TWI297359B - Surface display vector of sars virus antigen and microorganisms transfomred thereby - Google Patents

Description

1297359 IX. Description of the Invention: [Technical Field] The present invention relates to a carrier capable of exhibiting an antigen of SARS on a surface of a microorganism, and a microorganism transformed by the carrier, and a vaccine for preventing SARS, which comprises a transformed microorganism and a substance naturally extracted or purified from the microorganism; in particular, a surface expression vector comprising a gene encoding a SARS antigen causing SARS, at least one encoding polypro-gamma glutamic acid The pgsB, pgsC and pgsA genes of p〇ly-gamma_glutamic acid synthase and a transformed microorganism, wherein the poly-gamma-glutamic acid synthase complex is a microbial surface Insect module; and in particular, a SARS vaccine containing microorganisms that have been transformed. [Prior Art] Severe Acute Respiratory Syndrome (SARS) is a new type of epidemic disease. It has spread to Hong Kong and Singapore since the first case occurred in Guangdong Province in November 2002. In Canada (Toronto) and other places, the symptoms include fever (temperature more than 38 degrees Celsius), cough, dyspnea, and respiratory symptoms such as atypical pneumonia 'have been confirmed by a mutant coronavirus (c〇r〇nav) |rus) caused. In general, members of the coronavirus are mostly large rna viruses and have a positive-chain rna-specific structure. The genetic composition of the coronavirus contains approximately 29 to 3100 (bases) and is named under the microscope for turning or diverging. This facial virus causes upper respiratory tract disease in human 1297359, but on animals. It causes respiratory, gastrointestinal, liver, nerve and other related diseases. The coronaviruses present in nature can be divided into three categories. The first and second types of sickle viruses are infected with mammals, and the third is birds. These coronaviruses, known to exist in nature, often cause lung-related diseases in humans, especially those with weak immune systems, and in other animals such as dogs, cats, pigs, old breasts, birds, etc. It can also cause serious illness. Coronavirus has a high mutation rate and a high recombination rate of about 25%, so it is generally presumed that it is susceptible to mutation to produce a novel state of a mutant coronavirus (such as SRAS coronavirus), and can also be self- Animals spread to humans. According to the World Health Organization (WHO), from November 2002 to May 12, 2003, there were 7,447 possible SARS cases in 31 countries in the world, of which 551 were The patient has died of SARS infection. In the year of 2003, the risk-infected areas of SARS included Beijing, Guangdong, Hong Kong, Inner Mongolia, Shanxi, and Tianjin in China; in other countries, including Singapore, Toronto, and Canada.) Ancient Uzbekistan, and the Philippines and other places 'have the danger of spreading to other parts of the world.

The SARS coronavirus that erupted in 2002 was first decoded by a team of tropical medical research centers in Germany to decode the nucleic acid sequence of the SARS virus. (pcR; p〇|ymerase Chain Reaction) was amplified and confirmed to be a coronavirus. Subsequently, Artus GmbH 1297359, Germany, used this decoding result to develop a rapid SARS reagent that amplifies the virus gene and diagnoses whether the patient is infected with SARS. To date, the genome of the SARS virus (gen〇me) has been decoded, and more than 12 strains have been subjected to complete sequence analysis. The first sequence of the virus sequence that has been completely sequenced is from the United States. The research team led by the Center for Disease Control and Prevention (CDC) Pau丨A_R〇ta published and published in the journal Sdence, and in commemoration of the World Health Organization Dr. Urbani The strain was named the Albany strain (u "banj strajn". In the same issue of the scientific journal, the Canadian Columbia Cancer Research Center (Canada Brit_|sh)

Columbia Cancer search center) The research team led by Marco A. Marra also published a virus strain that was sequenced from a Toronto SARS patient on April 12, 2003. Named Toronto strain br2 strain). Although the coronaviruses sequenced by the above two research teams were taken from different places and different patients, the sequence of the two coronaviruses was only 15 base pairs, so it can be speculated that the SARS system is from the same virus. Caused by. The SARS coronavirus can be known by genetic analysis, and its protein-forming structure is not much different from the coronavirus that has been found in nature today, but its genome and amino acid are greatly different. For example, Rat hepatitis virus and turkey bronchitis virus are similar to SARS coronavirus, but the association of SARS coronavirus with other coronaviruses can be known by molecular taxonomic analysis. The SARS coronavirus is indeed different from other coronaviruses that have been discovered today. 1297359 It is known that SARS is first detected by polymerized chain reaction (PCR), which separates the virus and carries out cell culture, and then amplifies the polymerized 晦 chain reaction to confirm whether the patient is infected with SARS coronavirus; other methods such as enzyme Immunoassay (EL|SA) and immunofluorescence assay (IFA) can also be used to determine whether a patient's serum antibody is positive to determine whether it is infected with SARS.目 il did not develop a method that can completely cure SARS. Only a supporting therapy can be used for patients, and the SARS coronavirus that causes this epidemic disease is still in a preliminary research stage. Vaccines that can prevent SARS have not yet been developed, but research on SARS in countries around the world is actively being carried out in order to develop vaccines that can prevent SARS as early as possible. The technique of attaching and expressing the protein to be expressed on the surface of a microbial cell is referred to as a cell surface display technology. Cell surface expression technology is a surface anchoring motif by using proteins on the surface of microorganisms such as bacteria or yeast, and its application range includes recombination of live vaccines. Establish a database of petide/antibody (丨jbrary) and screening, cell absorbable, and catalyst for cell biotransformation, etc., and thus have industrial Great development potential. In the subsequent development of cell surface representation technology, surface mosaic module is an important core key. The core of this technology is that it can select and develop a model of 1297359 in the microbial cell table to effectively express allogeneic protein. . Therefore, in order to select the appropriate surface mosaic module, the following characteristics should be considered: (1) It must have a secretation signal to help the foreign body protein transfer through the cellular inner membrane. Cell surface. (2) It must have a target message to help the foreign body protein to be firmly fixed in the outer membrane of the cell (ce丨丨u|a "〇ute" membrane). (3) can be expressed on the cell surface in large quantities. However, it does not affect the growth of cells. (4) It has nothing to do with protein size, and can display foreign proteins without changing the three-dimensional structure of proteins. However, surface mosaic modules that fully meet the above conditions have not yet been developed. Pathways can be roughly divided into four categories: ce||〇uter membrane proteins, lipoproteins, 丨ipoproteins, secret 〇ry proteins, and surface organ proteins. For example, flagella protein. For example, LamB, PhoE has been found on gram negative bacteria (cf. Charbit et al., J. Immunol., 139: 1658, 1987;

Agterberg et al" Vaccine, 8:85, 1990) and OmpA and other proteins present on the outer cell membrane and TraT (Felici et al" 丄Mol_Biol" 222:301,1991) and PAL (peptidoglycan associated lipoprotein) (Fuchs et Al., Bio/Technology, 9:1369, 1991) and Lpp (Francisco et al_, Proc. NatL Acad. Sci_ USA, 489:2713, 1992) and other lipoproteins. Others also include the first type of pili (type 1 Fimbriae) FimA and FimH (Hedegaard et al_, Gene, 85:115, 1989) and other fimbriae proteins, and PapApilu subunit and other pili proteins can be used as surface mosaic modules. It exhibits allogeneic proteins. In addition, studies have indicated that ice nucleation proteins (Jung et al., Nat. Biotechnol., 16: 576, 1998; 11 1297359)

Jung et al., Enzyme Microb. Technol., 22:348, 1998; Lee et aL, Nat

Biotechnol" 18.645, 2000), at Klebsiela oxytoca (Kornacker et al_, Mol·

Microl·, 4:1101, 1990) IgA protease on bacterial bacterial pruning enzyme (pu||u|anase) 'Neisseria (Klauser et al) EMB〇丄, 9:1991, 1990) Protease), AIDA-1 on Escherichia coli, VirG protein on Shigella, Lpp, and fusion protein of OmpA can be used as surface dysfunction modules. In Gram's gram positive bacteria, studies have shown that malaria antigen can be encoded by the A protein from Staphy丨〇c〇ccus aureus-derivedprotein and the FnBPB protein. It is effectively expressed as a mosaic module, and lactic acid bacteria are expressed by surface coat protein; others can be used as mosaic modules: strept〇c〇ccus pyogenes- Derived Me protein (Medaglini, D et al., Pr〇c. Natl. Acad, Sci. USA., 92:6868, 1995) - Bacillus anthracis derived S-layer protein EA1 > and Bacillus subtilis CotB, etc. Providing an effective microorganism a vector for displaying a foreign protein on the surface of a cell, which is a surface-inserted module by using a pgSBCA (poly-gamma glutamic acid synthesizing complex gene) gene obtained by a strain of Bacillus genus strain. In addition, the present invention also provides a large amount of A method of expressing (mass_eXpressing) a foreign protein which is caused by a carrier provided by a Korean patent (Application No. 10-2〇〇1-48373) to cause a change in microbial trait (transformed) and to be expressed on the cell surface thereof A method for producing allogeneic proteins. The method of genetic engineering (genetic enginee "ing meth〇d", which stably causes disease-causing, is developed by the above-mentioned surface-embedded module anchoring 12 1297359 motives). Pathogenic antigen or a group of antigens on bacteria. In particular, studies have shown that exogenous immunogens can be expressed on the surface of bacteria that do not cause disease, which are administered orally and produce longer and longer lasting immune responses (immune) Response), just as the vaccine is based on the principle of attenuating (oily scent (10) yi (1) characteristics and causing disease or disease in the month b. The cause of a longer and more durable immune response, part It is also because of the help of the surface structure of bacteria, which can increase the antigen of allogeneic proteins and increase the immune response to living bacteria. The surface expression system can reconstitute live vaccines on bacteria that do not cause disease. The present invention has successfully demonstrated the antigen of the SARS coronavirus, which selects the surface of the microorganism that does not cause disease for gene and protein analysis, such as 丨actic add bacteria' and by rod strain (Bad丨丨us genus strajn) obtained pGSBCA (poly-gamma glutamic acid synthesizing complex gene) gene as The surface is inlaid with a module; and the present invention has developed an economical and effective vaccine for producing antibodies against SARS coronavirus via blood injection or oral administration (causing a mucosal immune response)-microorganism. One of the objects of the present invention is to provide a vector for expressing a SARS coronavirus antigen by a microbial surface expression system, and a microorganism for transferring B (t "ansf〇rm" by this vector. 13 1297359 and another of the present invention - The object is to provide a transformed microorganism which exhibits a sickle I antigen on the cell surface, and a vaccine which can prevent Sars, which is effective for extracting or purifying from microorganisms (purjfy) The SARs coronavirus antigen is provided. According to the above object, the present invention provides a surface expression vector comprising a polygenic γ-flycine synthetase (p〇丨y ga_a g|utamic _ Nabca) which can be encoded. Or a pgsB, pgsc or pgsA gene, and a gene comprising a spine antigen protein or a nuclear sheath antigen protein which can encode a SARS coronavirus. The gene encoding the spine antigen protein of the SARS coronavirus can be used alone or as the base of the silk antigen egg, and contains pgsA. This is often used to encode the synthase of the genus cerevisiae. The genus (4) grasps the heart and adds the gene of talang (2). Among them, the spine antigen protein can be selected from SARS SA, SARS SB, SARS SC, SARS SD or SARS SBC, and the nuclear sheath antigen protein can be selected from SARS NA, SARS NBC. Or SARS N. Further, the present invention provides a microorganism which is transformed by a performance vector, and a method for producing a SARA ticker virus antigen, protein or sputum antigen, protein, and the method further comprises culturing the above microorganism. The microorganism used in the present invention may be selected from microorganisms which are not toxic or have attenuated characteristics in vivo, and may be selected, for example, from Escherichia coli (E. c〇|j) and Salmonella typhimurium (Salmonella). Typhi)> g(Salmonella typhimurium)«(Vibrio cholerae), Myc〇bacterium bovis, and Shige||a are gram negative bacteria; Or Bacillus 14 1297359 (Bacillus), Lactobacillus, Lactococcus, Staphylococcus, usteria monocytogenes, Streptococcus, etc. are Gram-positive bacteria (gram positive bacteria) The species of the strain; in the present invention, 'selected from an edible microorganism such as lactic acid bacteria is a preferred option. Furthermore, the present invention provides a vaccine which can prevent SRAS, comprising a microorganism which extracts an antigen protein on the surface of a cell, a crude form extracted from a broken microbial cell membrane composition, or It is an antigenic protein purified from microorganisms and can be used as an active ingredient in vaccines. The vaccine provided by the present invention can be used as a drug for preventing SARS (SARS is caused by SARS coronavirus). The vaccine provided by the present invention can be administered orally, mixed with food, injected intradermally or intraperitoneally, or administered intranasally (jntranasa|r〇ute). As of the end, it is known that the route of infection with SARS coronavirus causes infection of respiratory organs by exposure to infectious droplets, and it is presumed to be infected on the mucosal surface of the respiratory organs. Therefore, in order to avoid SARS infection, how to make the mucosal surface immune is an important issue. Microorganisms, on the surface of their cells, exhibit the antigenic advantages of SARS coronavirus, which can effectively form antibodies on the surface membrane (mucosal response), so in the way of needle vaccine against SARS coronavirus, by oral or via Nasal 15 1297359 Application will be more effective than parenteral (parentera|). [Embodiment] Some embodiments of the present invention will be described in detail below. However, in addition to the detailed description, the present invention and the invention can be implemented in other practical ways. That is, the scope of the present invention is limited by the scope of the proposed embodiment, and the scope of the patent application proposed by the present invention shall prevail. The prior art to which the present invention pertains is hereby incorporated by reference in its entirety in its entirety herein. The following specific complements according to the present invention are SARS coronary disease spine proteins and genes related to antigenic positions in nuclear sheath proteins, but other types of antigenic protein genes can also be used alone or simultaneously in other specific embodiments of the present invention. In the following specific examples, the pgsBCA gene used on the extracellular membrane protein was obtained from Bacillus subtilis var_chungkookjang, and this protein was involved in the synthesis of polymorphogenetic glutamic acid. Further, the gene containing the vector used in the present invention is selected from the pgsBCA gene obtained from Bacillus genus strain to produce a polymorphism or a microorganism which is transformed by the vector. For example, the vector required for the pgsBCA gene from other strains to be used in the field is compared with the pgsBCA gene present in BacHlus subtilis var chungkookjang, which has more than 80% of the gene sequence. The similarity, wherein the pgsBCA comprises one or more pgsB (SEQ | DN 〇 29), pgsC (SEQ ID NO 30) or pgsA (SEQ ID NO 31). The use of a carrier is also included in the scope of the present invention. Furthermore, in the following specific examples, only the PgSA in the pgsBCA gene is used to constitute the surface expression of 16 1297359, but in the other aspects of the invention, the whole or part of the PgsBCA can be used to constitute the vaccine. The shop is required and thus does not touch the scope of the following specific examples. In the following implementation, the county-owned postal mail a|_e丨|a _丨) and the lactic acid n (LactQbad丨丨us) belonging to Gram-positive bacteria will be used as the host of the carrier. Other types of leather boats are as fine as Gram- _, and the same effect can be achieved according to the transformation method provided by the present invention. In addition, in the following examples, the microorganisms that are transferred by the carrier are used as a living field for the living body, and in the technical field related to the vaccine, it is known that when expressing a protein (SARS coronavirus antigen) When the protein is extracted or purified from a microorganism and administered to a living body, the same or similar results can be obtained. «The first embodiment of the present invention provides for the synthesis of an antigenic position gene on the spine protein f of the SARS coronavirus. The spine protein f of the SARS coronavirus is composed of 1256 amino acids. If the __ crown scale is also tested, it will usually cover the face of the thorns. (enve丨Qpe prctein), the virus structure is exposed, and the location of the virus and the location of the antigen have been widely studied as the target antigen of the vaccine towel (ta "get antigen" to cause or lion Viral infection. In order to select the position of the antigen from the 1256 amino acids from the spine protein of the SARS coronavirus, read the porcine infectious stomach 17 1297359 with swine protein that has been synthesized to study the antigen (swine) Transmissible gastroenteritis (TGE) is a structural comparative analysis of antigens on coronaviruses. It is currently known that there are four antigenic positions (A, B, C, D) on the spine protein of porcine transmissible gastroenteritis coronavirus (see Enjuanes, L_, Virology, 183: 225, 1991). The correlation between these antigenic positions and antigenic positions on the SARS coronavirus spine protein is based on

Kyte_Doolittle, Jameson-wolf, and Emini methods for hydrophilicity, antigenic index, and viral surface likelihood analysis, while SARSSA (SEQ ID NO 34), SARSSB (SEQ ID NO 35), SARSSC (SEQ ID NO 36 And SARS SD (SEQ ID NO 37) was selected and isolated from the spine protein sequence (SEQ ID NO 33) of the Toronto strain (T〇r2 strain) SARS coronavirus, as shown in the first panel. First of all, 'based on the sequenced multiple SARS coronavirus (SARS coronavirus Tor2, SEQ ID NO 32), the sequence isolated from the spine protein (with 21392 to 25259 test sites and 1255 amino acids), The four antigenic sites are selected from positions 2 to 114 of the amino acid, respectively, and are named SARS SA genes, the positions of 375 to 470 are selected, and the SARS SB gene is selected, and the 510th is selected. The position of 596 was named SARS SC gene, and the position of 1117 to 1197 was selected and named SARS SD gene. Among these antigenic positions, the genes located at the SARS SA and SARS SC positions are formed in a synthesized manner. In order to synthesize a SARS SA that conforms to the length of 113 amino acids, a polymerase chain reaction (PCR) is carried out using primers containing coding sequences 1-8 (SEQ ID NOs: 1-8) to obtain amplification. The SARS SA gene has a fragment molecular weight of 339 bp. SEQ ID NO: 1: 5-ggatcctttattttcttattatttcttactctcactagtggtagtgaccttgaccg-3, 18 1297359 SEQ ID NO: 2: 5'-tgagtgtaattaggagcttgaacatcatcaaaagtggtacaacggtcaaggtc- 3 'SEQ ID NO: 3: 5'-aattacactcaacatacttcatctatgcgtggggtttactatcctgatgaaatttttc- 3' SEQ ID NO: 4: 5 '- aaaatggaagaaataaatcctgagttaaataaagagtgtctgaacgaaaaattt -3' SEQ ID NO: 5: 5-cttccattttattctaatgttactgggtttcatactattaatcatacgtttggcaac-3, SEQ ID NO: 6: 5, -ggcagcaaaataaataccatccttaaaaggaatgacagggttgccaaacgtatg-5, SEQ ID NO: 7: 5'-atttattttgctgccacagagaaatcaaatgttgtccgtggttgggtttttgg-3' SEQ ID NO: 8: 5,- Ggtaccaagcttattacacagactgtgacttgttgttcatggtagaaccaaaaaccc-3, and in order to synthesize SARS SC in accordance with the length of 87 amino acids, a polymerization chain reaction (PCR) using primers containing coding sequence 9_14 (SEQ ID NOs: 9-14) is used to obtain amplification The SARSSC gene has a fragment molecular weight of 261 bp. SEQ ID NO: 9: 5-ggatccgtttgtggtccaaaattatctactgaccttattaagaaccagtgtgtcaat-3, SEQ ID NO: 10: 5'-gaagaaggagttaacacaccagtaccagtgagaccattaaaattaaaattgacacact-3 'SEQ ID NO: 11: 5-aactccttcttcaaagcgttttcaaccatttcaacaatttggccgtgatgtttctga-3, SEQ ID NO: 12: 5-ctaaaatttcagatgttttaggatcacgaacagaatcagtgaaatcagaaacat-3, SEQ ID NO: 13: 5'-ctgaaattttagacatttcaccttgtgcttttgggggtgtaagtgtaattaca-3, SEQ ID NO: 14: 5'-ggtaccaagcttattaaacagcaacttcagatgaagcatttgtaccaggtgtaattac-3, in addition, by synthesis step, the following antigenic position genes are obtained: amines at positions 264 to 596 of the gene coding position Base acid, amplified by polymerase chain reaction, and complementary DNA extraction of spine proteins on SARS virus provided by Canada's Michael Smith Genome Science Center The cDNA clone (from the SARS coronavirus Tor2) was used as a template and the primers of the coding sequence 15_16 (SEQ ID NOs: 15-16) were used to obtain the fragment molecule. The 996 bp gene was named SARS SBC (SEQ | DN 〇 19 1297359 38); this gene contains a critical site that is useful to generate neutralizing antiby (see PNAS, 101: 2536). , 2004). SEQ ID NO: 15 (SBC sense): 5-cgcggatccctcaagtatgatgaaaat-3, SEQ ID NO: 16 (SBC anti-sense): 5-cggggtaccttaaacagcaacttcaga-3, 'Second embodiment according to the present invention is provided in SARS The antigenic position gene is synthesized on the nucleocapsid protein of the coronavirus. The nuclear sheath protein of SARS coronavirus consists of 422 amino acids. In previous studies, it was pointed out that on other types of coronavirus, most of the nuclear sheath protein is used as an antigen, and such antigens Location has been widely used as a target antigen in vaccines to induce or prevent infection by viruses. Therefore, 'on the nuclear protein of SARS coronavirus, how to select and synthesize the position of the antigen on the amino acid, and compare it with the nuclear protein on the porcine transmissible gastroenteritis coronavirus ( After comparative analysis). Specifically, I wish that the relationship between the nuclear sheath protein on the infectious gastroenteritis gastrointestinal coronavirus and the nuclear protein on the SARS coronavirus can be made hydrophilic according to the methods of Kyte_D〇〇|ittie, olf and Emini, respectively. Sex (hydr〇phj|jCjty), antigenicity (antjgenjc index) and surface likelihood analysis, and SARS na (seq丨d (10) 4〇) and anti-NB (SEQ丨〇N0 41) from the Toronto strain (Tor2 strain) SARS coronary The nucleocapsid protein of the virus, the sequence (R 39 D NO 39), was selected and isolated as shown in the second figure. First, 'based on the sequence of the sequenced SARS corona virus-h sheath protein shell (with 28i2〇 to four coffee bases and 20 1297359 422 amino acids), The antigenic sites, which are pre-operative as antigens, are selected from positions 2 to 157 in the amino acid, respectively, and are named SARS NA and the positions of 163 to 305 are selected and designated as SARS NB. In the present invention, however, the gene located at the SARS NB position is formed (or produced) in a synthetic manner. In order to synthesize SARS NB corresponding to 143 amino acid lengths, a polymerase chain reaction (PCR) was carried out using primers containing coding sequences 17-26 (SEQ ID NOs: 17-26) to obtain amplification. The SARS NB gene has a molecular weight of 429 bp. SEQ ID NO: 17: 5'_ggatcccctcaaggtacaacattgccaaaaggcttctacgcagagggtagccgtgg-3 'SEQ ID NO: 18: 5'-accacgactacgtgatgaagaacgagaagaggcttgactgccgccacggctacc-3, SEQ ID NO: 19: 5'-cacgtagtcgtggtaattcacgtaattcaactcctggcagcagtcgtggtaat-3, SEQ ID NO: 20: 5'_gcgagggcagtttcaccaccaccgctagccatacgagcaggagaattaccacga-3' SEQ ID NO: 21: 5'_gaaactgccctcgcacttttgctgcttgaccgtttgaaccagcttgagagcaa-3, SEQ ID NO: 22: 5'-tagtgacagtttgaccttgttgttgttggcctttaccagaaactttgctctcaa_3, SEQ ID NO: 23: 5'-caaactgtcactaagaaatctgctgctgaggcatctaaaaagcctcgtcaaaaacgt-3, SEQ ID NO: 24: 5'-ggaccacgacgcccaaatgcttgagtgacgttgtactgttttgtggcagtacgtttttg_3, SEQ ID NO_ 25: 5'-gggcgtcgtggtccagaacaaacccaaggtaatttcggggaccaagaccttatccgt-3' SEQ ID NO. 26: 5-ggtaccaagcttattaaatttgcggccaatgtttgtaatcagtaccttgacggataagg-3, additionally 'genes obtained by the synthesis step to obtain the following antigenic positions: amino acid at positions 2 to 356 of the gene coding position by Michael's Michael Smith gene A complementary DNA clone of the nucleocapsid protein on the SARS virus provided by the Canada's Michael Smith Genome Science Center (from the SARS coronavirus Tor2) Template 21 1297359 (template), and the primers of coding sequence 27-28 (SEQ ID NOs: 27-28) were used to obtain a gene with a fragment molecular weight of 912 bp and designated as SARS N. SEQ ID NO: 27 (N sense): 5-cgcggatcctctgataatggtccgcaa-3, SEQ ID NO: 28 (N anti-sense): 5-cggggtaccttaaatttgcggccaatgttt-3, according to a third embodiment of the present invention: Preparation of pHCE2LB: pgsA -SARS SA and pHCE2LB: pgsA-SARS SC vector for surface performance. The vector pHCE2LB: pgsA-SARS SA and pHCE2LB: pgsA-SARS SC line can display the SARS SA and the antigenic position of the SC gene on the surface of the host cell on the surface of the host cell; wherein the vector is from the strain Bacillus genus The pgsA gene (pgsBCA) on the extracellular membrane protein of strain is involved in the synthesis of polypro-gamma glutamic acid, and microorganisms such as Gram-negative bacteria and Gram-positive bacteria are selected as hosts. First, in order to let the vector know the antigenic position of the SARS SA and SARS SC genes on the spine protein of the SARS coronavirus, the surface expression can be made, and the vector can express the L1 antigen on human papilloma vims (HPV). A surface of a microbial host such as a blue-negative bacterium or a Gram-positive bacterium (this vector has a high-performance HCE promoter (or Xpromotor), a gene involved in polymorphic γ-folinine synthesis, and a protein located on the outer membrane protein. (pgsBCA), and HPV L1 vector applied to pA-negative bacteria and Gram-positive bacteria). PHCE2LB: PgsA-HPVL1 (KCTC 10349BP) is BamH and

Kpnl, two restriction enzymes, digests. The HPVL1 gene was isolated to prepare a pHCE2LB:pgsA vector for surface expression. The SARS SA and SARS sc lines synthesized in the first embodiment are digested by restriction enzymes 22 1297359 (restriction enzyme) BamHI and Kpnl, and with the C-terminal region of the pgsA gene on the outer membrane protein (C-terminal region). Engagement, and this extracellular membrane protein is involved in the synthesis of polypro-gamma glutamic acid when previously prepared surface expression vector pHCE2LB:pgsA, and is compatible with the preparation of pHCE2LB:pgsA_SARS SA and pHCE2LB:pgsA-SARS SC vector ( Translation codon), refer to the third A and third B drawings. The lactic acid bacteria (Lactobacillus) in Gram-positive bacteria are transformed by the surface expression carrier pHCE2LB: pgsA-SARS SA and pHCE2LB: pgsA_SARS SC.

The pHCE2LB:pgsA-SARS SA and pHCE2LB:pgsA-SARS SC plastids present in acid bacteria were examined. According to a fourth embodiment of the invention, there is provided the preparation of a pHCE2LB:pgSA-SAIRS SBC carrier for surface performance. Vector pHCE2LB: The pgsA-SARS SBC line can display the antigenic position of the SARS SBC gene on the spine protein of the SARS coronavirus on the surface of the host cell; wherein the vector is derived from the outer membrane protein of the Bacillus genus strain. The pgsA gene (pgsBCA) is involved in the synthesis of poly-gamma-glutamic acid. First, the surface expression carrier pHCE2LB: pgsA was prepared by the method provided in the third embodiment. According to the content of the first embodiment, a complementary DNA clone of the SARS coronavirus protein (from the ARS coronavirus Tor2) is used as a template to form an amine group. The gene at positions 264 to 596 of the acid position was subjected to a polymerization 晦 chain reaction to be amplified to obtain a SARS SBC gene having a fragment molecular weight of 996 bp. The SARS SBC gene was then inserted into the surface expression vector pHCE2LB:pgsA to prepare pHCE2LB:pgsA_SARS SBC vector (see Figure 3C). Lactobacillus lactic acid 23 1297359 bacteria (Lactobacillus) in the preparation of surface expression carrier pHCE2LB: pgsA_SARS SBC, resulting in trait changes (that is, transformed), and pHCE2LB present in lactic acid bacteria: pgsA-SARS SBC plastid (plasmid) is analyzed and examined.

According to a fifth embodiment of the present invention, there is provided the preparation of pHCE2LB: pgsA-SARS NB carrier for surface performance.

Vector pHCE2LB: The pgsA-SARS NB line can display the antigenic position of the SARS NB gene on the spine protein of the SARS coronavirus on the surface of the host cell; wherein the vector is derived from the extracellular membrane protein of the Bacillus genus strain. The pgsA gene (pgsBCA)' is involved in the synthesis of p〇|y-gamma-glutamic acid. First, the surface expression carrier pHCE2LB: pgsA was prepared by the method provided in the third embodiment. The SARS NB antigen gene system synthesized in the second embodiment is digested by the restriction enzymes BamHI and Kpnl, and the C-terminal region of the pgsA gene on the extracellular membrane protein. Engagement, and this extracellular membrane protein is involved in the synthesis of polypro-gamma glutamic acid when the surface expression vector pHCE2LB:pgsA was previously prepared, and is compatible with the translation codon for preparing pHCE2LB:pgsA_SARS NB vector, reference to Four A picture. The lactic acid bacteria (Lactobacillus) in the Gram-positive bacteria were transformed by the surface expression vector pHCE2LB: pgsA_SARS NB (the trait changed), and the pHCE2LB:pgsA_SARS NB plastid present in the lactic acid bacteria was examined.

According to a sixth embodiment of the present invention, there is provided a method of preparing a pHCE2LB:pgSA-SARS N carrier for surface performance. 24 1297359 Vector pHCE2LB: The PgsA-SARS N line can display the antigenic position of the SARS N gene from the spine protein of the anti-coronavirus on the surface of the host cell; wherein the vector is derived from the extracellular membrane of a Bacillus genus strain. The pgsA gene (pgsBCA) on the protein and is involved in the synthesis of polymorphism. First, the surface expression carrier pHCE2LB:pgSA was prepared by the method provided in the third embodiment. According to the content of the second embodiment, a complementary DNA clone of the SARS coronavirus nucleocapsid protein (from the SARS coronavims Tor2) is used as a template to form an amine group. The gene encoding the 2nd to 3〇5 acid positions was subjected to a polymerization 晦 chain reaction to amplify, and a SARS n gene having a fragment molecular weight of 912 bp was obtained. The SARS N gene was then inserted into the surface expression vector pHCE2LB:pgsA to prepare a pHCE2LB:pgsA-SARS N vector (see Figure 4b). Lactobacillus in Gram-positive bacteria causes a change in traits (ie, transformation) when preparing surface expression vector pHCE2LB: pgsA-SARS N, while pHCE2LB: pgsA-SARS N plastids present in lactic acid bacteria ( Plasmid) is analyzed and tested. According to a seventh embodiment of the present invention, there is provided a method for confirming the surface appearance of a SARS virus thorn antigen protein on lactic acid bacteria (|actic acid bacteria).

Lactobacillus (Lactobaci丨丨us) is transformed by the surface expression vector pHCE2LB: pgsA-SARS SA, pHCE2LB: pgsA-SARS SC and pHCE2LB: pgsA-SARS SBC (that is, the trait changes), so each antigen is tested by individual analysis. The surface manifestation of proteins. SARS disease 25 1297359 venomous antigen conjugated to the C-terminal portion of the pgsA gene of synthetic pro- 7 glutamate, whose antigenic position is expressed by pHCE2LB: pgsA-SARS SA, pHCE2LB: pgsA_SARS SC and PHCE2LB: PgsA -SARS SBC vector transformed by Lactobacillus casei (commonly known as c-bacteria), which is in the 3rt environment, using MRS culture medium (Lactobacillus MRS, Becton Dickinson and

Company Sparks, USA) Culture and reproduction. The results of the surface representation of each of the spine antigens were determined by Western immunochromatography, including the use of SDS-polyacrylamide colloidal electrophoresis, and an antibody specific for pgsA. First, the protein of the entire cell of Lactobacillus casei was denatured to obtain a volume of the same concentration to prepare a sample. It was then analyzed by SDS-polypropylene guanamine colloidal electrophoresis and the fractionated proteins were broken onto PVDF membranes (polyvinylidene-difluoride membranes, Bio-Rad). The protein was then shaken onto the PVDF membrane and shaken in a blocking buffer solution (50 mM Tris HCI, 5% skim milk, pH 8_0) for 1 hour, and then taken from the rabbit with the joint of 95. The antibody was diluted 1000-fold in a blocking buffer solution and reacted for 12 hours. After the reaction, the membrane was washed with a buffer > trough solution, and a biotin-binding antibody which binds to the rabbit antibody was added and diluted in a blocking buffer solution for 1 to 00 times for 4 hours. After completion of this step, the membrane was washed with a buffer solution, and then reacted with an avidin-biotin reagent for 1 hour, and then the membrane was washed with a buffer solution. Hydrogen peroxide and DAB are then added as a substrate to confirm the specific bond formed by the specific antibody with pgsA or the fused protein. In Fig. 5A, the first line is Lact〇bad丨丨us casej with unchanging traits, and the second, third and fourth lines are Kjeldae with changes in traits due to pHCE2LB: pgsA-SARS SA. Lactobacillus. In the picture of No. 26 1297359, Figure 5B, the first line is Lactobacillus eutropha with unchanged traits, and the second, third, fourth, fifth and sixth lines are kelp milk with trait changes due to pHCE2LB: pgsA-SARS SC Bacillus. In the fifth C-picture, the first line is Lactobacillus berghei whose trait is unchanged, and the second line is Lactobacillus johnsonii which has a change in trait due to pHCE2LB: pgsA-SARS SBC.

Referring to Figures 5A through 5C, the specific fused protein (pgSA-SARS SA has a molecular weight of approximately 54 kDa (kilo-Dalton) (figure A), and the pgsA_SARS SC has a molecular weight of approximately 51 kDa (figure B). And the pgsA_SARS SBC molecular weight is approximately 78 kDa (fifth C map)) identified in individual lactic acid bacterial cells. Moreover, in order to determine if individual antigens and pgsA will be expressed in lactic acid fines that cause trait changes due to pHcE2LB:pgsA-SARS SA and pHCE2LB:pgsA-SARS:SBC surface expression vectors, trait changes due to individual vectors The lactic acid fine sputum uses the cell separation method to remove the cell wall and cytoplasm by ultra-high speed centrifugation and divide the cells into several parts. 'In the western point-and-ink method, specific proteins that bind to pgSA are used to determine individual fusion. The location of the protein. Lactobacillus with surface expression of the fusion protein will achieve the same cell concentration by the procedure described above as Lactobacillus with unchanged properties. At a temperature of -60 ° C, these cells were pipetted back into secondary water containing 5 mg/ml lysozyme, 1 mM PMSF and 1 mM EDTA, and thawed back to room temperature with TES buffer solution (10 mM Tris- HCI, ρΗ8·0, lmM EDTA, 25% sucrose) Washing, after several steps, add DNase (CL5 mg/ml) and RNase (0.5mg/ml) and use sound waves to make the cell morphology not complete 27 1297359 complete Sex, then, after the cells are melted, using centrifugation, 1 〇, 〇〇〇Xg, temperature 4. (:, from 20 knives, separating the unmelted Lact〇bad丨丨us (cell granules; that is, the entire intact cell) and the cytoplasmic residue (ie, the suspended ocean in the upper liquid). The resulting cell debris is reused in a way '21,000 X g, temperature 4. 〇, centrifugation, 々, time to obtain fine granules and suspension

The part of the upper liquid towel (the soluble part) contains the cytoplasmic egg. The lysed cell pellets were pumped back and forth with 1% SDS in TE solution (1〇 _ Tris Hc丨, _ imM EDTA, pH 7.4) to obtain the cell wall proteins (part of the cell wall) of Lactobacillus. In the individual parts of Lactobacillus, the SDS-polyacrylamide colloidal electrophoresis method and the pgsA special (D) anti-long-term checkpoint were used to confirm the presence of the spine protein antigen of the SARS disease fused to the pgsA. In the sixth graph, the first line is the Lactobacillus casei whose trait has not changed, and the second line is the part of the entire cell of the Lactobacillus caseiv whose trait changes due to pHCE2LB:pgsA SARS SA, the third and fourth lines respectively It is because the pHCE2LB: pgsA_SARS SA and the altered traits of Lactobacillus kawaii are dissolved in the water and cell wall parts. In the sixth B towel, the sputum line is a trait that does not change the Lactobacillus laurelii, and the 帛 2 lines make the whole cell part of the Lactobacillus kawaii that changes in trait due to pHCE2LB: pgsA_SARS SBC. The 3rd and 4th lines are the parts of Lactobacillus caseiv dissolved in water and cell wall due to pHCE2LB: pgsA_SARS SBCA, respectively. Referring to Figures 6A through 6c, the entire cell and cell wall of the lactic acid bacterium is discernible, the molecular weight of the SARS SA protein fused to pgsA is approximately 54 kDa, and the molecular weight of the SARS SBC protein fused with pgsA is approximately 78 kDa. From these results, it was found that individual SARS antigen proteins fused to pgsA were expressed and transferred to the surface of lactic acid fine 28 1297359 bacteria due to pgsA. Main and 'in the analysis of flow cytometry of fluorescent cell screening analysis, it can be confirmed that the part of the diseased rat protein antigen on the surface of lactic acid bacteria (Lact〇baci|丨us) is due to Acidic synthesizing pr〇tein pgsA c_terminal fusion appears. In immunofluorescence staining, the lactic acid bacteria (Lact〇baci丨丨us) causing the expression were obtained at the same cell concentration. These cells were washed several times with a pBS buffer solution (pBs buffe ", 7 4) with an acid value of 47, and then pumped back and forth with a buffer solution containing 1 〇 /. bovine serum, and at hours and 4 Under the condition of C, a plurality of antibodies derived from mice were added to dilute the 彳〇〇〇 times and the spine antigen reaction of sars virus. After completion of this reaction, the cells were further buffered with pBS having a pH of 74 (PBS buffer). , pH 7_4) washed several times, and then pumped back and forth with 'm丨 buffer solution containing 1% bovine serum. After 3 hours and 4 °C, add biotin-binding biotin-binder antibody diluted 1000 times. The reaction was carried out. After completion of the reaction, the cells were washed several times with a PBS buffer (PBS buffer, pH 7.4) having an acid value of 47, and then pumped back and forth with a buffer solution containing 彳% bovine serum. The streptavidin-R-phycoerythrin dye combined with biotin biotin is diluted 1000-fold.

After completion of this reaction, Lactobacillus was washed several times and analyzed by flow cytometry using fluorescent-activated cells. Compared with the lactic acid bacteria whose traits have not changed, the SBC spine resistance protein of SARS virus will be expressed on the surface of the original lactic acid bacteria. Referring to the sixth c-picture, the gray part is derived from the unaltered Lactobacillus casei, and the white part is from the trait. The altered pHCE2LB: pgsA-SARS SBC/Lactobacillus casei was derived. Sixth C 29 1297359 clearly shows the appearance of the SBC spine antigen protein on the surface of the lactic acid bacteria whose properties are altered by the pHCE2LB:pgsA-SARS SBC vector vector, while the Lactobac丨丨丨us casei whose properties have not changed has no fluorescent expression. According to an eighth embodiment of the present invention, there is provided a method for confirming the surface appearance of a SAR protein nucleocapsid antigen antigen protein on lactic acid bacteria. Lactobacillus causes changes in traits due to surface performance of pHCE2LB: pgsA-SARS NB and pHCE2LB: pgsA-SARS N vectors, so individual analysis examined the surface appearance of each antigenic protein. The SARS virus spine antigen conjugated to the C-terminal portion of the pgsA gene of the synthetic polyprogenitor 7 glutamate, whose antigenic position is expressed by pHCE2LB: pgsA-SARS SA, pHCE2LB: pgsA-SARS NB and pHCE2LB: pgsA- The SARS N vector is transformed with Lactobacillus casei (commonly known as c-bacteria), which is used in 37t environment with MRS medium (Lactobacillus MRS, Bect〇n coffee (4) Sparks, USA) Cultivation and reproduction. In order to determine the hypothesis that individual antigens are expressed in lactic acid bacteria having pHCEaB:pgsA_sARs nb _ Ρ Ε Β Β Β 议 议 议 议 议 议 议 , , , , , , , , , , , , , , 乳酸 乳酸 乳酸 乳酸 乳酸 乳酸 乳酸With the seventh and body embodiment _, _ fine-touch, (four) way, the cell wall and the cell _, so that _ into _ 嶋, in the _ __ p_ combined with the special protein to determine the position of the side fusion egg self-quality. 30 !297359 As shown in the results, SDS-polyacrylamide colloidal electrophoresis and pgsA-specific antibodies are used in the local lactic acid bacteria to make Western immunospot inks, which are recognized by cancer in individual Lact〇bad丨丨us In the presence of the core-shell antigen of the SARS virus fused to the PgsA on the cell wall. In Figure 7A, 'the first line is the trait that does not change the ship's nipple g, the second line is the trait change PHCE2LB: pgsA-SARS NB and the whole cell part of Lactobacillus kawaii, the third and the third The four line cutters are part of the water and cell wall that are modified by pHCE2LB: pgsA_SARS NB. In the Z-B diagram, one line of 帛 is a Lactobacillus berghei with unchanged traits, and the second line is a change of pHCE2LB: pgsA_SARS N her secret _ whole cell injury. Lines 3 and 4 are the parts of Lactobacillus johnsonii that are soluble in water and cell walls due to changes in pHCE2LB: pgsA-SARS N, respectively. More..., 苐7A to 七七B, can be distinguished in the whole cell and the hard wall of lactic acid bacteria, the molecular weight of SARS NB protein fused with pgsA is about 57 hearts, and the molecular weight of SARS N protein About 75kDa. Through these results, it was found that the individual SARS antigen proteins that were fused with the eight were expressed and transferred to the surface of the lactic acid bacteria due to pgsA. According to the red embodiment of the present invention, Na provides a lactic acid bacterium having a nucleocapsid antigen protein and a surface of the SARS virus and the effect of spine protein expression. The Gram-positive bacteria Kjeldahl g of the pHCE2LB:pgSA_SARS SA, PHCE2LB:pgSA-SARS sc and pHCE2LB:PgsA-SARS NB surface-induced carrier will change with the above example. The expression of the antigen on the surface of g 31 1297359 will be induced. In the mouse paradigm, the spine protein and the nucleocapsid antigen protein on the SARS virus are fused to the extracellular membrane protein pgsA to participate in the synthesis of polygenic y- glutamic acid. In the present invention, Lactobacillus berghei causes changes in traits due to the expression of pHCE2LB: pgSA_SARS SA, pHCE2LB: pgsA_SARS SC and PHCE2LB: pgsA_SARS NB. These cells were obtained at the same cell concentration and washed several times with buffer solution (PBS buffer, ρΗ7·4). 5 χ 1 〇 9 Lactobacillus cells with antigen surface expression were orally administered to 4-6 week old BALB/c mice, fed 3 times a day for 4 weeks. In addition, 1x1〇9 Lact〇bad丨丨 cells having antigen surface expression were administered to the cells in the form of intranasal administration to the mice 3 times per day for the first week, and mouse cells every 2 days for the 2nd and 4th weeks. 2 times. The cells are fed by oral and nasal methods. Every two weeks, the value of the igG antibody in the serum of the rat, the spine antigen egg and the nuclear antigen protein is determined by immunoassay. The value of the |gA antibody in the rat's small intestine and in the suspension washed from the bronchus and alveoli, the |gA antibody in the spine antigen egg and the nuclear sheath antigen protein was measured using an immunoenzyme assay. Lactic acid bacteria mixture and performance of SARS SA and SARS SC in this experiment

The lactic acid fines of SARS NB and the lactic acid bacteria expressing SARS SA, SARS SC and SARS NB SARS NB will be divided into 8 groups of 10 BALB/ by intranasal and intranasal injection of bacteria (including control group). c mice (4-6 weeks) arranged in groups. The eighth panel shows the values of SARS secret SARS SA and SARS SC spine antigen protein | gG antibodies when the mouse serum was determined by immunoenzyme assay. The ninth figure shows the value of the SARS SA SARS SA and SARS SC spine antigen protein IgA antibodies of SARS virus in suspension from the small intestine of the mouse and from the bronchial and alveolar cells by immunoassay 32 1297359 > Wherein A is a group of bacteria administered orally to mice, and the value of the lg antibody is measured, and B is a group of bacteria administered to the mice by intranasal injection, and the value of the IgA antibody is measured. The tenth figure shows the value of the SARS NB nuclear antigen protein |gG antibody of SARS virus in the serum of rats by immunoassay. Figure 11 shows the value of the SARS NB nuclear antigen f |gA antibody of sars virus in the small intestine of the k-mouse and in the suspension washed from the bronchi and alveoli by immuno-enzyme assay. Where a is the amount of the bacterium that is administered orally to the old bacteria, and the value of the 丨g antibody is determined, and B is the group of the bacteria administered to the mouse by the nasal brewing method, and the value of the IgA antibody is measured. *The eighth to tenth lining test method can be noted that the BALB/c old milk is given pHCE2LB: pgsA SARS sa, pHCEAB pgsA SARs % and

P 2LB_Pgs> VSARS NB vector and altered traits of Lactobacillus, in the SARS virus, the spine antigen protein and the _ antigen egg (four) 敝 , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , The amount of IgG antibody and |gA antibody in the hanging tube and the lung assisted by the money tube and the lung are quite high. In the middle of the month, the part of the spine protein and the nucleocapsid antigen of the surface of the microbial SARS disease can be used as a live vaccine. The above is only the embodiment of the present invention, and the scope of the patent application of the present invention is not limited to the scope of the present invention. The change of 33 1297359 should still be The scope of the invention. Accordingly, the scope of the invention is defined by the scope of the following claims. Industrial application of the present invention: According to the above description, in the current research, the coronavirus antigen protein caused by SARA is expressed on the surface of the microorganism whose trait is changed, and the antigen extracted and purified from the microorganism can be used as a vaccine to prevent And treatment of SARS. More particularly, the use of recombinant SARS coronavirus antigens to produce oral vaccines has a large economic effect. [Simplified illustration] The first-graph shows the correlation between the porcine transmissible gastroenteritis virus and the spine protein of the SARA coronavirus. The hydrophilicity of the two viral antigens is expressed according to the method of Kyte-D〇〇|itt|e. The antigen-specific labeling is expressed according to the method of JameS〇n_W〇丨f, and the graph of the possibility of virus surface is According to Emini's method of performance; the second figure shows the correlation between porcine transmissible gastroenteritis virus and SARA coronavirus nucleocapsid protein. The hydrophilicity of the two viral antigens is expressed according to the method of Kyte-DooHttle. The antigen-specific markers are expressed according to the method of grasping the 〇 〇 〇 , , , , , , , , , , , , 病毒 病毒 病毒 病毒 病毒 病毒 病毒 病毒 病毒 病毒 病毒 病毒 病毒 病毒 病毒Performance; Figure 3A shows the genetic map of pHCE2LB: PgsA-SARS SA vector on the surface of Gram-positive and Gram-negative microbial host cells; Figure 3B and Figure 3C show pHCE2LB: pgsA_SARS sc and 34 1297359 pHCE2LB: Gene map of pgsA-SARS SBC vector; Figures 4A and 4B show the genetic map of pHCE2LB: pgsASARS NB and pHCE2LB: pgsA_SARS N vector; 5A to 5C Western blotting to show the specific binding of specific antibodies to pgsA and fusion proteins to determine the expression of SARS SA, SARS Sc and SARS SBC and pgsA protein binding to Lactobacillus outer membrane; Figure 6A and The six B ® line shows the use of a fragment of lactic acid g protein as a specific antibody in the US immunoblot ink method, and observed its binding to pgsA to determine the SARS SA and SARS SBC antigen and the outer membrane pgs in Lactobacillus cells. The performance of A protein after binding. Figure 6c is a flow cytometry analysis to determine the surface behavior of the SARS SBC antigen in Lact〇bad丨丨us; I - Figure 7A, Figure 7B, showing a fragment of the New Zealand white in the West Prepare specific antibodies and observe their binding to pgsA to determine the expression of SARS NB and SARS N antigens after binding to the outer membrane pgsA protein of Lactobacillus cells. The eighth image is measured in mouse serum, and SARs SAand The amount of IgG antibody bound by the SARS SCD antigen. In this invention, after the surface performance of the lactic acid bacteria path protein is changed via pHCE2LB: pgsASARS SA, pHCE2LB: pgsA-SARS SC and pHCE1LB: pgsA_SARS NB vector, the changed lactic acid egg is administered to the mouse body by oral and intranasal injection. Internally and using enzyme immunoassay to determine the performance of surface antigen groups;

The ninth panel is the measurement of the amount of IgA antibodies that bind to SARs SA 35 ' 1297359 and SARS SCD antigens in mouse intestinal washes and bronchoalveolar washes. In this invention, after changing the surface performance of lactic acid bacteria casein via pHCE2LB:pgsA-SARS SA, pHCE2LB:pgsA-SARS SC and pHCE1LB:pgsA-SARS NB carrier, the changed lactic acid bacteria casein is administered by oral and intranasal injection. In mice, the enzyme immunoassay was used to determine the expression of the surface antigen group; the tenth figure is the amount of IgG antibody that binds to the SARS NB antigen in the serum of the mouse. In this invention, after changing the surface performance of lactic acid bacteria casein via pHCE2LB:pgsA-SARS SA, pHCE2LB:pgsA-SARS SC and pHCE1LB:pgsA-SARSNB carrier, the changed lactic acid-based protein paste oral and nasal (four) injection method age In mice, enzyme immunoassay was used to determine the performance of the surface antigen group; and the tenth-side 7F was the amount of 丨gA antibody that was measured in the intestinal wash and bronchus-alveolar tract of the mouse and bound to the SARS NB antigen. . In this invention, after the surface performance of the lactic acid bacteria is changed via pHCE2 LB_pgsA-SARS SA, pHCE2LB: pgsA-SARS SC and p LBePgsA SARS NB carrier, the changed lactic acid bacteria casein is administered to the mouse by oral and intranasal shovel In vivo, enzyme immunoassay is used to determine the performance of the surface antigen group. [Explanation of main component symbols] No 36 1^97359 Sequence Listing (修(more) 正本<100> Bio-Leading Co., Ltd., etc. <120> Severe Acute Respiratory Syndrome (SARS) virus antigen expression vector and the expression vector The transformed microorganism 丨 <130>(KR)10-2001-48373 <140>TW 093136838 <141>2004-Η-30 <160>31 <210>1 <211>56 <212> DNA <213>Artifical sequence<223>PRCR primer <400>1 ggatccttta ttttcttatt atttcttact ctcactagtg gtagtgacct tgaccg 56 <210>2 <211>53 <212>DNA <213>artificial sequence<223> PRCR primer <400>2 tgagtgtaat taggagcttg aacatcatca aaagtggtac aacggtcaag gtc 53 <210>3 <211>58 <212>DNA<213> artificial sequence<223>PRCR primer <400>3 aattacactc aacatacttc atctatgcgt ggggtttact Atcctgatga aatttttc 58 1297359 , <210>4 <211>54 <212>DNA <213> artificial sequence <223>PRCR primer <400>4 aaaatggaag aaataaatcc tgagttaaat aaagagtgtc tgaacgaaaa attt 54 <210>5 <211>57 <212>DNA<213> artificial sequence <223>PRCR primer <400>5 cttccattt attctaatgt tactgggttt catactatta atcatacgtt tggcaac 57 <210>6 <211>54 <;212>DNA<213>Artificialsequence<223>PRCRprimer<400>6 ggcagcaaaa taaataccat ccttaaagg aatgacaggg ttgccaaacg tatg 54 <210>7 <211>53 <212>DNA <213>;223>PRCR primer <400>7 atttattttg ctgccacaga gaaatcaaat gttgtccgtg gttgggtttt tgg 53 <210>8 <211>57 <212>DNA<213>artificial sequence<223>PRCR primer <400>8 1297359 Ggtaccaagc ttattacaca gactgtgact tgttgttcat ggtagaacca aaaaccc 57 <210>9 <211>56 <212>DNA<213> artificial sequence <223>PRCR primer <400>9 ggatccgttt gtggtccaaa attatctact gaccttatta agaaccagtg tgtcaat 57 <210> 10 <211>58 <212>DNA<213> artificial sequence <223>PRCR primer <400>10 gaagaaggag ttaacacacc agtaccagtg agaccattaa aattaaaatt gacacac T58 <210>11 <211>57 <212>DNA<213> artificial sequence <223>PRCR primer <400>11 aactccttct tcaaagcgtt ttcaaccatt tcaacaattt ggccgtgatg tttctga 57 <210>12 <211> 54

<212>DNA <213> artificial sequence: <223>PRCR primer <400>12 ctaaaatttc agatgtttta ggatcacgaa cagaatcagt gaaatcagaa acat 54 <210>13 <211>53

&lt;212&gt;DNA&lt;213&gt; artificial sequence 1297359 &lt;223&gt;PRCR primer &lt;400&gt;13 ctgaaatttt agacatttca ccttgtgctt ttgggggtgt aagtgtaatt aca 53 &lt;210&gt;14 &lt;211&gt;58 &lt;212&gt;DNA &lt;213&gt; Sequence &lt;223&gt;PRCR primer &lt;400&gt;14 ggtaccaagc ttattaaaca gcaacttcag atgaagcatt tgtaccaggt gtaattac 58 &lt;210&gt;15 &lt;211&gt;27 &lt;212&gt;DNA <213>Artificial sequence&lt;223&gt; PCR primer (SBC sense) &lt;;400&gt;15 cgcggatccc tcaagtatga tgaaaat 27 &lt;210&gt;16 &lt;211&gt;27 &lt;212&gt;DNA&lt;213&gt; artificial sequence &lt;223&gt; PCR primer (SBC anti-sense) &lt;400&gt;16 cggggtacct taaacagcaa cttcaga 27 &lt;210&gt;17 &lt;211&gt;56 &lt;212&gt;DNA&lt;213&gt; artificial sequence&lt;223&gt;PRCR primer &lt;400&gt;17 ggatcccctc aaggtacaac attgccaaaa ggcttctacg cagagggtag ccgtgg 56 «5 « &lt;210&gt;18 &lt;211&gt ;54 1297359 &lt;212&gt;DNA&lt;213>Artificial sequence&lt;223&gt;PRCR primer &lt;400&gt;18 accacgacta cgtgatgaag aacgagaaga ggcttgactg ccgccacggc tacc 54 &lt;210&gt;19 ί &lt;211&gt;53

&lt;212&gt;DNA &lt;213&gt; artificial sequence &lt;223&gt;PRCR primer &lt;400&gt;19 cacgtagtcg tggtaattca cgtaattcaa ctcctggcag cagtcgtggt aat 53 &lt;210&gt;20 &lt;211&gt;54

&lt;212&gt;DNA &lt;213&gt; artificial sequence &lt;223&gt;PRCR primer &lt;400&gt;20 ί gcgagggcag tttcaccacc accgctagcc atacgagcag gagaattacc acga 54 &lt;210&gt;21 &lt;211&gt;53 &lt;212&gt;DNA &lt;213&gt; Sequence &lt;223&gt;PRCR primer &lt;400&gt;21 gaaactgccc tcgcacttt gctgcttgac cgtttgaacc agcttgagag caa 53 &lt;210&gt;22 &lt;211&gt;57

&lt;212&gt;DNA &lt;213&gt; artificial sequence &lt;223&gt;PRCR primer &lt;400&gt;22 tagtgacagt ttgaccttgt tgttgttggc ctttaccaga aactttgctc tcaa 54 1297359 , &lt;210&gt;23 &lt;211&gt;57 &lt;212&gt;DNA &lt;213&gt; Artificial sequence &lt;223&gt;PRCR primer &lt;400&gt;23 caaactgtca ctaagaaatc tgctgctgag gcatctaaaa agcctcgtca aaaacgt 57 &lt;210&gt;24 &lt;211&gt;59 &lt;212&gt;DNA&lt;213&gt;&gt;213&gt;223&gt;PRCR primer &lt;400&gt;; 24 ggaccacgac gcccaaatgc ttgagtgacg ttgtactgtt ttgtggcagt acgttttg 59 &lt;210&gt;25 &lt;211&gt;57 &lt;212&gt;DNA &lt;213&gt; artificial sequence &lt;223&gt;PRCR primer &lt;400&gt;25 gggcgtcgtg gtccagaaca aacccaaggt aatttcgggg accaagacct tatccgt 57 &lt;210&gt;26&lt;211&gt;59&lt;212&gt;DNA&lt;213&gt; artificial sequence&lt;223&gt;PRCR primer &lt;400&gt;26 ggtaccaagc ttattaaatt tgcggccaat gtttgtaatc agtaccttga cggataagg 59 &lt;210&gt;27 &lt;211&gt;27 &lt;212&gt ;DNA &lt;213>Artificial sequence&lt;223&gt; PCR primer (N sense) &lt;400&gt;27 1297359 cgcggatcct ctgataatgg tccgcaa 27 &lt;210&gt;28 &lt;211&gt;30

&lt;212&gt;DNA &lt;213&gt; artificial sequence &lt;223&gt; PCR primer (N anti-sense) &lt;400&gt;28 cggggtacct taatttgcg gccaatgttt 30 &lt;210&gt;29 &lt;211&gt;1182

&Lt; 212 &gt; DNA &lt; 213 &gt; Bacillus subtil is &lt; 400 &gt; 29 atgggctggt tactcattat agcctgtgct gtcatactgg tcatcggaat attagaaaaa 60 cgacgacatc agaaaaacat tgatgccctc cctgttcggg tgaatattaa cggcatccgc 120 ggaaaatcga ctgtgacaag gctgacaacc ggaatattaa tagaagccgg ttacaagact 180 gttggaaaaa caacaggaac agatgcaaga atgatttact gggacacacc ggaggaaaag 240 ccgattaaac ggaaacctca ggggccgpat atcggagagc aaaaagaagt catgagagaa 300 acagtagaaa gaggggctaa cgcgattgtc agtgaatgca tggctgttaa cccagattat 360 caaatcatct ttcaggaaga acttctgcag gccaatatcg gcgtcattgt gaatgtttta 420 gaagaccata tggatgtcat ggggccgacg cttgatgaaa ttgcagaagc gtttaccgct 480 acaattcctt ataatggcca tcttgtcatt acagatagtg aatataccga gttctttaaa 540 caaaaagcaa aagaacgaaa cacaaaagtc atcattgctg ataactcaaa aattacagat 600 gagtatttac gtaattttga atacatggta ttccctgata acgcttctct ggcgctgggt 660 gtggctcaag cactcggcat tgacgaagaa acagcattta agggaatgct gaatgcgccg 720 ccagatccgg gagcaatgag aattcttccg ctgatcagtc cgagcgagcc tgggcacttt 780 gttaatgggt ttgccgcaaa cgacgcttct tctactttga atatatggaa acgtgtaaaa 840 gaaatcggtt acccgaccga tgatccgatc atcatcatga actgccgcgc agaccgtgtc 900 gatcggacac agcaattcgc aaatgacgta ttgccttata ttgaagcaag tgaactgatc 960 ttaatcggtg aaacaacaga accgatcgta aaagcctatg aagaaggcaa aattcctgca 1020 gacaaactgc atgacctaga gtataagtca acagatgaaa ttatggaatt gttaaagaaa 1080 agaatgcaca accgtgtcat atatggcgtc ggcaatattc atggtgccgc agagccttta 1140 attgaaaaaa tccacgaata caaggtaaag cagctcgtaa gc 1182 &lt; 210 &gt; 30 &lt;211&gt;447 7 1297359

&Lt; 212 &gt; DNA &lt; 213 &gt; Bacillus subtil is &lt; 400 &gt; 30 atgttcggat cagatttata catcgcacta attttaggtg tactactcag tttaattttt 60 gcggaaaaaa cagggatcgt gccggcagga cttgttgtac cgggatattt aggacttgtg 120 tttaatcagc cggtctttat tttacttgtt ttgctagtga gcttgctcac ttatgttatc 180 gtgaaatacg gtttatccaa atttatgatt ttgtacggac gcagaaaatt cgctgccatg 240 ctgataacag ggatcgtcct aaaaatcgcg tttgattttc tatacccgat Tgtaccattt 300 gaaatcgcag aatttcgagg aatcggcatc atcgtgccag gtttaattgc caataccatt 360 cagaaacaag gtttaaccat tacgttcgga agcacgctgc tattgagcgg agcgaccttt 420 gctatcatgt ttgtttacta cttaatt 447 &lt;210&gt;31 &lt;211&gt;1140

&Lt; 212 &gt; DNA &lt; 213 &gt; Bacillus subtil is &lt; 400 &gt; 31 atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag 60 aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc 120 atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca 180 gcctcatttg taggcgatat tatgatggga cgctatgttg aaaaagtaac ggagcaaaaa 240 ggggcagaca gtatttttca atatgttgaa ccgatcttta gagcctcgga ttatgtagca 300 ggaaactttg aaaacccggt aacctatcaa aagaattata aacaagcaga taaagagatt 360 catctgcaga cgaataagga atcagtgaaa gtcttgaagg atatgaattt cacggttctc 420 aacagcgcca acaaccacgc aatggattac ggcgttcagg gcatgaaaga tacgcttgga 480 gaatttgcga agcaaaacct tgatatcgtt ggagcgggat acagcttaag tgatgcgaaa 540 aagaaaattt cgtaccagaa agtcaacggg gtaacgattg caacgcttgg ctttaccgat 600 gtgtccggga aaggtttcgc ggctaaaaag aatacgccgg gcgtgctgcc cgcagatcct 660 gaaatcttca tccctatgat ttcagaagcg aaaaaacatg ctgacattgt tgttgtgcag 720 tcacactggg gccaagagta tgacaatgat ccaaacgacc gccagcgcca gcttgcaaga 780 gccatgtctg atgcgggagc tgacatcatc gtcggccatc atccgcacgt cttagaaccg 840 attgaagtat ataacggaac cgtcattttc tacagcctcg gcaactttgt ctttgaccaa 900 ggctggacga gaacaagaga cagtgcactg gttcagtatc acctgaagaa aaatggaaca 960 ggccgctttg aagtgacacc gatcgatatc catgaagcga cacctgcacc tgtgaaaaaa 1020 gacagcctta aacagaaaac cattattcgc gaactgacga aagactctaa tttcgcttgg 1080 aaagtagaag acggaaaact gacgtttgat attgatcata gtgacaaact aaaatctaaa 1140 &lt; 210 &gt; 32 8 1297359 &lt; 211 &gt; 29751

&Lt; 212 &gt; DNA &lt; 213> Toronto strain of SARS coronavirus (SARS Coronavirus T0R2) &lt; 400 &gt; 32 atattaggtt tttacctacc caggaaaagc caaccaacct cgatctcttg tagatctgtt ctctaaacga actttaaaat ctgtgtagct gtcgctcggc tgcatgccta gtgcacctac gcagtataaa caataataaa ttttactgtc gttgacaaga aacgagtaac tcgtccctct tctgcagact gcttacggtt tcgtccgtgt tgcagtcgat catcagcata cctaggtttc gtccgggtgt gaccgaaagg taagatggag agccttgttc ttggtgtcaa cgagaaaaca cacgtccaac tcagtttgcc tgtccttcag gttagagacg tgctagtgcg tggcttcggg gactctgtgg aagaggccct atcggaggca cgtgaacacc tcaaaaatgg cacttgtggt ctagtagagc tggaaaaagg cgtactgccc cagcttgaac agccctatgt gttcattaaa cgttctgatg ccttaagcac caatcacggc cacaaggtcg ttgagctggt tgcagaaatg gacggcattc agtacggtcg tagcggtata acactgggag tactcgtgcc acatgtgggc gaaaccccaa ttgcataccg caatgttctt cttcgtaaga acggtaataa gggagccggt ggtcatagct atggcatcga tctaaagtct tatgacttag gtgacgagct tggcactgat cccattgaag attatgaaca aaactggaac actaagcatg Gcagtggtgc actccgtgaa ctcactcgtg agctcaatgg aggtgcagtc actcgctatg tcgac Aacaa tttctgtggc ccagatgggt accctcttga ttgcatcaaa gattttctcg cacgcggggg caagtcaatg tgcactcttt ccgaacaact tgattacatc gagtcgaaga gaggtgtcta ctgctgccgt

I. I gaccatgagc atgaaattgc ctggttcact gagcgctctg ataagagcta cgagcaccag acacccttcg aaattaagag tgccaagaaa tttgacactt tcaaagggga atgcccaaag tttgtgtttc ctcttaactc aaaagtcaaa gtcattcaac cacgtgttga aaagaaaaag actgagggtt tcatggggcg tatacgctct gtgtaccctg ttgcatctcc acaggagtgt aacaatatgc acttgtctac cttgatgaaa tgtaatcatt gcgatgaagt ttcatggcag acgtgcgact ttctgaaagc cacttgtgaa cattgtggca ctgaaaattt agttattgaa ggacctacta catgtgggta cctacctact aatgctgtag tgaaaatgcc atgtcctgcc tgtcaagacc cagagattgg acctgagcat agtgttgcag attatcacaa ccactcaaac attgaaactc gactccgcaa gggaggtagg actagatgtt ttggaggctg tgtgtttgcc tatgttggct gctataataa gcgtgcctac tgggttcctc gtgctagtgc tgatattggc tcaggccata ctggcattac tggtgacaat gtggagacct tgaatgagga tctccttgag atactgagtc gtgaacgtgt taacattaac attgttggcg attttcattt gaatgaagag gttgccatca ttttggcatc tttctctgct tctacaagtg cctttattga cactataaag agtcttgatt acaagtcttt caaaaccatt gttgagtcct gcggtaacta taaagttacc aagggaaagc ccgtaaaagg tgcttggaac attggacaac agagatcagt tttaacacca * 0 ctgtgtggtt ttccctcaca ggctgctggt gttatcagat caatttttgc gcgcacactt gatgcagcaa accactcaat tcctgatttg caaagagcag ctgtcaccat acttgatggt atttctgaac agtcattacg tcttgtcgac gccatggttt atacttcaga cctgctcacc 60 120 1 ^ 80 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 9 1297359 aacagtgtca ttattatggc atatgtaact ggtggtcttg tacaacagac ttctcagtgg ttgtctaatc ttttgggcac tactgttgaa aaactcaggc ctatctttga atggattgag gcgaaactta gtgcaggagt tgaatttctc aaggatgctt gggagattct caaatttctc attacaggtg tttttgacat cgtcaagggt caaatacagg ttgcttcaga taacatcaag gattgtgtaa aatgcttcat tgatgttgtt aacaaggcac tcgaaatgtg cattgatcaa gtcactatcg ctggcgcaaa gttgcgatca ctcaacttag gtgaagtctt catcgctcaa agcaagggac tttaccgtca gtgtatacgt ggcaaggagc agctgcaact actcatgcct cttaaggcac caaaagaagt Aacctttctt gaaggtgatt cacatgacac agtacttacc tctgaggagg ttgttctcaa gaacggtgaa ctcgaagcac tcgagacgcc cgttgatagc ttcacaaatg gagctatcgt tggcacacca gtctgtgtaa atggcctcat gctcttagag attaaggaca aagaacaata ctgcgcattg tctcctggtt tactggctac aaacaatgtc tttcgcttaa aagggggtgc accaattaaa ggtgtaacct ttggagaaga tactgtttgg gaagttcaag gttacaagaa tgtgagaatc acatttgagc ttgatgaacg tgttgacaaa gtgcttaatg aaaagtgctc tgtctacact gttgaatccg gtaccgaagt tactgagttt gcatgtgttg tagcagaggc tgttgtgaag actttacaac cagtttctga tctccttacc aacatgggta ttgatcttga tgagtggagt gtagctacat tctacttatt tgatgatgct ggtgaagaaa acttttcatc acgtatgtat tgttcctttt accctccaga tgaggaagaa gaggacgatg cagagtgtga ggaagaagaa attgatgaaa cctgtgaaca tgagtacggt acagaggatg attatcaagg tctccctctg gaatttggtg cctcagctga aacagttcga gttgaggaag aagaagagga agactggctg gatgatacta ctgagcaatc agagattgag ccagaaccag aacctacacc tgaagaacca gttaatcagt ttactggtta tttaaaactt actgacaatg ttgccattaa atgtgttgac atcgttaagg aggcacaaag tgctaatcct atggtgattg taaatgctgc taacatacac ctgaaacatg gtggtggtgt agcaggtgca ctcaacaagg caaccaatgg tgccatgcaa aaggagagtg atgattacat taagctaaat ggccctctta cagtaggagg gtcttgtttg ctttctggac ataatcttgc taagaagtgt ctgcatgttg ttggacctaa cctaaatgca ggtgaggaca tccagcttct taaggcagca tatgaaaatt tcaattcaca ggacatctta cttgcaccat tgttgtcagc aggcatattt ggtgctaaac cacttcagtc tttacaagtg tgcgtgcaga cggttcgtac acaggtttat attgcagtca atgacaaagc tctttatgag caggttgtca tggattatct tgataacctg aagcctagag tggaagcacc taaacaagag gagccaccaa acacagaaga ttccaaaact gaggagaaat ctgtcgtaca gaagcctgtc gatgtgaagc caaaaattaa ggcctgcatt gatgaggtta ccacaacact ggaagaaact aagtttctta ccaataagtt actcttgttt gctgatatca atggtaagct ttaccatgat tctcagaaca tgcttagagg tgaagatatg tctttccttg agaaggatgc accttacatg gtaggtgatg ttatcactag tggtgatatc acttgtgttg taataccctc caaaaaggct ggtggcacta ctgagatgct ctcaagagct ttgaagaaag tgccagttga tgagtatata accacgtacc ctggacaagg atgtgctggt tatacacttg aggaagctaa gactgctctt aagaaatgca aatctgcatt ttatgtacta ccttcagaag cacctaatgc taaggaagag attctaggaa ctgtatcctg gaatttgaga 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 10 1297359 gaaatgcttg ctcatgctga agagacaaga aaattaatgc ctatatgcat ggatgttaga gccataatgg caaccatcca acgtaagtat aaaggaatta aaattcaaga gggcatcgtt gactatggtg tccgattctt cttttatact agtaaagagc ctgtagcttc tattattacg aagctgaact ctctaaatga gccgcttgtc acaatgccaa ttggttatgt gacacatggt tttaatcttg aagaggctgc gcgctgtatg cgttctctta aagctcctgc cgtagtgtca gtatcatcac cagatgctgt tactacatat aatggatacc tcacttcgtc atcaaagaca tctgaggagc actttgtaga aacagtttct ttggctggct cttacagaga ttggtcctat tcaggacagc gtacagagtt aggtgttgaa tttcttaagc gtggtgacaa aattgtgtac cacactctgg agagccccgt cgagtttcat cttgacggtg aggttctttc acttgacaaa ctaaagagtc tcttatccct gcgggaggtt aagactataa aagtgttcac aactgtggac aacactaatc tccacacaca gcttgtggat atgtctatga catatggaca gcagtttggt ccaacatact tggatggtgc tgatgttaca aaaattaaac ctcatgtaaa tcatgagggt aagactttct ttgtactacc tagtgatgac acactacgta gtgaagcttt cgagtactac catactcttg atgagagttt tcttggtagg tacatgtctg ctttaaacca cacaaagaaa tggaa atttc ctcaagttgg tggtttaact tcaattaaat gggctgataa caattgttat ttgtctagtg ttttattagc acttcaacag cttgaagtca aattcaatgc accagcactt caagaggctt attatagagc ccgtgctggt gatgctgcta acttttgtgc actcatactc gcttacagta ataaaactgt tggcgagctt ggtgatgtca gagaaactat gacccatctt ctacagcatg ctaatttgga atctgcaaag cgagttctta atgtggtgtg taaacattgt ggtcagaaaa ctactacctt aacgggtgta gaagctgtga tgtatatggg tactctatct, tatgataatc ttaagacagg tgtttccatt ccatgtgtgt gtggtcgtga tgctacacaa tatctagtac aacaagagtc ttcttttgtt atgatgtctg caccacctgc tgagtataaa ttacagcaag gtacattctt atgtgcgaat gagtacactg gtaactatca gtgtggtcat tacactcata taactgctaa ggagaccctc tatcgtattg acggagctca ccttacaaag atgtcagagt acaaaggacc agtgactgat gttttctaca aggaaacatc ttacactaca accatcaagc ctgtgtcgta taaactcgat ggagttactt acacagagat tgaaccaaaa ttggatgggt attataaaaa ggataatgct tactatacag agcagcctat agaccttgta ccaactcaac cattaccaaa tgcgagtttt gataatttca aactcacatg ttctaacaca aaatttgctg atgatttaaa tcaaatgaca ggcttcacaa agccagcttc acgagagcta tctgtcacat tct tcccaga cttgaatggc gatgtagtgg ctattgacta tagacactat tcagcgagtt tcaagaaagg tgctaaatta aacacttggt ctgcataagc caattgtttg gcacattaac caggctacaa ccaagacaac gttcaaacca aacctaatga gctttcacta gccttaggtt gtttacgttg tctttggagt acaaagccag tagatacttc aaattcattt gaagttctgg cagtagaaga cacacaagga atggacaatc ttgcttgtga aagtcaacaa cccacctctg aagaagtagt ggaaaatcct accatacaga aggaagtcat agagtgtgac gtgaaaacta ccgaagttgt aggcaatgtc atacttaaac catcagatga aggtgttaaa gtaacacaag agttaggtca tgaggatctt atggctgctt atgtggaaaa cacaagcatt accattaaga taaaaacaat tgccactcat Ggtattgctg caattaatag tgttccttgg 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 11 1297359 agtaaaattt tggcttatgt caaaccattc ttaggacaag cagcaattac aacatcaaat 6660 Tgcgctaaga gattagcaca acgtgtgttt aacaattata tgccttatgt gtttacatta 6720 ttgttccaat tgtgtacttt tactaaaagt accaattcta gaattagagc ttcactacct 6780 acaact attg ctaaaaatag tgttaagagt gttgctaaat tatgtttgga tgccggcatt 6840 aattatgtga agtcacccaa attttctaaa ttgttcacaa tcgctatgtg gctattgttg 6900 ttaagtattt gcttaggttc tctaatctgt gtaactgctg cttttggtgt actcttatct 6960 aattttggtg ctccttctta ttgtaatgge gttagagaat tgtatcttaa ttcgtctaac 7020 gttactacta tggatttctg tgaaggttct tttccttgca gcatttgttt aagtggatta 7080 gactcccttg attcttatcc agctcttgaa accattcagg tgacgatttc atcgtacaag 7140 ctagacttga caattttagg tctggccgct gagtgggttt tggcatatat gttgttcaca 7200 aaattctttt atttattagg tctttcagct ataatgcagg tgttctttgg ctattttgct 7260 agtcatttca tcagcaattc ttggctcatg tggtttatca ttagtattgt acaaatggca 7320 cccgtttctg caatggttag gatgtacatc ttctttgctt ctttctacta catatggaag 7380 agctatgttc atatcatgga tggttgcacc tcttcgactt gcatgatgtg ctataagcgc 7440 aatcgtgcca cacgcgttga gtgtacaact attgttaatg gcatgaagag atctttctat 7500 gtctatgcaa atggaggccg tggcttctgc aagactcaca attggaattg tctcaattgt 7560 gacacatttt gcactggtag tacattcatt agtgatgaag ttgctcgtga tttgtcactc 7620 cagtttaaaa g accaatcaa ccctactgac cagtcatcgt atattgttga tagtgttgct 7680 gtgaaaaatg gcgcgcttca cctctacttt gacaaggctg gtcaaaagac ctatgagaga 7740 catccgctct cccattttgt caatttagac aatttgagag ctaacaacac taaaggttca 7800 ctgcctatta atgtcatagt ttttgatggc aagtccaaat gcgacgagtc tgcttctaag 7860 tctgcttctg tgtactacag tcagctgatg tgccaaccta ttctgttgct tgaccaagct 7920 cttgtatcag acgttggaga tagtactgaa gtttccgtta agatgtttga tgcttatgtc 7980 gacacctttt cagcaacttt tagtgttcct atggaaaaac ttaaggcact tgttgctaca 8040 gctcacagcg agttagcaaa gggtgtagct ttagatggtg tcctttctac attcgtgtca 8100 gctgcccgac aaggtgttgt tgataccgat gttgacacaa aggatgttat tgaatgtctc 8160 aaactttcac atcactctga cttagaagtg acaggtgaca gttgtaacaa tttcatgctc 8220 acctataata aggttgaaaa catgacgccc agagatcttg gcgcatgtat tgactgtaat 8280 gcaaggcata tcaatgccca agtagcaaaa agtcacaatg tttcactcat ctggaatgta 8340 aaagactaca tgtctttatc tgaacagctg cgtaaacaaa ttcgtagtgc tgccaagaag 8400 aacaacatac cttttagact aacttgtgct acaactagac aggttgtcaa tgtcataact 8460 actaaaatct cactcaa ggg tggtaagatt gttagtactt gttttaaact tatgcttaag 8521 gccacattat tgtgcgttct tgctgcattg gtttgttata tcgttatgcc agtacataca 8580 ttgtcaatcc atgatggtta cacaaatgaa atcattggtt acaaagccat tcaggatggt 8640 gtcactcgtg acatcatttc tactgatgat tgttttgcaa ataaacatgc tggttttgac 8700 gcatggttta gccagcgtgg tggttcatac aaaaatgaca aaagctgccc tgtagtagct 8760 gctatcatta caagagagat tggtttcata gtgcctggct taccgggtac tgtgctgaga 8820 gcaatcaatg gtgacttctt gcattttcta cctcgtgttt ttagtgctgt tggcaacatt 8880 12 1297359 tgctacacac cttccaaact cattgagtat agtgattttg ctacctctgc ttgcgttctt 8940 gctgctgagt gtacaatttt taaggatgct atgggcaaac ctgtgccata ttgttatgac 9000 actaatttgc tagagggttc tatttcttat agtgagcttc gtccagacac tcgttatgtg 9060 cttatggatg gttccatcat ctcatagcta acatctttac tcctcttgtg acagtttcct aacacttacc tggagggttc tgttagagta 9120 gtaacaactt ttgatgctga gtactgtaga catggtacat gcgaaaggtc agaagtaggt 9180 atttgcctat ctaccagtgg tagatgggtt cttaataatg agcattacag agctctatca 9240 ggagttttct gtggtgttga tgcgatgaat 9300 caacctgtgg Gt gctttaga tgtgtctgct tcagtagtgg ctggtggtat tattgccata 9360 ttggtgactt gtgctgccta ctactttatg aaattcagac gtgtttttgg tgagtacaac 9420 catgttgttg ctgctaatgc acttttgttt ttgatgtctt tcactatact ctgtctggta 9480 ccagcttaca gctttctgcc gggagtctac tcagtctttt acttgtactt gacattctat 9540 ttcaccaatg atgtttcatt cttggctcac cttcaatggt ttgccatgtt ttctcctatt 9600 gtgccttttt ggataacagc aatctatgta ttctgtattt ctctgaagca ctgccattgg 9660 ttctttaaca actatcttag gaaaagagtc atgtttaatg gagttacatt tagtaccttc 9720 gaggaggctg ctttgtgtac ctttttgctc aacaaggaaa tgtacctaaa attgcgtagc 9780 gagacactgt tgccacttac acagtataac aggtatcttg ctctatataa caagtacaag 9840 tatttcagtg gagccttaga tactaccagc tatcgtgaag cagcttgctg ccacttagca 9900 aaggctctaa atgactttag caactcaggt gctgatgttc tctaccaacc accacagaca 9960 tcaatcactt ctgctgttct gcagagtggt tggcattccc gtcaggcaaa 10020 gttgaagggt gcatggtaca agtaacctgt ggaactacaa ctcttaatgg ^ ttgtggttg 10080 gatgacacag tatactgtcc aagacatgtc atttgcacag cagaagacat gettaatcct 10140 aactatgaag atctg tttaggaaaa ctcat tcgcaaatcc aaccatagct ttcttgttca ggctggcaat 10200 gttcaacttc gtgttattgg ccattctatg caaaattgtc tgettagget taaagttgat 10260 acttctaacc ctaagacacc caagtataaa tttgtccgta tccaacctgg tcaaacattt 10320 teagttetag catgctacaa tggttcacca tctggtgttt atcagtgtgc catgagacct 10380 aatcatacca ttaaaggttc tttccttaat ggatcatgtg gtagtgttgg ttttaacatt 10440 gattatgatt gcgtgtcttt ctgctatatg catcatatgg agcttccaac aggagtacac 10500 gctggtactg aettagaagg taaattctat ggtccatttg ttgacagaca aactgcacag 10560 gctgcaggta cagacacaac cataacatta aatgttttgg catggctgta tgctgctgtt 10620 atcaatggtg ataggtggtt tettaataga ttcaccacta ctttgaatga ctttaacctt 10680 gtggcaatga agtacaacta tgaacctttg acacaagatc atgttgacat attgggacct 10740 ctttctgctc aaacaggaat tgeegtetta gatatgtgtg ctgctttgaa agagctgctg 10800 cagaatggta tgaatggtcg tactatcctt ggtagcacta ttttagaaga tgagtttaca 10860 ccatttgatg ttgttagaca atgctctggt gttaccttcc aaggtaagtt caagaaaatt 10920 gttaagggca ctcatcattg gatgctttta actttcttga catcactatt gattcttgtt 10980 caaagtac ac agtggtcact gtttttcttt gtttacgaga atgetttett gccatttact 11040 cttggtatta tggcaattgc tgcatgtgct atgctgcttg ttaagcataa gcacgcattc 11101 ttgtgcttgt ttctgttacc ttetettgea acagttgctt aetttaatat ggtctacatg 11160 13 1297359 cctgctagct gggtgatgcg tatcatgaca tggcttgaat tggctgacac tagcttgtct 11220 ggttataggc ttaaggattg tgttatgtat gcttcagctt tagttttgct tattctcatg 11280 acagctcgca ctgtttatga tgatgctgct agacgtgttt ggacactgat gaatgtcatt 11340 acacttgttt acaaagtcta ctatggtaat gctttagatc aagctatttc catgtgggcc 11400 ttagttattt ctgtaacctc taactattct ggtgtcgtta cgactatcat gtttttagct 11460 agagctatag tgtttgtgtg tgttgagtat tacccattgt tatttattac tggcaacacc 11520 ttacagtgta tcatgcttgt ttattgtttc ttaggctatt gttgctgctg ctactttggc 11580 cttttctgtt tactcaaccg ttacttcagg cttactcttg gtgtttatga ctacttggtc 11640 tctacacaag aatttaggta tatgaactcc caggggcttt tgcctcctaa gagtagtatt 11700 gatgctttca agcttaacat taagttgttg ggtattggag gtaaaccatg tatcaaggtt 11760 gctactgtac agtctaaaat gtctgacgta aagtgcacat ctgtggtact gctctc ggtt 11820 cttcaacaac ttagagtaga gtcatcttct aaattgtggg cacaatgtgt acaactccac 11880 aatgatattc ttcttgcaaa agacacaact gaagctttcg agaagatggt ttctcttttg 11940 tctgttttgc tatccatgca atcatatgcc gggtgctgta gacattaata ggttgtgcga ggaaatgctc 12000 gataaccgtg ctactcttca ggctattgct tcagaattta gttctttacc gcaagttgga aaagatggca gatcaggcta 12060 gcttatgcca ctgcccagga ggcctatgag caggctgtag ctaatggtga ttctgaagtc 12120 gttctcaaaa agttaaagaa atctttgaat gtggctaaat ctgagtttga ccgtgatgct 12180 gccatgcaac tgacccaaat gtacaaacag 12240 gcaagatctg aggacaagag ggcaaaagta actagtgcta tgcaaacaat gctcttcact 12300 atgcttagga agcttgataa tgatgcactt aacaacatta tcaacaatgc gcgtgatggt 12360 tgtgttccac tcaacatcat accattgact acagcagcca aactcatggt tgttgtccct 12420 gattatggta cctacaagaa cacttgtgat ggtaacacct ttacatatgc atctgcactc 12480 tgggaaatcc agcaagttgt tgatgcggat agcaagattg ttcaacttag tgaaattaac 12540 atggacaatt caccaaattt ggcttggcct cttattgtta cagctctaag agccaactca 12600 gctgttaaac tacagaataa tgaactgagt ccagtagcac tacgacaga t gtcctgtgcg 12660 gctggtacca cacaaacagc ttgtactgat taacaattcg gacaatgcac ttgcctacta cctgctaaag catataagga ttacctagca 12720 aagggaggta ggtttgtgct ggcattacta tcagaccacc aagatctcaa atgggctaga 12780 ttccctaaga gtgatggtac aggtacaatt tacacagaac tggaaccacc ttgtaggttt 12840 gttacagaca caccaaaagg gcctaaagtg aaatacttgt acttcatcaa aggcttaaac 12900 aacctaaata gaggtatggt gctgggcagt ttagctgcta cagtacgtct tcaggctgga 12960 aatgctacag aagtacctgc caattcaact gtgctttcct tctgtgcttt tgcagtagac 13020 agtggaggac aaccaatcac caactgtgtg 13080 aagatgttgt gtacacacac tggtacagga caggcaatta ctgtaacacc agaagctaac 13140 atggaccaag agtcctttgg tggtgcttca tgttgtctgt attgtagatg ccacattgac 13200 catccaaatc ctaaaggatt ctgtgacttg aaaggtaagt acgtccaaat acctaccact 13260 tgtgctaatg acccagtggg ttttacactt agaaacacag tctgtaccgt ctgcggaatg 13320 tggaaaggtt atggctgtag ttgtgaccaa ctccgcgaac ccttgatgca gtctgcggat 13380 gcatcaacgt ttttaaacgg gtttgcggtg taagtgcagc ccgtcttaca ccgtgcggca 13440 14 1297359 caggcactag tactgatgtc gtctacaggg c ttttgatat ttacaacgaa aaagttgctg 13500 gttttgcaaa gttcctaaaa actaattgct gtcgcttcca ggagaaggat gaggaaggca 13560 atttattaga ctcttacttt gtagttaaga ggcatactat gtctaactac caacatgaag 13620 agactattta taacttggtt aaagattgtc cagcggttgc tgtccatgac tttttcaagt 13680 ttagagtaga tggtgacatg gtaccacata tatcacgtca gcgtctaact aaatacacaa 13740 tggctgattt agtctatgct ctacgtcatt ttgatgaggg taattgtgat acattaaaag 13800 aaatactcgt cacatacaat tgctgtgatg atgattattt caataagaag gattggtatg 13860 acttcgtaga gaatcctgac atcttacgcg tatatgctaa cttaggtgag cgtgtacgcc 13920 aatcattatt aaagactgta caattctgcg atgctatgcg tgatgcaggc attgtaggcg 13980 tactgacatt agataatcag gatcttaatg ggaactggta cgatttcggt gatttcgtac 14040 aagtagcacc aggctgcgga tgtttggatg 14280 ataggtgtat gttcctattg tggattcata ttactcattg ctgatgccca 14100 tcctcacttt gactagggca ttggctgctg agtcccatat ggatgctgat ctcgcaaaac 14160 cacttattaa gtgggatttg ctgaaatatg attttacgga agagagactt tgtctcttcg 14220 accgttattt taaatattgg gaccagacat accatcccaa ttgtattaac ccttcattgt gcaa acttta atgtgttatt ttctactgtg tttccaccta 14340 caagttttgg accactagta agaaaaatat ttgtagatgg tgttcctttt gttgtttcaa 14400 ctggatacca ttttcgtgag ttaggagtcg tacataatca ggatgtaaac ttacatagct 14460 cgcgtctcag tttcaaggaa cttttagtgt atgctgctga tccagctatg catgcagctt 14520 ctggcaattt attgctagat aaacgcacta catgcttttc agtagctgca ctaacaaaca 14580 atgttgcttt tcaaactgtc aaacccggta attttaataa agacttttat gg, ctttgctg 14640 • i! tgtctaaagg tttctttaag gaaggaagtt ctgttgaact aaaacacttc ttctttgctc 14700 aggatggcaa cgctgctatc agtgattatg actattatcg ttataatctg ccaacaatgt 14760 gtgatatcag acaactccta ttcgtagttg aagttgttga taaatacttt gattgttacg 14820 atggtggctg tattaatgcc aaccaagtaa tcgttaacaa tctggataaa tcagctggtt 14880 tcccatttaa taaatggggt aaggctagac tttattatga ctcaatgagt tatgaggatc 14940 aagatgcact tttcgcgtat actaagcgta atgtcatccc tactataact caaatgaatc 15000 ttaagtatgc cattagtgca aagaatagag ctcgcaccgt agctggtgtc tctatctgta 15060 gtactatgac aaatagacag tttcatcaga aattattgaa gtcaatagcc gccactagag 15120 gagctactg t ggtaattgga acaagcaagt tttacggtgg ctggcataat atgttaaaaa 15180 ctgtttacag tgatgtagaa actccacacc ttatgggttg ggattatcca aaatgtgaca 15240 gagccatgcc taacatgctt aggataatgg cctctcttgt tcttgctcgc aaacataaca 15300 cttgctgtaa cttatcacac cgtttctaca ggttagctaa cgagtgtgcg caagtattaa 15360 gtgagatggt catgtgtggc ggctcactat atgttaaacc aggtggaaca tcatccggtg 15420 atgctacaac tgcttatgct aatagtgtct ttaacatttg tcaagctgtt acagccaatg 15480 taaatgcact tctttcaact gatggtaata agatagctga caagtatgtc cgcaatctac 15540 aacacaggct ctatgagtgt ctctatagaa atagggatgt tgatcatgaa ttcgtggatg 15600 agttttacgc ttacctgcgt aaacatttct ccatgatgat tctttctgat gatgccgttg 15660 tgtgctataa cagtaactat gcggctcaag gtttagtagc tagcattaag aactttaagg 15720 15 1297359 cagttcttta ttatcaaaat aatgtgttca tgtctgaggc aaaatgttgg actgagactg 15780 accttactaa aggacctcac gaattttgct cacagcatac aatgctagtt aaacaaggag 15840 atgattacgt gtacctgcct tacccagatc catcaagaat attaggcgca ggctgttttg 15900 tcgatgatat tgtcaaaaca gatggtacac ttatgattga aaggttcgtg tcactgg cta 15960 ttgatgctta cccacttaca aaacatccta atcaggagta tgctgatgtc tttcacttgt 16020 atttacaata cattagaaag ttacatgatg agcttactgg ccacatgttg gacatgtatt 16080 ccgtaatgct aactaatgat aacacctcac ggtactggga acctgagttt tatgaggcta 16M0 tgtacacacc acatacagtc ttgcaggctg taggtgcttg tgtattgtgc aattcacaga 16200 cttcacttcg ttgcggtgcc tgtattagga atgttgcaag gaccattcct tgatgtcact gatgtgacac aactgtatct tgctgctatg 16260 accatgtcat ttcaacatca cacaaattag tgttgtctgt taatccctat gtttgcaatg 16320 ccccaggttg aggaggtatg agctattatt 16380 gcaagtcaca taagcctccc attagttttc cattatgtgc taatggtcag gtttttggtt 16440 tatacaaaaa cacatgtgta ggcagtgaca atgtcactga cttcaatgcg atagcaacat 16500 gtgattggac taatgctggc gattacatac ttgccaacac ttgtactgag agactcaagc 16560 ttttcgcagc agaaacgctc aaagccactg aggaaacatt taagctgtca tatggtattg 16620 ccactgtacg cgaagtactc tctgacagag aattgcatct ttcatgggag gttggaaaac 16680 ctagaccacc attgaacaga aactatgtct ttactggtta ccgtgtaact aaaaatagta 16740 aagtacagat tggagagtac acctttgaaa aaggtgacta tggtgatgct gttgtgtaca 16800 gaggtactac gacatacaag ttgaatgttg gtgattactt tgtgttgaca tctcacactg 16860 taatgccact tagtgcacct actctagtgc cacaagagca ctatgtgaga attactggct 16920 tgtacccaac actcaacatc tcagatgagt tttctagcaa tgttgcaaat tatcaaaagg 16980 tcggcatgca aaagtactct acactccaag gaccacctgg tactggtaag agtcattttg 17040 ccatcggact tgctctctat tacccatctg ctcgcatagt gtatacggca tgctctcatg 17100 cagctgttga tgccctatgt gaaaaggcat taaaatattt gcccatagat aaatgtagta 17160 gaatcatacc tgcgcgtgcg cgcgtagagt gttttgataa attcaaagtg aattcaacac 17220 tagaacagta tgttttctgc actgtaaatg cattgccaga aacaactgct gacattgtag 17280 tctttgatga aatctctatg gctactaatt atgacttgag tgttgtcaat gctagacttc 17340 gtgcaaaaca ctacgtctat attggcgatc ctgctcaatt accagccccc cgcacattgc 17400 tgactaaagg cacactagaa ccagaatatt ttaattcagt gtgcagactt atgaaaacaa 17460 taggtccaga catgttcctt ggaacttgtc gccgttgtcc tgctgaaatt gttgacactg 17520 tgagtgcttt agtttatgac aataagctaa aagcacacaa ggataagtca gctcaatgct 17580 tcaaaatgtt ctacaaaggt gttattacac atgatgtttc atc tgcaatc aacagacctc 17640 aaataggcgt tgtaagagaa tttcttacac gcaatcctgc ttggagaaaa gctgttttta 17700 tctcacctta taattcacag aacgctgtag cttcaaaaat cttaggattg cctacgcaga 17760 ctgttgattc atcacagggt tctgaatatg actatgtcat attcacacaa actactgaaa 17820 cagcacactc ttgtaatgtc aaccgcttca atgtggctat cacaagggca aaaattggca 17880 ttttgtgcat aatgtctgat agagatcttt atgacaaact gcaatttaca agtctagaaa 17940 taccacgtcg caatgtggct acattacaag cagaaaatgt aactggactt tttaaggact 18000 16 1297359 gtagtaagat cattactggt cttcatccta cacaggcacc tacacacctc agcgttgata 18060 taaagttcaa gactgaagga ttatgtgttg acataccagg cataccaaag gacatgacct 18120 accgtagact catctctatg atgggtttca aaatgaatta ccaagtcaat ggttacccta 18180 atatgtttat cacccgcgaa gaagctattc gtcacgttcg tgcgtggatt ggctttgatg 18240 tagagggctg tcatgcaact agagatgctg tgggtactaa cctacctctc cagctaggat 18300 tttctacagg tgttaactta gtagctgtac cgactggtta tgttgacact gaaaataaca 18360 cagaattcac cagagttaat gcaaaacctc caccaggtga ccagtttaaa catcttatac 18420 cactcatgta taaaggcttg ccctgg aatg tagtgcgtat taagatagta caaatgctca 18480 gtgatacact gaaaggattg tcagacagag tcgtgttcgt cctttgggcg catggctttg 18540 agcttacatc aatgaagtac tttgtcaaga ttggacctga aagaacgtgt tgtctgtgtg 18600 acaaacgtgc aacttgcttt tctacttcat cagatactta tgcctgctgg aatcattctg 18660 tgggttttga ctatgtctat aacccattta tgattgatgt tcagcagtgg ggctttacgg 18720 gtaaccttca gagtaaccat gaccaacatt gccaggtaca tggaaatgca catgtggcta 18780 gttgtgatgc tatcatgact agatgtttag cagtccatga gtgctttgtt aagcgcgttg 18840 attggtctgt tgaataccct attataggag atgaactgag ggttaattct gcttgcagaa 18900 aagtacaaca catggttgtg aagtctgcat tgcttgctga taagtttcca gttcttcatg 18960 acattggaaa tccaaaggct atcaagtgtg tgcctcaggc tgaagtagaa tggaagttct 19020 acgatgctca gccatgtagt gacaaagctt acaaaataga ggaactcttc tattcttatg 19080 ctacacatca cgataaattc actgatggtg tttgtttgtt ttggaattgt aacgttgatc 19140 gttacccagc caatgcaatt gtgtgtaggt ttgacacaag agtcttgtca aacttgaact 19200 taccaggctg tgatggtggt agtttgtatg tgaataagca tgcattccac actccagctt 19260 tcgataaaag tgcatttac t aatttaaagc aattgccttt cttttactat tctgatagtc 19320 cttgtgagtc tcatggcaaa caagtagtgt cggatattga ttatgttcca ctcaaatctg 19380 ctacgtgtat tacacgatgc aatttaggtg gtgctgtttg cagacaccat gcaaatgagt 19440 accgacagta cttggatgca tataatatga tgatttctgc tggatttagc ctatggattt 19500 acaaacaatt tgatacttat aacctgtgga atacatttac caggttacag agtttagaaa 19560 atgtggctta taatgttgtt aataaaggac actttgatgg acacgccggc gaagcacctg 19620 tttccatcat taataatgct gtttacacaa aggtagatgg tattgatgtg gagatctttg 19680 aaaataagac aacacttcct gttaatgttg catttgagct ttgggctaag cgtaacatta 19740 aaccagtgcc agagattaag atactcaata atttgggtgt tgatatcgct gctaatactg 19800 taatctggga ctacaaaaga gaagccccag cacatgtatc tacaataggt gtctgcacaa 19860 tgactgacat tgccaagaaa cctactgaga gtgcttgttc ttcacttact gtcttgtttg 19920 atggtagagt ggaaggacag gtagaccttt ttagaaacgc ccgtaatggt gttttaataa 19980 cagaaggttc agtcaaaggt ctaacacctt caaagggacc agcacaagct agcgtcaatg 20040 gagtcacatt aattggagaa tcagtaaaaa cacagtttaa ctactttaag aaagtagacg 20100 gcattattca a cagttgcct gaaacctact ttactcagag cagagactta gaggatttta 20160 agcccagatc acaaatggaa actgactttc tcgagctcgc tatggatgaa ttcatacagc 20220 gatataagct cgagggctat gccttcgaac acatcgttta tggagatttc agtcatggac 20280 17 1297359 aacttggcgg tcttcattta atgataggct tagccaagcg ctcacaagat tcaccactta 20340 aattagagga ttttatccct atggacagca cagtgaaaaa ttacttcata acagatgcgc 20400 aaacaggttc atcaaaatgt gtgtgttctg tgattgatct tttacttgat gactttgtcg 20460 agataataaa gtcacaagat ttgtcagtga tttcaaaagt ggtcaaggtt acaattgact 20520 atgctgaaat ttcattcatg ctttggtgta aggatggaca tgttgaaacc ttctacccaa 20580 aactacaagc aagtcaagcg tggcaaccag gtgttgcgat gcctaacttg tacaagatgc 20640 aaagaatgct tcttgaaaag tgtgaccttc agaattatgg tgaaaatgct gttataccaa 20? 0.0 aaggaataat gatgaatgtc gcaaagtata ctcaactgtg tcaatactta aatacactta 20760 ctttagctgt accctacaac atgagagtta ttcactttgg tgctggctct gataaaggag 20820 ttgcaccagg tacagctgtg ctcagacaat ggttgccaac tggcacacta cttgtcgatt 20880 cagatcttaa tgacttcgtc tccgacgcag attctacttt aattggagac tgtgcaaca g 20940 tacatacggc taataaatgg gaccttatta ttagcgatat gtatgaccct aggaccaaac 21000 atgtgacaaa agagaatgac tctaaagaag ggtttttcac ttatctgtgt ggatttataa 21060 agcaaaaact agccctgggt ggttctatag ctgtaaagat aacagagcat tcttggaatg 21120 ctgaccttta caagcttatg ggccatttct catggtggac agcttttgtt acaaatgtaa 21180 atgcatcatc atcggaagca tttttaattg gggctaacta tcttggcaag ccgaaggaac 21240 aaattgatgg ctataccatg catgctaact acattttctg gaggaacaca aatcctatcc 21300 agttgtcttc ctattcactc tttgacatga gcaaatttcc tcttaaatta agaggaactg 21360 ctgtaatgtc tcttaaggag aatcaaatca atgatatgat ttattctctt ctggaaaaag 21420 gtaggcttat cattagagaa aacaacagag ttgtggtttc aagtgatatt cttgttaaca 21480 actaaacgaa catgtttatt ttcttattat ttcttactct cactagtggt agtgaccttg 21540 accggtgcac cacttttgat gatgttcaag ctcctaatta cactcaacat acttcatcta 21600 tgaggggggt ttactatcct gatgaaattt ttagatcaga cactctttat ttaactcagg 21660 atttatttct tccattttat tctaatgtta cagggtttca tactattaat catacgtttg 21720 gcaaccctgt catacctttt aaggatggta tttattttgc tgccacagag a aatcaaatg 21780 ttgtccgtgg ttgggttttt ggttctacca tgaacaacaa gtcacagtcg gtgattatta 21840 ttaacaattc tactaatgtt gttatacgag catgtaactt tgaattgtgt gacaaccctt 21900 tctttgctgt ttctaaaccc atgggtacac agacacatac tatgatattc gataatgcat 21960 ttaattgcac tttcgagtac atatctgatg ccttttcgct tgatgtttca gaaaagtcag 22020 gtaattttaa acacttacga gagtttgtgt ttaaaaataa agatgggttt ctctatgttt 22080 ataagggcta tcaacctata gatgtagttc gtgatctacc ttctggtttt aacactttga 22140 aacctatttt taagttgcct cttggtatta acattacaaa ttttagagcc attcttacag 22200 ccttttcacc tgctcaagac atttggggca cgtcagctgc agcctatttt gttggctatt 22260 taaagccaac tacatttatg ctcaagtatg atgaaaatgg tacaatcaca gatgctgttg 22320 attgttctca aaatccactt gctgaactca aatgctctgt taagagcttt gagattgaca 22380 aaggaattta ccagacctct aatttcaggg ttgttccctc aggagatgtt gtgagattcc 22440 ctaatattac aaacttgtgt ccttttggag aggtttttaa tgctactaaa ttcccttctg 22500 tctatgcatg ggagagaaaa aaaatttcta attgtgttgc tgattactct gtgctctaca 22560 18 1297359 actcaacatt tttttcaacc tttaagtgct atgg cgtttc tgccactaag ttgaatgatc 22620 tttgcttctc caatgtctat gcagattctt ttgtagtcaa gggagatgat gtaagacaaa 22680 tagcgccagg acaaactggt gttattgctg attataatta taaattgcca gatgatttca 22740 tgggttgtgt ccttgcttgg aatactagga acattgatgc tacttcaact ggtaattata 22800 attataaata taggtatctt agacatggca agcttaggcc ctttgagaga gacatatcta 22860 atgtgccttt ctcccctgat ggcaaacctt gcaccccacc tgctcttaat tgttattggc 22920 cattaaatga ttatggtttt tacaccacta ctggcattgg ctaccaacct tacagagttg 22980 tagtactttc ttttgaactt ttaaatgcac cggccacggt ttgtggacca aaattatcca 23040 ctgaccttat taagaaccag tgtgtcaatt ttaattttaa tggactcact ggtactggtg 23100 tgttaactcc ttcttcaaag agatttcaac catttcaaca atttggccgt gatgtttctg 23160 atttcactga ttccgttcga gatcctaaaa catctgaaat attagacatt tcaccttgcg 23220 cttttggggg tgtaagtgta attacacctg gaacaaatgc ttcatctgaa gttgctgttc 23280 tatatcaaga tgttaactgc actgatgttt ctacagcaat tcatgcagat caactcacac 23340 cagcttggcg catatattct actggaaaca atgtattcca gactcaagca ggctgtctta 23400 taggagctga gcatgtcgac acttctt atg agtgcgacat tcctattgga gctggcattt 23460 gtgctagtta ccatacagtt tctttattac gtagtactag ccaaaaatct attgtggctt 23520 atactatgtc tttaggtgct gatagttcaa ttgcttactc taataacacc attgctatac 23580 ctactaactt ttcaattagc attactacag aagtaatgcc tgtttctatg gctaaaacct 23640 ccgtagattg taatatgtac atctgcggag attctactga atgtgctaat ttgcttctcc 23700 aatatggtag cttttgcapa caactaaatc gtgcactctc aggtattgct gctgaacagg 23760 atcgcaacac acgtgaagtg ttcgctcaag tcaaacaaat gtacaaaacc ccaactttga 23820 aatattttgg tggttttaat ttttcacaaa tattacctga ccctctaaag ccaactaaga 23880 ggtcttttat tgaggacttg ctctttaata aggtgacact cgctgatgct ggcttcatga 23940 agcaatatgg cgaatgccta ggtgatatta atgctagaga tctcatttgt gcgcagaagt 24000 tcaatggact tacagtgttg ccacctctgc tcactgatga tatgattgct gcctacactg 24060 ctgctctagt tagtggtact gccactgctg gatggacatt tggtgctggc gctgctcttc 24120 aaataccttt tgctatgcaa atggcatata ggttcaatgg cattggagtt acccaaaatg 24180 ttctctatga gaaccaaaaa caaatcgcca accaatttaa caaggcgatt agtcaaattc 24240 aagaatcact tacaacaaca tcaactgcat tgggcaagct gcaagacgtt gttaaccaga 24300 atgctcaagc attaaacaca cttgttaaac aacttagctc taattttggt gcaatttcaa 24360 gtgtgctaaa tgatatcctt tcgcgacttg ataaagtcga ggcggaggta caaattgaca 24420 ggttaattac aggcagactt caaagccttc aaacctatgt aacacaacaa ctaatcaggg 24480 ctgctgaaat cagggcttct gctaatcttg ctgctactaa aatgtctgag tgtgttcttg 24540 gacaatcaaa aagagttgac ttttgtggaa agggctacca ccttatgtcc ttcccacaag 24600 cagccccgca tggtgttgtc ttcctacatg tcacgtatgt gccatcccag gagaggaact 24660 0 &Lt; tcaccacagc gccagcaatt tgtcatgaag gcaaagcata cttccctcgt gaaggtgttt 24720 ttgtgtttaa tggcacttct tggtttatta cacagaggaa cttcttttct ccacaaataa 24780 ttactacaga caatacattt gtctcaggaa attgtgatgt cgttattggc atcattaaca 24840 19 1297359 acacagttta tgatcctctg caacctgagc ttgactcatt caaagaagag ctggacaagt 24900 acttcaaaaa tcatacatca ccagatgttg atcttggcga catttcaggc attaacgctt 24960 ctgtcgtcaa cattcaaaaa gaaattgacc gcctcaatga ggtcgctaaa aatttaaatg 25020 aatcactcat tgaccttcaa gaattgggaa aatatgagca atatattaaa tggccttggt 25080 atgtttggct cggcttcatt gctggactaa ttgccatcgt catggttaca atcttgcttt 25140 gttgcatgac tagttgttgc agttgcctca agggtgcatg ctcttgtggt tcttgctgca 25200 agtttgatga ggatgactct gagccagttc tcaagggtgt caaattacat tacacataaa 25260 cgaacttatg gatttgttta tgagattttt tactcttaga tcaattactg cacagccagt 25320 aaaaattgac aatgcttctc ctgcaagtac tgttcatgct acagcaacga taccgctaca 25380 agcctcactc cctttcggat ggcttgttat tggcgttgca tttcttgctg tttttcagag 25440 cgctaccaaa ataattgcgc tcaataaaag atggcagcta gccc tttata agggcttcca 25500 gttcatttgc aatttactgc tgctatttgt taccatctat tcacatcttt tgcttgtcgc 25560 tgcaggtatg gaggcgcaat ttttgtacct ctatgccttg atatattttc tacaatgcat 25620 caacgcatgt agaattatta tgagatgttg gctttgttgg aagtgcaaat ccaagaaccc 25680 attactttat gatgccaact actttgtttg ctggcacaca cataactatg actactgtat 25740 accatataac agtgtcacag atacaattgt cgttactgaa ggtgacggca tttcaacacc 25800 aaaactcaaa gaagactacc aaattggtgg ttattctgag gataggcact caggtgttaa 25860 agactatgtc gttgtacatg gctatttcac cgaagtttac taccagcttg agtctacaca 25920 aattactaca gacactggta ttgaaaatgc tacattcttc atctttaaca agcttgttaa 25980 agacccaccg aatgtgcaaa tacacacaat cgacggctct tcaggagttg ctaatccagc 26040 aatggatcca atttatgatg agccgacgac gactactagc gtgcctttgt aagcacaaga 26100 aagtgagtac gaacttatgt actcattcgt ttcggaagaa acaggtacgt taatagttaa 26160 tagcgtactt ctttttcttg ctttcgtggt attcttgcta gtcacactag ccatccttac 26220 tgcgcttcga ttgtgtgcgt actgctgcaa tattgttaac gtgagtttag taaaaccaac 26280 ggtttacgtc tactcgcgtg ttaaaaatct gaactct tct gaaggagttc ctgatcttct 26340 ggtctaaacg aactaactat tattattatt ctgtttggaa ctttaacatt gcttatcatg 26400 gcagacaacg gtactattac cgttgaggag cttaaacaac tcctggaaca atggaaccta 26460 gtaataggtt tcctattcct agcctggatt atgttactac aatttgccta ttctaatcgg 26520 aacaggtttt tgtacataat aaagcttgtt ttcctctggc tcttgtggcc agtaacactt 26580 gcttgttttg tgcttgctgc tgtctacaga attaattggg tgactggcgg gattgcgatt 26640 gcaatggctt gtattgtagg cttgatgtgg cttagctact tcgttgcttc cttcaggctg 26700 tttgctcgta cccgctcaat gtggtcattc aacccagaaa caaacattct tctcaatgtg 26760 cctctccggg ggacaattgt gaccagaccg ctcatggaaa gtgaacttgt cattggtgct 26820 gtgatcattc gtggtcactt gcgaatggcc ggacactccc tagggcgctg tgacattaag 26880 gacctgccaa aagagatcac tgtggctaca tcacgaacgc tttcttatta caaattagga 26940 gcgtcgcagc gtgtaggcac tgattcaggt tttgctgcat acaaccgcta ccgtattgga 27000 aactataaat taaatacaga ccacgccggt agcaacgaca atattgcttt gctagtacag 27060 taagtgacaa cagatgtttc atcttgttga cttccaggtt acaatagcag agatattgat 27120 20 1297359 tatcattatg aggactttca ggattgctat ttggaatctt gacgttataa taagttcaat 27180 agtgagacaa ttatttaagc ctctaactaa gaagaattat tcggagttag atgatgaaga 27240 acctatggag ttagattatc cataaaacga acatgaaaat tattctcttc ctgacattga 27300 ttgtatttac atcttgcgag ctatatcact atcaggagtg tgttagaggt acgactgtac 27360 tactaaaaga accttgccca tcaggaacat acgagggcaa ttcaccattt caccctcttg 27420 ctgacaataa atttgcacta acttgcacta gcacacactt tgcttttgct tgtgctgacg 27480 gtactcgaca tacctatcag ctgcgtgcaa gatcagtttc accaaaactt ttcatcagac 27540 aagaggaggt tcaacaagag ctctactcgc cactttttct cattgttgct gctctagtat 27600 ttttaatact ttgcttcacc attaagagaa agacagaatg aatgagctca ctttaattga 27660 cttctatttg tgctttttag cctttctgct attccttgtt ttaataatgc ttattatatt 27720 ttggttttca ctcgaaatcc aggatctaga agaaccttgt accaaagtct aaacgaacat 27780 gaaacttctc attgttttga cttgtatttc tctatgcagt tgcatatgca ctgtagtaca 27840 gcgctgtgca tctaataaac ctcatgtgct tgaagatcct tgtaaggtac aacactaggg 27900 gtaatactta tagcactgct tggctttgtg ctctaggaaa ggttttacct tttcatagat 27960 ggcacactat gg ttcaaaca tgcacaccta atgttactat caactgtcaa gatccagctg 28020 gtggtgcgct tatagctagg tgttggtacc ttcatgaagg tcaccaaact gctgcattta 28080 gagacgtact tgttgtttta aataaacgaa caaattaaaa tgtctgataa tggaccccaa 28140 tcaaaccaac gtagtgcccc ccgcattaca tttggtggac ccacagattc aactgacaat 28200 aaccagaatg gaggacgcaa tggggcaagg ccaaaacagc gccgacccca aggtttaccc 28260 aataatactg cgtcttggtt cacagctptc actcagcatg gcaaggagga acttagattc 28320 ij cctcgaggcc agggcgttcc aatcaacacc aatagtggtc cagatgacca aattggctac 28380 taccgaagag ctacccgacg agttcgtggt ggtgacggca aaatgaaaga gctcagcccc 28440 agatggtact tctattacct aggaactggc ccagaagctt cacttcccta cggcgctaac 28500 aaagaaggca tcgtatgggt tgcaactgag ggagccttga atacacccaa agaccacatt 28560 ggcacccgca atcctaataa caatgctgcc accgtgctac aacttcctca aggaacaaca 28620 ttgccaaaag gcttctacgc agagggaagc agaggcggca gtcaagcctc ttctcgctcc 28680 tcatcacgta gtcgcggtaa ttcaagaaat tcaactcctg gcagcagtag gggaaattct 28740 cctgctcgaa tggctagcgg aggtggtgaa actgccctcg cgctattgct gctagacaga 28800 t tgaaccagc ttgagagcaa agtttctggt aaaggccaac aacaacaagg ccaaactgtc 28860 actaagaaat ctgctgctga ggcatctaaa aagcctcgcc aaaaacgtac tgccacaaaa 28920 cagtacaacg tcactcaagc atttgggaga cgtggtccag aacaaaccca aggaaatttc 28980 ggggaccaag acctaatcag acaaggaact gattacaaac attggccgca aattgcacaa 29040 tttgctccaa gtgcctctgc attctttgga atgtcacgca ttggcatgga agtcacacct 29100 tcgggaacat ggctgactta tcatggagcc attaaattgg atgacaaaga tccacaattc 29160 aaagacaacg tcatactgct gaacaagcac attgacgcat acaaaacatt cccaccaaca 29220 gagcctaaaa aggacaaaaa gaaaaagact gatgaagctc agcctttgcc gcagagacaa 29280 aagaagcagc ccactgtgac tcttcttcct gcggctgaca tggatgattt ctccagacaa 29340 cttcaaaatt ccatgagtgg agcttctgct gattcaactc aggcataaac actcatgatg 29400 21 1297359 accacacaag gcagatgggc tatgtaaacg ttttcgcaat tccgtttacg atacatagtc 29460 tactcttgtg cagaatgaat tctcgtaact aaacagcaca agtaggttta gttaacttta 29520 atctcacata gcaatcttta atcaatgtgt aacattaggg aggacttgaa agagccacca 29580 cattttcatc gaggccacgc ggagtacgat cgagggtaca gtgaataatg Ctagggagag 29640 ctgcctatat ggaagagccc taatgtgtaa aattaatttt agtagtgcta tccccatgtg 29700 attttaatag cttcttagga gaatgacaaa aaaaaaaaaa aaaaaaaaaa a 29751 &lt;210&gt;33 &lt;211&gt;3768

&Lt; 212 &gt; DNA &lt; 213> Toronto strains of SARS-CoV spike protein sequence &lt; 400 &gt; 33 atgtttattt tcttattatt tcttactctc 120 tactatcctg actagtggta gtgaccttga ccggtgcacc 60 acttttgatg atgttcaagc tcctaattac actcaacata cttcatctat gaggggggtt atgaaatttt tagatcagac actctttatt taactcagga tttatttctt 180 ccattttatt ctaatgttac agggtttcat actattaatc atacgtttgg caaccctgtc 240 atacctttta aggatggtat ttattttgct gccacagaga aatcaaatgt tgtccgtggt 300 tgggtttttg gttctaccat gaacaacaag tcacagtcgg tgattattat taacaattct 360 actaatgttg ttatacgagc atgtaacttt gaattgtgtg acaacccttt ctttgctgtt 420 tctaaaccca tgggtacaca gacacatact atgatattcg ataatgcatt taattgcact 480 ttcgagtaca tatctgatgc cttttcgctt gatgtttcag aaaagtcagg taattttaaa 540 cacttacgag agtttgtgtt taaaaataaa gatgggtttc tctatgttta taagggctat 600 caacctatag atgtagttcg tgatctacct tctggtttta acactttgaa acctattttt 660 Aagttgcctc ttggtattaa cattacaaat tttagagcca ttcttacagc cttttcacct 720 gctcaagaca tttggggcac gtcagctgca gcctattttg ttggctattt aaagccaact 780 ac atttatgc tcaagtatga tgaaaatggt acaatcacag atgctgttga ttgttctcaa 840 aatccacttg ctgaactcaa atgctctgtt aagagctttg agattgacaa aggaatttac 900 cagacctcta atttcagggt tgttccctca ggagatgttg tgagattccc taatattaca 960 aacttgtgtc cttttggaga ggtttttaat gctactaaat tcccttctgt ctatgcatgg 1020 gagagaaaaa aaatttctaa ttgtgttgct gattactctg tgctctacaa ctcaacattt 1080 ttttcaacct ttaagtgcta tggcgtttct gccactaagt tgaatgatct ttgcttctcc 1140 aatgtctatg cagattcttt tgtagtcaag ggagatgatg taagacaaat agcgccagga 1200 caaactggtg ttattgctga ttataattat aaattgccag atgatttcat gggttgtgtc 1260 cttgcttgga atactaggaa cattgatgct acttcaactg gtaattataa ttataaatat 1320 aggtatctta gacatggcaa gcttaggccc tttgagagag acatatctaa tgtgcctttc 1380 tcccctgatg gcaaaccttg caccccacct gctcttaatt gttattggcc attaaatgat 1440 tatggttttt acaccactac tggcattggc taccaacctt acagagttgt agtactttct 1500 tttgaacttt taaatgcacc ggccacggtt tgtggaccaa aattatccac tgaccttatt 1560 22 1297359 aagaaccagt gtgtcaattt taattttaat ggactcactg gtactggtgt gttaactcct tcttc aaaga gatttcaacc atttcaacaa tttggccgtg atgtttctga tttcactgat tccgttcgag atcctaaaac atctgaaata ttagacattt caccttgcgc ttttgggggt gtaagtgtaa ttacacctgg aacaaatgct tcatctgaag ttgctgttct atatcaagat gttaactgca ctgatgtttc tacagcaatt catgcagatc aactcacacc agcttggcgc atatattcta ctggaaacaa tgtattccag actcaagcag gctgtcttat aggagctgag catgtcgaca cttcttatga gtgcgac ^ tt cctattggag ctggcatttg tgctagttac catacagttt ctttattacg tagtactagc caaaaatcta ttgtggctta tactatgtct ttaggtgctg atagttcaat tgcttactct aataacacca ttgctatacc tactaacttt tcaattagca ttactacaga agtaatgcct gtttctatgg ctaaaacctc cgtagattgt aatatgtaca tctgcggaga ttctactgaa tgtgctaatt tgcttctcca atatggtagc ttttgcacac aactaaatcg tgcactctca ggtattgctg ctgaacagga tcgcaacaca cgtgaagtgt tcgctcaagt caaacaaatg tacaaaaccc caactttgaa atattttggt ggttttaatt attacctgac cctctaaagc caactaagag gtcttttatt gaggacttgc tctttaataa ggtgacactc gctgatgctg gcttcatgaa gcaatatggc gaatgcctag gtgatattaa tgctagagat ctcatttgtg cgcagaagtt caatggactt acagtgttgc cacc tttcacaaat tctgct cactgatgat atgattgctg cctacactgc tgctctagtt agtggtactg ccactgctgg atggacattt ggtgctggcg ctgctcttca aatacctttt gctatgcaaa tggcatatag gttcaatggc attggagtta cccaaaatgt tctctatgag aaccaaaaac aaatcgccaa ccaatttaac aaggcgatta gtcaaattca a ^ aatcactt acaacaacat caactgcatt gggcaagctg caagacgttg ttaaccagaa tgctcaagca ttaaacacac ttgttaaaca acttagctct aattttggtg caatttcaag tgtgctaaat gatatccttt cgcgacttga taaagtcgag gcggaggtac aaattgacag gttaattaca ggcagacttc aaagccttca aacctatgta acacaacaac taatcagggc tgctgaaatc agggcttctg ctaatcttgc tgctactaaa atgtctgagt gtgttcttgg acaatcaaaa agagttgact tttgtggaaa gggctaccac cttatgtcct tcccacaagc agccccgcat ggtgttgtct tcctacatgt cacgtatgtg ccatcccagg agaggaactt caccacagcg ccagcaattt gtcatgaagg caaagcatac ttccctcgtg aaggtgtttt tgtgtttaat ggcacttctt ggtttattac acagaggaac ttcttttctc cacaaataat tactacagac aatacatttg tctcaggaaa ttgtgatgtc gttattggca tcattaacaa cacagtttat gatcctctgc aacctgagct tgactcattc aaagaagagc tggacaagta cttcaaaaat catacatcac cagatgttga tct tggcgac atttcaggca ttaacgcttc tgtcgtcaac attcaaaaag aaattgaccg cctcaatgag gtcgctaaaa atttaaatga atcactcatt gaccttcaag aattgggaaa atatgagcaa tatattaaat ggccttggta tgtttggctc ggcttcattg ctggactaat tgccatcgtc atggttacaa tcttgctttg ttgcatgact agttgttgca gttgcctcaa gggtgcatgc tcttgtggtt cttgctgcaa gtttgatgag gatgactctg agccagttct caagggtgtc aaattacatt acacataa 3768 1620 1680 1740 1800 1860 1920 1_ 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 23 1297359 &lt;210&gt;34 &lt;211&gt;339

atgttacagg gtttcatact 34 tttattttct tattatttct tactctcact agtggtagtg accttgaccg gtgcaccact 60 tttgatgatg ttcaagctcc taattacact caacatactt catctatgag gggggtttac Γ20 tatcctgatg aaatttttag atcagacact ctttatttaa ctcaggattt atttcttcca 180 ttttattcta; &lt; 212 &gt; DNA &lt; 213 &gt; SARS SA (SA of Spike protein of SARS Coronavirus T0R2) &lt; 400 & gt Atatatcata cgtttggcaa ccctgtcata 240 ccttttaagg atggtattta ttttgctgcc acagagaaat caaatgttgt ccgtggttgg 300 gtttttggtt ctaccatgaa caacaagtca cagtcggtg 339 &lt;210&gt;35 &lt;211&gt;288

&Lt; 212 &gt; DNA &lt; 213 &gt; SARS SB (SB of Spike protein of SARS Coronavirus T0R2) &lt; 400 &gt; 35 aatgatcttt gcttctccaa tgtctatgca gattcttttg tagtcaaggg agatgatgta 60 agacaaatag cgccaggaca aactggtgtt attgctgatt ataattataa attgccagat 120 gatttcatgg gttgtgtcct tgcttggaat actaggaaca ttgatgctac ttcaactggt 180 aattataatt ataaatatag gtatcttaga Catggcaagc ttaggccctt tgagagagac 240 atatctaatg tgcctttctc ccctgatggc aaaccttgca ccccacct 288 &lt;210&gt;36 &lt;211&gt;261

&Lt; 212 &gt; DNA &lt; 213 &gt; SARS SC (SC of Spike protein of SARS Coronavirus T0R2) &lt; 400 &gt; 36 gtttgtggac caaaattatc cactgacctt attaagaacc agtgtgtcaa ttttaatttt 60 aatggactca ctggtactgg tgtgttaact ccttcttcaa agagatttca accatttcaa 120 caatttggcc gtgatgtttc tgatttcact gattccgttc gagatcctaa aacatctgaa 180 atattagaca tttcaccttg cgcttttggg Ggtgtaagtg taattacacc tggaacaaat 240 gcttcatctg aagttgctgt t 261 ' &lt;210&gt;37 &lt;211&gt;243 * °

&Lt; 212 &gt; DNA &lt; 213 &gt; SARS SD (SD of Spike protein of SARS Coronavirus T0R2) 24 1297359 &lt; 400 &gt; 37 aacacagttt atgatcctct gcaacctgag cttgactcat tcaaagaaga gctggacaag 60 tacttcaaaa atcatacatc accagatgtt gatcttggcg acatttcagg cattaacgct 120 tctgtcgtca acattcaaaa agaaattgac cgcctcaatg aggtcgctaa aaatttaaat 180 gaatcactca Ttgaccttca agaattggga aaatatgagc aatatattaa atggccttgg 240 tat 243

I I &lt;210&gt;38 &lt;211&gt;996

&Lt; 212 &gt; DNA &lt; 213 &gt; SARS SBC (SBC of Spike protein oi SARS Coronavirus TOR2) &lt; 400 &gt; 38 aagtatgatg aaaatggtac aatcacagat gctgttgatt gttctcaaaa tccacttgct 60 gaactcaaat gctctgttaa gagctttgag attgacaaag gaatttacca gacctctaat 120 ttcagggttg ttccctcagg agatgttgtg agattcccta atattacaaa cttgtgtcct 180 tttggagagg tttttaatgc tactaaattc ccttctgtct atgcatggga gagaaaaaaa 240 atttctaatt gtgttgctga ttactctgtg ctctacaact caacattttt ttcaaccttt 300 aagtgctatg gcgtttctgc cactaagttg aatgatcttt gcttctccaa tgtctatgca 360 gattcttttg tagtcaaggg agatgatgta agacaaatag cgccaggaca aactggtgtt 420 attgctgatt ataattataa attgcc Shu agat gatttcatgg gttgtgtcct tgcttggaat 480 actaggaaca ttgatgctac ttcaactggt aattataatt ataaatatag gtatcttaga 540 catggcaagc ttaggccctt tgagagagac atatctaatg tgcctttctc ccctgatggc 600 aaaccttgca ccccacctgc Tcttaattgt tattggccat taaatgatta tggtttttac 660 accactactg gcattggcta ccaaccttac agagttgtag tactttcttt tgaactttta 720 aatgcaccgg ccacggtttg tggaccaaaa ttatccactg accttattaa gaacc agtgt 780 gtcaatttta attttaatgg actcactggt actggtgtgt taactccttc ttcaaagaga 840 tttcaaccat ttcaacaatt tggccgtgat gtttctgatt tcactgattc cgttcgagat 900 cctaaaacat ctgaaatatt agacatttca ccttgcgctt ttgggggtgt aagtgtaatt 960 acacctggaa caaatgcttc atctgaagtt gctgtt 996 &lt; 210 &gt; 39 &lt; 211 &gt; 1269

&Lt; 212 &gt; DNA &lt; 213> Toronto strain SARS coronal virus core-sheath protein sequence &lt; 400 &gt; 39 atgtctgata atggacccca atcaaaccaa cgtagtgccc cccgcattac atttggtgga 60 cccacagatt caactgacaa taaccagaat ggaggacgca atggggcaag gccaaaacag 120 cgccgacccc aaggtttacc caataatact gcgtcttggt tcacagctct cactcagcat 180 25 1297359 ggcaaggagg aacttagatt ccctcgaggc cagggcgttc caatcaacac caatagtggt 240 ccagatgacc aaattggcta ctaccgaaga gctacccgac gagttcgtgg tggtgacggc 300 aaaatgaaag agctcagccc cagatggtac ttctattacc taggaactgg cccagaagct 360 tcacttccct acggcgctaa caaagaaggc atcgtatggg ttgcaactga gggagccttg 420 aatacaccca aagaccacat tggcacccgc aatcctaata acaatgctgc caccgtgcta 480 caacttcctc aaggaacaac attgccaaaa ggcttctacg cagagggaag cagaggcggc 540 agtcaagcct cttctcgctc ctcatcacgt agtcgcggta attcaagaaa ttcaactcct 600 ggcagcagta ggggaaattc tcctgctcga atggctagcg Gaggtggtga aactgccctc 660 gcgctattgc tgctagacag attgaaccag cttgagagca aagtttctgg taaaggccaa 720 caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcatctaa aaa gcctcgc 780 caaaaacgta ctgccacaaa acagtacaac gtcactcaag catttgggag acgtggtcca 840 gaacaaaccc aaggaaattt cggggaccaa gacctaatca gacaaggaac tgattacaaa 900 cattggccgc aaattgcaca atttgctcca agtgcctctg cattctttgg aatgtcacgc 960 attggcatgg aagtcacacc ttcgggaaca tggctgactt atcatggagc cattaaattg 1020 gatgacaaag atccacaatt caaagacaac gtcatactgc tgaacaagca cattgacgca 1080 tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaaaaagac tgatgaagct 1140 cagcctttgc cgcagagaca aaagaagcag cccactgtga ctcttcttcc tgcggctgac 1200 atggatgatt tctccagaca acttcaaaat tccatgagtg gagcttctgc tgattcaact 1260 caggcataa 1269 • ί* &lt;210&gt;40 &lt;211&gt;471

&Lt; 212 &gt; DNA &lt; 213 &gt; SARS Μ (M of SARS Coronavirus TOR2) &lt; 400 &gt; 40 tctgataatg gaccccaatc aaaccaacgt agtgcccccc gcattacatt tggtggaccc 60 acagattcaa ctgacaataa ccagaatgga ggacgcaatg gggcaaggcc aaaacagcgc 120 cgaccccaag gtttacccaa taatactgcg tcttggttca cagctctcac tcagcatggc 180 aaggaggaac ttagattccc tcgaggccag ggcgttccaa tcaacaccaa tagtggtcca 240 gatgaccaaa ttggctacta ccgaagagct acccgacgag ttcgtggtgg tgacggcaaa 300 atgaaagagc tcagccccag atggtacttc tattacctag gaactggccc agaagcttca 360 cttccctacg gcgctaacaa agaaggcatc gtatgggttg caactgaggg agccttgaat 420 acacccaaag accacattgg cacccgcaat cctaataaca atgctgccac c 471 &lt; 210 &gt; 41 &lt; 211 &gt; 429

&Lt; 212 &gt; DNA &lt; 213 &gt; SARS NB (NB of SARS Coronavirus T0R2) 26 1297359,, &lt; 400 &gt; 41 cctcaaggaa caacattgcc aaaaggcttc tacgcagagg gaagcagagg cggcagtcaa 60 gcctcttctc gctcctcatc acgtagtcgc ggtaattcaa gaaattcaac tcctggcagc 120 agtaggggaa attctcctgc tcgaatggct agcggaggtg gtgaaactgc cctcgcgcta 180 ttgctgctag acagattgaa Ccagcttgag agcaaagttt ctggtaaagg ccaacaacaa 240 caaggccaaa ctgtcactaa gaaatctgct gctgaggcat ctaaaaagcc tcgccaaaaa 300 cgtactgcca caaaacagta caacgtcact caagcatttg ggagacgtgg tccagaacaa 360 acccaaggaa atttcgggga ccaagaccta atcagacaag gaactgatta caaacattgg 420 ccgcaaatt 429 27

Claims (1)

Ϊ29735910, the scope of application for patents: *# 曰修(more) original j' species of severe respiratory syndrome (SARS) coronavirus antigen surface expression vector, the vector contains: at least one used to encode polypro-gamma glutamic acid synthetase ( The pgsB, pgsC and pgsA genes of poly-gamma-glutamic acid synthase; and a gene encoding an antigen on a SARS coronavirus, wherein the antigen is selected from one of the following groups: a spine antigen and a nuclear sheath antigen. 2_ The target of a severe respiratory syndrome coronavirus antigen surface expression according to claim 1, wherein the spine antigen is selected from one of the following groups: SARS SA, SARS SB, SARS SC, SARS SD, and SARS SBC. 3. The severe respiratory syndrome coronavirus antigen surface expression vector according to claim 1, wherein the nuclear sheath antigen is selected from one of the following groups: SARS NA, SARS ΝΒ, and SARS N 〇 4 The severe respiratory syndrome coronavirus antigen surface expression vector according to the second aspect of the invention, wherein the preparation of the surface expression vector is selected from one of the following groups: pHCE2LB: pgsA-SARS SA, pHCE2LB: pgsA-SARS SC and pHCE2LB: pgsA_SARS SBC. 4 * 5. The severe respiratory syndrome coronavirus antigen surface expression vector according to claim 3, wherein the preparation of the surface carrier is selected from one of the following groups: 1 Ί297359 pHCE2LB: pgsA-SARS NB and pHCE2LB: pgsA-SARS N. 6_- A microorganism which is transformed by a surface expression carrier provided by any one of the claims of Item _5, wherein the microorganism is selected from one of the following groups: Escherichia coli (Ε·c〇n), typhoid fever Salmonella typhi, Salmonella typhimurium, vibrio cholerae, Mycobacterium bovis, and Shigella, Bacillus, Lactobacillus , Lactococcus, Staphylococcus, usteria monocyt〇genes, and Streptococcus (Streptococcus) a method for producing a SARS coronavirus antigen, wherein the antigen is selected from one of the following groups : the spine antigen and the _ antigen, and the financial method includes the cultivating material to follow the microorganism provided in item 6. 8. The sars coronavirus is resistant to (four) green, and the microbial system is produced. It is a lactic acid bacterium. 9. A kind of milk _, the milk _ series (4) is prepared by the method provided in the eighth item of the patent, and the spine antigen or 彳 _ _ _ _ _ _ _ _ _ _ _ _ 10· Kind of pre- The vaccine of the SARS virus includes an antigenic protein produced by the method provided in item 7 of the scope of the application, wherein the antigen is selected from one of the following groups: a spine antigen egg nucleocapsid antigen protein ^ such as a patent patent The vaccine for the SARS virus according to the above item, wherein the antigen protein 1297359 is taken from the surface of the microorganism and taken out by one of the following methods: natural extraction and purification. 12. As claimed in claim 10 The vaccine for preventing SARS virus, wherein the vaccine is applied to one of the following groups: oral and mixed with food. 13_ The vaccine for preventing SARS virus according to the scope of claim 1 of the patent application, wherein the vaccine The application method of sputum is selected from one of the following groups: subcutaneous injection and intraperitoneal injection. 14_ The vaccine for preventing SARS virus according to the first aspect of the patent application, wherein the vaccine is injected through the nasal cavity. Method of application 15. A vaccine for preventing SARS virus, which contains the lactic acid letter provided in item g of the patent application scope as its active ingredient. 16_If the patent application scope is 15th The vaccine for preventing SARS virus, wherein + the vaccine is administered by one of the following groups: oral and mixed with food. 17_ The vaccine for preventing SARS virus according to claim 15 of the patent application, wherein The vaccine is administered by one of the following groups: subcutaneous injection and intraperitoneal injection. 18. The vaccine for preventing SARS virus according to claim 15 of the patent application, wherein the vaccine is injected intranasally. Apply.