CN100591766C - Antiglyphosate gene and its use - Google Patents

Abstract

A roundup-resisting gene, its related protein polypeptide, protein, plasmid and plant cell and their uses are disclosed. The nucleotide sequence of the gene is SEQ ID NO:1 or SEQ ID NO:3. It has better roundup resistance and can remove weed selectively. It can be used to breed and culture plant cell.

Description

Antiglyphosate gene and application thereof

Technical field

The invention belongs to plant genetic engineering field, specifically, the present invention relates to the protein of a kind of Antiglyphosate gene and this genes encoding.This gene can be used for expressing in plant and make the resistance capacity of plant acquisition to glyphosate, thereby can utilize optionally management of weeds of glyphosate.The present invention also can be used in the breeding of crop, the screening of culture plant cell.

Background technology

Glyphosate is a kind of very important herbicide.It suppresses a kind of important enzyme in the die aromatischen Aminosaeuren biosynthesizing, i.e. 5-enol acetone shikimic acid-3-phosphate synthase (EPSPS) in the plant.Glyphosate is a kind of herbicide of utmost point wide spectrum, and farm crop are possessed lethality too.Therefore in order optionally to kill grass when the crop growth, farm crop need obtain to have the ability of resistance glyphosate.

Glyphosate also can suppress the 5-enol acetone shikimic acid-3-phosphate synthase (EPSPS) in the biosynthesizing of die aromatischen Aminosaeuren in most of bacterium.But the EPSPS of part bacterium has found that glyphosate is had resistance, and separated acquisition.Plant can obtain the ability of resistance glyphosate by the resistance EPSPS of transgene expression bacterium.The resistance of expressing in the EPSPS of Agrobacterium CP4 and Salmonella typhimurium CT7 and the plant and obtaining is quoted (United States Patent (USP) 453590,4769061,5094945) aborning.But, still need new Antiglyphosate gene and anti-glyphosate plants based on this in the production application for the diversity of resistant gene.Yet whether the EPSPS of a kind of bacterium the height of resistance glyphosate and resistance, be can not be by EPSPS the aminoacid sequence prediction.

Summary of the invention

At the deficiencies in the prior art part, the invention provides a kind of gene, this gene has very high resistance glyphosate ability, can be used for producing anti-glyphosate plants, also can be used as microorganism and the vegetable cell selection markers in cultivating.

The present invention is to realize by such technical scheme for reaching above purpose: a kind of Antiglyphosate gene is provided, and the nucleotides sequence of this gene is classified SEQ ID NO:1 or SEQ ID NO:3 as.

The present invention also provides a kind of protein and peptide: the aminoacid sequence of this protein and peptide is that SEQ IDNO:2 or compare with SEQ ID NO:2 has the protein that is not less than 80% homogeny.It can improve the resistance glyphosate ability of cell in cell.

The present invention also provides a kind of protein, and it comprises two protein and peptide zones, and the aminoacid sequence in one of them protein and peptide zone is SEQ ID NO:2 or compares to have with SEQ ID NO:2 and be not less than 80% homogeny.It can improve the resistance glyphosate ability of cell in cell.

The present invention also provides the nucleotide sequence molecule of the above-mentioned protein and peptide of encoding.

The present invention also provides a kind of plasmid: comprise above-mentioned nucleotide sequence molecule, and functionally be connected with the nucleotide sequence that control is expressed.

The present invention also provides a kind of and has utilized above-mentioned nucleotide sequence molecule to express in cell and obtain the method for marking protein.

The present invention also provides a kind of vegetable cell that comprises above-mentioned nucleotide sequence molecule.

The present invention also provides a kind of method that plant is transformed: comprise and utilize above-mentioned vegetable cell, more corresponding transfer-gen plant is cultivated in its differentiation.The plant that is obtained has the resistance glyphosate ability.Plant can be selected for use and be paddy rice, corn, cotton, wheat, soybean, turfgrass or herbage.

The present invention also provides and has utilized above-mentioned nucleotide sequence molecule, makes selection markers in the plant transgene cell cultures.

Have 80% or the protein of above sequence homogeny according to a kind of protein provided by the present invention (GT-1) and with it, by existing plant transgenic technology; Can make coding these proteinic gene transfered plant or plant tissues plant or plant tissue express this protein, thereby obtain the ability of resistance glyphosate.

The protein that the aminoacid sequence homogeny is quite high generally has identical functions, therefore with aminoacid sequence shown in the SEQ IDNO:2 have 80% or the gene of above homogeny all may resistance be arranged to glyphosate.Amino acid whose homogeny can obtain by existing method, for example Karlin and Altschul, 1990, Porc.Natl.Acad.Sci.USA 87:3364; Karlin and Altschul (1993) Proc.Natl.Acad.Sci.USA 90:5873-5877.).Need to prove that especially homogeny is based on the comparison of homology part, and do not comprise the not homologous part in the artificial or natural fusion gene.

Utilize the GT-1 nucleotide sequence, can obtain to have the homologous gene of identical function.A kind of method is to utilize GT-1 nucleic acid to obtain homologous gene for probe hybridization DNA library, and another kind of method is to obtain by PCR according to Gt-1 nucleotide sequence design primer.Moreover, by nucleotide sequence and the protein sequence that the present invention finds, can from genomic library, find out the gene of high homology by the method for molecular information.BLAST (www.ncbi.nih.gov) can find all homologous genes in gene pool.These genes can be used for producing anti-glyphosate plants or plant tissue too.

GT-1 also can be used for manually introducing one or more variations and obtain to maintain the GT-1 metagon of resistance glyphosate ability.For example utilize the method for Lo-Fi PCR can produce a lot of GT-1 metagons, and these metagons can obtain to continue to maintain the GT-l metagon of resistance glyphosate ability by the glyphosate screening.

Utilize the protein sequence of genes encoding of the present invention, can design the nucleotide sequence that help in plant express codon optimized with synthetic.The report of Campbell and Gowri (1990) (Plant Physiol.92:1-11) for example.And this nucleotide sequence can further make up and comprises the Plant Transformation plasmid of expressing member.Express member and comprise promotor, have the Antiglyphosate gene and the terminator of chloroplast(id) signal peptide.Promotor can be a corn Ubiqutin promotor when transforming monocots, perhaps paddy rice Actin promotor, perhaps other promotors.And terminator can be agrobacterium tumefaciens terminator or other terminators.The GT-1 gene of resistance glyphosate is at the dna fragmentation of a coded signal peptide of expressing in frame is read in same expression of 5 ' end connection, and this signal peptide can guide GT-1 protein to enter chloroplast(id).This signal peptide can be the signal peptide (de Castro Silva Filho 1996 Plant Mol.Biol.30:767-780) of the subunit of Rubisco, perhaps plant EPSPS signal peptide (Archer 1990 J.Bioenerg.Biomemb.22 (b): 789-810).This expresses member can change in the genome that is incorporated into plant genetic stability and expression over to by Agrobacterium (as Agrobacterium bacterial strain LAB4404).

Another aspect of the present invention is the screening sign that GT-1 is used as plant transgene.By known molecule clone technology GT-1 is expressed in vegetable cell, make up an expression member of in plant, expressing usually.This expresses GT-1 and terminator that member comprises promotor, has the chloroplast(id) signal peptide.This expression member can be used as the screening sign and is cloned into the Plant Transformation plasmid.The Plant Transformation plasmid also contains goal gene and other dna sequence dnas usually.The Plant Transformation plasmid can import plant tissue by particle gun or Agrobacterium method, the glyphosate substratum that contains suitable concn then can optionally kill the vegetable cell that does not import plasmid DNA, thereby selects to contain the vegetable cell of GT-1 and goal gene.

Further, the present invention can be used for developing the transgenosis anti-glyphosate plants.The Plant Transformation plasmid that contains GT-1 expression member can obtain the resistance glyphosate transfer-gen plant.Each kind of plant of the method for Plant Transformation and step is different, and the different kind of kindred plant also may be different.But the technology of Plant Transformation and method are known and sophisticated.Usually import immature embryo, mature embryo, undifferentiated callus or the protoplastis of plant by Agrobacterium or particle gun.Glyphosate substratum with 1～5mM carries out screening and culturing then.Break up again and obtain to transform bud, cultivate through root media and just can obtain the seedling that to plant.Further, glyphosate can spray transforming seedling and offspring thereof screening and remove unconverted plant and separate the plant that loses the GT-1 gene with the offspring.

The present invention is applicable to all plants, comprises dicotyledonous and monocotyledons.

Embodiment

The screening of embodiment 1, resistance glyphosate bacterial isolates

M 63 culture medium culturing that glyphosate contaminated soil sample is containing the 50mM glyphosate.Because M63 does not contain die aromatischen Aminosaeuren, the bacterium of survival and growth is the resistance bacterium.The prescription of substratum is as follows: (every liter of M63:13.6g KH.sub.2PO.sub.4,2g (NH.sub.4) .sub.2SO.sub.4,0.5mgFeSO.sub.4-7H.sub.2O, 2.4mg MgCl.sub.2,10g glucose, 10mg Thiamine-HCl and 25mg L-Proline).Wherein a kind of bacterial strain, called after G3 is selected, and it can contain the M63 substratum growth of 200mM glyphosate.

The evaluation of embodiment 2, resistant strain

Obtained part 16sRNA sequence by PCR.The primer of PCR is the universal primer of 16s bacteria RNA.The PCR product checks order after being cloned into the pMD18-T plasmid.Found that it and Burkholderia caryophylli, Pseudomonas sp. ' FSL R1-057 ' (AF205137), bacteriumSV70AB2-1 (AY770429), Pseudomonas putida (AB180734) (AM184283); All have with Pseudomonas rhizosphaerae (AY866408)～99% homogeny.Therefore this bacterial strain is a kind of false pseudomonas bacillus (Pseudomonas sp G3).

The clone of embodiment 3, EPSPS gene

Finished the gene order data of gene order-checking according to gene pool Pseudomonas, designed one group of degenerate primer (PsR:5 ' gacatsgcgatrcgrtgrtg; PsFa; 5 ' gasctgcgsgtcaaggarwsyga).The product that obtains through PCR is cloned and order-checking with pMD18-T.Found that it is similar to the EPSPS that Pseudomonas putida etc. has finished gene order-checking.Further designed the pulsating PCR primer of amplification total length EPSPS (PsN:5 ' tggcccgccgggcctatgtggacgctatgaac, PsC:5 ' tgaccggtgcttgcgaactcacgact) according to genes involved group sequencing result.The full segment that PCR amplifies is cloned among the pMD18-T, and through ABI 3700 order-checkings.The nucleotides sequence of this gene is classified SEQ ID NO:1 as, is named as Gt-1.

Embodiment 4, the expression of Gt-1 gene in intestinal bacteria

1, causes the efficient resistance of intestinal bacteria to glyphosate.

The Gt-1 gene is cloned in and obtains clone g6 among the carrier pMD18-T.The LacZ of reading frame and the pMD18-T of clone g6 reads that frame connects and is consistent, and Gt-1 can be under the control of LacZ promotor and operon and the acquisition expression like this.

Clone g6 and pMD 18-T (empty carrier, contrast) in LB, cultivates, when OD600 reaches 0.6, get 0.2ml centrifugal 1 minute at 5000rpm, abandon supernatant, sedimentary cell is centrifugal again after cleaning through the M63 nutrient solution, then sedimentary cell is diluted to 0.02 (OD600) with the M63 nutrient solution that contains the 100mM glyphosate.At 37 ℃ of shaking tables, 250 rev/mins, cultivate after 24 hours, measure OD600.Clone g6 is 0.95, and the pMD18-T contrast has only repeated 4 times for this experiment of 0.03., has obtained identical result.Obviously, Gt-1 makes intestinal bacteria obtain the ability of resistance glyphosate.

For further proving the ability of the resistance glyphosate of Gt-1, clone g6 and pMD18-T (contrast) all are coated in respectively on the M63 nutrient agar that contains 30mM and 100mM glyphosate, after 24 hours, PMD18-T (contrast) does not find the growth of bacterium colony, and clone g6 obviously 30 and the substratum of 100mM glyphosate on all can grow.This illustrates that also GT-1 has the resistance glyphosate ability.

The similarity of embodiment 5, Gt-1 and other known Antiglyphosate genes

Gt-1 is quite different with other known Antiglyphosate genes.For example the aminoacid sequence of the EPSPS gene of it and known Agrobacterium CP4 with resistance glyphosate has only 46.4% homogeny, with 46.5% the homogeny (United States Patent (USP): 5633435) of having only of Pseudomonassp PG2982.

Gt-1 gene and Pseudomonas putida F1, Pseudomonas putida k224, Pseudomonas entomophila L48, with the aminoacid sequence of an a kind of functional area of theoretical prediction protein sequence among the Pseudomonas fluorescens Pf-5 genome sequencing result higher similarity (Pseudomonas putida F1 whole genome sequence: NZ AALM00000000,5925059bp is arranged; Pseudomonas putida KT2440 whole genome sequence: AE015451,6181863bp; Pseudomonas entomophila L48 whole genome sequence: CT573326,5888780bp; With the full genome of Pseudomonas fluorescens Pf-5: NC 004129 7074893bp).

In Pseudomonas putida F1, this theoretical prediction protein has 746 amino acid (gb:EAP49406.1), and wherein the peptide of amino acid 27～291 is similar to prephenate dehydrogenase (PDH), and the peptide of amino acid 322～732 is similar to EPSPS.But the proteinic actual functional capability of theoretical prediction and unclear, particularly its whether resistance glyphosate is more unclear.

The proteinic EPSPS of the theoretical prediction zone of embodiment 6, Pseudomonas putida F1 has EPSPS resistance glyphosate function

There are 98.8% aminoacid sequence homogeny and 93%DNA sequence homogeny in the proteinic EPSPS of the theoretical prediction zone of Gt-1 gene and Pseudomonas putida F1.Therefore the resistance glyphosate function in the proteinic EPSPS of the theoretical prediction of Pseudomonasputida F1 zone is studied.According to the frequency of utilization of the secret numeral of corn amino acid, synthetic the nucleotide sequence Gt-2 (seeing SEQID NO:3) in the proteinic EPSPS of theoretical prediction zone (amino acid 309-746) of coding Pseudomonas putida F1.Gt-2 handles rear clone between the BamHI and SacI of pET-28a through BglII and SacI, obtains expression plasmid pET-Gt-2, and further the pET-Gt-2 plasmid is changed in the e. coli bl21 Star bacterial strain.

Clone pET-Gt-2 and pET-28a (empty carrier, contrast) in LB, cultivates, when OD600 reaches 0.6, get 0.2ml centrifugal 1 minute at 5000rpm, abandon supernatant, sedimentary cell is centrifugal again after cleaning through the M63 nutrient solution, then sedimentary cell is diluted to 0.02 (OD600) with the M63 nutrient solution that contains the 50mM glyphosate.At 37 ℃ of shaking tables, 250 rev/mins, cultivate after 24 hours, measure OD600.Clone pET-Gt-2 is 1.27 and pET-28a contrast only is 0.04.Obviously, Gt-2 makes intestinal bacteria obtain the ability of resistance glyphosate.

The present invention finds for the first time and has proved that the proteinic EPSPS zone of this theoretical prediction has the ability of high-resistance glyphosate.

The acquisition of embodiment 7, transformation gene resistance glyphosate paddy rice

The preparation method of transgenic plant is to adopt prior art (the refined Gong ancestral of Lu Xiong an ancient egg-shaped, holed wind instrument 1998 life science 10:125-131; Liu Fan etc., 2003 Molecular Plant Breeding 1:108-115).Choose ripe full seed and shell, induce to produce callus as converting material.Get the Agrobacterium that contains goal gene and draw plate, choose single colony inoculation preparation conversion and use Agrobacterium.Callus to be transformed is put into the agrobacterium liquid (containing Syringylethanone) of proper concn, allow Agrobacterium be attached to the callus surface, then callus is transferred in the common substratum, cultivated altogether 2～3 days.Callus after transforming with aseptic water washing is transferred to and is contained on the suitable antibiotic screening culture medium screening and culturing (2mM glyphosate) two months (middle subculture once).After screening, the callus that growth vigor is good is transferred on the pre-differentiation substratum and was cultivated about 20 days, will break up good callus then in advance and move on to division culture medium, and illumination in 14 hours differentiation is germinateed.2-3 transfers to strengthening seedling and rooting on the root media to the resistance regeneration plant after week, at last regeneration plant flush away agar is transplanted in the greenhouse, as expert evidence.

Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention all should be thought protection scope of the present invention.

Sequence table

SEQ?ID?NO：1

1 ATGAACGCCA?ACGATCTGAT?TTTCCTGGCC?CAACCGGGTG?GCCGCCTGAA?CGGGCGGATT

61 CGCGTACCGG?GCGACAAGTC?GATTTCCCAC?CGCTCGATCA?TGCTCGGCTC?GCTGGCCGAA

121 GGCACTACCG?AGGTCGAAGG?CTTCCTCGAG?GGTGAAGACG?CGCTGGCGAC?CCTGCAGGCA

181 TTCCGTGACA?TGGGTGTGGT?CATCGAAGGC?CCCAACCATG?GTCGAGTGAC?CATTCATGGT

241 GTCGGCCTGC?ATGGCCTCAA?GCCGCCGCCT?GGCCCGCTGT?ATGTGGGTAA?CTCCGGTACT

301 TCGATGCGCC?TGCTGTCGGG?CCTGTTGGCC?GGTCAGTCGT?TCGACGTGAC?CATGACGGGC

361 GACGCCTCGC?TGTCCAAGCG?CCCGATGAAC?CGTGTGGCCA?ACCCGCTGCG?CGAAATGGGT

421 GCCGTGGTCG?AGACCGGTCC?GGAAGGCCGC?CCGCCGCTGA?CCATCCGTGG?TGGCCACAAG

481 CTCAAGGGGC?TGACCTACAC?GCTGCCGATG?GCCAGCGCCC?AGGTAAAATC?CTGCCTGCTG

541 CTGGCTGGCC?TGTACGCCGA?AGGCAAGACC?ACTGTCACCG?AGCCTGCGCC?TACCCGTGAC

601 CACACCGAGC?GCATGCTGCG?TGGTTTCGGC?TATTCGGTCG?AAAGCAACGG?CCCAGTCGCT

661 TCGCTGCAGT?CCGGCGGCAA?ACTGACCGCT?ACCCGCATCG?AAGTGCCGGC?CGACATTTCC

721 TCGGCGGCGT?TCTTCCTGGT?GGCAGCTTCT?ATCGCCGAAG?GCTCCGAGTT?GGTGCTGGAG

781 CACGTTGGCA?TCAACCCGAC?CCGTACCGGC?GTAATCGACA?TTCTGCGCCT?GATGGGTGGC

841 GACATCACCC?TGGAAAACCA?GCGTGAAGTC?GGCGGCGAGC?CAGTGGCCGA?CCTGCGTGTG

901 CGCGGTGCCC?AGCTCAAAGG?TATCGATATT?CCAGAAGCGT?TGGTGCCGCT?GGCCATCGAC

961 GAATTCCCGG?TGCTGTTCGT?CGCGGCTGCA?TGCGCTGAAG?GGCGCACAGT?GCTACGTGGC

1021 GCCGAAGAGC?TGCGGGTGAA?GGAGTCCGAC?CGCATCCAGG?TCATGGCTGA?CGGCCTGATC

1081 ACGCTGGGAA?TCAAGTGCGA?GCCGACCCCG?GACGGCATCA?TCATCGACGG?CGGCCAGTTG

1141 GGCGGCGGCG?AAGTACACGG?GCATGGTGAC?CACCGCATCG?CCATGGCCTT?CAGCGTGGCC

1201 TCGCTGCGCG?CCAGTGCGCC?GATCCGCATC?CACGACTGCG?CCAACGTCGC?CACCTCGTTC

1261 CCCAACTTCC?TGGCACTGTG?CGCCGAAGTG?GGCATCCGCG?TGGCGGAAGA?GGGCAAGTCG

1321 TGA

SEQ?ID?NO：2

1 Met?Asn?Ala?Asn?Asp?Leu?Ile?Phe?Leu?Ala?Gln?Pro?Gly?Gly?Arg?Leu?Asn?Gly?Arg?Ile

21 Arg?Val?Pro?Gly?Asp?Lys?Ser?Ile?Ser?His?Arg?Ser?Ile?Met?Leu?Gly?Ser?Leu?Ala?Glu

41 Gly?Thr?Thr?Glu?Val?Glu?Gly?Phe?Leu?Glu?Gly?Glu?Asp?Ala?Leu?Ala?Thr?Leu?Gln?Ala

61 Phe?Arg?Asp?Met?Gly?Val?Val?Ile?Glu?Gly?Pro?Asn?His?Gly?Arg?Val?Thr?Ile?HAs?Gly

81 Val?Gly?Leu?His?Gly?Leu?Lys?Pro?Pro?Pro?Gly?Pro?Leu?Tyr?Val?Gly?Asn?Ser?Gly?Thr

101 Ser?Met?Arg?Leu?Leu?Ser?Gly?Leu?Leu?Ala?Gly?Gln?Ser?Phe?Asp?Val?Thr?Met?Thr?Gly

121 Asp?Ala?Ser?Leu?Ser?Lys?Arg?Pro?Met?Asn?Arg?Val?Ala?Asn?Pro?Leu?Arg?Glu?Met?Gly

141 Ala?Val?Val?Glu?Thr?Gly?Pro?Glu?Gly?Arg?Pro?Pro?Leu?Thr?Ile?Arg?Gly?Gly?His?Lys

161 Leu?Lys?Gly?Leu?Thr?Tyr?Thr?Leu?Pro?Met?Ala?Ser?Ala?Gln?Val?Lys?Ser?Cys?Leu?Leu

181 Leu?Ala?Gly?Leu?Tyr?Ala?Glu?Gly?Lys?Thr?Thr?Val?Thr?Glu?Pro?Ala?Pro?Thr?Arg?Asp

201 His?Thr?Glu?Arg?Met?Leu?Arg?Gly?Phe?Gly?Tyr?Ser?Val?Glu?Ser?Asn?Gly?Pro?Val?Ala

221 Ser?Leu?Gln?Ser?Gly?Gly?Lys?Leu?Thr?Ala?Thr?Arg?Ile?Glu?Val?Pro?Ala?Asp?Ile?Ser

241 Ser?Ala?Ala?Phe?Phe?Leu?Val?Ala?Ala?Ser?Ile?Ala?Glu?Gly?Ser?Glu?Leu?Val?Leu?Glu

261 His?Val?Gly?Ile?Asn?Pro?Thr?Arg?Thr?Gly?Val?Ile?Asp?Ile?Leu?Arg?Leu?Met?Gly?Gly

281 Asp?Ile?Tnr?Leu?Glu?Asn?Gln?Arg?Glu?Val?Gly?Gly?Glu?Pro?Val?Ala?Asp?Leu?Arg?Val

301 Arg?Gly?Ala?Gln?Leu?Lys?Gly?Ile?Asp?Ile?Pro?Glu?Ala?Leu?Val?Pro?Leu?Ala?Ile?Asp

321 Glu?Phe?Pro?Val?Leu?Phe?Val?Ala?Ala?Ala?Cys?Ala?Glu?Gly?Arg?Thr?Val?Leu?Arg?Gly

341 Ala?Glu?Glu?Leu?Arg?Val?Lys?Glu?Ser?Asp?Arg?Ile?Gln?Val?Met?Ala?Asp?Gly?Leu?Ile

361 Thr?Leu?Gly?Ile?Lys?Cys?Glu?Pro?Thr?Pro?Asp?Gly?Ile?Ile?Ile?Asp?Gly?Gly?Gln?Leu

381 Gly?Gly?Gly?Glu?Val?His?Gly?His?Gly?Asp?His?Arg?Ile?Ala?Met?Ala?Phe?Ser?Val?Ala

401 Ser?Leu?Arg?Ala?Ser?Ala?Pro?Ile?Arg?Ile?His?Asp?Cys?Ala?Asn?Val?Ala?Thr?Ser?Phe

421 Pro?Asn?Phe?Leu?Ala?Leu?Cys?Ala?Glu?Val?Gly?Ile?Arg?Val?Ala?Glu?Glu?Gly?Lys?Ser

SEQ?ID?NO：3

1 AGATCTGCCA?ACGACCTGAT?CTTCCAGGCC?CAGCCGGGCG?GCAGGCTGAA?CGGCAGGATC

61 AGGGTGCCGG?GCGACAAGAG?CATCAGCCAC?AGGAGCATCA?TGCTGGGCAG?CCTGGCCGAG

121 GGCACCACCG?AGGTGGAGGG?CTTCCTGGAG?GGCGAGGACG?CCCTGGCCAC?CCTGCAGGCC

181 TTCAGGGACA?TGGGCGTGGT?GATCGAGGGC?CCGAACCACG?GCAGGGTGAC?CATCCACGGC

241 GTGGGCCTGC?ACGGCCTGAA?GCCGCCGCCG?GGCCCGCTGT?ACGTGGGCAA?CAGCGGCACC

301 AGCATGAGGC?TGCTGAGCGG?CCTGCTGGCC?GGCCAGAGCT?TCGACGTGAC?CATGACCGGC

361 GACGCCAGCC?TGAGCAAGAG?GCCGATGAAC?AGGGTGGCCA?ACCCGCTGAG?GGAGATGGGC

421 GCCGTGGTGG?AGACCGGCCC?GGACGGCAGG?CCGCCGCTGA?CCATCAGGGG?CGGCCACAAG

481 CTGAAGGGCC?TGACCTACAC?CCTGCCGATG?GCCAGCGCCC?AGGTGAAGAG?CTGCCTGCTG

541 CTGGCCGGCC?TGTACGCCGA?GGGCAAGACC?ACCGTGACCG?AGCCGGCCCC?GACCAGGGAC

601 CACACCGAGA?GGATGCTGAG?GGGCTTCGGC?TACAGCGTGG?ACAGCAACGG?CCCGGTGGCC

661 AGCCTGCAGA?GCGGCGGCAA?GCTGACCGCC?ACCAGGATCG?AGGTGCCGGC?CGACATCAGC

721 AGCGCCGCCT?TCTTCCTGGT?GGCCGCCAGC?ATCGCCGAGG?GCAGCGAGCT?GGTGCTGGAG

781 CACGTGGGCA?TCAACCCGAC?CAGGACCGGC?GTGATCGACA?TCCTGAGGCT?GATGGGCGGC

841 GACATCACCC?TGGAGAACCA?GAGGGAGGTG?GGCGGCGAGC?CGGTGGCCGA?CCTGAGGGTG

901 AGGGGCGCCA?AGCTGAAGGG?CATCGACATC?CCGGAGGCCC?TGGTGCCGCT?GGCCATCGAC

961 GAGTTCCCGG?TGCTGTTCGT?GGCCGCCGCC?TGCGCCGAGG?GCAGGACCGT?GCTGAGGGGC

1021 GCCGAGGAGC?TGAGGGTGAA?GGAGAGCGAC?AGGATCCAGG?TGATGGCCGA?CGGCCTGACC

1081 ACCCTGGGCA?TCAAGTGCGA?GCCGACCCCG?GACGGCATCA?TCATCGACGG?CGGCCAGCTG

1141 GGCGGCGGCG?AGGTGCACGG?CCACGGCGAC?CACAGGATCG?CCATGGCCTT?CAGCGTGGCC

1201 AGCCTGAGGG?CCAGCGCCCC?GATCAGGATC?CACGACTGCG?CCAACGTGGC?CACCAGCTTC

1261 CCGAACTTCC?TGGCCCTGTG?CGCCGAGGTG?GGCATCAGGG?TGGCCGAGGA?GGGCAAGAGC

1321 TGATGAGCTC

Claims (4)

1, Antiglyphosate gene is characterized in that: the nucleotides sequence of this gene is classified SEQ ID NO:1 as.

2, a kind of vegetable cell that comprises the described gene of claim 1.

3, a kind of method that plant is transformed is characterized in that: comprise and utilize the described vegetable cell of claim 2, more corresponding transfer-gen plant is cultivated in its differentiation.

4, remodeling method according to claim 3 is characterized in that: described plant is paddy rice, corn, cotton, wheat, soybean, turfgrass or herbage.