CN101008013A - pET15b-PEP-1-SOD1 plasmid and its construction, PEP-1-SOD1 fusion protein and its expression - Google Patents

Abstract

The invention provides pET15b-PEP-1-SOD1 plasmid, PEP-1-SOD1 blend protein construction and expression. It comprises following steps: synthesizing vertical primer added with Xho I and BamH I restriction site at two ends, PCR augmentating with vertical primer with PCR method byb taking pBluescript II SK-SOD1 plasmid as mould; adding A for augmentated SOD 1 c DNA thorugh reaction with dATP, purifying and connecting with pGEM-T Easy vector; double enzyme digesting with Xho I and BamH I for pGEM-T Easy-SOD1 plasmid and pET15b plasmid, recovering SOD1 segment and liner pET15bp- SOD1 and purifying, connecting them under action of T4 DNA connection enzyme and getting pET15b-SOD1 plasmid; double enzyme digesting pET15b-SOD1 with Nde I,Xho I, recovering liner pET15b-SOD1 segment, compositing two oligonucleotide chain with code being PEP-1 into double chain, then double enzyme digesting slaking with Nde I,Xho I, purifying recovered pET15b-SOD1 and getting pET15b-PEP-1-SOD1 plasmid. The expression of fused protein is as follows: tansversing competence E.coli BL21(DE3) with pET15b-PEP-1-SOD1, fermentating in culture medium, ultrasonic breaking bacteria with ice bath, collecting supernatant, purifying fused protein, desalting, sterilizing and packing with Eppendorf pipe and storing at -80 Deg. C.

Description

PET15b-PEP-1-SOD1 plasmid and structure, PEP-1-SOD1 fusion rotein and expression

Technical field

The present invention relates to pET15b-PEP-1-SOD1 plasmid and structure, PEP-1-SOD1 fusion rotein and expression.

Background technology

Superoxide-dismutase (SOD) is a free radical in the scavenger cell, and the protection cell is avoided one of key enzyme of oxidative stress damage.The mammal cell contains 3 kinds of SOD, i.e. SOD1 in the endochylema, the SOD2 in the plastosome and extracellular SOD3.SOD1 is the SOD of high level expression in the cell, is the principal mode of SOD.

Discover that recently some proteinic some zone has the characteristic in the extrinsic protein transfered cell, these zones are called protein transduction domain (Protein Transduction Domain, PTD), as HIV-1 Tat, fruit bat rqikiwfqnrrmkwkk (Antp), HSV VP22 albumen.Choi SY leader's research group has also confirmed Tat-GFP, and Tat-GDH, Tat-SOD, Tat-CAT fusion rotein import in the mammalian cell and skin histology efficiently.The SOD of transduction can increase the survival rate that Paraquat (paraquat, exogenous free radical generating agent) is handled cell effectively, illustrates that Tat-SOD can make cell avoid the damage of oxidative stress.But the protein transduction of Tat-PTD mediation needs fusion rotein to carry out sex change before importing, and fusion rotein is entered in the cell.The Tat fusion rotein of sex change is the target protein refolding natural activated conformation by the HSP90 family member after entering in the cell.Therefore import the refolding efficient that proteic biological activity depends on the HSP90 molecular chaperones.For the albumen that improves transduction enters biological activity behind the cell, need a kind of new transduction peptide of design with target protein with in a kind of natural activated structure formation transfered cell.Morris research group has designed the transduction peptide (KETWWETWWTEWSQPKKKRKV) of a kind of PEP-1 of being called ^[10], when (GFP, β-gal) mix the back add cultured cells, and unmodified target protein with natural radioactivity has been imported in the cell efficiently with PEP-1 peptide and target protein.

Morris research group engages with target protein the PEP-1 peptide and forms mixture with non covalent bond; because the peptide-mediated target protein of PEP-1 enters the efficient of cell and depends on PEP-1 peptide and target protein bonded efficient; also do not occur the peptide-mediated SOD1 of PEP-1 at present and enter cell, the protection cell is avoided the oxidative stress damage.

Summary of the invention

For SOD1 transfered cell inside, protect cell to avoid the oxidative stress damage, pET15b-PEP-1-SOD1 plasmid and structure, PEP-1-SOD1 fusion rotein and expression and purification are proposed.

The pET15b-PEP-1-SOD1 plasmid, employing pET15b is an expression vector, the PEP-1-SOD1 gene is seen the nucleotide sequence in the sequence table 1.

The PEP-1-SOD1 fusion rotein is the aminoacid sequence in the sequence table 2.

The structure of described pET15b-PEP-1-SOD1 plasmid is as follows:

(1), evaluation, recovery and the purifying of PCR reaction and product thereof

With pBluescript II SK-SOD1 plasmid is template, and above downstream primer carries out pcr amplification, amplification condition: 94 ℃ of 5min of initial sex change, carry out following reaction conditions then: 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 45s, 30 circulations, last 72 ℃ are extended 10min.PCR product electrophoresis is identified and the low melting-point agarose gel electrophoresis, reclaims the also SOD1 cDNA fragment of purifying 470bp.

(2), " T " ligation

PCR product S OD1 cDNA behind the purifying puts in the PCR instrument and adds " A " with dATP (2mmol/L) reaction, the purified back of SOD1 cDNA fragment and the ligation of pGEM-T Easy carrier that add " A ", connect product transformed into escherichia coli DH5 α, and be applied on the nutrient agar that contains penbritin (100 μ g/ml) and cultivate 12h, the Lan Bai screening, select white single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, a small amount of plasmid that extracts is identified by Xho I and BamH I double digestion.

(3), the structure of pET15b-SOD1, the enzyme evaluation of cutting and check order

PGEM-T Easy-SOD1 plasmid and pET15b plasmid are used Xho I and BamH I double digestion respectively, reclaim SOD1 fragment and linearizing pET15b fragment, behind row 1.2% low melting-point agarose gel electrophoresis recovery and the purifying, ligation takes place in both under the effect of T4 dna ligase, connect product and transform DH5 α, and be layered on the 12h that grows on the nutrient agar that contains penbritin (100 μ g/ml), select single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, extract and plasmid purification, identify by Xho I and BamH I double digestion.Getting the pET15b-SOD1 recombinant plasmid mails sea base health gene engineering company limited to and checks order.

(4), the structure of pET15b-PEP-1-SOD1

Confirm that through order-checking the successful pET15b-SOD1 of reorganization with Nde I, Xho I double digestion, adopts 1% low melting-point agarose gel electrophoresis to reclaim linearizing pET15b-SOD1 fragment.With two oligonucleotide chains of coding PEP-1 by the method renaturation of boiling for double-stranded, directly be connected with pET15b-SOD1 after Nde I, the digestion of Xho I double digestion, purifying reclaim then.Connect product and transform DH5 α, and be layered on the 12h that grows on the nutrient agar that contains penbritin (100 μ g/ml), select single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, extract plasmid on a small quantity and enzyme is cut evaluation.Because of having the restriction enzyme site of an Xba I on the pET15b plasmid, so recombinant plasmid adopts Xba I and Xho I double digestion rear electrophoresis to identify.The sequence of PEP-1-SOD1 is the nucleotide sequence in the sequence table 1.

PEP-1-SOD1 Expression of Fusion Protein purifying is as follows among the present invention:

(1), PEP-1-SOD1 Expression of Fusion Protein

Respectively with pET15b-SOD1 and pET15b-PEP-1-SOD1 recombinant plasmid transformed E.coli BL21 (DE3), be layered in the TB substratum that contains penbritin (100 μ g/ml) and cultivate 12h, the single bacterium colony of picking contains 37 ℃ of amplification culture in the LB nutrient solution of penbritin (100 μ g/ml) to 100ml.When bacterial growth to OD ₆₀₀Add 0.83MIPTG (isopropyl β-, put 30 ℃ of inducing culture 12h during for 0.5-1.0 D-thiogalactoside) to final concentration 0.83mM/L.4 ℃ of centrifugal 10min of 5000r/min collect thalline, then with PBS washing 3 times.

(2), the purifying of PEP-1-SOD1 fusion rotein

The thalline of collecting is dissolved in 30ml binding buffer liquid (20mM Tris-HCl, pH 7.9 for 5mM imidazole, 500mM NaCl), 400W, 10S, 20S at interval, 4 ℃ of carrying out ultrasonic bacteria breaking 30min.20000r/min in the superspeed refrigerated centrifuge, 4 ℃ of centrifugal 10min are put in the clarification of bacterium liquid completely of broken bacterium.Fusion rotein is present in the supernatant with structure formation natural, solubility, and supernatant is slowly added Ni ²⁺-nitrogen base nitrilotriacetic agarose affinity chromatography post after last sample finishes, leaves standstill 2h, so that make 6 Ni histidine-tagged and chromatography column is interior on the fusion rotein ²⁺In conjunction with.With the binding buffer liquid of 10 times of volumes and rinsing damping fluid (the 60mM imidazole of 6 times of volumes, 500mM NaCl, 20mM Tris-HCl, pH 7.9) cross post respectively, the unconjugated foreign protein of flush away is used elution buffer (1M imidazole, 500mM NaCl then, 20mMTris-HCl, pH 7.9) fusion rotein is eluted.

The present invention is by the fragment of composite coding PEP-1 DNA, construct the pET15b-PEP-1-SOD1 plasmid with genetic engineering means, give expression to the PEP-1-SOD1 fusion rotein, pass through purifying then, thereby express higherly and be purified into the PEP-1-SOD1 fusion rotein that the PEP-1-SOD1 fusion rotein has successfully prepared penetrable cell, for control and oxidative stress damage diseases associated are laid a good foundation.

Description of drawings

Fig. 1 is the structure schema of pET15b-PEP1-SOD1.

Fig. 2 is the electrophorogram of pcr amplification product.

Fig. 3 is Xho I and the BamH I double digestion evaluation figure of pGEM-T Easy-SOD1.

Fig. 4 is the Xho I and the BamH I double digestion evaluation figure of pET15b-SOD1 recombinant plasmid.

Fig. 5 is that the pET15b-PEP1-SOD1 recombinant plasmid is used Xba I and Xho I respectively; Xho I and BamH I double digestion are identified figure.

Fig. 6 is that the protein extract of bacterium and the capable 12%SDS-PAGE of fusion rotein of purifying analyze (A) and Westernbloting analysis (B)

Embodiment

One, the reagent and the material of the present invention's use

1, reagent

Restriction enzyme Xho I, BamH I, Nde I and Xba I are available from match Parkson, Beijing gene engineering company limited, Taq polysaccharase and dNTP and dATP, LigaFast rapid DNA ligation system, (isopropyl β-D-thiogalactoside) available from U.S. Promega company, the pfu archaeal dna polymerase is available from New EnglandBiolabs company for IPTG.200 bp DNA Ladder and 100 bp DNA Ladder are available from the magnificent biotechnology in Beijing company limited.His-probe (G-18) is available from Santa Cruz Biotechnology company; Dye molecular weight of albumen standard (P0066) in advance available from Beyotime Biotechnology company; Western blot detection kit is available from KPL company.

2, bacterial classification, plasmid and primer

PBluescript II SK-SOD1 plasmid by U.S. west how mountain medical college biological chemistry and pharmacology be that doctor Bai Jingxiang is so kind as to give, pGEM-T easy vector system is available from Promega company, pET15b, E.coli BL21 (DE3) is available from Novagen company.Bacillus coli DH 5 alpha is provided by this clinic study.According to accession number among the GeneBank is the people SOD1 cDNA sequence of " AB087266 ", and design 5 ' end is added with the PCR upstream and downstream primer of Xho I and BamH I restriction enzyme site, upstream primer: 5 '-CTCGAGGCGACGAAGGCCGTGTGCGT-3 ' respectively; Downstream primer: 5 '-GGATCCTTATTGGGCGATCCCAATTA-3 ', primer is synthetic by match Parkson, Beijing gene engineering company limited.According to the PEP-1 transduction peptide (KETWWETWWTEWSQPKKKRKV) of Morris research group design, match two oligonucleotide chains of the Parkson composite coding PEP-1 of gene engineering company limited transduction peptide by Beijing: (positive-sense strand) 5 '

-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCTCAGCCGAAAAAAA AACGTAAAGTGC-3 ', 5 ' end is added with the restriction enzyme site of Nde I;

(antisense strand) 5 '

-TCGACCACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTCCACCAGGTTTCCCA CCAGGTTTCTTTCC-3 ', 5 ' end is added with the restriction enzyme site of Xho I.

Two, embodiment

The structure of embodiment 1:pET15b-PEP-1-SOD1 plasmid, as follows in conjunction with structure flow chart description shown in Figure 1:

1.1 evaluation, recovery and the purifying of PCR reaction and product thereof

With pBluescript II SK-SOD1 plasmid is template, and above downstream primer carries out pcr amplification, amplification condition: 94 ℃ of 5min of initial sex change, carry out following reaction conditions then: 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 45s, 30 circulations, last 72 ℃ are extended 10min.PCR product electrophoresis is identified and the low melting-point agarose gel electrophoresis, reclaims the also SOD1 cDNA fragment of purifying 470bp.

" 1.2 T " ligation

PCR product S OD1 cDNA behind the purifying puts in the PCR instrument and adds " A " with dATP (2mmol/L) reaction, the purified back of SOD1 cDNA fragment and the ligation of pGEM-T Easy carrier that add " A ", connect product transformed into escherichia coli DH5 α, and be applied on the nutrient agar that contains penbritin (100 μ g/ml) and cultivate 12h, the Lan Bai screening, select white single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, a small amount of plasmid that extracts is identified by Xho I and BamH I double digestion.

The evaluation 1.3 the structure of pET15b-SOD1, enzyme are cut and checked order

PGEM-T Easy-SOD1 plasmid and pET15b plasmid are used Xho I and BamH I double digestion respectively, reclaim SOD1 fragment and linearizing pET15b fragment, behind row 1.2% low melting-point agarose gel electrophoresis recovery and the purifying, ligation takes place in both under the effect of T4 dna ligase, connect product and transform DH5 α, and be layered on the 12h that grows on the nutrient agar that contains penbritin (100 μ g/ml), select single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, extract and plasmid purification, identify by XhoI and BamH I double digestion.Getting the pET15b-SOD1 recombinant plasmid mails sea base health gene engineering company limited to and checks order.

1.4 the structure of pET15b-PEP-1-SOD1

Confirm that through order-checking the successful pET15b-SOD1 of reorganization with Nde I, Xho I double digestion, adopts 1% low melting-point agarose gel electrophoresis to reclaim linearizing pET15b-SOD1 fragment.With two oligonucleotide chains of coding PEP-1 by the method renaturation of boiling for double-stranded, directly be connected with pET15b-SOD1 after Nde I, the digestion of Xho I double digestion, purifying reclaim then.Connect product and transform DH5 α, and be layered on the 12h that grows on the nutrient agar that contains penbritin (100 μ g/ml), select single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, extract plasmid on a small quantity and enzyme is cut evaluation.Because of having the restriction enzyme site of an Xba I on the pET15b plasmid, so recombinant plasmid adopts XbaI and Xho I double digestion rear electrophoresis to identify.Get the pET15b-PEP-1-SOD1 recombinant plasmid and mail sea base health gene engineering company limited to and check order, the sequence of PEP-1-SOD1 is the nucleotide sequence in the sequence table 1.

Embodiment 2:PEP-1-CAT Expression of Fusion Protein purification process

(1), PEP-1-SOD1 Expression of Fusion Protein

Respectively with pET15b-SOD1 and pET15b-PEP-1-SOD1 recombinant plasmid transformed E.coli BL21 (DE3), be layered in the TB substratum that contains penbritin (100 μ g/ml) and cultivate 12h, the single bacterium colony of picking contains 37 ℃ of amplification culture in the LB nutrient solution of penbritin (100 μ g/ml) to 100ml.When bacterial growth to OD ₆₀₀Add 0.83MIPTG (isopropyl β-, put 30 ℃ of inducing culture 12h during for 0.5-1.0 D-thiogalactoside) to final concentration 0.83mM/L.4 ℃ of centrifugal 10min of 5000r/min collect thalline, then with PBS washing 3 times.

(2) purifying of PEP-1-SOD1 fusion rotein

The thalline of collecting is dissolved in 30ml binding buffer liquid (20mM Tris-HCl, pH 7.9 for 5mM imidazole, 500mM NaCl), 400W, 10S, 20S at interval, 4 ℃ of carrying out ultrasonic bacteria breaking 30min.20000r/min in the superspeed refrigerated centrifuge, 4 ℃ of centrifugal 10min are put in the clarification of bacterium liquid completely of broken bacterium.Fusion rotein is present in the supernatant with structure formation natural, solubility, and supernatant is slowly added Ni ²⁺-nitrogen base nitrilotriacetic agarose affinity chromatography post after last sample finishes, leaves standstill 2h, so that make 6 Ni histidine-tagged and chromatography column is interior on the fusion rotein ²⁺In conjunction with.With the binding buffer liquid of 10 times of volumes and rinsing damping fluid (the 60mM imidazole of 6 times of volumes, 500mM NaCl, 20HM Tris-HCl, pH 7.9) cross post respectively, the unconjugated foreign protein of flush away is used elution buffer (1M imidazole, 500mM NaCl then, 20mMTris-HCl, pH 7.9) fusion rotein is eluted.

(3), capable 12%SDS-PAGE of fusion rotein and Western bloting identify

Collect the capable 12%SDS-PAGE of elutriant of wash-out peak value, the double point sample, the left side gel is dyeed in coomassie brilliant blue R250 liquid, right side gel 100mA changes film 2h, after taking out film, add rabbit anti-poly Histidine antibody (1: 1000) overnight incubation under room temperature, add under goat anti-rabbit antibodies (1: the 1000) room temperature and hatch 2h, then with TMB MembranePeroxidase Substrate colour developing.In the elutriant that contains the purpose fusion rotein, add 10% glycerine, during mixing is packed dialysis tubing into together, insert 4 ℃ of dialysis desalting 24h among the PBS that contains 10% glycerine.With the albumen after the disposable filter filtration dialysis of diameter 0.22 μ m.(1mg/ml) does contrast with bovine serum albumin, adopts the Bradford method ^[11]Measure the concentration of SOD1 and PEP-1-SOD1 fusion rotein.Then SOD1 and PEP-1-SOD1 fusion rotein are sub-packed in the eppendorf pipe of 1.5ml, put-80 ℃ of preservations with standby.

Three, result

3.1 PCR product

With pBluescript II SK-SOD1 plasmid is masterplate, and after the amplification of SOD1 upstream and downstream primer PCR, as seen the gel electrophoresis of the capable 1.2% plain agar sugar of PCR product amplifies the specific SOD1 fragment of 470bp.See shown in Figure 2,

Marker：200?bp?DNA?Ladder；1：PCR?product(470bp)

Fig.2?PCR?amplification?of?the?full?length?coding?region?of?SOD1?frompBluescript?II?SK-SOD1?plasmid

3.2 pcr amplification product is connected with pGEM-T Easy vector's

Connect product and identify that through Xho I and BamH I double digestion positive colony contains two bands of about 3015bp of length and 470bp, positive colony called after pGEM-T Easy-SOD1.See shown in Figure 3,

Marker：200?bp?DNA?Ladder；1：pGEM-T?Easy-SOD1/Xho?I+BamH?I(470bp，3015bp)

Fig.3?Identification?of?pGEM-T?Easy-SOD1?digested?with?Xho?I?and?BamH?I

3.3, the pET15b-SOD1 construction of recombinant plasmid

The recombinant plasmid that makes up identifies that through Xho I and BamH I double digestion positive colony contains two bands of about 5700bp of length and 470bp, positive colony called after pET15b-SOD1.See shown in Figure 4,

1：pET15b/Xho?I+BamH?I(5700bp)；2：pGEM-T?Easy-SOD1/Xho?I+BamH?I(470bp，3015bp)；

3：pET15b-SOD1/Xho?I+BamH?I(470bp，5700bp)；Marker：200?bp?DNA?Ladder

Fig.4?Identification?of?pET15b-SOD1?digested?with?Xho?I?and?BamH?I

3.4, the structure of pET15b-PEP1-SOD1

The pET15b-PEP1-SOD1 recombinant plasmid that makes up identifies that through Xba I and Xho I double digestion positive colony contains two bands of about 6069bp of length and 167bp, illustrates that the PEP1 encoding sequence successfully is inserted into the Nde I-Xho I site of pET15b-SOD1; Identify that through Xho I and BamH I double digestion positive colony contains two bands of about 5766bp of length and 470bp, positive colony called after pET15b-PEP1-SOD1.See shown in Figure 5,

Marker：100?bp?DNA?Ladder；1：pET15b-PEP1-SOD1/Xba?I+Xho?I(167bp，6069bp)；

2：pET15b-PEP1-SOD1/Xho?I+BamH?I(470bp，5766bp)

Fig.6?Identification?of?pET15b-PEP1-SOD1digested?with?Xba?I+Xho?I?and?Xho?I+BamH

3.5, the capable 12%SDS-PAGE of fusion rotein and the Western bloting Analysis and Identification of expression, purifying

PET15b-SOD1 and pET15b-PEP-1-SOD1 recombinant plasmid be Transformed E .coli BL21 (DE3) respectively, induce down at IPTG, can be stable and express SOD1 and PEP-1-SOD1 fusion rotein efficiently respectively, row 12%SDS-PAGE and Western-bloting result show, at 22KD and 26KD SOD1 and PEP1-SOD1 objective expression band appear respectively, and two kinds of expressing proteins exist with form natural, solubility, and the purpose fusion rotein of expression accounts for 30% of total bacterial protein.(1mg/ml) does contrast with bovine serum albumin, and the output that adopts the Bradford method to record SOD1 and PEP-1-SOD1 fusion rotein is respectively 15.54mg/100ml and 20.72mg/100ml bacterium liquid.See shown in Figure 6,

The capable 12%SDS-PAGE of the protein extract of bacterium and the fusion rotein of purifying analyzes (A) and Western bloting analyzes (B), with the anti-poly Histidine of rabbit antibody.A figure: M: standard molecular weight albumen; 1: the pSOD1 before the purifying; 2: the pSOD1 behind the purifying; 3: the pPEP-1-SOD1 before the purifying; 4: the pPEP-1-SOD1 behind the purifying.B figure: M: standard molecular weight albumen; 1: the pSOD1 behind the purifying; 2: the pPEP-1-SOD1 behind the purifying.

Four, analyze discussion

People wish to use SOD1 and prevent and treat various oxidative stress damages for a long time, but SOD1 is a biomacromolecule, does not have special acceptor and passage in vivo, can not rely on endocytosis etc. to go into born of the same parents' mode and enter in the cell.How the SOD1 molecule is transformed,, had important and practical meanings so that make it enter performance effect in the cell.A kind of transduction peptide (KETWWETWWTEWSQPKKKRKV) that is called PEP-1 of Morris research group design ^[10], form by 21 amino-acid residues, be divided into three parts: be rich in the hydrophobic region (KETWWETWWTEW) of tryptophane, joining region (SQP) and be rich in the hydrophilic area (KKKRKV) of Methionin.People such as Morris find ^[10]PEP-1 transduction peptide has the incomparable advantage of HIV Tat-PTD, and at first, PEP-1 transduction peptide can be transduceed target protein in the cell with a kind of natural activated structure formation, does not need to depend on the refolding efficient of HSP90 molecular chaperones; Secondly, the PEP-1 fusion rotein has higher stability, security than Tat fusion rotein, and it is not subjected to influence of serum.

The TA clone is adopted in this research ^[12]Method, successfully made up prokaryotic expression plasmid pET15b-SOD1 and pET15b-PEP-1-SOD1.The structure of pET15b-SOD1 is for pET15b-PEP-1-SOD1 provides contrast, thereby for estimating later the transduction efficiency of PEP1 transduction peptide objectively.At first, we have designed the primer that comprises second initiator codon and end a pair of SOD1 of codon, and the encoding sequence that has synthesized PEP-1 transduction peptide, purpose is to make the pET15b-SOD1 that recombinates out to give expression to respectively and 6 histidine-tagged SOD1 that merge mutually with pET15b-PEP-1-SOD1, utilize 6 histidine residues of N end to carry out Ni2+ column chromatography and detection, thereby simplified this proteic separation and purifying process His-tag-SOD1 and the His-tag-PEP1-SOD1 that genetic engineering bacterium is expressed.In addition, in order to prevent that amplified production from the base mistake occurring and mixing, the pfu archaeal dna polymerase of high-fidelity is adopted in this research, and then with product purification, utilizes the Taq enzyme in its 3 ' terminal adding single unpaired " A ", so that carry out the TA clone.The result can be inserted into pGEM-T easy vector after showing that pcr amplification product 3 ' end adds " A " at an easy rate.With pET15b-SOD1 and pET15b-PEP-1-SOD1 recombinant plasmid Transformed E .coli BL21 (DE3) respectively, induce down at IPTG, can stablize and express SOD1 and PEP-1-SOD1 fusion rotein efficiently respectively.Row 12%SDS-PAGE and Western-bloting result show, at 22KD and 26KD SOD1 and PEP1-SOD1 objective expression band appear respectively, and two kinds of expressing proteins exist with form natural, solubility, and the fusion rotein of expression accounts for 30% of bacterial protein.With bovine serum albumin contrast in vain, the output that adopts the Bradford method to record SOD1 and PEP-1-SOD1 fusion rotein is respectively 15.54mg/100ml and 20.72mg/100ml bacterium liquid.

This research has successfully made up prokaryotic expression plasmid pET15b-SOD1 and pET15b-PEP-1-SOD1, and higher express and be purified into SOD1 and PEP-1-SOD1 fusion rotein, for the anti-oxidant activity that this proteic industrialized development and next step research PEP-1 mediation SOD1 penetrate mammalian cell and bring into play SOD1 has been established experiment basis.

Sequence table

＜110〉Wang Jianing

＜120〉pET15b-PEP-1-SOD1 plasmid and PEP-1-SOD1 fusion rotein

<160>2

<210>1

<211>531

<212>DNA

＜213〉mankind

<220>

<221>

<222>(1)...(531)

<223>

<400>1

aaa?gaa?acc?tgg?tgg?gaa?acc?tgg?tgg?acc?gaa?tgg?tct?cag 42

Lys?Glu?Thr?Trp?Trp?Glu?Thr?Trp?Trp?Thr?Glu?Trp?Ser?Gln

1 5 10

ccg?aaa?aaa?aaa?cgt?aaa?gtg?ctc?gag?gcg?acg?aag?gcc?gtg 84

Pro?Lys?Lys?Lys?Arg?Lys?Val?Leu?Glu?Ala?Thr?Lys?Ala?Val

15 20 25

tgc?gta?ctg?aag?ggc?gat?ggc?cca?gtg?cag?ggc?atc?atc?aat 126

Cys?Val?Leu?Lys?Gly?Asp?Gly?Pro?Val?Gln?Gly?Ile?Ile?Asn

30 35 40

ttc?gag?cag?aag?gaa?agt?aat?gga?cca?gtg?aag?gtg?tgg?gga 168

Phe?Glu?Gln?Lys?Glu?Ser?Asn?Gly?Pro?Val?Lys?Val?Trp?Gly

45 50 55

agc?att?aaa?gga?ctg?act?gaa?ggc?ctg?cat?gga?ttc?cat?gtt 210

Ser?Ile?Lys?Gly?Leu?Thr?Glu?Gly?Leu?His?Gly?Phe?His?Val

60 65 70

cat?gag?ttt?gga?gat?aat?aca?gca?ggc?tgt?acc?agt?gca?ggt 252

His?Glu?Phe?Gly?Asp?Asn?Thr?Ala?Gly?Cys?Thr?Ser?Ala?Gly

75 80

cct?cac?ttt?aat?cct?cta?tcc?aga?aaa?cac?ggt?ggg?cca?aag 294

Pro?His?Phe?Asn?Pro?Leu?Ser?Arg?Lys?His?Gly?Gly?Pro?Lys

85 90 95

gat?gaa?gag?agg?cat?gtt?gga?gac?ttg?ggc?aat?gtg?act?gct 336

Asp?Glu?Glu?Arg?His?Val?Gly?Asp?Leu?Gly?Asn?Val?Thr?Ala

100 105 110

gac?aaa?gat?ggt?gtg?gcc?gat?gtg?tct?att?gaa?gat?tct?gtg 378

Asp?Lys?Asp?Gly?Val?Ala?Asp?Val?Ser?Ile?Glu?Asp?Ser?Val

115 120 125

atc?tca?ctc?tca?gga?gac?cat?tgc?atc?att?ggc?cgc?aca?ctg 420

Ile?Ser?Leu?Ser?Gly?Asp?His?Cys?Ile?Ile?Gly?Arg?Thr?Leu

130 135 140

gtg?gtc?cat?gaa?aaa?gca?gat?gac?ttg?ggc?aaa?ggt?gga?aat 462

Val?Val?His?Glu?Lys?Ala?Asp?Asp?Leu?Gly?Lys?Gly?Gly?Asn

145 150

gaa?gaa?agt?aca?aag?aca?gga?aac?gct?gga?agt?cgt?ttg?gct 504

Glu?Glu?Ser?Thr?Lys?Thr?Gly?Asn?Ala?Gly?Ser?Arg?Leu?Ala

155 160 165

tgt?ggt?gta?att?ggg?atc?gcc?caa?taa 531

Cys?Gly?Val?Ile?Gly?Ile?Ala?Gln

170 175

<210>

<211>176

<212>PRT

＜213〉mankind

<400>2

Lys?Glu?Thr?Trp?Trp?Glu?Thr?Trp?Trp?Thr?Glu?Trp?Ser?Gln

1 5 10

Pro?Lys?Lys?Lys?Arg?Lys?Val?Leu?Glu?Ala?Thr?Lys?Ala?Val

15 20 25

Cys?Val?Leu?Lys?Gly?Asp?Gly?Pro?Val?Gln?Gly?Ile?Ile?Asn

30 35 40

Phe?Glu?Gln?Lys?Glu?Ser?Asn?Gly?Pro?Val?Lys?Val?Trp?Gly

45 50 55

Ser?Ile?Lys?Gly?Leu?Thr?Glu?Gly?Leu?His?Gly?Phe?His?Val

60 65 70

His?Glu?Phe?Gly?Asp?Asn?Thr?Ala?Gly?Cys?Thr?Ser?Ala?Gly

75 80

Pro?His?Phe?Asn?Pro?Leu?Ser?Arg?Lys?His?Gly?Gly?Pro?Lys

85 90 95

Asp?Glu?Glu?Arg?His?Val?Gly?Asp?Leu?Gly?Asn?Val?Thr?Ala

100 105 110

Asp?Lys?Asp?Gly?Val?Ala?Asp?Val?Ser?Ile?Glu?Asp?Ser?Val

115 120 125

Ile?Ser?Leu?Ser?Gly?Asp?His?Cys?Ile?Ile?Gly?Arg?Thr?Leu

130 135 140

Val?Val?His?Glu?Lys?Ala?Asp?Asp?Leu?Gly?Lys?Gly?Gly?Asn

145 150

Glu?Glu?Ser?Thr?Lys?Thr?Gly?Asn?Ala?Gly?Ser?Arg?Leu?Ala

155 160 165

Cys?Gly?Val?Ile?Gly?Ile?Ala?Gln

170 175

Claims (4)

1, pET15b-PEP-1-SOD1 plasmid, employing pET15b is an expression vector, the PEP-1-SOD1 gene is seen the nucleotide sequence in the sequence table 1.

2, PEP-1-SOD1 fusion rotein is the aminoacid sequence in the sequence table 2.

3, the structure of pET15b-PEP-1-SOD1 plasmid is as follows:

(1), evaluation, recovery and the purifying of PCR reaction and product thereof

With pBluescript II SK-SOD1 plasmid is template, and above downstream primer carries out pcr amplification, amplification condition: 94 ℃ of 5min of initial sex change, carry out following reaction conditions then: 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 45s, 30 circulations, last 72 ℃ are extended 10min.PCR product electrophoresis is identified and the low melting-point agarose gel electrophoresis, reclaims the also SOD1 cDNA fragment of purifying 470bp;

(2), " T " ligation

PCR product S OD1 cDNA behind the purifying puts in the PCR instrument and adds " A " with dATP (2mmol/L) reaction, the purified back of SOD1 cDNA fragment and the ligation of pGEM-T Easy carrier that add " A ", connect product transformed into escherichia coli DH5 α, and be applied on the nutrient agar that contains penbritin (100 μ g/ml) and cultivate 12h, the Lan Bai screening, select white single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, a small amount of plasmid that extracts is identified by Xho I and BamH I double digestion;

(3), the structure of pET15b-SOD1, the enzyme evaluation of cutting and check order

PGEM-T Easy-SOD1 plasmid and pET15b plasmid are used Xho I and BamH I double digestion respectively, reclaim SOD1 fragment and linearizing pET15b fragment, behind row 1.2% low melting-point agarose gel electrophoresis recovery and the purifying, ligation takes place in both under the effect of T4 dna ligase, connect product and transform DH5 α, and be layered on the 12h that grows on the nutrient agar that contains penbritin (100 μ g/ml), select single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, extract and plasmid purification, identify by Xho I and BamH I double digestion;

(4), the structure of pET15b-PEP-1-SOD1

Confirm that through order-checking the successful pET15b-SOD1 of reorganization with Nde I, Xho I double digestion, adopts 1% low melting-point agarose gel electrophoresis to reclaim linearizing pET15b-SOD1 fragment.With two oligonucleotide chains of coding PEP-1 by the method renaturation of boiling for double-stranded, directly be connected with pET15b-SOD1 after Nde I, the digestion of Xho I double digestion, purifying reclaim then.Connect product and transform DH5 α, and be layered on the 12h that grows on the nutrient agar that contains penbritin (100 μ g/ml), select single colony inoculation and in the TB substratum that contains penbritin (100 μ g/ml), cultivate 12h, extract plasmid on a small quantity and enzyme is cut evaluation.

4, PEP-1-SOD1 Expression of Fusion Protein purifying is as follows:

(1), PEP-1-SOD1 Expression of Fusion Protein

Respectively with pET15b-SOD1 and pET15b-PEP-1-SOD1 recombinant plasmid transformed E.coli BL21 (DE3), be layered in the TB substratum that contains penbritin (100 μ g/ml) and cultivate 12h, the single bacterium colony of picking contains 37 ℃ of amplification culture in the LB nutrient solution of penbritin (100 μ g/ml) to 100ml.When bacterial growth adds 0.83M IPTG (isopropy1 β-D-thiogalactoside) to final concentration 0.83mM/L, put 30 ℃ of inducing culture 12h during for 0.5-1.0 to OD600.4 ℃ of centrifugal 10min of 5000r/min collect thalline, then with PBS washing 3 times;

(2), the purifying of PEP-1-SOD1 fusion rotein

The thalline of collecting is dissolved in 30ml binding buffer liquid (20mM Tris-HCl, pH 7.9 for 5mM imidazole, 500mM NaCl), 400W, 10S, 20S at interval, 4 ℃ of carrying out ultrasonic bacteria breaking 30min.20000r/min in the superspeed refrigerated centrifuge, 4 ℃ of centrifugal 10min are put in the clarification of bacterium liquid completely of broken bacterium.Fusion rotein is present in the supernatant with structure formation natural, solubility, supernatant is slowly added Ni2+-nitrogen base nitrilotriacetic agarose affinity chromatography post, after last sample finishes, leave standstill 2h, so that 6 Ni2+ histidine-tagged and in the chromatography column on the fusion rotein are combined.With the binding buffer liquid of 10 times of volumes and rinsing damping fluid (the 60mM imidazole of 6 times of volumes, 500mM NaCl, 20mM Tris-HCl, pH 7.9) cross post respectively, the unconjugated foreign protein of flush away is used elution buffer (1M imidazole, 500mM NaCl then, 20mMTris-HCl, pH 7.9) fusion rotein is eluted.

Images