite amplification checking system, the fluorescent marker of described detection primer is TH01, TPOX, D8S1179, D3S1358, the yellow marker TMR mark that CSF1PO, Pema D are adopted in the site.
9, described blood group gene of claim 5 and short tandem repeat composite amplification checking system, the buffer system of described PCR reaction is: 50mM KCI, 10mM Tris-HCI, 2.5mM MgCI
2, the dNTP of 1.0mg/ml BSA and each 200mM.
10, described blood group gene of claim 5 and short tandem repeat composite amplification checking system, described PCR reaction conditions is: 95 ℃ are incubated 5 minutes; 94 ℃ were incubated for 30 seconds, and 60 ℃ were incubated for 35 seconds, and 70 ℃ were incubated for 50 seconds, " moving 30 circulations "; 60 ℃ are incubated 30 minutes; 4-10 ℃ of insulation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006101715929A CN100485046C (en) | 2006-12-31 | 2006-12-31 | ABO blood type gene and short tandem repetitive locus composite amplification system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006101715929A CN100485046C (en) | 2006-12-31 | 2006-12-31 | ABO blood type gene and short tandem repetitive locus composite amplification system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101008035A true CN101008035A (en) | 2007-08-01 |
| CN100485046C CN100485046C (en) | 2009-05-06 |
Family
ID=38696695
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006101715929A Active CN100485046C (en) | 2006-12-31 | 2006-12-31 | ABO blood type gene and short tandem repetitive locus composite amplification system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100485046C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011023131A1 (en) * | 2009-08-27 | 2011-03-03 | 基点认知技术(北京)有限公司 | Composite amplification kits of 20 short tandem repeats |
| CN101403007B (en) * | 2008-11-03 | 2011-06-15 | 深圳市血液中心 | Detection agent for ABO blood type gene and shaping method |
| CN102154269A (en) * | 2011-01-06 | 2011-08-17 | 湖南农业大学 | Polymerase chain reaction (PCR)-based quick construction method for tandem repetitive sequence and special primer pair and use |
| CN108517363A (en) * | 2018-03-08 | 2018-09-11 | 深圳华大法医科技有限公司 | A kind of individual identification system, kit and application thereof based on the sequencing of two generations |
-
2006
- 2006-12-31 CN CNB2006101715929A patent/CN100485046C/en active Active
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101403007B (en) * | 2008-11-03 | 2011-06-15 | 深圳市血液中心 | Detection agent for ABO blood type gene and shaping method |
| WO2011023131A1 (en) * | 2009-08-27 | 2011-03-03 | 基点认知技术(北京)有限公司 | Composite amplification kits of 20 short tandem repeats |
| CN102154269A (en) * | 2011-01-06 | 2011-08-17 | 湖南农业大学 | Polymerase chain reaction (PCR)-based quick construction method for tandem repetitive sequence and special primer pair and use |
| CN102154269B (en) * | 2011-01-06 | 2012-05-23 | 湖南农业大学 | Polymerase chain reaction (PCR)-based quick construction method for tandem repetitive sequence and special primer pair and use |
| CN108517363A (en) * | 2018-03-08 | 2018-09-11 | 深圳华大法医科技有限公司 | A kind of individual identification system, kit and application thereof based on the sequencing of two generations |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100485046C (en) | 2009-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101818192B (en) | Compound amplification kit of 20 short tandem repeats | |
| CN109750110B (en) | Composite amplification kit for 47 human autosomal and Y chromosome loci and application thereof | |
| CN109468384B (en) | Composite amplification detection kit for simultaneously detecting 45Y loci | |
| CN110607374A (en) | Fluorescence labeling amplification kit for simultaneously amplifying 27 STR loci of human and application thereof | |
| CN108913757B (en) | Primer group and detection kit for chromosome aneuploid number abnormality and application thereof | |
| CN109880911A (en) | The composite amplification reagent kit of 25 human chromosomal locus and its application | |
| CN109880913B (en) | Composite amplification kit for 38 human Y chromosome loci and application thereof | |
| CN106011229B (en) | The composite amplification systems of 18 STR bit points for people, kit and application thereof | |
| CN109055576B (en) | STR primer group with multiple sites and high individual recognition capability, kit and application | |
| CN113584217B (en) | Method for identifying rhododendron hybrid varieties based on EST-SSR molecular markers | |
| CN111621499B (en) | Complex amplification detection kit for 17 autosomal STR and 28Y chromosome STR loci of human and application thereof | |
| CN100485046C (en) | ABO blood type gene and short tandem repetitive locus composite amplification system | |
| CN106906292A (en) | A kind of 22 STR composite amplification methods and its kit | |
| CN106701988B (en) | Primer, kit and method for detecting short tandem repeat sequence | |
| CN107557475B (en) | Multiplex amplification system and kit for 23 STR loci of human and application thereof | |
| CN113416791B (en) | Specific amplification primer group for simultaneously amplifying 25 STR loci of human, fluorescence labeling amplification kit, application and method | |
| CN108753952A (en) | A kind of gene parting detecting reagent for 10 common mutations sites of mankind SLC25A13 genes | |
| CN112852971A (en) | Primer group and kit for simultaneously amplifying 44 human Y-STR loci and application of primer group and kit | |
| CN110982895B (en) | Primer group and kit for detecting human erythrocyte ABO blood type genotyping and application | |
| CN103789414A (en) | Multiplex amplification kit of 17 short tandem repeats (STR) on X chromosomes | |
| CN112322733A (en) | Nucleic acid composition and kit for detecting EGFR gene mutation and method for detecting EGFR gene mutation | |
| CN112852972A (en) | Primer group and kit for simultaneously amplifying 34 STR loci of human and application of primer group and kit | |
| CN110628920A (en) | Fluorescence labeling multiplex amplification kit for 35 STR loci of human Y chromosome and application thereof | |
| CN103820564A (en) | Multiplex amplification kit for 25 STRs (short tandem repeats) | |
| CN115029450A (en) | Fluorescent multiplex amplification system with 32 short tandem repeat sequences and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| DD01 | Delivery of document by public notice |
Addressee: Peoplespot (Beijing) Co., Ltd. Document name: Notification of Passing Examination on Formalities |
|
| DD01 | Delivery of document by public notice |
Addressee: Peoplespot (Beijing) Co., Ltd. Document name: Notification to Pay the Fees |