CN100588708C - Anti-SARS vaccine - Google Patents

Abstract

The present invention relates to nucleotide sequences from SARS (Severe Acute Respiratory Syndrome) coronavirus genomes, as well as the applications of the partial fragments thereof in preparing DNA vaccine or expressing corresponding proteins. Furthermore, the present invention also relates to the uses of said proteins in preventing and treating diseases, and preparing antibodies.

Description

Anti-SARS vaccin

Technical field

The present invention relates to field of virology, the part fragment in the genomic nucleotide sequence of sars coronavirus and these sequences is used to prepare dna vaccination, expresses the purposes of corresponding proteins matter.Also relate to the purposes that these albumen are used for disease prevention and treatment.

Background technology

Since in November, 2002 since China Guangdong Province finds the first routine SARS (Severe Acute Respiratory Syndrome) (SARS), in many time half a year in the past, global number of the infected and area constantly increase.According to the data from World Health Organization website, by on June 6th, 2003, whole world accumulative total reported cases reached 8404 people, spread all over 32 countries and regions, have seized 779 people's life.

SARS (Severe Acute Respiratory Syndrome) is a kind of novel very strong respiratory system disease of infectivity, and English name is Severe Acute Respiratory Syndrome, is called for short SARS.The atypical pneumonia of its appearance different from the past.Atypical pneumonia in the past (Atypical Pneumonia, ATP) normally treatable, and seldom be in peril of one's life.And the infectivity of SARS (Severe Acute Respiratory Syndrome) is very strong, and can produce respiratory distress and death.Discovered a kind of new coronavirus for the cause of disease of SARS (Severe Acute Respiratory Syndrome), and the called after sars coronavirus.

Coronavirus is separated from chicken on one's body prior to nineteen thirty-seven.Make the scientist of Qin Rui find that under electron microscope the adventitia of coronavirus is corona shape or imperial crown shape projection, called after " coronavirus " thus in nineteen sixty-eight by one.

The viral nomenclature council in 1975 definite designation coronaviridae.According to the serology characteristics of virus and the difference of nucleotide sequence, coronavirus is divided into coronavirus and two genus of Torovirus at present.

The classification of coronaviridae:

Representative strains be avian infectious bronchitis virus (Avian infectious bronchitis virus, IBV)

Other member has:

Human corona virus (Human coronavirus)

Murine hepatitis virus (Murine virus hepatitis, MHV)

Pigs haemagglutinating encephalomyelitis virus (Porcine hemagglutinating encephalomyelitis virus)

Transmissible gastro-enteritis virus (Porcine transmissible gastroenteri tis virus, TGEV)

Nascent calf diarrhoea coronavirus (Neonatal calf diarrhea coronavirus, BCV)

The rat coronavirus (Rat coronavirus, RCV)

Turkey blue comb poison (Turkey bluecomb virus)

Feline infectious peritonitis virus (Feline infectious peritonitis virus) may the member have:

Canine coronavirus (Canine coronavirus)

Rat saliva order adenositis virus (Sialodacryoadenitis virus of rat)

People's enteric coronavirus virus (Human enteric coronavirus)

The physicochemical characteristics of coronavirus: the about 60-220 nanometer diameter of coronavirus, profile is the imperial crown shape, so be called coronavirus.Coronavirus is made of single Yeast Nucleic Acid (RNA), and this RNA and N albumen are formed virus jointly.Its genetic material is RNA, and three structural protein are arranged, and belongs to glycoprotein.Its feature is that recombination fraction is very high between RNA and the RNA, variation occurs just because of this very high recombination fraction.After the reorganization, RNA has become, and variation has taken place its sequence; Albumen has also become, and proteic aminoacid sequence has also become.

The epidemiology of coronavirus: up to the present, about 15 kinds of different coronavirus strains are found, and some can make the people fall ill, and other can make ox, pig, mouse, cat, dog and birds morbidity, particularly fowl plague and dog pest.Dog pest shows as a kind of acute alimentary infection disease, and its Clinical symptoms is diarrhoea.Cause of disease is a coronavirus, mainly is present in the gi tract of disease dog, and discharges with ight soil, pollutes feed and surrounding environment.Therefore, canine coronavirus is mainly through digestive tract infection.The resistibility of viral environment to external world is stronger.Virus in the ight soil can be survived 6～9 days, and pollutent can keep the infectivity of a couple of days in water.Therefore in a single day, this disease taking place among the dog group, is difficult in its popular and propagation of short period of time inner control.Virus is to thermo-responsive, and ultraviolet ray, lysol, 0.1% Peracetic Acid and the distant woods of 1% gram etc. all can kill virus at short notice.

But coronavirus infected person and poultry, domestic animal can cause infectious bronchitis, mouse hepatitis, porcine encephalomyelitis, feline infectious peritonitis of poultry etc.The human diseases that coronavirus causes has two classes, at first is respiratory tract infection, secondly is intestinal tract infections.

Viral mask work difficulty to coronavirus is very big, needs the dirty cell of personnel selection embryo, tracheae and nasal mucosa cell, can separate through organ culture.Virus of proliferation is also very difficult, also will use above-mentioned materials.

This virus is very sensitive to temperature, 33 ℃ of well-growns, and 35 ℃ just are suppressed.Because this characteristic, the disease popularity that is caused by it mostly occurs in the winter time and early spring.

Coronavirus still there are not special prevention and medicine at present.

The specificity prevention, promptly the specific aim preventive measures should be vaccines.The development of vaccine is possible, but needs the time longer, and solving the viral proliferation problem is its difficult problem.

Non-specific preventive measures are prevention respiratory infectious disease in the spring measure that the Ministry of Health has announced, as warming, wash one's hands, ventilate, not overtired and do not contact patient, go to the many public places of people etc. less.Treatment mainly is a symptomatic treatment.Coronavirus infection is very general in the whole world, ubiquity coronavirus antibody among the crowd, and the grownup is higher than children.Crowd's antibody positive rate difference of various countries reports, population of China in the past coronavirus neutralizing antibody positive rate 30% to 60%.Respiratory and enteric coronavirus infects by the air droplet transmission, infects the peak in autumn and winter and early spring.Have report to think that different virus popular has different periodicity, general at interval 2 to 3 years once popular.The immunne response that coronavirus infection causes is relatively poor, and subinfection is more common again.

The clinical characters of coronavirus: coronavirus is one of main pathogen of adult's common cold, can cause upper respiratory tract infection children, generally seldom involves lower respiratory tract.Be generally average out to 3 days the latent period of coronavirus infection 2 to 5 days.Typical coronavirus infection is cold symptoms such as runny nose, discomfort.The virulence difference of different type viruses, the clinical manifestation that causes also is not quite similar, and the symptom that the OC43 strain causes is generally serious than 229E virus.There is the report coronavirus infection symptoms such as heating, shiver with cold, vomiting can occur.Generally about 1 week, clinical course is slight for the course of disease, does not have sequela.

Coronavirus can also cause baby, newborn infant's acute gastroenteritis, and cardinal symptom is water sample stool, heating, vomiting, and surplus every day 10 time, the blood watery stool can appear in severe patient.The infection of reported literature coronavirus can produce following clinical symptom:

1) respiratory system infection comprises severe acute respiratory system synthesis disease (SARS);

2) intestinal tract infections (baby is taken place once in a while);

3) neurological symptom (seldom).

Coronavirus excretes by respiratory secretions, per os liquid, jet, contagion.Clinically, most coronavirus cause slight and self-healing property disease, but minority can have neurological complication.

On April 16th, 2003, World Health Organization's official confirmation causes that the pathogenic agent of SARS is the mutation of coronavirus, with its called after " sars coronavirus ".It and influenza virus have sibship, but very unique, never find on mankind in the past.As previously mentioned, coronavirus is that a class diameter is the spherical positive chain RNA togavirus of 80～220 nanometers.The spinous process that the similar corona of shape is arranged on its cyst membrane is so life is coronavirus.Studies show that further two kinds of glycoprotein are generally arranged on the cyst membrane: S albumen, M albumen.Wherein S albumen is responsible for inducing the film of virus envelope and host cell membrane to merge, and excitating organism produces the humoral immunization and the cell immune response of neutralizing antibody.Being surrounded by the genetic material RNA of virus in the virus, being about 26～32kb, is the longest in all RNA viruses.Other has nucleocapsid protein, is called N albumen, and it duplicates and sprout relevant with viral RNA.When coronavirus enters into host cell, at first translate the RNA polymerase of synthetic virus.Under the guidance of RNA polymerase, finish the early stage incident of virus infection, so realize the transcribing of virus, duplicate, the assembling of translation and new virus.Genome has comprised the open reading frame that number does not wait, and (Open Reading Frame ORF), has gene overlap or intergenic region between each ORF.In all coronavirus gene structures, gene order is consistent: 5 '-rna polymerase gene-S protein gene-E protein gene-M protein gene-N protein gene-3 ', sars coronavirus is no exception.But this virus is very different again with known coronavirus.Coronavirus can cause that the respiratory tract, digestive tube, liver of people and many animals and neural system produce disease, and according to the serological characteristic and the homology of nucleotide sequence of virus coronavirus is divided into 3 groups: group one comprises human respiratory coronavirus 229E, transmissible gastro-enteritis virus, cat enteric coronavirus virus and canine coronavirus etc.; Group two member has human respiratory coronavirus OC43, bovine coronavirus, HEV etc.; Group three is contained avian infectious bronchitis virus etc.Gene order and known 3 virus groups of sars coronavirus are compared, and draw the systematic evolution tree of several important structural protein, find that in SARS virus and other groups any one is not closely related.

Sars coronavirus variation as a kind of pathogenic agent of deadly infectious disease is very fast, and it is very important that seek medicine for preparation vaccine and design genetic information, structure and the proliferating cycle of studying this pathogenic agent, also presses for diagnosis with reagent and method.

Summary of the invention

The present inventor has measured a kind of genome sequence of virus strain of sars coronavirus, and some purposes of this sequence also are provided.

First aspect the invention provides the genome sequence of sars coronavirus.Extract total RNA from the patient's that suffers from atypical pneumonia death pathological tissues, synthetic cDNA checks order to the virus strain genome of sars coronavirus, finds that the Nucleotide number that this genome contains is 29760, is illustrated among the SEQ ID NO:1.Put down in writing in priority document of the present invention with this sequence and compared the sequence that lacks 15 Nucleotide at its 5 ' end, wherein Ji Zai sequence has 29745 Nucleotide.Sars coronavirus genome sequence provided by the invention has been embodied among the GenBank, Accession No.AY390556[gi:41323719].

Initial analysis to the SARS virus genome sequence shows, this virus contains 11 open reading frame (ORFs) at least, spike protein (the spike of the virus of encoding respectively, S), membranin (membrane, M), envelope protein (envelope, E) and nucleocapsid protein (nucleocapsid, N) and one can produce several proteic orflab.Wherein S albumen is a kind of important antigen decision albumen.S and M albumen insert endoplasmic reticulum in cell, N albumen links with the RNA that duplicates simultaneously, this albumen-RNA complex body is connected and enters endoplasmic reticulum on the M albumen together then, referring to Tin-Yun Ho, Shih-Lu Wu, et al.Antigenicity and receptor-bindingability of recombinant SARS coronavirus spike protein.Biochemical andBiophysical Research Communications 313,2004,938-947.

Second aspect the invention provides isolating polynucleotide, and these isolating polynucleotide comprise and being selected from: the polynucleotide sequence shown in the a.SEQ ID NO:1; B. compare with the sequence shown in the SEQ ID NO:1, have the natural polynucleotide sequence of at least 90% sequence homology; With, with a) or b) the complementary polynucleotide sequence.

The 3rd aspect the invention provides isolating polynucleotide, and these isolating polynucleotide are to adopt following primer, classify template as with the genome sequence of sars coronavirus, prepare through pcr amplification.

First group of primer: upstream primer 5 ' ACA GGA TCC AAG AAC ATG TTTATT TTC TTA TT 3 ', downstream primer 5 ' AGA TCT GAA TTC TAT CCA ATAGGA ATG TCG CAC TC 3 ';

Second group of primer: upstream primer 5 ' ATT GGA TCC ACC ATG GGC TGTCTT ATA GGA GCT GAG C 3 ', downstream primer 5 ' ATG GAT CCG AAT TCTGGC TGT GCA GTA ATT GAT CT 3 ';

The 3rd group of primer: upstream primer 5 ' CAA GGA TCC GTT ATG TAC TCATTC GTT TCG 3 ', downstream primer 5 ' ACA AGA TCT GAA TTC TTT AAGCTC CTC AAC GGT AA 3 ';

The 4th group of primer: upstream primer 5 ' ACA GGA TCC ATC ATG GCA GACAAC GGT AC 3 ', downstream primer 5 ' AAC AGA TCT GAA TTC GCA ATCCTG AAA GTC CTC ATA 3 ';

The 5th group of primer: upstream primer 5 ' ATT GGA TCC GTC ATG GAC AATAAC CAG AAT GGA GGA CG 3 ', downstream primer 5 ' AAC AGA TCT GAATTC ATT CTG CAC AAG AG 3 ';

The 6th group of primer: upstream primer 5 ' ACA CCA TGG AAT TCG ACA TGGCTA TTT CAC CGA AG 3 ', downstream primer 5 ' CAG GTA CCG GAT CCAATA TTG CAG CAG TAC GCA C 3 '.

The template of amplification is to be to have the molecule that is illustrated in the nucleotide sequence among the SEQ ID NO:1, for example cDNA molecule.Amplification method and condition are known in the art, can be with reference to " molecular cloning experiment guide " (J Sambrook E.F.Fritsch T.Maniatis, Molecular Cloning, a Laboratory Mannual, 2 ^NdEd, Cold Spring HarborLaboratory Press, 1989) carry out.

The 4th aspect the invention provides the isolated polypeptide fragment, and this isolated polypeptide fragment is by the polynucleotide encoding of the genome sequence of the sars coronavirus of first aspect of the present invention, also is the polypeptide of nucleic acid sequence encoding shown in the SEQ ID NO:1.

The 5th aspect the invention provides the isolated polypeptide fragment, and this isolated polypeptide fragment is by the described isolating polynucleotide encoding of third aspect of the present invention.

The 6th aspect the invention provides isolating polynucleotide, and they are the natural polynucleotide sequences that have at least 90% sequence homology with the described isolating polynucleotide of third aspect of the present invention.

The 7th aspect the invention provides the isolated polypeptide fragment, and they are the natural the more peptide sequences that have at least 90% sequence homology with the 4th described isolated polypeptide fragment in aspect of the present invention.

The 8th aspect, the invention provides with the isolated polypeptide fragment described in the present invention can specificity bonded antibody.In one embodiment, these antibody are monoclonal antibodies.

The 9th aspect the invention provides the separation polynucleotide that contain described in the present invention and polypeptide fragment and the pharmaceutical composition of acceptable carrier pharmaceutically.

The tenth aspect the invention provides the detection kit of the separation polynucleotide that contain described in the present invention.

The 11 aspect the invention provides the recombinant adenovirus of the separation polynucleotide that contain described in the present invention.

The 12 aspect the invention provides the vaccine that contains above-mentioned the 11 the described recombinant adenovirus in aspect.

Above-mentioned aspect is a brief overview of the present invention, and the present invention is not limited to these.The explanation of other parts of the present invention, and do not deviating from spirit of the present invention and essence is perhaps in the simple modification of utilizing the present invention to carry out with improve within the scope of the present invention.

In one embodiment of the invention, found that the polypeptide of six fragment codings or albumen can excite the immune response at sars coronavirus in vivo, used so these fragments be can be used as dna vaccination.They are to utilize six groups of primers in the third aspect of the present invention, genome sequence with sars coronavirus is classified template as, through the polynucleotide of pcr amplification preparation, note is made SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6 and SEQ ID No:7 respectively.

For dna vaccination of the present invention, the nucleotide sequence of SEQ ID NO:1 wherein, also can comprise with this homology of nucleotide sequence greater than 90% sequence, preferably include the nucleic acid fragment that is selected from SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ IDNo:6 and SEQ ID No:7 or with its homology greater than 90% nucleic acid fragment.

In another embodiment of the invention, a kind of protein vaccine is provided, this vaccine contains expresses resultant big polypeptide or protein fragments with the nucleotide sequence of SEQ ID NO:1.

The contriver recognizes that the coded product of SEQ ID NO:1 has immunogenicity, has certain biological activity, has using value.In the present invention, adopt any coding mode of reading, from the resulting translation product of SEQ ID NO:1 all within the scope of the invention.To the sequence that SEQ ID NO:1 is disclosed, in translation, can read partial sequence, the starting point of reading can be different, and resulting product is all within the present invention.To be designated as SEQ ID NO:8 corresponding to the aminoacid sequence of SEQ ID NO:1 total length.

The present invention includes the isolated polypeptide sequence, comprise and be selected from following amino acid sequences:

A) aminoacid sequence of SEQ ID NO:8;

B) has the identical natural acid sequence of aminoacid sequence of at least 90% sequence and SEQ ID NO:8;

C) bioactive fragment in the aminoacid sequence of SEQ ID NO:8; With

D) immunogenic fragments in the aminoacid sequence of SEQ ID NO:8.

In another embodiment of the invention, a kind of protein vaccine is provided, wherein contain sequence SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQID No:6 and the coded protein of SEQ ID No:7, the aminoacid sequence in these protein is expressed as SEQ ID No:9, SEQ ID No:10, SEQ ID No:11, SEQ ID No:12, SEQ ID No:13 and SEQ ID No:14 respectively.

In another embodiment, be based on designed dna fragmentation of SEQ ID No:1 or RNA fragment, they can be used as diagnostic sounder, and the integral part that also can be used as gene chip uses.Further, or treatment molecule, such as antisense rna molecule, it is identical with SARS virus whole genome sequence disclosed by the invention or have a complementarity, also can be identical or complementary with the open genome sequence part of the present invention, such as represented fragment in SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6 and SEQ IDNo:7.Stop duplicating, transcribing or various nucleic acid molecule or its fragment of translation process of SARS virus thereby can combine with it according to genomic information of the present invention design, and the nucleic acid molecule of design or its fragment inserted that various carriers are expressed or directly use include among the present invention.

In one embodiment, nucleotide sequence of the present invention is inserted in the carrier.The kind of carrier does not add restriction.Carrier can import in the host cell, and wherein said cell is prokaryotic cell prokaryocyte or eukaryotic cell.Furthermore, the protein involved of host cell expression SARS virus.Nucleic acid probe comprises at least 15 Nucleotide, can be with containing SEQ ID No:1 the nucleotide sequence of listed nucleotide sequence carry out specific hybridization.

Furthermore, nucleic acid probe of the present invention can carry out mark with detectable marker, can be used for the SARS INFECTION IN DETECTION, has improved the susceptibility that detects.

Gene order-checking of the present invention will help the SARS virus diagnosis of infection (using PCR and immunity test) among human and the potential animal host, help the exploitation (comprising neutralizing antibody) of antiviral, and help to identify the antigenic determinant of inferring that is used for vaccine development.Genomic information also helps to prepare gene chip, is used for detecting and diagnosis.

The present invention also especially provides the distinctive sequence that contains 29 Nucleotide in the genome sequence of sars coronavirus, i.e. the 27891st to the 27919th nucleotide sequence among the SEQ ID No:1, and called after SEQ ID No:15, its sequence is as follows:

CCTACTGGTTACCAACCTGAATGGAATAT

Based on this sequence, can prepare test kit that is used to detect etc.

Technical scheme provided by the invention is summarized as follows:

1. isolating polynucleotide are selected from following sequence: the polynucleotide sequence of a.SEQ ID NO:1; B. have at least 90% the sequence natural polynucleotide sequence identical with the sequence of SEQ ID NO:1; With, a) or b) the complementary polynucleotide sequence.

2. isolating polynucleotide sequence, coding comprises one section polypeptide that is selected from following amino acid sequences: a.SEQ ID NO:8; B. the identical natural acid sequence of aminoacid sequence that has at least 90% sequence and SEQ ID NO:8; Bioactive fragment in the aminoacid sequence of c.SEQ ID NO:8; With, the immunogenic fragments in the aminoacid sequence of d.SEQ ID NO:8.

3. isolating polynucleotide, be selected from: a. is selected from the polynucleotide sequence of SEQ ID NO:2-7; B. have at least 90% the sequence natural polynucleotide sequence identical with the sequence that is selected from SEQ ID NO:2-7; With, c. and a) or b) the complementary polynucleotide sequence.

4. isolated polypeptide sequence comprises and is selected from following amino acid sequences: the aminoacid sequence of a.SEQ ID NO:8; B. the identical natural acid sequence of aminoacid sequence that has at least 90% sequence and SEQ ID NO:8; Bioactive fragment in the aminoacid sequence of c.SEQ ID NO:8; With, the immunogenic fragments in the aminoacid sequence of d.SEQ ID NO:8.

5. one kind can produce immunoreactive isolated polypeptide fragment to SARS virus, and be selected from: a. is selected from the polynucleotide sequence of SEQ ID NO:9-14; B. have at least 90% the sequence natural polynucleotide sequence identical with the sequence that is selected from SEQ ID NO:9-14.

6. the separation antibody of an energy and above-mentioned the 4th described polypeptide specific combination.

7. the separation antibody of an energy and above-mentioned the 5th described polypeptide specific combination.

8. the separation antibody in above-mentioned the 6th is a monoclonal antibody.

9. the separation antibody in above-mentioned the 7th is a monoclonal antibody.

10. pharmaceutical composition contains above-mentioned the 4th the described polypeptide and the pharmaceutically acceptable carrier of significant quantity.

11. a pharmaceutical composition contains above-mentioned the 5th the described polypeptide and the pharmaceutically acceptable carrier of significant quantity.

12. a pharmaceutical composition contains above-mentioned the 1st the described polynucleotide and the pharmaceutically acceptable carrier of significant quantity.

13. a pharmaceutical composition contains above-mentioned the 2nd the described polynucleotide and the pharmaceutically acceptable carrier of significant quantity.

14. a pharmaceutical composition contains above-mentioned the 3rd the described polynucleotide and the pharmaceutically acceptable carrier of significant quantity.

15. a pharmaceutical composition contains above-mentioned the 6th the described antibody that combines with pharmaceutically acceptable carrier.

16. a pharmaceutical composition contains above-mentioned the 7th the described antibody that combines with pharmaceutically acceptable carrier.

17. a pharmaceutical composition contains above-mentioned the 8th the described antibody that combines with pharmaceutically acceptable carrier.

18. a pharmaceutical composition contains above-mentioned the 9th the described antibody that combines with pharmaceutically acceptable carrier.

19. one kind is used for the diagnostic kit that the test sample SARS virus exists, contains above-mentioned the 1st described polynucleotide and pharmaceutically acceptable carrier.

20. one kind is used for the diagnostic kit that the test sample SARS virus exists, contains above-mentioned the 2nd described polynucleotide and pharmaceutically acceptable carrier.

21. one kind is used for the diagnostic kit that the test sample SARS virus exists, contains above-mentioned the 3rd described polynucleotide and pharmaceutically acceptable carrier.

22. one kind is used for the probe that the test sample SARS virus exists, contain at least 20 continuous polynucleotide, SARS virus polynucleotide sequence complementation in this sequence and the sample, described probe is forming under the condition of hybridization complex specificity and SARS virus multi-nucleotide hybrid between this probe and the SARS virus polynucleotide.

23. one kind is used for the probe that the test sample SARS virus exists, and contains the polynucleotide sequence of SEQ IDNO:15.

24. the method for the polynucleotide of SARS virus in the check sample, described SARS virus polynucleotide have above-mentioned the 1st described polynucleotide sequence, this method comprises: a. probe hybridization sample, this probe contains at least 20 continuous polynucleotide, comprise with sample in SARS virus polynucleotide sequence complementary sequence, described probe is forming under the condition of hybridization complex specificity and SARS virus multi-nucleotide hybrid between this probe and the SARS virus polynucleotide; With, b. detects described hybridization complex and whether exists, if exist, and the alternative amount that detects described hybridization complex.

25. the method for the polynucleotide of SARS virus in the check sample, described SARS virus polynucleotide have above-mentioned the 2nd described polynucleotide sequence, this method comprises: a. probe hybridization sample, this probe contains at least 20 continuous polynucleotide, comprise with sample in SARS virus polynucleotide sequence complementary sequence, described probe is forming under the condition of hybridization complex specificity and SARS virus multi-nucleotide hybrid between this probe and the SARS virus polynucleotide; With, b. detects described hybridization complex and whether exists, if exist, and the alternative amount that detects described hybridization complex.

26. the method for the polynucleotide of SARS virus in the check sample, described SARS virus polynucleotide have above-mentioned the 3rd described polynucleotide sequence, this method comprises: a. probe hybridization sample, this probe contains at least 20 continuous polynucleotide, comprise with sample in SARS virus polynucleotide sequence complementary sequence, described probe is forming under the condition of hybridization complex specificity and SARS virus multi-nucleotide hybrid between this probe and the SARS virus polynucleotide; With, b. detects described hybridization complex and whether exists, if exist, and the alternative amount that detects described hybridization complex.

27. top the 24th described method, its middle probe contains at least 30 successive Nucleotide.

28. top the 25th described method, its middle probe contains at least 30 successive Nucleotide.

29. top the 26th described method, its middle probe contains at least 30 successive Nucleotide.

30. top the 24th described method, its middle probe contains at least 50 successive Nucleotide.

31. top the 25th described method, its middle probe contains at least 50 successive Nucleotide.

32. top the 26th described method, its middle probe contains at least 50 successive Nucleotide.

33. the method for the polynucleotide of encoding SARS virus protein in the detection of biological sample may further comprise the steps: polynucleotide that a. is above-mentioned the 1st and the hybridization of the nucleic acid substances in the biological sample form hybridization complex; With, b. detects described hybridization complex, and the existence of the polynucleotide of encoding SARS virus protein is relevant in the existence of wherein said hybridization complex and the described biological sample.

34. the method for the polynucleotide of encoding SARS virus protein in the detection of biological sample may further comprise the steps: the nucleic acid substances hybridization in above-mentioned the 2nd described polynucleotide of a. and the biological sample forms hybridization complex; With, b. detects described hybridization complex, and the existence of wherein said hybridization complex is relevant with the existence of the proteinic polynucleotide of SARS virus in the described biological sample of coding.

35. the method for the polynucleotide of encoding SARS virus protein in the detection of biological sample may further comprise the steps: the nucleic acid substances hybridization in above-mentioned the 3rd described polynucleotide of a. and the biological sample forms hybridization complex; With, b. detects described hybridization complex, and the existence of wherein said hybridization complex is relevant with the existence of the proteinic polynucleotide of SARS virus in the described biological sample of coding.

36. effectively resist the vaccine that people's SARS virus infects, comprise peptide and pharmaceutically acceptable carrier for one kind with the sequence that is selected from SEQ IDNO:1-7.

37. effectively resist the vaccine that people's SARS virus infects, comprise peptide and pharmaceutically acceptable carrier for one kind with the sequence that is selected from SEQ IDNO:8-14.

38. express the proteinic recombinant adenovirus of SARS virus, comprising for one kind:

A. adenovirus, wherein the part of being responsible for duplicating in its sequence is deleted, so this adenovirus of cracking reproducible it self not; With

B. at least one polypeptide fragment is selected from spike protein, little membranin, little envelope protein and nucleocapsid protein.

39. express the proteinic recombinant adenovirus of SARS virus, comprising for one kind:

A. adenovirus, wherein the part of being responsible for duplicating in its sequence is deleted, so this adenovirus of cracking reproducible it self not; With

B. two polypeptide fragments are selected from spike protein, little membranin, little envelope protein and nucleocapsid protein.

40. express the proteinic recombinant adenovirus of SARS virus, comprising for one kind:

A. adenovirus, wherein the part of being responsible for duplicating in its sequence is deleted, so this adenovirus of cracking reproducible it self not; With

B. three polypeptide fragments are selected from spike protein, little membranin, little envelope protein and nucleocapsid protein.

41. express the proteinic recombinant adenovirus of SARS virus, comprising for one kind:

A. adenovirus, wherein the part of being responsible for duplicating in its sequence is deleted, so this adenovirus of cracking reproducible it self not; With

B. many polypeptide fragments are selected from spike protein, little membranin, little envelope protein and nucleocapsid protein.

42. express the proteinic recombinant adenovirus of SARS virus, comprising for one kind:

A. adenovirus, wherein the part of being responsible for duplicating in its sequence is deleted, so this adenovirus of cracking reproducible it self not;

The spike protein of b.SARS virus; With

C. little envelope protein.

43. express the proteinic recombinant adenovirus of SARS virus, comprising for one kind:

A. adenovirus, wherein the part of being responsible for duplicating in its sequence is deleted, so this adenovirus of cracking reproducible it self not;

The spike protein of b.SARS virus; With

C. little membranin.

44. express the proteinic recombinant adenovirus of SARS virus, comprising for one kind:

A. adenovirus, wherein the part of being responsible for duplicating in its sequence is deleted, so this adenovirus of cracking reproducible it self not;

The spike protein of b.SARS virus;

C. little membranin; With

D. little envelope protein.

45. express the proteinic recombinant adenovirus of SARS virus, comprising for one kind:

A. adenovirus, wherein the part of being responsible for duplicating in its sequence is deleted, so this adenovirus of cracking reproducible it self not;

B. little envelope protein;

C. little membranin; With

D. nucleocapsid protein.

46. a SARS vaccine contains above-mentioned the 38th described recombinant adenovirus and pharmaceutically acceptable carrier.

47. a SARS vaccine contains above-mentioned the 39th described recombinant adenovirus and pharmaceutically acceptable carrier.

48. a SARS vaccine contains above-mentioned the 40th described recombinant adenovirus and pharmaceutically acceptable carrier.

49. a SARS vaccine contains above-mentioned the 41st described recombinant adenovirus and pharmaceutically acceptable carrier.

50. a SARS vaccine contains above-mentioned the 42nd described recombinant adenovirus and pharmaceutically acceptable carrier.

51. a SARS vaccine contains the above-mentioned the 43rd described recombinant adenovirus and pharmaceutically acceptable carrier.

52. a SARS vaccine contains the above-mentioned the 44th described recombinant adenovirus and pharmaceutically acceptable carrier.

53. a SARS vaccine contains the above-mentioned the 45th described recombinant adenovirus and pharmaceutically acceptable carrier.

54. a metering needle comprises above-mentioned the 46th the described vaccine of using significant quantity to the immunoreactive method that people's SARS virus infects.

55. a metering needle comprises above-mentioned the 47th the described vaccine of using significant quantity to the immunoreactive method that people's SARS virus infects.

56. a metering needle comprises above-mentioned the 48th the described vaccine of using significant quantity to the immunoreactive method that people's SARS virus infects.

57. a metering needle comprises above-mentioned the 49th the described vaccine of using significant quantity to the immunoreactive method that people's SARS virus infects.

58. a metering needle comprises above-mentioned the 50th the described vaccine of using significant quantity to the immunoreactive method that people's SARS virus infects.

59. a metering needle comprises above-mentioned the 51st the described vaccine of using significant quantity to the immunoreactive method that people's SARS virus infects.

60. a metering needle comprises above-mentioned the 52nd the described vaccine of using significant quantity to the immunoreactive method that people's SARS virus infects.

61. a metering needle comprises above-mentioned the 53rd the described vaccine of using significant quantity to the immunoreactive method that people's SARS virus infects.

62. an immune experimenter resists the method that SARS virus infects, and comprises to described experimenter and uses above-mentioned the 46th described vaccine.

63. an immune experimenter resists the method that SARS virus infects, and comprises to described experimenter and uses above-mentioned the 47th described vaccine.

64. an immune experimenter resists the method that SARS virus infects, and comprises to described experimenter and uses above-mentioned the 48th described vaccine.

65. an immune experimenter resists the method that SARS virus infects, and comprises to described experimenter and uses above-mentioned the 49th described vaccine.

66. an immune experimenter resists the method that SARS virus infects, and comprises to described experimenter and uses above-mentioned the 50th described vaccine.

67. an immune experimenter resists the method that SARS virus infects, and comprises to described experimenter and uses above-mentioned the 51st described vaccine.

68. an immune experimenter resists the method that SARS virus infects, and comprises to described experimenter and uses above-mentioned the 52nd described vaccine.

69. an immune experimenter resists the method that SARS virus infects, and comprises to described experimenter and uses above-mentioned the 53rd described vaccine.

70. above-mentioned the 62nd described method, wherein said experimenter is human.

71. above-mentioned the 63rd described method, wherein said experimenter is human.

72. above-mentioned the 64th described method, wherein said experimenter is human.

73. above-mentioned the 65th described method, wherein said experimenter is human.

74. above-mentioned the 66th described method, wherein said experimenter is human.

75. above-mentioned the 67th described method, wherein said experimenter is human.

76. above-mentioned the 68th described method, wherein said experimenter is human.

77. above-mentioned the 69th described method, wherein said experimenter is human.

78. treat the method that experimenter's SARS virus infects, comprise to described experimenter and use above-mentioned the 46th described vaccine for one kind.

79. treat the method that experimenter's SARS virus infects, comprise to described experimenter and use above-mentioned the 47th described vaccine for one kind.

80. treat the method that experimenter's SARS virus infects, comprise to described experimenter and use above-mentioned the 48th described vaccine for one kind.

81. treat the method that experimenter's SARS virus infects, comprise to described experimenter and use above-mentioned the 49th described vaccine for one kind.

82. treat the method that experimenter's SARS virus infects, comprise to described experimenter and use above-mentioned the 50th described vaccine for one kind.

83. treat the method that experimenter's SARS virus infects, comprise to described experimenter and use above-mentioned the 51st described vaccine for one kind.

84. treat the method that experimenter's SARS virus infects, comprise to described experimenter and use above-mentioned the 52nd described vaccine for one kind.

85. treat the method that experimenter's SARS virus infects, comprise to described experimenter and use above-mentioned the 53rd described vaccine for one kind.

86. above-mentioned the 78th described method, wherein said experimenter is human.

87. above-mentioned the 79th described method, wherein said experimenter is human.

88. above-mentioned the 80th described method, wherein said experimenter is human.

89. above-mentioned the 81st described method, wherein said experimenter is human.

90. above-mentioned the 82nd described method, wherein said experimenter is human.

91. above-mentioned the 83rd described method, wherein said experimenter is human.

92. above-mentioned the 84th described method, wherein said experimenter is human.

93. above-mentioned the 85th described method, wherein said experimenter is human.

Detailed Description Of The Invention

The present inventor determines the cause of death, and carries out Study on etiology carried out first example pathological study that becomes celestial on January 31st, 2003 and dead SARS patient on February 10th, 2003.Method: dead patient carries out necrotomy to atypical pneumonia, and pathological tissues carries out the ultrathin section(ing) electron microscopic observation, to the synthetic cDNA of pathological tissues extracted total RNA, and measures the sars coronavirus whole genome sequence.The result: the inspection that becomes celestial is observed lung tissue popularity consolidation, pulmonary edema, pulmonary apoplexy, lung focal hemorrhage infarct.Diseased lung tissue ultrathin section(ing) electron microscopic observation is present in the II type alveolar epithelial cells to virion.Sequencing detects complete sars coronavirus whole genome sequence (sequence called after GZ02102003), the i.e. sequence that is disclosed among the SEQ IDNO:1 among the present invention.

The details of the above-mentioned research that the contriver carried out is as follows:

1.1 patient: the dead woman, 62 years old, Guangzhou resident, began heating on January 31st, 2003, runny nose, pharyngalgia, cough, February 4, due to illness feelings increased the weight of, symptoms such as expiratory dyspnea occur, be diagnosed as atypical pneumonia and transfer from one hospital to another immediately to Guangzhou City No.8 People's Hospital and give treatment to, the state of an illness commentaries on classics of not getting better, expiratory dyspnea further increases the weight of, and stops death 0: 15 on the 10th February in 2003 because of breathing heartbeat.We have carried out pathology dissection in Nanfang Hospital of No.1 Military Medical Univ. to corpse second day (on February 11st, 2003) 15.

1.2 electron microscopic examination

Lung tissue is fixed 30 minutes with 1% osmic acid, and the Resins, epoxy embedding is dewatered in PBS washing back with gradient acetone.Use the plumbous double staining of uranium behind the ultrathin section(ing), electron microscopic observation.

1.3 viral complete sequence determination and analysis

1.3.1 American I nvitrogen company's T RIZOL Reagent test kit is used in the extraction of total RNA.Reference reagent box operation instruction is carried out.

1.3.2cDNA synthetic (Invitrogen is USA) with the synthetic cDNA of random primer with ThermoScript with complete sequence determination.According to the PCR primer of the full gene of disclosed sars coronavirus complete sequence design covering SARS virus, every pair of long product of the about 1kb of PCR primer amplification, adjacent primer is to the long overlap of 200 bases of having an appointment.The PCR reaction is 39 circulation 25ul cumulative volumes, and reaction conditions is that the every circulation of preceding 14 cycle annealing temperature descends 0.5 ℃.The order-checking of PCR product uses ABI Big Dye Terminator reagent to carry out on the ABI377 machine.The sequence of measuring be used in combination " Phred, the Phrapand Consed " program that comes from University of Washington.

The result

2.1 gross anatomy lung tissue popularity consolidation (especially with the upper lobe of left lung bottom, inferior lobe, the full lung of right lung is attached most importance to) pulmonary edema, pulmonary apoplexy, lung focal hemorrhage infarct.The lung tissue of pathology is desquamative interstitial pneumonia and changes, be full of in the alveolar space of consolidation come off in a large number and outgrowth alveolar epithelium, edematous fluid, interalveolar septum and alveolar space in see mononuclear macrophage and the lymphocytic infiltration that quantity does not wait, in the part alveolar space, the visible neutrophil infiltration of pleura.The popularity transparent film forms the focal alveolus wall necrosis of companion in two lung alveolar spaces.Viral inclusion body is seen in inspection in the part alveolar epithelium.The pulmonary branches tracheal epithelium comes off, in the part Bronchiole wall and around see lymphocyte is arranged, monocyte and neutrophil infiltration.Interstitial lung hyperemia, hemorrhage, telangiectasis, the chamber includes monocyte, lymphocyte and neutrophil leucocyte, interstitial lung arteriole and Venule endotheliocytic swelling, hyperplasia, interior subcutaneous oedema, visible hyaline thrombus in visible monocyte of tunica media and adventitia and the lymphocytic infiltration, the little blood vessel of part.Blood vessel height dilatation and congestion in the hilar lymph node, skin, medullary substance are demarcated unclear, and paracortex has more monocytoid cell, and medullary substance endolymph tissue reduces.Hemothorax 200ml, the main pulmonary artery thrombosis.

2.2 electron microscopic examination

Electronic Speculum result shows, visible coronavirus sample particle (see figure 1) in II type alveolar epithelial cells.

2.3 sequencing and analysis

The sars coronavirus sequence total length that the contriver measures is 29760 bases, and called after GZ02102003 is to detect the patient lung tissue sample on February 10th, 2003 from a death to indicate this sequence.Warp is compared with other sars coronavirus complete sequence that GeneBank goes up login and (is ended on June 6th, 2003, have 17 sars coronavirus complete sequence logins on GeneBank, wherein sequence ZJ01 has the many places apparent error, can not finish sequence alignment), find this sequence except that having a spot of SNP, have more one section 29 nucleotide sequences (CCTACTGGTTACCAACCTGAATGGAATAT), the sequence comparative result referring to table one .17 strain sars coronavirus complete sequence relatively.The existence of these 29 nucleotide sequences has changed the encoding histone frame of ORF10 and ORF11 fully, and also be present in the masked civet SARS virus, and the sars coronavirus that detects in the patient body of in March, 2003 sequela has all been lost 29 above-mentioned nucleotide sequences, shows that there is cognation highly in this strain sars coronavirus of separation determination in patient's body of morbidity in January with the masked civet sars coronavirus.In view of the above, the contriver believes that the human SARS virus that is infected derives from masked civet.

Table one .17 strain sars coronavirus complete sequence relatively

Remarks: only express non-synonym variation in the table one.The position of each Nucleotide is to be basic representation with the TOR2SARS-CoV sequence.Aminoacid replacement, respective egg white matter or open reading frame also show.

An important results of sequential analysis be GZ02102003 exclusive 29 sequence changes ORF10 and 11 amino acid coding, the result is shown in Fig. 2 A and Fig. 2 B.

The unique distinction of contriver's method is: employing direct total cDNA of construction from this patient's the diseased lung tissue sample that becomes celestial also measures the complete sequence of sars coronavirus with the SNP sequence measurement.

This is studied most important discovery and is to detect and is exclusive 29 nucleotide sequences (CCTACTGGTTACCAACCTGAATGGAATAT sees Table 1) of the entrained sars coronavirus strain of this patient.The significance of this discovery is following three facts: 1) this section sequence exists only in the SARS death patient specimen the earliest that the contriver can find at present, other sars coronavirus of finishing complete sequence determination all derive from March, 2003 with the patient of sequela and without exception lost this section sequence (seeing Table 1).2) existence of this section sequence has changed ORF10 and 11 (seeing Fig. 2 A and Fig. 2 B) fully.3) this section sequence is present in simultaneously in wildlife masked civet body and is separated to sars coronavirus.So we think that this section sequence in time migration rule from the masked civet to the human body and on human body makes us have reason to believe that the human SARS virus that is infected derives from masked civet.

The accompanying drawing summary

Fig. 1 is a diseased lung tissue ultrathin section(ing) electron microscopic observation.

Fig. 2 A is that ORF10 and Fig. 2 B are that ORF11 compares.

Fig. 3 is the PCR end product.DNA Marker: be followed successively by 1.100bp from top to bottom; 2.250bp; 3.500bp; 4.750bp; 5.1000bp; 6.2000bp; 7.2500bp; 8.5000bp; 9.7500bp; 10.10000bp; 11.15000bp.PCR fragment: from left to right be followed successively by the S total length; The S1 fragment; The S2 fragment; E albumen; M albumen; N albumen; The PXN fragment.

Fig. 4: plasmid pMD18-T (providing) by Takara company.

The pMD18-T clone collection of illustrative plates of Fig. 5: S1, S2, E, M, N and X2.

Fig. 6: pcDNA3.1 (+)/(-) collection of illustrative plates.

Fig. 7: enzyme is cut and is confirmed the clone of pcDNA3.1 (+)/(-) (S1, S2, E, M, N and X2).

Fig. 8 A-8D is the antigenicity experimental result of partial nucleotide sequence of the present invention.Among Fig. 8 A the adenovirus carrier of only expressing S albumen (spike protein), S1.Be to express S albumen and the proteic adenovirus carrier of E, S2 among Fig. 8 B.Be to express S albumen, the proteic adenovirus carrier of M albumen and E, S3G among Fig. 8 C.Be to express E albumen, the proteic adenovirus carrier of M albumen and N, S3N among Fig. 8 D.

Fig. 9 is the antigenicity experimental result of partial nucleotide sequence of the present invention.Experiment is adopted and is expressed S albumen, the proteic adenovirus carrier of M albumen and E, and promptly S3G carries out as vaccine; With PBS in contrast.

Embodiment

The present invention will be described in the mode of embodiment below, but as those skilled in the art understood, and these embodiment only are used to illustrate the present invention rather than in order to limit the present invention.The present invention only is subjected to the restriction of claims.

Segmental the obtaining of embodiment 1.SARS virogene

SARS virus RNA extracts

1.1 material

1.1.2 contain the lung tissue of SARS virus: take from the women patient in Guangdong Province because of infection SARS death.

1.2.3TRIZOL Reagent:, be the total RNA extraction reagent box available from GIBCOBRL company.

1.2 method

1.2.1 get the frozen about 100mg of patient's lung tissue in-80 ℃ of refrigerators, place clean glass mortar to grind.

Place glass mortar 1.2.2 take out 1ml TRIZOL reagent, piping and druming gently, make the lung tissue of grinding be dissolved in TRIZOL reagent after, collect with the 1.5ml centrifuge tube.

1.2.3 centrifuge tube was placed room temperature 5 minutes, in centrifuge tube, add the 0.2ml chloroform, after the violent jolting of hand, centrifuge tube was placed room temperature 3 minutes again.

1.2.4 4 ℃ centrifugal 15 minutes, 12000g/ minute.

1.2.5 collect the upper strata water that contains RNA after centrifugal, add the 0.5ml Virahol, room temperature was placed 15 minutes.

1.2.6 4 ℃ centrifugal 10 minutes, 12000g/ minute.

1.2.7 remove supernatant, the washing with alcohol RNA throw out with 75% once.

Dry in the air in air to little doing 1.2.8 treat the RNA throw out, adding 50ml does not have the sterilized water dissolving that the RNA enzyme pollutes.

CDNA is synthetic

2.1 material

2.1.1cDNA synthetic agent box: RNA PCR Kit (AMV) Ver.2.1, available from precious biotech firm.

2.1.2SARS RNA: infect internal medicine by Nanfang Hospital and extract.

2.2 method

2.2.1 reaction mixture

MgCl 4.0μl

Damping fluid 2.0 μ l

dNTP 2.0μl

RNAase inhibitor 0.5 μ l

Random primer 1.0 μ l

Orligo dT primer 1.0 μ l

RNA template 1.0 μ l

Transcriptase enzyme 1.0 μ l

Water 7.5 μ l

2.2.2 response procedures

The 1st step: hatched 50 minutes for 37 ℃

The 2nd step: hatched 2 minutes for 50 ℃

The 3rd step: hatched 5 minutes for 37 ℃

The 4th the step: repeat the 2nd the step, the 3rd the step 5 times

The 5th step: hatched 3 minutes for 95 ℃

Pcr amplification

3.1 material

3.1.1PCR test kit: KaTaRa Ex Taq, available from precious biotech firm

3.1.2cDNA it is synthetic voluntarily by our company

3.2 method

3.2.1 reaction mixture

10X Ex Taq damping fluid 1.0 μ l

DNTP mixture 0.8 μ l

CDNA template 1.0 μ l

Random primer 0.5 μ l

Random primer 0.5 μ l

Taq enzyme 0.05 μ l

Water 6.15 μ l

3.2.2 response procedures

The 1st step: hatched 3 minutes for 94 ℃

The 2nd step: hatched for 30 seconds for 94 ℃

The 3rd step: hatched for 20 seconds for 58 ℃

The 4th step: hatched for 40 seconds that (annotate: according to the molecular weight size of amplified fragments, incubation time does not wait from 40 seconds by 4 minutes for 72 ℃.)

The 5th the step: repeat the 2nd the step, the 3rd the step and the 4th the step 34 times

The 6th step: hatched 5 minutes for 72 ℃.

The results are shown in Figure in 3.

The clone of embodiment 2.SARS VAA gene fragment

One, 6 segmental pcr amplifications of antigen gene

All PCR primers (seeing Table two) all have ATG (start codon) when design, and all PCR products all have terminator (stop codon) at 3 ' end, so just make all fragments obtain effectively expressing after being cloned into relevant carrier.These primers are synthetic by the China peaceful thing of big gene Shanghai ancient cooking vessel Science and Technology Ltd., respectively by after the minipore sterilized water dissolving of each OD with 200ul, as working concentration, press the 10X use when PCR react behind 5 times of the redilution.

With the PCR test kit that Takara company provides, the template of PCR is (pGEM T Easy Clones)The clone of corresponding pGEM-T Easy.Two primers of condition 1/10 volume of PCR reaction, the template of 10～50ng, dNTP, 10 times of PCR damping fluids of 1/10 volume, the Taq enzyme of 2 units adds sterilized water to working volume (10 to 25ul), the program of PCR be 94 ℃ 4 minutes, 94 ℃ of-58 ℃ of-72 ℃ of 30 circulations of 2 minutes 30 seconds in 30 seconds in 30 seconds then, afterwards another 72 ℃ 10 minutes.The PCR reaction of being done is all carried out with the PCR machine of Eppendorf company.

The PCR end product of gained as shown in Figure 3.

Two, 6 antigen gene fragment pMD18-T clones' structure

The PCR Purification Kit that provides with Qiagen company distinguishes purifying with the PCR product of above gained, then with pMD18-T (the TA cloning vector of Takara company, see Fig. 4) by the molar concentration rate of 2: 1 to 5: 1 scopes, 10 to 20ul cumulative volume, the unit ligase enzyme connects, be transformed into the competent cell of DH5 α afterwards, then at the bacterium colony that the white selected on the LB substratum of 100ug/mlAmpicillin and IPTG/X-gal is arranged, respectively these bacterium colonies are cultivated the back with 4mlLB (100ug/ml Ampicillin) and extract plasmid (with the miniprep extraction kit of Qiagen company), then further enzyme is cut and (is cut S1 with BamHI and EcoRI, S2, E, M and N clone cut the X2 clone with KpnI and EcoRI) determine whether the clone of gained has the insertion fragment (see figure 5) of correct size.To there be the segmental clone of correct size insertion to deliver to the big peaceful thing of the gene Shanghai ancient cooking vessel Science and Technology Ltd. of China then and insert segmental order-checking, finally determine the correctness of cloned sequence.

Three, 6 antigen gene fragment pcDNA3.1 clones' structure

5 pMD18-T clones such as S1, S2, E, M and N etc. after the order-checking conclusive evidence, after cutting with BamHI and EcoRI enzyme respectively, cloned sequence and pMD18-T that sample leakage of electricity swimmer is inserted separate, and come separation and purification to insert fragment S1, S2, E, M and N accordingly with the gel extraction kit of Qiagen company, at last these fragments are cloned into respectively that BamHI and EcoRI enzyme are cut and purifying after pcDNA3.1 (+) (see figure 6) carrier; X2pMD18-T clone then carries out enzyme with EcoRI and KpnI and cuts, and is cloned into then with EcoRI and KpnI to come on pcDNA3.1 (-) the (see figure 6) carrier after enzyme is cut purifying also.PcDNA3.1 (+)/(-) of resulting these reorganization (S1, S2, E, M, N and X2) clone's (see figure 7) will be carried out the test of animal and check as the possible candidate of dna vaccination.

Table two: the template and the corresponding PCR product of PCR primer and corresponding PCR reaction

The design of table three, 6 fragment clonings

The target clone	Insert gene source	The pcDNA3.1 carrier that connects clone's usefulness
			pcDNA3.1(+)-S1	The S1 fragment that the BamHI/EcoRI enzyme is cut (～1980bp), derive from pMD18-T/S1	The pcDNA3.1 (+) that the BamHI/EcoRI enzyme is cut
pcDNA3.1(+)-S2	The S2 fragment that the BamHI/EcoRI enzyme is cut (～1940bp), derive from pMD18-T/S2	The pcDNA3.1 (+) that the BamHI/EcoRI enzyme is cut
			pcDNA3.1(+)-E	The E fragment that the BamHI/EcoRI enzyme is cut (～300 bp) derives from pMD18-T/E	The pcDNA3.1 (+) that the BamHI/EcoRI enzyme is cut
pcDNA3.1(+)-M	The M fragment that the BamHI/EcoRI enzyme is cut (～760 bp) pMD18-T/M	The pcDNA3.1 (+) that the BamHI/EcoRI enzyme is cut
			pcDNA3.1(+)-N	The N fragment that the BamHI/EcoRI enzyme is cut (～1315bp) pMD18-T/N	The pcDNA3.1 (+) that the BamHI/EcoRI enzyme is cut
pcDNA3.1(-)-X2	The X2 fragment that the KpnI/EcoRI enzyme is cut (～380 bp) pMD18-T/X2	The pcDNA3.1 (-) that the KpnI/EcoRI enzyme is cut

The antigenicity of E albumen, M albumen, S albumen, X protein and the proteic nucleotide sequence of N of embodiment 3. encoding SARS coronavirus (CoV-SARS) is tested with mouse

In order to control developing of SARS effectively, the research of this virus vaccines is seemed particularly important.So far, the advantage of dna vaccination is more significant with respect to the attenuation of routine, inactivated vaccine, and this innovation vaccine product does not have immunogenicity, and having pleiotropy, the immunization time is long, manufacturing and easy to use, the storage motion is simple, and production cost is lower.Be not reported at present to the phenomenon in the animal gene group for the dna vaccination plasmid integration that might take place yet.

The complex gland virus carrier system is used to the antigenicity of the nucleotide sequence of mensuration coding little envelope protein (E), little membranin (M), spike protein (Spike) or glycoprotein (S) and nucleocapsid protein (N).All adenovirus carriers all contain E3 and all E4 ORF6 disappearance, except ORF6.

Dna vaccination provided by the invention is to be carrier with the complex gland virus carrier system.Insert the gene fragment of encoding SARS viral protein S therein and be built into the S1 vaccine, insert the gene fragment of encoding SARS viral protein S and E therein and be built into the S2 vaccine, insert coding E, M and the proteic gene fragment of N and be built into the S3N vaccine, insert coding S, E and the proteic gene fragment of M therein and be built into the S3G vaccine.

Experimentize in mouse with above-mentioned vaccine, each candidate vaccine is according to 10 ^8thThe dosage of pfu is injected one group of mouse (6).After the inoculation, per two all blood samplings once.Detect S albumen, the proteic antibody of E with ELISA.

Experimental result is illustrated among Fig. 8 A-8D, and wherein S1 is the complex gland virus vector (Fig. 8 A) of only expressing spike protein; S2 expresses S albumen and the proteic described carrier of E (Fig. 8 B); S3G expresses S albumen, M albumen and the proteic described carrier of E (Fig. 8 C); S3N expresses E albumen, M albumen and the proteic described carrier of N (Fig. 8 D).The S2 lysate is to express S albumen and the proteic disruptive cell of E.This cell has been transfection expresses the people A549 lung carcinoma cell of S albumen and the proteic carrier of E.This cell matrix is used to wrap the hole by elisa plate as immune target.The HC4 lysate contains irrelevant antigen, with comparing.

The repeated experiments of embodiment 4.S3N vaccine in mouse

Adopt the S3N vaccine of preceding method preparation to carry out repeated experiments, carry out with the route of inoculation of abdominal injection.

Experiment material

1. the used animal of this experiment is purchased in Shanghai Slac Experimental Animal Co., Ltd. for the C57 mouse, supports in this laboratory animal room, and day alternates with night in 12 hours.Half and half, 8 week of mouse male and female is big or small, and body weight is between 19g and 29g when getting blood first.

2.SARS the IgG antibody ELISA detects box and purchases in the BeiJing HuaDa JiBiAi Biology Technology Co., Ltd.

Experimental technique

1. experimentation on animals process:

1) administration: the C57 mouse, 8 weeks are big or small, divide 2 groups, ten every group.Each is organized in 0 week and abdominal injection vaccine S3N and the PBS contrast respectively of 8 weeks.The S3N vaccine is dissolved in PBS, to concentration be 10 ⁸Pfu/ml PBS, every injected in mice 0.5ml.

2) serum pref: respectively at 0 week (injection before), 2 weeks, 4 weeks, 6 weeks, 8 weeks (before the injection), 10 weeks, 12 week and 16 weeks, eye socket is got the about 100 μ l of blood, and the blood sample room temperature left standstill 1 hour, the centrifugal serum of producing, serum sample be stored in-20 ℃ to be measured.

3) SARS antibody test in the serum:

The anti-SARS antibody ELISA detection technique of this experiment utilization is the Himani Bisht that makes amendment on the basis of the ELISA detection kit of BeiJing HuaDa JiBiAi Biology Technology Co., Ltd's production, Anjeanette Roberts, et al.Severe acute respiratorysyndrome coronavirus spike protein expressed by attenuated vacciniavirus protectively immunizes mice.PNAS April 27,2004, vol.101 no.17 6641-6646; Yellow galaxy of literary talent, Liu Ranyi, Huang Bijun, Huang Jialing.Carry the Spike gene fragment recombinant adenovirus structure and induce anti-SARS-CoV immune response.

2. concrete steps:

A. each test holes of test kit was hatched 60 minutes in 37 ℃ of environment with the 5%BSA that is dissolved in PBS (pH7.5).

B. after washing plate 5 times with washing lotion that test kit is with, add serum sample (1/50 dilutes) the regulating YIN and YANG contrast of doubling dilution, hatched 60 minutes for 37 ℃.

C. after washing plate 5 times with washing lotion that test kit is with, each hole adds following mixture: 0.5 μ g/ml sheep anti-mouse igg-HRP+0.2%tween 20+1%BSA is dissolved in PBS, hatches 60 minutes for 37 ℃.

D. after washing plate 5 times with washing lotion+0.05%tween that test kit is with 20, carry out color reaction by the test kit explanation.The time (5-10 minute) of control color reaction.

E. dual-wavelength measurement, 450nm, 630nm

Following table is classified the concrete injection of DNA SARS vaccine as and is got the blood schedule:

Grouping

S3N

PBS

Serum pref 1 before the injection	01/16	01/16
				Serum pref 2 before the injection	02/18	02/18
Injection (week 0) for the first time	02/19	02/19
				Get for the first time blood (week 2)	03/03	03/03
Get for the second time blood (week 4)	03/17	03/17	3 serum samples of ELISA
				Get blood (week 6) for the third time	03/31	03/31
Get blood (week 8) preinjection for the 4th time	04/14	04/14	ELISA
				Injection (week 8) for the second time	04/14	04/14
Get blood (week 10) for the 5th time	04/28	04/28
				Get blood (week 12) for the 6th time	05/12	05/12
Get half execution of blood (week 14) for the 7th time	05/27	05/27	8 serum samples of ELISA

Experimental result

This experiment detects the titre of the anti-SARS IgG in the 0th, 4,8,10 and 12 week each mice serum with the method for ELISA, carries out doubling dilution at this each sample.Measured result as shown in the figure, but the result shows 1.Ad-S3N both humoral immune reaction of inducing mouse around the after injection; 2. the Ad-S3N in the 8th week injects the humoral immune reaction that can strengthen mouse once more, and titre is up to 3000.The result is referring to Fig. 9.

Embodiment 5. detects SARS dna vaccination S2, S3N, and S3G is to the immunization of rat

Dna vaccination in the experiment is to be carrier with the adenovirus, insert the gene fragment of encoding SARS viral protein S and E therein and be built into the S2 vaccine, insert coding E, M and the proteic gene fragment of N and be built into the S3N vaccine, insert coding S, E and the proteic gene fragment of M therein and be built into the S3G vaccine.Dna vaccination has different vaccination ways, and we at first adopt the route of inoculation of abdominal injection at this.

Experiment purpose:

Detect SARS dna vaccination S2, S3 (N), S3 (G) is to the immune induction effect of rat.

Experiment material:

1. the used animal of this experiment is purchased in Shanghai Slac Experimental Animal Co., Ltd. for the SD rat, supports in this laboratory animal room, and day alternates with night in 12 hours.Rat is male, the about 200g of body weight.

2.SARS the IgG antibody ELISA detects box and purchases in the BeiJing HuaDa JiBiAi Biology Technology Co., Ltd.

Experimental technique:

1. experimentation on animals process:

1) administration: the SD rat, about 200g, male, divide 4 groups, 3 every group of 3 administration groups, the 4th group is that PBS injection group contains a rat.Each is organized in 0 week and abdominal injection vaccine S2, S3 (N), S3 (G) and the PBS contrast respectively of 8 weeks.Various vaccines are dissolved in PBS respectively, and injected dose is 10 ⁹Pfu/ only.

2) serum pref: respectively at 0 week (injection before), 4 all 8 weeks (before the injection), 10 weeks, 12 week and 16 weeks, cut tail and get the about 200 μ l of blood, the blood sample room temperature left standstill 1 hour, the centrifugal serum of producing, serum sample be stored in-20 ℃ to be measured.

3) SARS antibody test in the serum:

The SARS antibody ELISA detection technique of this experiment utilization is to make amendment on the basis of the ELISA detection kit of BeiJing HuaDa JiBiAi Biology Technology Co., Ltd's production, referring to preamble.

2. concrete steps:

A. each test holes of test kit was hatched 60 minutes in 37 ℃ of environment with the 5%BSA that is dissolved in PBS (pH 7.5).

B. after washing plate 5 times with washing lotion that test kit is with, add serum sample (1/50 dilutes) the regulating YIN and YANG contrast of doubling dilution, hatched 60 minutes for 37 ℃.

C. after washing plate 5 times with washing lotion that test kit is with, each hole adds following mixture: 0.5 μ g/ml goat-anti rat IgG-HRP+0.2%tween 20+1%BSA is dissolved in PBS, hatches 60 minutes for 37 ℃.

D. after washing plate 5 times with washing lotion+0.05%tween that test kit is with 20, carry out color reaction by the test kit explanation.The time (5-10 minute) of control color reaction.

E. dual-wavelength measurement, 450nm, 630nm

Following table is classified the concrete injection of each DNA SARS vaccine as and is got the blood schedule:

Grouping	S2	S3N	S3G	PBS
					Serum pref
1 before the injection	04/08	04/08	04/08	04/08
					Injection (week 0) for the first time	04/08	04/08	04/08	04/08
Get for the first time blood (week 4)	05/09	05/09	05/09	05/09

Get for the second time blood+injection (week 8)	06/03	06/03	06/03	06/03
					Get blood (week 10) for the third time	06/17	06/17	06/17	06/17
Get blood (week 12) for the 4th time	07/01	07/01	07/01	07/01

Experimental result:

This experiment detects the titre of the anti-SARS IgG in the 0th, 4 week each rat blood serum with the method for ELISA, carries out doubling dilution at this each sample.Measured result as shown in the figure, the result shows that Ad-S3G can induce the humoral immune reaction of rat, the titre around the reaches more than 200.The result is referring to Figure 10.

Sequence list

＜110〉Tsinghua Yuanxing Bio-pharm Technology Co., Ltd

＜120〉anti-SARS vaccin

<130>CGCNS41571

<150>CN03142873.8

<151>2003-06-17

<160>1

<170>PatentIn version 3.1

<210>1

<211>29760

<212>DNA

＜213〉sars coronavirus (SARS-CoV)

<400>1

atattaggtt tttacctacc caggaaaagc caaccaacct cgatctcttg tagatctgtt 60

ctctaaacga actttaaaat ctgtgtagct gtcgctcggc tgcatgccta gtgcacctac 120

gcagtataaa caataataaa ttttactgtc gttgacaaga aacgagtaac tcgtccctct 180

tctgcagact gcttacggtt tcgtccgtgt tgcagtcgat catcagcata cctaggtttc 240

gtccgggtgt gaccgaaagg taagatggag agccttgttc ttggtgtcaa cgagaaaaca 300

cacgtccaac tcagtttgcc tgtccttcag gttagagacg tgctagtgcg tggcttcggg 360

gactctgtgg aagaggccct atcggaggca cgtgaacacc tcaaaaatgg cacttgtggt 420

ctagtagagc tggaaaaagg cgtactgccc cagcttgaac agccctatgt gttcattaaa 480

cgttctgatg ccttaagcac caatcactgc cacaaggtcg ttgagctggt tgcagaaatg 540

gacggcattc agtacggtcg tagcggtata acactgggag tactcgtgcc acatgtgggc 600

gaaaccccaa ttgcataccg caatgttctt cttcgtaaga acggtaataa gggagccggt 660

ggtcatagct atggcatcga tctaaagtct tatgacttag gtgacgagct tggcactgat 720

cccattgaag attatgaaca aaactggaac actaagcatg gcagtggtgc actccgtgaa 780

ctcactcgtg agctcaatgg aggtgcagtc actcgctatg tcgacaacaa tttctgtggc 840

ccagatgggt accctcttga ttgcatcaaa gattttctcg cacgcgcggg caagtcaatg 900

tgcactcttt ccgaacaact tgattacatc gagtcgaaga gaggtgtcta ctgctgccgt 960

gaccatgagc atgaaattgc ctggttcact gagcgctctg ataagagcta cgagcaccag 1020

acacccttcg aaattaagag tgccaagaaa tttgacactt tcaaagggga atgcccaaag 1080

tttgtgtttc ctcttaactc aaaagtcaaa gtcattcaac cacgtgttga aaagaaaaag 1140

actgagggtt tcatggggcg tatacgctct gtgtaccctg ttgcatctcc acaggagtgt 1200

aacaacatgc acttgtctac cttgatgaaa tgtaatcatt gcgatgaagt ttcatggcag 1260

acgtgcgact ttctgaaagc cacttgtgaa cattgtggca ctgaaaattt agttattgaa 1320

ggacctacta catgtgggta cctacctact aatgctgtag tgaaaatgcc atgtcctgcc 1380

tgtcaagacc cagagattgg acctgagcat agtgttgcag attatcacaa ccactcaaac 1440

attgaaactc gactccgcaa gggaggtagg actagatgtt ttggaggctg tgtgtttgcc 1500

tatgttggct gctataataa gcgtgcctac tgggttcctc gtgctagtgc tgatattggc 1560

tcaggccata ctggcattac tggtgacaat gtggagacct tgaatgagga tctccttgag 1620

atactgagtc gtgaacgtgt taacattaac attgttggcg attttcattt gaatgaagag 1680

gttgccatca ttttggcatc tttctctgct tctacaagtg cctttattga cactataaag 1740

agtcttgatt acaagtcttt caaaaccatt gttgagtcct gcggtaacta taaagttacc 1800

aagggaaagc ccgtaaaagg tgcttggaac attggacaac agagatcagt tttaacacca 1860

ctgtgtggtt ttccctcaca ggctgctggt gttatcagat caatttttgc gcgcacactt 1920

gatgcagcaa accactcaat tcctgatttg caaagagcag ctgtcaccat acttgatggt 1980

atttctgaac agtcattacg tcttgtcgac gccatggttt atacttcaga cctgctcacc 2040

aacagtgtca ttattatggc atatgtaact ggtggtcttg tacaacagac ttctcagtgg 2100

ttgtctaatc ttttgggcac tactgttgaa aaactcaggc ctatctttga atggattgag 2160

gcgaaactta gtgcaggagt tgaatttctc aaggatgctt gggagattct caaatttctc 2220

attacaggtg tttttgacat cgtcaagggt caaatacagg ttgcttcaga taacatcaag 2280

gattgtgtaa aatgcttcat tgatgttgtt aacaaggcac tcgaaatgtg cattgatcaa 2340

gtcactatcg ctggcgcaaa gttgcgatca ctcaacttag gtgaagtctt catcgctcaa 2400

agcaagggac tttaccgtca gtgtatacgt ggcaaggagc agctgcaact actcatgcct 2460

cttaaggcac caaaagaagt aacctttctt gaaggtgatt cacatgacac agtacttacc 2520

tctgaggagg ttgttctcaa gaacggtgaa ctcgaagcac tcgagacgcc cgttgatagc 2580

ttcacaaatg gagctatcgt tggcacacca gtctgtgtaa atggcctcat gctcttagag 2640

attaaggaca aagaacaata ctgcgcattg tctcctggtt tactggctac aaacaatgtc 2700

tttcgcttaa aagggggtgc accaattaaa ggtgtaacct ttggagaaga tactgtttgg 2760

gaagttcaag gttacaagaa tgtgagaatc acatttgagc ttgatgaacg tgttgacaaa 2820

gtgcttaatg aaaagtgctc tgtctacact gttgaatccg gtaccgaagt tactgagttt 2880

gcatgtgttg tagcagaggc tgttgtgaag actttacaac cagtttctga tctccttacc 2940

aacatgggta ttgatcttga tgagtggagt gtagctacat tctacttatt tgatgatgct 3000

ggtgaagaaa acttttcatc acgtatgtat tgttcctttt accctccaga tgaggaagaa 3060

gaggacgatg cagagtgtga ggaagaagaa attgatgaaa cctgtgaaca tgagtacggt 3120

acagaggatg attatcaagg tctccctctg gaatttggtg cctcagctga aacagttcga 3180

gttgaggaag aagaagagga agactggctg gatgatacta ctgagcaatc agagattgag 3240

ccagaaccag aacctacacc tgaagaacca gttaatcagt ttactggtta tttaaaactt 3300

actgacaatg ttgccattaa atgtgctgac atcgttaagg aggcacaaag tgctaatcct 3360

atggtgattg taaatgctgc taacatacac ctgaaacatg gtggtggtgt agcaggtgca 3420

ctcaacaagg caaccaatgg tgccatgcaa aaggagagtg atgattacat taagctaaat 3480

ggccctctta cagtaggagg gtcttgtttg ctttctggac ataatcttgc taagaagtgt 3540

ctgcatgttg ttggacctaa cctaaatgca ggtgaggaca tccagcttct taaggcagca 3600

tatgaaaatt tcaattcaca ggacacctta cttgcaccat tgttgtcagc aggcatattt 3660

ggtgctaaac cacttcagtc tttacaagtg tgcgtgcaga cggttcgtac acaggtttat 3720

attgcagtca atgacaaagc tctttatgag caggttgtca tggattatct tgataacctg 3780

aagcctagag tggaagcacc taaacaagag gagccaccaa acacagaaga ttccaaaact 3840

gaggagaaat ctgtcgtaca gaagcctgtc gatgtgaagc caaaaattaa ggcctgcatt 3900

gatgaggtta ccacaacact ggaagaaact aagtttctta ccaataagtt actcttgttt 3960

gctgatatca atggtaagct ttaccatgat tctcagaaca tgcttagagg tgaagatatg 4020

tctttccttg agaaggatgc accttacatg gtaggtgatg ttatcactag tggtgatatc 4080

acttgtgttg taataccctc caaaaaggct ggtggcacta ctgagatgct ctcaagagct 4140

ttgaagaaag tgccagttga tgagtatata accacgtacc ctggacaagg atgtgctggt 4200

tatacacttg aggaagctag gactgctctt aagaaatgca aatctgcatt ttatgtacta 4260

ccttcagaag cacctaatgc taaggaagag attctaggaa ctgtatcctg gaatttgaga 4320

gaaatgcttg ctcatgctga agagacaaga aaattaatgc ctatatgcat ggatgttaga 4380

gccataatgg caaccatcca acgtaagtat aaaggaatta aaattcaaga gggcatcgtt 4440

gactatggtg tccgattctt cttttatact agtaaagagc ctgtagcttc tattattacg 4500

aagctgaact ctctaaatga gccgcttgtc acaatgccaa ttggttatgt gacacatggt 4560

tttaatcttg aagaggctgc gcgctgtatg cgttctctta aagctcctgc cgtagtgtca 4620

gtatcatcac cagatgctgt tactacatat aatggatacc tcacttcgtc atcaaagaca 4680

tctgaggagc actttgtaga aacagtttct ttggctggct cttacagaga ttggtcctat 4740

tcaggacagc gtacagagtt aggtgttgaa tttcttaagc gtggtgacaa aattgtgtac 4800

cacactctgg agagccccgt cgagtttcat cttgacggtg aggttctttc acttgacaaa 4860

ctaaagagtc tcttatccct gcgggaggtt aagactataa aagtgttcac aactgtggac 4920

aacactaatc tccacacaca gcttgtggat atgtctatga catatggaca gcagtttggt 4980

ccaacatact tggatggtgc tgatgttaca aaaattaaac ctcatgtaaa tcatgagggt 5040

aagactttct ttgtactacc tagtgatgac acactacgta gtgaagcttt cgagtactac 5100

catactcttg atgagagttt tcttggtagg tacatgtctg ctttaaacca cacaaagaaa 5160

tggaaatttc ctcaagttgg tggtttaact tcaattaaat gggctgataa caattgttat 5220

ttgtctagtg ttttattagc acttcaacag attgaagtca aattcaatgc accagcactt 5280

caagaggctt attatagagc ccgtgctggt gatgctgcta acttttgtgc actcatactc 5340

gcttacagta ataaaactgt tggcgagctt ggtgatgtca gagaaactat gacccatctt 5400

ctacagcatg ctaatttgga atctgcaaag cgagttctta atgtggtgtg taaacattgt 5460

ggtcagaaaa ctactacctt aacgggtgta gaagctgtga tgtatatggg tactctatct 5520

tatgataatc ttaagacagg tgtttccatt ccatgtgtgt gtggtcgtga tgctacacaa 5580

tatctagtac aacaagagtc ttcttttgtt atgatgtctg caccacctgc tgagtataaa 5640

ttacagcaag gtacattctt atgtgcgaat gagtacactg gtaactatca gtgtggtcat 5700

tacactcata taactgctaa ggagaccctc tatcgtattg acggagctca ccttacaaag 5760

atgtcagagt acaaaggacc agtgactgat gttttctaca aggaaacatc ttacactaca 5820

accatcaagc ctgtgtcgta taaactcgat ggagttactt acacagagat tgaaccaaaa 5880

ttggatgggt attataaaaa ggataatgct tactatacag agcagcctat agaccttgta 5940

ccaactcaac cattaccaaa tgcgagtttt gataatttca aactcacatg ttctaacaca 6000

aaatttgctg atgatttaaa tcaaatgaca ggcttcacaa agccagcttc acgagagcta 6060

tctgtcacat tcttcccaga cttgaatggc gatgtagtgg ctattgacta tagacactat 6120

tcagcgagtt tcaagaaagg tgctaaatta ctgcataagc caattgtttg gcacattaac 6180

caggctacaa ccaagacaac gttcaaacca aacacttggt gtttacgttg tctttggagt 6240

acaaagccag tagatacttc aaattcattt gaagttctgg cagtagaaga cacacaagga 6300

atggacaatc ttgcttgtga aagtcaacaa cccacctctg aagaagtagt ggaaaatcct 6360

accatacaga aggaagtcat agagtgtgac gtgaaaacta ccgaagttgt aggcaatgtc 6420

atacttaaac catcagatga aggtgttaaa gtaacacaag agttaggtca tgaggatctt 6480

atggctgctt atgtggaaaa cacaagcatt accattaaga aacctaatga gctttcacta 6540

gccttaggtt taaaaacaat tgccactcat ggtattgctg caattaatag tgttccttgg 6600

agtaaaattt ttgcttatgt caaaccattc ttaggacaag cagcaattac aacatcaaat 6660

tgcgctaaga gattagcaca acgtgtgttt aacaattata tgccttatgt gtttacatta 6720

ttgttccaat tgtgtacttt tactaaaagt accaattcta gaattagagc ttcactacct 6780

acaactattg ctaaaaatag tgttaagagt gttgctaaat tatgtttgga tgccggcatt 6840

aattatgtga agtcacccaa attttctaaa ttgttcacaa tcgctatgtg gctattgttg 6900

ttaagtattt gcttaggttc tctaatctat gtaactgctg cttttggtgt actcttatct 6960

aattttggtg ctccttctta ttgtaatggc gttagagaat tgtatcttaa ttcgtctaac 7020

gttactacta tggatttctg tgaaggttct tttccttgca gcatttgttt aagtggatta 7080

gactcccttg attcttatcc agctcttgaa accattcagg tgacgatttc atcgtacaag 7140

ctagacttga caattttagg tctggccgct gagtgggttt tggcatatat gttgttcaca 7200

aaattctttt atttattagg tctttcagct ataatgcagg tgttctttgg ctattttgct 7260

agtcatttca tcagcaattc ttggctcatg tggtttatca ttagtattgt acaaatggca 7320

cccgtttctg caatggttag gatgtacatc ttctttgctt ctttctacta catatggaag 7380

agctatgttc atatcatgga tggttgcacc tcttcgactt gcatgatgtg ctataagcgc 7440

aatcgtgcca cacgcgttga gtgtacaact attgttaatg gcatgaagag atctttctat 7500

gtctatgcaa atggaggccg tggcttctgc aagactcaca attggaattg tctcaattgt 7560

gacacatttt gcactggtag tacattcatt agtgatgaag ttgctcgtga tttgtcactc 7620

cagtttaaaa gaccaatcaa ccctactgac cagtcatcgt atattgttga tagtgttgct 7680

gtgaaaaatg gcgcgcttca cctctacttt gacaaggctg gtcaaaagac ctatgagaga 7740

catccgctct cccattttgt caatttagac aatttgagag ctaacaacac taaaggttca 7800

ctgcctatta atgtcatagt ttttgatggc aagtccaaat gcgacgagtc tgcttctaag 7860

tctgcttctg tgtactacag tcagctgatg tgccaaccta ttctgttgct tgaccaagct 7920

cttgtatcag acgttggaga tagtactgaa gtttccgtta agatgtttga tgcttatgtc 7980

gacacctttt cagcaacttt tagtgttcct atggaaaaac ttaaggcact tgttgctaca 8040

gctcacagcg agttagcaaa gggtgtagct ttagatggtg tcctttctac attcgtgtca 8100

gctgcccgac aaggtgttgt tgataccgat gttgacacaa aggatgttat tgaatgtctc 8160

aaactttcac atcactctga cttagaagtg acaggtgaca gttgtaacaa tttcatgctc 8220

acctataata aggttgaaaa catgacgccc agagatcttg gcgcatgtat tgactgtaat 8280

gcaaggcata tcaatgccca agtagcaaaa agtcacaatg tttcactcat ctggaatgta 8340

aaagactaca tgtctttatc tgaacagctg cgtaaacaaa ttcgtagtgc tgccaagaag 8400

aacaacatac cttttagact aacttgtgct acaactagac aggttgtcaa tgtcataact 8460

actaaaatct cactcaaggg tggtaagatt gttagtactt ggtttaaact tatgcttaag 8520

gccacattat tgtgcgttct tgctgcattg gtttgttaca tcgttatgcc agtacataca 8580

ttgtcaatcc atgatggtta cacaaatgaa atcattggtt acaaagccat tcaggatggt 8640

gtcactcgtg acatcatttc tactgatgat tgttttgcaa ataaacatgc tggttttgac 8700

gcatggttta gccagcgtgg tggttcatac aaaaatgaca aaagctgccc tgtagtagct 8760

gctatcatta caagagagat tggtttcata gtgcctggct taccgggtac tgtgttgaga 8820

gcaatcaatg gtgacttctt gcattttcta cctcgtgttt ttagtgctgt tggcaacatt 8880

tgctacacac cttccaaact cattgagtat agtgattttg ctacctctgc ttgcgttctt 8940

gctgcagagt gtacaatttt taaggatgct atgggcaaac ctgtgccata ttgttatgac 9000

actaatttgc tagagggttc tatttcttat agtgagcttc gtccagacac tcgttatgtg 9060

cttatggatg gttccatcat acagtttcct aacatttacc tggagggttc tgttagagta 9120

gtaacaactt ttgatgctga gtactgtaga catggtacat gcgaaaggtc agaagcaggt 9180

atttgcctat ctaccagtgg tagatgggtt cttaataatg agcattacag agctctatca 9240

ggagttttct gtggtgttga tgcgatgaat ctcatagcta acatctttac tcctcttgtg 9300

caacctgtgg gtgctttaga tgtgtctgct tcagtagtgg ctggtggtat tattgccata 9360

ttggtgactt gtgctgccta ctactttatg aaattcagac gtgcttttgg tgagtacaac 9420

catgttgttg ctgctaatgc acttttgttt ttgatgtctt tcactatact ctgtctggca 9480

ccagcttaca gctttctgcc gggagtctac tcagtctttt acttgtactt gacattctat 9540

ttcaccaatg atgtttcatt cttggctcac cttcaatggt ttgccatgtt ttctcctatt 9600

gtgccttttt ggataacagc aatctatgta ttctgtattt ctctgaagca ctgccattgg 9660

ttctttaaca actatcttag gaaaagagtc atgtttaatg gagttacatt tagtaccttc 9720

gaggaggctg ctttgtgtac ctttttgctc aacaaggaaa tgtacctaaa attgcgtagc 9780

gagacactgt tgccacttac acagtataac aggtatcttg ctctatataa caagtacaag 9840

tatttcagtg gagccttaga tactaccagc tatcgtgaag cagcttgctg ccacttagca 9900

aaggctctaa atgactttag caactcaggt gctgatgttc tctaccaacc accacagaca 9960

tcaatcactt ctgctgttct gcagagtggt tttaggaaaa tggcattccc gtcaggcaaa 10020

gttgaaggat gcatggtaca agtaacctgt ggaactacaa ctcttaatgg attgtggttg 10080

gatgacacag tatactgtcc aagacatgtc atttgcacag cagaagacat gcttaatcct 10140

aactatgaag atctgctcat tcgcaaatcc aaccatagct ttcttgttca ggctggcaat 10200

gttcaacttc gtgttattgg ccattctatg caaaattgtc tgcttaggct taaagttgat 10260

acttctaacc ctaagacacc caagtataaa tttgtccgta tccaacctgg tcaaacattt 10320

tcagttctag catgctacaa tggttcacca tctggtgttt atcagtgtgc catgagacct 10380

aatcatacca ttaaaggttc tttccttaat ggatcatgtg gtagtgttgg ttttaacatt 10440

gattatgatt gcgtgtcttt ctgctatatg catcatatgg agcttccaac aggagtacac 10500

gctggtactg acttagaagg taaattctat ggtccatttg ttgacagaca aactgcacag 10560

gctgcaggta cagacacaac cataacatta aatgttttgg catggctgta tgctgctgtt 10620

atcaatggtg ataggtggtt tcttaataga ttcaccacta ctttgaatga ctttaacctt 10680

gtggcaatga agtacaacta tgaacctttg acacaagatc atgttgacat attgggacct 10740

ctttctgctc aaacaggaat tgccgtctta gatatgtgtg ctgctttgaa agagctgctg 10800

cagaatggta tgaatggtcg tactatcctt ggtagcacta ttttagaaga tgagtttaca 10860

ccatttgatg ttgttagaca atgctctggt gttaccttcc aaggtaagtt caagaaaatt 10920

gttaagggca ctcatcattg gatgctttta actttcttga catcactatt gattcttgtt 10980

caaagtacac agtggtcact gtttttcttt gtttacgaga atgctttctt gccatttact 11040

cttggtatta tggcaattgc tgcatgtgct atgctgcttg ttaagcataa gcacgcattc 11100

ttgtgcttgt ttctgttacc ttctcttgca acagttgctt actttaatat ggtctacatg 11160

cctgctagct gggtgatgcg tatcatgaca tggcttgaat tggctgacac tagcttgtct 11220

ggttataggc ttaaggattg tgttatgtat gcttcagctt tagttttgct tattctcatg 11280

acagctcgca ctgtttatga tgatgctgct agacgtgttt ggacactgat gaatgtcatt 11340

acacttgttt agaaagtcta ctatggtaat gctttagatc aagctatttc catgtgggcc 11400

ttagttattt ctgtaacctc taactattct ggtgtcgtta cgactatcat gtttttagct 11460

agagctatag tgtttgtgtg tgttgagtat tacccattgt tatttattac tggcaacacc 11520

ttacagtgta tcatgcttgt ttattgtttc ttaggctatt gttgctgctg ctactttggc 11580

cttttctgtt tactcaaccg ttacttcagg cttactcttg gtgtttatga ctacttggtc 11640

tctacacaag aatttaggta tatgaactcc caggggcttt tgcctcctaa gagtagtatt 11700

gatgctttca agcttaacat taagttgttg ggtattggag gtaaaccatg tatcaaggtt 11760

gctactgtac agtctaaaat gtctgacgta aagtgcacat ctgtggtact gctctcggtt 11820

cttcaacaac ttagagtaga gtcatcttct aaattgtggg cacaatgtgt acaactccac 11880

aatgatattc ttcttgcaaa agacacaact gaagctttcg agaagatggt ttctcttttg 11940

tctgttttgc tatccatgca gggtgctgta gacattaata ggttgtgcga ggaaatgctc 12000

gataaccgtg ctactcttca ggctattgct tcagaattta gttctttacc atcatatgcc 12060

gcttatgcca ctgcccagga ggcctatgag caggctgtag ctaatggtga ttctgaagtc 12120

gttctcaaaa agttaaagaa atctttgaat gtggctaaat ctgagtttga ccgtgatgct 12180

gccatgcaac gcaagttgga aaagatggca gatcaggcta tgacccaaat gtacaaacag 12240

gcaagatctg aggacaagag ggcaaaagta actagtgcta tgcaaacaat gctcttcact 12300

atgcttagga agcttgataa tgatgcactt aacaacatta tcaacaatgc gcgtgatggt 12360

tgtgttccac tcaacatcat accattgact acagcagcca aactcatggt tgttgtccct 12420

gattatggta cctacaagaa cacttgtgat ggtaacacct ttacatatgc atctgcactc 12480

tgggaaatcc agcaagttgt tgatgcggat agcaagattg ttcaacttag tgaaattaac 12540

atggacaatt caccaaattt ggcttggcct cttattgtta cagctctaag agccaactca 12600

gctgttaaac tacagaataa tgaactgagt ccagtagcac tacgacagat gtcctgtgcg 12660

gctggtacca cacaaacagc ttgtactgat gacaatgcac ttgcctacta taacaattcg 12720

aagggaggta ggtttgtgct ggcattacta tcagaccacc aagatctcaa atgggctaga 12780

ttccctaaga gtgatggtac aggtacaatt tacacagaac tggaaccacc ttgtaggttt 12840

gttacagaca caccaaaagg gcctaaagtg aaatacttgt acttcatcaa aggcttaaac 12900

aacctaaata gaggtatggt gctgggcagt ttagctgcta cagtacgtct tcaggctgga 12960

aatgctacag aagtacctgc caattcaact gtgctttcct tctgtgcttt tgcagtagac 13020

cctgctaaag catataagga ttacctagca agtggaggac aaccaatcac caactgtgtg 13080

aagatgttgt gtacacacac tggtacagga caggcaatta ctgtaacacc agaagctaac 13140

atggaccaag agtcctttgg tggtgcttca tgttgtctgt attgtagatg ccacattgac 13200

catccaaatc ctaaaggatt ctgtgacttg aaaggtaagt acgtccaaat acctaccact 13260

tgtgctaatg acccagtggg ttttacactt agaaacacag tctgtaccgt ctgcggaatg 13320

tggaaaggtt atggctgtag ttgtgaccaa ctccgcgaac ccttgatgca gtctgcggat 13380

gcatcaacgt ttttaaacgg gtttgcggtg taagtgcagc ccgtcttaca ccgtgcggca 13440

caggcactag tactgatgtc gtctacaggg cttttgatat ttacaacgaa aaagttgctg 13500

gttttgcaaa gttcctaaaa actaattgct gtcgcttcca ggagaaggat gaggaaggca 13560

atttattaga ctcttacttt gtagttaaga ggcatactat gtctaactac caacatgaag 13620

agactattta taacttggtt aaagattgtc cagcggttgc tgtccatgac tttttcaagt 13680

ttagagtaga tggtgacatg gtaccacata tatcacgtca gcgtctaact aaatacacaa 13740

tggctgattt agtctatgct ctacgtcatt ttgatgaggg taattgtgat acattaaaag 13800

aaatactcgt cacatacaat tgctgtgatg atgattattt caataagaag gattggtatg 13860

acttcgtaga gaatcctgac atcttacgcg tatatgctaa cttaggtgag cgtgtacgcc 13920

aatcattatt aaagactgta caattctgcg atgctatgcg tgatgcaggc attgtaggcg 13980

tactgacatt agataatcag gatcttaatg ggaactggta cgatttcggt gatttcgtac 14040

aagtagcacc aggctgcgga gttcctattg tggattcata ttactcattg ctgatgccca 14100

tcctcacttt gactagggca ttggctgctg agtcccatat ggatgctgat ctcgcaaaac 14160

cacttattaa gtgggatttg ctgaaatatg attttacgga agagagactt tgtctcttcg 14220

accgttattt taaatattgg gaccagacat accatcccaa ttgtattaac tgtttggatg 14280

ataggtgtat ccttcattgt gcaaacttta atgtgttatt ttctactgtg tttccaccta 14340

caagttttgg accactagta agaaaaatat ttgtagatgg tgttcctttt gttgtttcaa 14400

ctggatacca ttttcgtgag ttaggagtcg tacataatca ggatgtaaac ttacatagct 14460

cgcgtctcag tttcaaggaa cttttagtgt atgctgctga tccagctatg catgcagctt 14520

ctggcaattt attgctagat aaacgcacta catgcttttc agtagctgca ctaacaaaca 14580

atgttgcttt tcaaactgtc aaacccggta attttaataa agacttttat gactttgctg 14640

tgtctaaagg tttctttaag gaaggaagtt ctgttgaact aaaacacttc ttctttgctc 14700

aggatggcaa cgctgctatc agtgattatg actattatcg ttataatctg ccaacaatgt 14760

gtgatatcag acaactccta ttcgtagttg aagttgttga taaatacttt gattgttacg 14820

atggtggctg tattaatgcc aaccaagtaa tcgttaacaa tctggataaa tcagctggtt 14880

tcccatttaa taaatggggt aaggctagac tttattatga ctcaatgagt tatgaggatc 14940

aagatgcact tttcgcgtat actaagcgta atgtcatccc tactataact caaatgaatc 15000

ttaagtatgc cattagtgca aagaatagag ctcgcaccgt agctggtgtc tctatctgta 15060

gtactatgac aaatagacag tttcatcaga aattattgaa gtcaatagcc gccactagag 15120

gagctactgt ggtaattgga acaagcaagt tttacggtgg ctggcataat atgttaaaaa 15180

ctgtttacag tgatgtagaa actccacacc ttatgggttg ggattatcca aaatgtgaca 15240

gagccatgcc taacatgctt aggataatgg cctctcttgt tcttgctcgc aaacataaca 15300

cttgctgtaa cttatcacac cgtttctaca ggttagctaa cgagtgtgcg caagtattaa 15360

gtgagatggt catgtgtggc ggctcactat atgttaaacc aggtggaaca tcatccggtg 15420

atgctacaac tgcttatgct aatagtgtct ttaacatttg tcaagctgtt acagccaatg 15480

taaatgcact tctttcaact gatggtaata agatagctga caagtatgtc cgcaatctac 15540

aacacaggct ctatgagtgt ctctatagaa atagggatgt tgatcatgaa ttcgtggatg 15600

agttttacgc ttacctgcgt aaacatttct ccatgatgat tctttctgat gatgccgttg 15660

tgtgctataa cagtaactat gcggctcaag gtttagtagc tagcattaag aactttaagg 15720

cagttcttta ttatcaaaat aatgtgttca tgtctgaggc aaaatgttgg actgagactg 15780

accttactaa aggacctcac gaattttgct cacagcatac aatgctagtt aaacaaggag 15840

atgattacgt gtacctgcct tacccagatc catcaagaat attaggcgca ggctgttttg 15900

tcgatgatat tgtcaaaaca gatggtacac ttatgattga aaggttcgtg tcactggcta 15960

ttgatgctta cccacttaca aaacatccta atcaggagta tgctgatgtc tttcacttgt 16020

atttacaata cattagaaag ttacatgatg agcttactgg ccacatgttg gacatgtatt 16080

ccgtaatgct aactaatgat aacacctcac ggtactggga acctgagttt tatgaggcta 16140

tgtacacacc acatacagtc ttgcaggctg taggtgcttg tgtattgtgc aattcacaga 16200

cttcacttcg ttgcggtgcc tgtattagga gaccattcct atgttgcaag tgctgctatg 16260

accatgtcat ttcaacatca cacaaattag tgttgtctgt taatccctat gtttgcaatg 16320

ccccaggttg tgatgtcact gatgtgacac aactgtatct aggaggtatg agctattatt 16380

gcaagtcaca taagcctccc attagttttc cattatgtgc taatggtcag gtttttggtt 16440

tatacaaaaa cacatgtgta ggcagtgaca atgtcactga cttcaatgcg atagcaacat 16500

gtgattggac taatgctggc gattacatac ttgccaacac ttgtactgag agactcaagc 16560

ttttcgcagc agaaacgctc aaagccactg aggaaacatt taagctgtca tatggtattg 16620

ccactgtacg cgaagtactc tctgacagag aattgcatct ttcatgggag gttggaaaac 16680

ctagaccacc attgaacaga aactatgtct ttactggtta ccgtgtaact aaaaatagta 16740

aagtacagat tggagagtac acctttgaaa aaggtgacta tggtgatgct gttgtgtaca 16800

gaggtactac gacatacaag ttgaatgttg gtgattactt tgtgttgaca tctcacactg 16860

taatgccact tagtgcacct actctagtgc cacaagagca ctatgtgaga attactggct 16920

tgtacccaac actcaacatc tcagatgagt tttctagcaa tgttgcaaat tatcaaaagg 16980

tcggcatgca aaagtactct acactccaag gaccacctgg tactggtaag agtcattttg 17040

ccatcggact tgctctctat tacccatctg ctcgcatagt gtatacggca tgctctcatg 17100

cagctgttga tgccctatgt gaaaaggcat caaaatattt gcccatagat aaatgtagta 17160

gaatcatacc tgcgcgtgcg cgcgtagagt gttttgataa attcaaagtg aattcaacac 17220

tagaacagta tgttttctgc actgtaaatg cattgccaga aacaactgct gacattgtag 17280

tctttgatga aatctctatg gctactaatt atgacttgag tgttgtcaat gctagacttc 17340

gtgcaaaaca ctacgtctat attggcgatc ctgctcaatt accagccccc cgcacattgc 17400

tgactaaagg cacactagaa ccagaatatt ttaattcagt gtgcagactt atgaaaacaa 17460

taggtccaga catgttcctt ggaacttgtc gccgttgtcc tgctgaaatt gttgacactg 17520

tgagtgcttt agtttatgac aataagctaa aagcacacaa ggagaagtca gctcaatgct 17580

tcaaaatgtt ctacaaaggt gttattacac atgatgtttc atctgcaatc aacagacctc 17640

aaataggcgt tgtaagagaa tttcttacac gcaatcctgc ttggagaaaa gctgttttta 17700

tctcacctta taattcacag aacgctgtag cttcaaaaat cttaggattg cctacgcaga 17760

ctgttgattc atcacagggt tctgaatatg actatgtcat attcacacaa actactgaaa 17820

cagcacactc ttgtaatgtc aaccgcttca atgtggctat cacaagggca aaaattggca 17880

ttttgtgcat aatgtctgat agagatcttt atgacaaact gcaatttaca agtctagaaa 17940

taccacgtcg caatgtggct acattacaag cagaaaatgt aactggactt tttaaggact 18000

gtagtaagat cattactggt cttcatccta cacaggcacc tacacacctc agcgttgata 18060

taaagttcaa gactgaagga ttatgtgttg acataccagg cataccaaag gacatgacct 18120

accgtagact catctctatg atgggtttca aaatgaatta ccaagtcaat ggttacccta 18180

atatgtttat cacccgcgaa gaagctattc gtcacgttcg tgcgtggatt ggctttgatg 18240

tagagggctg tcatgcaact agagatgctg tgggtactaa cctacctctc cagctaggat 18300

tttctacagg tgttaactta gtagctgtac cgactggtta tgttgacact gaaaataaca 18360

cagaattcac cagagttaat gcaaaacctc caccaggtga ccagtttaaa catcttatac 18420

cactcatgta taaaggcttg ccctggaatg tagtgcgtat taagatagta caaatgctca 18480

gtgatacact gaaaggattg tcagacagag tcgtgttcgt cctttgggcg catggctttg 18540

agcttacatc aatgaagtac tttgtcaaga ttggacctga aagaacgtgt tgtctgtgtg 18600

acaaacgtgc aacttgcttt tctacttcat cagatactta tgcctgctgg aatcattctg 18660

tgggttttga ctatgtctat aacccattta tgattgatgt tcagcagtgg ggctttacgg 18720

gtaaccttca gagtaaccat gaccaacatt gccaggtaca tggaaatgca catgtggcta 18780

gttgtgatgc tatcatgact agatgtttag cagtccatga gtgctttgtt aagcgcgttg 18840

attggtctgt tgaataccct attataggag atgaactgag ggttaattct gcttgcagaa 18900

aagtacaaca catggttgtg aagtctgcat tgcttgctga taagtttcca gttcttcatg 18960

acattggaaa tccaaaggct atcaagtgtg tgcctcaggc tgaagtagaa tggaagttct 19020

acgatgctca gccatgtagt gacaaagctt acaaaataga ggaactcttc tattcttatg 19080

ctacacatca cgataaattc actgatggtg tttgtttgtt ttggaattgt aacgttgatc 19140

gttacccagc caatgcaatt gtgtgtaggt ttgacacaag agtcttgtca aacttgaact 19200

taccaggctg tgatggtggt agtttgtatg tgaataagca tgcattccac actccagctt 19260

tcgataaaag tgcatttact aatttaaagc aattgccttt cttttactat tctgatagtc 19320

cttgtgagtc tcatggcaaa caagtagtgt cggatattga ttatgttcca ctcaaatctg 19380

ctacgtgtat tacacgatgc aatttaggtg gtgctgtttg cagacaccat gcaaatgagt 19440

accgacagta cttggatgca tataatatga tgatttctgc tggatttagc ctatggattt 19500

acaaacaatt tgatacttat aacctgtgga atacatttac caggttacag agtttagaaa 19560

atgtggctta taatgttgtt aataaaggac actttgatgg acacgccggc gaagcacctg 19620

tttccatcat taataatgct gtttacacaa aggtagatgg tattgatgtg gagatctttg 19680

aaaataagac aacacttcct gttaatgttg catttgagct ttgggctaag cgtaacatta 19740

aaccagtgcc agagattaag atactcaata atttgggtgt tgatatcgct gctaatactg 19800

taatctggga ctacaaaaga gaagccccag cacatgtatc tacaataggt gtctgcacaa 19860

tgactgacat tgccaagaaa cctactgaga gtgcttgttc ttcacttact gtcttgtttg 19920

atggtagagt ggaaggacag gtagaccttt ttagaaacgc ccgtaatggt gttttaataa 19980

cagaaggttc agtcaaaggt ctaacacctt caaagggacc agcacaagct agcgtcaatg 20040

gagtcacatt aattggagaa tcagtaaaaa cacagtttaa ctactttaag aaagtagacg 20100

gcattattca acagttgcct gaaacctact ttactcagag cagagactta gaggatttta 20160

agcccagatc acaaatggaa actgactttc tcgagctcgc tatggatgaa ttcatacagc 20220

gatataagct cgagggctat gccttcgaac acatcgttta tggagatttc agtcatggac 20280

aacttggcgg tcttcattta atgataggct tagccaagcg ctcacaagat tcaccactta 20340

aattagagga ttttatccct atggacagca cagtgaaaaa ttacttcata acagatgcgc 20400

aaacaggttc atcaaaatgt gtgtgttctg tgattgatct tttacttgat gactttgtcg 20460

agataataaa gtcacaagat ttgtcagtga tttcaaaagt ggtcaaggtt acaattgact 20520

atgctgaaat ttcattcatg ctttggtgta aggatggaca tgttgaaacc ttctacccaa 20580

aactacaagc aagtcaagcg tggcaaccag gtgttgcgat gcctaacttg tacaagatgc 20640

aaagaatgct tcttgaaaag tgtgaccttc agaattatgg tgaaaatgct gttataccaa 20700

aaggaataat gatgaatgtc gcaaagtata ctcaactgtg tcaatactta aatacactta 20760

ctttagctgt accctacaac atgagagtta ttcactttgg tgctggctct gataaaggag 20820

ttgcaccagg tacagctgta ctcagacaat ggttgccaac tggcacacta cttgtcgatt 20880

cagatcttaa tgacttcgtc tccgacgcag attctacttt aattggagac tgtgcaacag 20940

tacatacggc taataaatgg gaccttatta ttagcgatat gtatgaccct aagaccaaac 21000

atgtgacaaa agagaatgac tctaaagaag ggtttttcac ttatctgtgt ggatttataa 21060

agcaaaaact agccctgggt ggttctatag ctgtaaagat aacagagcat tcttggaatg 21120

ctgaccttta caagcttatg ggccatttct catggtggac agcttttgtt acaaatgtaa 21180

atgcatcatc atcggaagca tttttaattg gggctaacta tcttggcaag ccgaaggaac 21240

aaattgatgg ctataccatg catgctaact acattttctg gaggaacaca aatcctatcc 21300

agttgtcttc ctattcactc tttgacatga gcaaatttcc tcttaaatta agaggaactg 21360

ctgtaatgtc tcttaaggag aatcaaatca atgatatgat ttattctctt ctggaaaaag 21420

gtaggcttat cattagagaa aacaacagag ttgtggtttc aagtgatatt cttgttaata 21480

actaaacgaa catgtttatt ttcttattat ttcttactct cactagtggt agtgaccttg 21540

accggtgcac cacttttgat gatgttcaag ctcctaatta cactcaacat acttcatcta 21600

tgaggggggt ttactatcct gatgaaattt ttagatcaga cactctttat ttaactcagg 21660

atttatttct tccattttat tctaatgtta cagggtttca tactattaat catacgtttg 21720

acaaccctgt catacctttt aaggatggta tttattttgc tgccacagag aaatcaaatg 21780

ttgtccgtgg ttgggttttt ggttctacca tgaacaacaa gtcacagtcg gtgattatta 21840

ttaacaattc tactaatgtt gttatacgag catgtaactt tgaattgtgt gacaaccctt 21900

tctttgctgt ttctaaaccc atgggtacac agacacatac tatgatattc gataatgcat 21960

ttaattgcac tttcgagtac atatctgatg ccttttcgct tgatgtttca gaaaagtcag 22020

gtaattttaa acacttacga gagtttgtgt ttaaaaataa agatgggttt ctctatgttt 22080

ataagggcta tcaacctata gatgtagttc gtgatctacc ttctggtttt aacactttga 22140

aacccatttt taagttgcct cttggtatta acattacaaa ttttagagcc attcttacag 22200

cctttttacc tgctcaagac acttggggca cgtcagctgc agcctatttt gttggctatt 22260

taaagccaac tacatttatg ctcaagtatg atgaaaatgg tacaatcaca gatgctgttg 22320

attgttctca aaatccactt gctgaactca aatgctctgt taagagcttt gagattgaca 22380

aaggaattta ccagacctct aatttcaggg ttgttccctc aagagatgtt gtgagattcc 22440

ctaatattac aaacttgtgt ccttttggag aggtttttaa tgctactaaa ttcccttctg 22500

tctatgcatg ggagaggaaa agaatttcta attgtgttgc tgattactct gtgctctaca 22560

actcaacatt tttttcaacc tttaagtgct atggcgtttc tgccactaag ttgaatgatc 22620

tttgcttctc caatgtctat gcagattctt ttgtagtcaa gggagatgat gtaagacaaa 22680

tagcgccagg acaaactggt gttattgctg attataatta taaattgcca gatgatttca 22740

tgggttgtgt ccttgcttgg aatactagga acattgatgc tacttcaact ggtaattata 22800

attataaata taggtatctt agacatggca agcttaggcc ctttgagaga gacatatcta 22860

atgtgccttt ctcccctgat ggcaaacctt gcaccccacc tgctcttaat tgttattggc 22920

cattaaatga ttatggtttt tacaccacta ctggcattgg ctaccaacct tacagagttg 22980

tagtactttc ttttgaactt ttaaatgcac cggccacggt ttgtggacca aaattatcca 23040

ctgaccttat taagaaccag tgtgtcaatt ttaattttaa tggactcact ggtactggtg 23100

tgttaactcc ttcttcaaag agatttcaac catttcaaca atttggccgt gatgtttctg 23160

atttcactga ttccgttcga gatcctaaaa catctgaaat attagacatt tcaccttgct 23220

cttttggggg tgtaagtgta attacacctg gaacaaatgc ttcatctgaa gttgctgttc 23280

tatatcaaga tgttaactgc actgatgttt ctacagcaat tcatgcagat caactcacac 23340

cagcttggcg catatattct actggaaaca atgtattcca gactcaagca ggctgtctta 23400

taggagctga gcatgtcgac acttcttatg agtgcgacat tcctattgga gctggcattt 23460

gtgctagtta ccatacagtt tctttattac gtagtactag ccaaaaatct attgtggctt 23520

atactatgtc tttaggtgct gatagttcaa ttgcttactc taataacacc attgctatac 23580

ctactaactt ttcaattagc attactacag aagtaatgcc tgtttctatg gctaaaacct 23640

ccgtagattg taatatgtac atctgcggag attctactga atgtgctaat ttgcttctcc 23700

aatatggtag cttttgcaca caactaaatc gtgcactctc aggtattgct gctgaacagg 23760

atcgcaacac acgtgaagtg ttcgctcaag tcaaacaaat gtacaaaacc ccaactttga 23820

aagattttgg tggttttaat ttttcacaaa tattacctga ccctctaaag ccaactaaga 23880

ggtcttttat tgaggacttg ctctttaata aggtgacact cgctgatgct ggcttcatga 23940

agcaatatgg cgaatgccta ggtgatatta atgctagaga tctcatttgt gcgcagaagt 24000

tcaatggact tacagtgttg ccacctctgc tcactgatga tatgattgct gcctacactg 24060

ctgctctagt tagtggtact gccactgctg gatggacatt tggtgctggc gctgctcttc 24120

aaataccttt tgctatgcaa atggcatata ggttcaatgg cattggagtt acccaaaatg 24180

ttctctatga gaaccaaaaa caaatcgcca accaatttaa caaggcgatt agtcaaattc 24240

aagaatcact tacaacaaca tcaactgcat tgggcaagct gcaagacgtt gttaaccaga 24300

atgctcaagc attaaacaca cttgttaaac aacttagctc taattttggt gcaatttcaa 24360

gtgtgctaaa tgatatcctt tcgcgacttg ataaagtcga ggcggaggta caaattgaca 24420

ggttaattac aggcagactt caaagccttc aaacctatgt aacacaacaa ctaatcaggg 24480

ctgctgaaat cagggcttct gctaatcttg ctgctactaa aatgtctgag tgtgttcttg 24540

gacaatcaaa aagagttgac ttttgcggaa agggctacca ccttatgtcc ttcccacaag 24600

cagccccgca tggtgttgtc ttcctacatg tcacgtatgt gccatcccag gagaggaact 24660

tcaccacagc gccagcaatt tgtcatgaag gcaaagcata cttccctcgt gaaggtgttt 24720

ttgtgtttaa tggcacttct tggtttatta cacagaggaa cttcttttct ccacaaataa 24780

ttactacaga caatacattt gtctcaggaa attgtgatgt cgttattggc atcattaaca 24840

acacagttta tgatcctctg caacctgagc ttgactcatt caaagaagag ctggacaagt 24900

acttcaaaaa tcatacatca ccagatgttg atcttggcga catttcaggc attaacgctt 24960

ctgtcgtcaa cattcaagaa gaaattgacc gcctcaatga ggtcgctaaa aatttaaatg 25020

aatcactcat tgaccttcaa gaattgggaa aatatgagca atatattaaa tggccttggt 25080

atgtttggct cggcttcatt gctggactaa ttgccatcgt catggttaca atcttgcttt 25140

gttgcatgac tagttgttgc agttgcctca agggtgcatg ctcttgtggt tcttgctgca 25200

agtttgatga ggatgactct gagccagttc tcaagggtgt caaattacat tacacataaa 25260

cgaacttatg gatttgttta tgagattttt tactcttgga tcaattactg cacagccagt 25320

aaaaattgac aatgcttctc ctgcaagtac tgttcatgct acagcaacga taccgctaca 25380

agcctcactc cctttcggat ggcttgttat tggcgttgca tttcttgctg tttttcagag 25440

cgctaccaaa ataattgcgc tcaataaaag atggcagcta gccctttata agggcttcca 25500

gttcatttgc aatttactgc tgctatttgt taccatctat tcacatcttt tgcttgtcgc 25560

tgcaggtatg gaggcgcaat ttttgtacct ctatgccttg atatattttc tacaatgcat 25620

caacgcatgt agaattatta tgagatgttg gctttgttgg aagtgcaaat ccaagaaccc 25680

attactttat gatgccaact actttgtttg ctggcacaca cataactatg actactgtat 25740

accatataac agtgtcacag atacaattgt cgttactgca ggtgacggca tttcaacacc 25800

aaaactcaaa gaagactacc aaattggtgg ttattctgag gattggcact caggtgttaa 25860

agactatgtc gttgtacatg gctatttcac cgaagtttac taccagcttg agtctacaca 25920

aattactaca gacactggta ttgaaaatgc tacattcttc atctttaaca agcttgttaa 25980

agacccaccg aatgtgcaaa tacacacaat cgacggctct tcaggagttg caaatccagc 26040

aatggatcca atttatgatg agccgacgac gactactagc gtgcctttgt aagcacaaga 26100

aagtgagtac gaacttatgt actcattcgt ttcggaagaa acaggtacgt taatagttaa 26160

tagcgtactt ctttttcttg ctttcgtggt attcttgcta gtcacactag ccatccttac 26220

tgcgcttcga ttgtgtgcgt actgctgcaa tattgttaac gtgagtttag taaaaccaac 26280

ggtttacgtc tactcgcgtg ttaaaaatct gaactcttct gaaggagttc ctgatcttct 26340

ggtctaaacg aactaactat tattattatt ctgtttggaa ctttaacatt gcttatcatg 26400

gcagacaacg gtactattac cgttgaggag cttaaacaac tcctggaaca atggaaccta 26460

gtaataggtt tcctattcct agcctggatt atgttactac aatttgccta ttctaatcgg 26520

aacaggtttt tgtacataat aaagcttgtt ttcctctggc tcttgtggcc agtaacactt 26580

gcttgctttg tgcttgctgc tgtctacaga attaattggg tgactggcgg gattgcgatt 26640

gcaatggctt gtattgtagg cttgatgtgg cttagctact tcgttgcttc cttcaggctg 26700

tttgctcgta cccgctcaat gtggtcattc aacccagaaa caaacattct tctcaatgtg 26760

cctctccggg ggacaattgt gaccagaccg ctcatggaaa gtgaacttgt cattggtgct 26820

gtgatcattc gtggtcactt gcgaatggcc ggacactccc tagggcgctg tgacattaag 26880

gacctgccaa aagagatcac tgtggctaca tcacgaacgc tttcttatta caaattagga 26940

gcgtcgcagc gtgtaggcac tgattcaggt tttgctgcat acaaccgcta ccgtattgga 27000

aactataaat taaatacaga ccacgccggt agcaacgaca atattgcttt gctagtacag 27060

taagtgacaa cagatgtttc atcttgttga cttccaggtt acaatagcag agatattgat 27120

tatcattatg aggactttca ggattgctat ttggaatctt gacgttataa taagttcaat 27180

agtgagacaa ttatttaagc ctctaactaa gaagaattat tcggagttag atgatgaaga 27240

acctatggag ttagattatc cataaaacga acatgaaaat tattctcttc ctgacattga 27300

ttgtatttac atcttgcgag ctatatcact atcaggagtg tgttagaggt acgactgtac 27360

tactaaaaga accttgccca tcaggaacat acgagggcaa ttcaccattt caccctcttg 27420

ctgacaataa atttgcacta acttgcacta gcacacactt tgcttttgct tgtgctgacg 27480

gtactcgaca tacctatcag ctgcgtgcaa gatcagtttc accaaaactt ttcatcagac 27540

aagaggaggt tcaacaagag ctctactcgc cactttttct cattgttgct gctctagtat 27600

ttttaatact ttgcttcacc attaagagaa agacagaatg aatgagctca ctttaattga 27660

cttctatttg tgctttttag cctttctgct attccttgtt ttaataatgc ttattatatt 27720

ttggttttca ctcgaaatcc aggatctaga agaaccttgt accaaagtct aaacgaacat 27780

gaaacttctc attgttttga cttgtatttc tctatgcagt tgcatacgca ctgtagtaca 27840

gcgctgtgca tctaataaac ctcatgtgct tgaagatcct tgtcctactg gttaccaacc 27900

tgaatggaat ataaggtaca acactagggg taatacttat agcactgctt ggctttgtgc 27960

tctaggaaag gttttacctt ttcatagatg gcacactatg gttcaaacat gcacacctaa 28020

tgttactatc aactgtcaag atccagctgg tggtgcgctt atagctaggt gttggtacct 28080

tcatgaaggt caccaaactg ctgcatttag agacgtattt gttgttttaa ataaacgaac 28140

aaattaaaat gtctgataat ggaccccaat caaaccaacg tagtgccccc cgcattacat 28200

ttggtggacc cacagattca actgacaata accagaatgg aggacgcaat ggggcaaggc 28260

caaaacagcg ccgaccccaa ggtttaccca ataatactgc gtcttggttc acagctctca 28320

ctcagcatgg caaggaggaa cttagattcc ctcgaggcca gggcgttcca atcaacacca 28380

atagtggtcc agatgaccaa attggctact accgaagagc tacccgacga gttcgtggtg 28440

gtgacggcaa aatgaaagag ctcagcccca gatggtactt ctattaccta ggaactggcc 28500

cagaagcttc acttccctac ggcgctaaca aagaaggcat cgtatgggtt gcaactgagg 28560

gagccttgaa tacacccaaa gaccacattg gcacccgcaa tcctaataac aatgctgcca 28620

ccgtgctaca acttcctcaa ggaacaacat tgccaaaagg cttctacgca gagggaagca 28680

gaggcggcag tcaagcctct tctcgctcct catcacgtag tcgcggtaat tcaagaaatt 28740

caactcctgg cagcagtagg ggaaattctc ctgctcgaat ggctagcgga ggtggtgaaa 28800

ctgccctcgc gctattgctg ctagacagat tgaaccagct tgagagcaaa gtttctggta 28860

aaggccaaca acaacaaggc caaactgtca ctaagaaatc tgctgctgag gcatctaaaa 28920

agcctcgcca aaaacgtact gccacaaaac agtacaacgt cactcaagca tttgggagac 28980

gtggtccaga acaaacccaa ggaaatttcg gggaccaaga cctaatcaga caaggaactg 29040

attacaaaca ttggccgcaa attgcacaat ttgctccaag tgcctctgca ttctttggaa 29100

tgtcacgcat tggcatggaa gtcacacctt cgggaacatg gctgacttat catggagcca 29160

ttaaattgga tgacaaagat ccacaattca aagacaacgt catactgctg aacaagcaca 29220

ttgacgcata caaaacattc ccaccaacag agcctaaaaa ggacaaaaag aaaaaaactg 29280

atgaagctca gcctttgccg cagagacaaa agaagcagcc cactgtgact cttcttcctg 29340

cggctgacat ggatgatttc tccagacaac ttcaaaattc catgagtgga gcttctgctg 29400

attcaactca ggcataaaca ctcatgatga ccacacaagg cagatgggct atgtaaacgt 29460

tttcgcaatt ccgtttacga tacatagtct actcttgtgc agaatgaatt ctcgtaacta 29520

aacagcacaa gtaggtttag ttaactttaa tctcacatag caatctttaa tcaatgtgta 29580

acattaggga ggacttgaaa gagccaccac attttcatcg aggccacgcg gagtacgatc 29640

gagggtacag tgaataatgc tagggagagc tgcctatatg gaagagccct aatgtgtaaa 29700

attaatttta gtagtgctat ccccatgtga ttttaatagc ttcttaggag aatgacaaaa 29760

Claims (9)

1. the gene of a SARS virus, its sequence is the nucleotide sequence of listing among the SEQ ID No:1.

2. dna vaccination is comprising the nucleotide sequence of the 25876bp-26255bp of the 28224bp-29511bp of 26395bp-27147bp, the SEQ ID No:1 of 26115bp-26436bp, the SEQ ID No:1 of 23391bp-25319bp, the SEQ ID No:1 of 21492bp-23449bp, the SEQ ID No:1 of SEQ ID No:1 or SEQ ID No:1.

3. a protein vaccine wherein contains the coded protein of the nucleotide sequence described in the claim 2.

4. an adenovirus carrier vaccine wherein contains the nucleotide sequence described at least one claim 2.

5. a carrier comprises nucleotide sequence according to claim 1.

6. the host cell that contains carrier according to claim 5, wherein said cell are prokaryotic cell prokaryocyte or eukaryotic cell.

7. host cell according to claim 6, the protein involved of wherein said cell expressing SARS virus.

8. nucleic acid probe comprises at least 15 Nucleotide, can be with containing SEQ ID No:1 the nucleotide sequence of listed nucleotide sequence carry out specific hybridization.

9. nucleic acid probe according to claim 8, wherein said probe carries out mark with detectable marker, can be used for the SARS INFECTION IN DETECTION.

Images