CN100582232C - Tumour-dissolving adenovirus mutant possessing multiple specific anti-tumour mechanism - Google Patents

Abstract

This invention involved oncolytic adenovirus mutant with the multiple antitumoral Mec. It belongs to the BME field. The adenovirus mutant Elb-55kDa and Elb-19kDa has missing gene, inserts chimeric promoter composed by the human telomerase reverse transcriptase core sequence and human tumor epidermal growth factor receptor enhancer before the replication required gene Ela codons mEla289R and mEla243R. So the virus can specific proliferate in cancer cell. Oncolytic viruses and mEla protein can exert thire influence. It can also increase the sensitivity of cancer cell to chemoradiation and have no influence to normal cell. It inserts the human h-endostatin gene expression cassette in adenovirus mutant gene group; along the replication of virus in cancer cell to amplificate h-endostatin gene and effective expression in tumor so to restrain neovascularization of tumor so to realize the result of restrain the increase and transformation of cancer cell and apoptotic cell. This new oncolytic adenovirus mutant has good clinical prospect in gene curing so to used in curing many kinds of human tumors.

Description

A kind of oncolytic adenovirus mutant with the anticancer mechanism of multiple specific

Technical field

The present invention relates to be applied to a kind of oncolytic adenovirus mutant of oncotherapy, belong to life science, biomedical sector with the anticancer mechanism of multiple specific.

Background technology

Malignant tumour is with cellular abnormality propagation and to shift be a big class disease of characteristics.Global New Development tumor cases in 2000 is about 1,000 ten thousand, and is dead 6,200,000, existing ill example 2,200 ten thousand.China's tumor invasion and mortality ratio are in rising trend always, the about 180-200 ten thousand of tumor invasion number in 2000, and dead 140-150 ten thousand, in the town dweller, tumour has accounted for the first place of the cause of the death.Yet along with The development in society and economy, the primary hazard factor of tumour is not effectively controlled.At present to the treatment of malignant tumour still based on operation, radiotherapy, the chemotherapy of routine, this conventional treatment is difficult to receive the curative effect of expection concerning most tumours.Particularly for chemotherapeutics, its therapeutic index is low, and toxic side effect is big.In recent years, molecular biology had had the development of advancing by leaps and bounds, and gene therapy becomes after radiotherapy, chemotherapy, operative treatment a part indispensable in the complex therapy day by day.According to the statistics in December, 2004, totally 1020 the gene therapy schemes in the whole world enters clinically, mainly concentrates on the U.S., secondly is Europe, and 63.4% is used for treatment for cancer.The gene therapy of cancer mainly is to transport antioncogene with replication-defective vector at present, the clinical progress that carries the p53 gene with replication-defective adenoviral is the rapidest, the whole world has at least 5 to enter the III clinical trial phase, wherein the recombinant adenovirus p53 injection liquid " Ad-p53 " of China becomes the gene therapy for cancer medicine of first listing in the world in listing in 2004.

Adenovirus is the most commonly encountered diseases poisonous carrier of present therapy of tumor, has been widely used in the human body gene treatment plan, has the following advantages: genome is clear fully, easy handling; The human cell that can infect is extensive, and the dissimilar human tissue cell of can transduceing efficiently comprises cell stationary phase; Virus titer is higher, and the recombinant virus output of high titre is arranged in cell culture; Genome is big, thereby can insert big fragment foreign gene; Enter and be not incorporated into the host cell gene group in the cell, thereby security is higher, non-carcinogenesis.The adenovirus carrier replication-defective adenovirals that lack the E1 district that adopt more, can grow in the engineering cell of expressing the E1 gene and go down to posterity, the present most of adenovirus vector genome that uses mostly is viral genome and the integrate foreign genes of removing part E1a, E1b and E3 and forms.Though replication-defective adenoviral has shown certain security in vivo and in vitro, yet this type of adenovirus carrier of the great majority of using in clinical trial so far remains in many shortcomings, as time of expression alien gene is short, immunogenicity is stronger, significant cytotoxicity etc. is arranged during high titre, so clinical efficacy is not good.At present, oncolytic adenovirus treatment tumor development is rapid, and this oncolytic adenovirus treatment does not generally cause serious toxic side effect, unlimited toxic agent amount.The oncolytic adenovirus project that makes fast progress both at home and abroad comprises a plurality of clinical preceding project of U.S. Geron company and Introgen company, the ONYX-015 project of U.S. ONYX company (adenovirus of E1B-55kDa disappearance); The H101 project of the three-dimensional company in domestic Shanghai (be similar to ONYX-015, it is clinical to have finished the III phase, and listing will go through for the end of the year 2005).More and more data proves that oncolytic adenovirus promises to be the anti-tumor medicine of a new generation.

The human entity tumour has the characteristic of infinite multiplication, and this just needs the cell telomere to keep chromosomal stability.Telomere is the structure of eukaryotic cell protection end of chromosome, and normal cell divides once, and telomere will be lost 50～200 Nucleotide, finally causes necrocytosis.When cell cancerated, Telomerase activated, and replenished because chromosomal stability is kept in losing of the telomere that cell fission caused, and made cell escape dead and be immortalized, and finally caused tumor cell proliferation out of control.Studies show that human tumor has very high telomerase activation more than 90%, and normal somatic cell and benign tumor tissue Telomerase Activity are negative.Therefore, carrying out therapy of tumor with Telomerase as target spot may have broad prospects.Secondly, Epidermal Growth Factor Receptor Family (EGFRs comprises EGFR, Her-2, Her-3, Her-4) is a class glycoprotein receptor, is positioned on the cytolemma, belong to the I type and stride film Tyrosylprotein kinase growth factor receptors, comprise the film outskirt, stride the film district, three parts of film inner region.When part with after the film outside part of acceptor combines, the tyrosine residues phosphorylation of part in the acceptor born of the same parents, form the tyrosine substrate binding site, EGFRs is activated, pass through a series of signal transduction path that nuclear factors such as Ras, Raf, MAPK participate in again, cell signal is gone in the nucleus the synthetic and cell propagation effect of mediated dna by cell surface.The generation of EGFRs overexpression and kinds of tumors, development and prognosis have substantial connection, but found to comprise the most tumors cell high expression level EGFRs of nonsmall-cell lung cancer, straight colorectal carcinoma, mammary cancer, kidney and prostate cancer etc., the tumour patient of EGFRs high expression level easily shifts, recurrence time is short, the recurrence rate height, survival time is short.Because the Tyrosylprotein kinase of EGFRs is the prerequisite of signal transduction, thereby becomes the important target molecule of oncotherapy, the oncotherapy that with EGFRs is target probably is a kind of special and effective treatment plan.

The big characteristic of another of human entity tumour is exactly tumor neovasculature formation.When tumor cell number reaches 10 ⁶, volume is at 2-3mm ³The time, oxygen and the nutritive ingredient of new vessel formation so that tumor tissues to be provided must be arranged.In the generation and metastasis forming process of tumour, the factor of inducing and promote new vessel to form is a lot of and occupy advantage, as vascular endothelial growth factor (VECF), fibroblast growth factor (bFGF), transforminggrowthfactor-(TGF-α), interleukin 8 (IL-8), tumor necrosis factor-alpha (TNF-α), plasminogen activating factors (PA) and matrix metalloproteinase (MMPs) etc., promote tumor neovasculature formation, and then carry nutrition to satisfy tumour cell fast breeding and the remote needs that shift.After new vessel generation (angiogenesis) hypothesis of the Folkman proposition seventies in last century tumour is proved, formed the treatment viewpoint of the anti-new vessel generation of tumour gradually.Adopt and suppress the factor such as Endostatin (endostatin), angiostatin (angiostatin), Interferon, rabbit (IFN-α, β, γ), thrombospondin, plasminogen activating factors inhibitor (PAI) and the Canstatin etc. that new vessel forms, suppress tumor neovasculature formation, the nutrition supply of tumour cell capable of blocking causes that tumour is because of the under-nutrition atrophy and even disappear fully and take off.There have been tens of kinds of angiogenesis inhibitors to enter clinical trial at present, wherein found by O ' Reilly that Endostatin received much concern in 1997, this molecule is the cracking segment of endogenous X VIII Collagen Type VI, have an effect at endotheliocyte, can suppress the hyperplasia and the migration of endotheliocyte, the blood supply of blocking-up tumour is taken off thereby make apoptosis of tumor cells or disappear.That Endostatin has is potent, nontoxic, non-immunogenicity, advantage such as have no drug resistance.But its protein molecular transformation period is short, and therapeutic dose is big, needs prolonged and repeated injection to use, and still can not produce on a large scale at present.

Summary of the invention

The object of the present invention is to provide a kind of oncolytic adenovirus mutant that has good potential applicability in clinical practice, can be used for the kinds of tumors treatment with the anticancer mechanism of multiple specific, this oncolytic virus and antioncogene recombinant chou overcome current replication-defective adenoviral vector (as Ad-p53) transhipment and express the shortcoming of antioncogene inefficiency, no target, overcome propagation replication type adenovirus carrier (as H101, ONYX-015) and only have shortcomings such as single antitumor mechanism, security be not good, its antitumor curative effect is improved, and security is improved.

Human adenovirus has A, B, C, D, 6 different subgenus of E, F, and they have nothing in common with each other to close preferendum, tumorigenicity and the history of disease of host cell, the present invention relates to 5 types in the adenovirus C subgenus.

The oncolytic adenovirus mutant that the present invention has the anticancer mechanism of multiple specific is on the basis of human 5 type adenoviral gene groups, lack simultaneously Elb-55kDa and Elb-19kDa protein gene fully, its propagation indispensable gene E1a sports mE1a289R and mE1a243R sequence, and before mE1a289R and mE1a243R sequence, insert a kind of tumour-specific chimeric promoters, also inserted blood vessel endothelium chalone expression casette in the said viral genome.

Above-mentioned chimeric promoters is made up of human telomerase reverse reversed transcriptive enzyme promotor core sequence and human tumor EGF-R ELISA enhanser, may command virus is at the malignant cell proliferated specifically inside, bring into play the antitumor action of viral oncolysis and mE1a viral protein, and can increase put, chemotherapy is to the susceptibility of tumour cell, and to not influence of normal cell.The blood vessel endothelium chalone expression casette that inserts in the while viral genome, endostatin gene is duplicated in tumour cell along with virus and increase, and in tumour, efficiently express the blood vessel endothelium chalone, suppress tumor neogenetic blood vessels and form, reach the effect of inhibition tumor cell proliferation and transfer, inducing apoptosis of tumour cell.

The propagation indispensable gene mE1a289R and the mE1a243R sequence of oncolytic adenovirus mutant of the present invention are respectively:

mE1a289R：atgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccctggacacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataa

mE1a243R：atgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataa

The propagation indispensable gene mE1a289R of oncolytic adenovirus mutant and mE1a243R may command virus are brought into play oncolysis at the malignant cell proliferated specifically inside.This area is known, and adenovirus wild-type E1a gene can produce two kinds of main mRNA spliceosomes, and size is respectively 13s and 12s, 289 and 243 the amino acid whose two kinds of albumen of encoding respectively.ME1a289R provided by the invention is connected by polysome entry site (IRES) sequence with the mE1a243R mutant nucleotide sequence, make both be subjected to the regulation and control of tumour-specific chimeric promoters jointly and synchronous high-efficiency expression mE1a 13S and 12S mRNA, guarantee adenovirus in tumour cell inner height propagation, the performance oncolysis.Some viral protein of its adenovirus has antitumor action, pass through activity, the expression that improves p53 that suppresses the Her-2/neu gene transcription, blocks NF-κ B, the number of ways such as expression that suppress proteinase genes expression such as IV Collagen Type VI enzyme, plasminogen activator, interstitial collagenase, urokinase and stromelysin, the lethal effect that improves CTL cell, NK cell, scavenger cell, enhancing nm-23 nm23 as Ela, inducing apoptosis of tumour cell, suppress tumor invasion and shift, improve the susceptibility of tumour cell chemotherapy, radiotherapy.Adenovirus system (as Ad-p53) commonly used at present, its El district disappearance can not be expressed E1a, thereby makes adenovirus lack the Ela antineoplastic action.Novel oncolytic adenovirus provided by the invention duplicates and efficiently expresses E1a mutant mE1a289R and mE1a243R in specifically inside tumor cell ground propagation, performance mEla antitumor action.And this oncolytic adenovirus can share with chemotherapy and radiation, strengthens the susceptibility of tumour cell to chemotherapy and radiation, further improves result of treatment.

Oncolytic adenovirus mutant of the present invention is with a kind of cis-acting elements control virus multiplication indispensable gene of tumour-specific chimeric promoters, this chimeric promoters by the human telomerase reverse transcriptase's promotor-304 that has knocked out silencer～+ 48bp core sequence and people's tumour EGF-R ELISA enhanser form, this cis-acting elements inserts between the transcription initiation site and translation initiation site ATG of propagation indispensable gene sequence, and the sequence of its chimeric promoters is:

gcagggtgcgagacccaggcagaaacattttgctggatgaggaggaaagatgtaaggttgctccccttcagagacagcaaagggcaggtctgtagcttcacttacttcaggattgtgatttttgacagagccgagagatcagggttgttgaaccaggcctgaaggtcctagtgaatctcgtgaagagaggaggggtctggctgtaacatggacctagaggacatttttactgcaggagaaggaacagtggggatggggtggacttgccaaaggaatatagctcaagttcctgcagcccaaaaaagctcagtttcttttggccaaagcttcgcgcgggcggggaagcgcggcccagaccccgcggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggatctcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccac

Virus mutant of the present invention is effectively controlled by the virus multiplication indispensable gene is carried out selectivity, can duplicate propagation performance oncolysis at specifically inside tumor cell, and to not influence of normal cell.

Human tumor has very high telomerase activation more than 90%, and normal somatic cell and benign tumor tissue Telomerase Activity are negative, and most human malignancies overexpression EGFRs.The present invention is the target molecule of oncotherapy with Telomerase and EGFRs, design is formed chimeric promoters as cis-acting elements with EGFRs enhanser and reverse transcriptase of telomere promotor core sequence, insert between the transcription initiation site and translation initiation site ATG of propagation indispensable gene sequence, regulating and controlling adenovirus propagation indispensable gene transcriptional activation, the virus multiplication indispensable gene can only be expressed in tumour cell specifically, thereby control virus can only be in the tumour cell internal breeding, and in normal cell, do not breed or multiplication capacity extremely a little less than.Reverse transcriptase of telomere promotor total length 3996bp, the core sequence that has knocked out silencer (Silencer) with-304～+ the 48bp activity is the highest ,-255～+ the 40bp activity takes second place.The reverse transcriptase of telomere promotor of oncolytic adenovirus mutant provided by the invention is-304～+ the 48bp spliceosome, can the regulating and controlling adenovirus mutant in the human tumor cell of most of types, breed and destroy cell, under the effect of EGFRs enhanser, its regulation and control have better reliability and security.

Gene clone site BglII has been preset in the propagation indispensable gene expressed intact sequence upstream of oncolytic adenovirus mutant of the present invention, and gene clone site SalI and AccI have been preset in the downstream, and various Antioncogene expression cassettes are easy to carry.

The nucleotide sequence of the coding blood vessel endothelium chalone of oncolytic adenovirus mutant of the present invention directly inserts the exogenous gene cloning site BglII in this oncolytic adenovirus mutant gene group; Inserted M-before the nucleotide sequence of blood vessel endothelium chalone and become knurl protein signal peptide-coding sequence, its complete sequence is:

atgggggtacttgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagccagcagccaccgcgacttccagccggtgctccacctggttgctgctcaacagccccctgtcaggcggcatgcggggcatccgcggggccgacttccagtgcttccagcaggcgcgggccgtggggctggcgggcaccttccgcgccttcctgtcctcgcgcctgcaggacctgtacagcatcgtgcgccgtgccgaccgcgcacgcgtgcccatcgtcaacctcaaggacgagctgctgtttcccagctgggaggctctgttctcaggctctgagggtccgctgaagcccggggcacgcatcttctcctttaacggcaaggacgtcctgaggcaccccacctggccccagaagagcgtgtggcatggctcggaccccaacggcgcaggctgaccgagagctactgtgagacgtggcggacggaggctccctcggccacgggcaggcctcctcgctgctgggggcaggctcctggggcagagtgccgcgagctgccatcacgcctacatcgtgctatgcattgagaacagcttcatgactgcctccaagtaatag

To the encode nucleotide sequence of blood vessel endothelium chalone of oncolytic adenovirus mutant of the present invention inserts this viral exogenous gene cloning site BglII, can bring into play multiple antitumor usefulness.Along with the proliferated specifically of virus in tumour duplicates, the copy number of the endostatin gene that it carries and expression amount also are how much multiples and increase, thereby suppress tumor neovasculature formation, the nutrition supply of blocking-up tumour cell causes tumor growth to suppress and even disappear fully to take off.

The nucleotide sequence of coding blood vessel endothelium chalone is subjected to the control of human cytomegalovirus (CMV) promotor in the Antioncogene expression cassette of oncolytic adenovirus mutant of the present invention, between the transcription initiation site and translation initiation site of the nucleotide sequence of this promotor insertion Endostatin, guarantee that this gene protein efficiently expresses in the inside tumor of virus infection, the performance biologic activity.

The tailer sequence that adds of the Nucleotide of coding blood vessel endothelium chalone is SV40 Poly A in the Antioncogene expression cassette of oncolytic adenovirus mutant of the present invention, after translation stop codon of the nucleotide sequence of this cis-acting elements insertion Endostatin.

The propagation indispensable gene mE1a289R of oncolytic adenovirus mutant of the present invention is connected by polysome entry site (IRES) sequence with the mE1a243R mutant nucleotide sequence, makes both expression regulated and control by the tumour-specific chimeric promoters.

The CR2 conserved regions is introduced deletion mutantion in the propagation indispensable gene mE1a289R of oncolytic adenovirus mutant of the present invention and the mE1a243R mutant nucleotide sequence, encoding sequence (CACGAGGCTGGC) disappearance of 125-128 amino acids residue.

Adenovirus wild-type E1a has 3 functional zone, i.e. CR1, CR2, CR3 district, and the CR1 district is by suppressing the Her-2/neu expression of gene with transcription regulaton factor P300/CBP bound energy; The CR2 district combines with the Rb protein family; The CR3 district is the transcription activating district.E1a albumen can be directly and the Rb protein binding of low phosphorylation by the CR2 district, forms stabilized complex and make Rb albumen inactivation, loses the normal restraining effect of cell growth.The present invention introduces deletion mutantion to the CR2 district of E1a, encoding sequence (CACGAGGCTGGC) disappearance of 125-128 amino acids residue, purpose is the proteic function of inactivation of viruses protein binding Rb, guarantee that dephosphorylized Rb albumen and transcription factor E2F form mixture, the transcriptional activity of blocking-up E2F plays therapeutic action to tumour.

The codon mutation (ATC-ATT) of the propagation indispensable gene mE1a289R of oncolytic adenovirus mutant of the present invention and mE1a243R mutant nucleotide sequence the 120th amino acids residue, 146, the codon mutation of 147 amino acids residues (CCCGGG-CCTGGA), the codon mutation of 219 amino acids residues (AGA-AGG).

Oncolytic adenovirus mutant of the present invention is formed by the cis-acting elements and the human vascular endothelial chalone expression casette structure of human 5 type adenovirus carriers, a kind of tumour-specific chimeric promoters.This oncolytic adenovirus mutant is by the skeleton plasmid pBHGloxdeltaE1 that contains 5 type adenoviral gene groups, and 3Cre produces by the reorganization of Cre-loxP recombinase diced system fixed point in 293 cells with the adenovirus shuttle plasmid that carries the blood vessel endothelium chalone.Below show the sequence in the oncolytic adenovirus mutant ITR-LoxP recombination zone, the sequence unanimity beyond all the other adenovirus 5 type genome sequence and pBHGloxdeltaE1,3Cre adenovirus carrier ITR-LoxP recombination zone, its fusion sequence is:

Adenovirus 5 type genome sequences-

ttcatcaataatataccttattttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgtgggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaacacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacaggaagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagtaagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttgtgttactcatagcgcgtaatatttgtctagggccgcggggactttgaccgtttacgtggagactcgcccaggtgtttttctcaggtgttttccgcgttccgggtcaaagttggcgttttattattatagtcagttctagcagatctaattccctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctggggatcagtcttcgagtcgacaagcttgaattcaccatgggggtacttgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagccagcagccaccgcgacttccagccggtgctccacctggttgctgctcaacagccccctgtcaggcggcatgcggggcatccgcggggccgacttccagtgcttccagcaggcgcgggccgtggggctggcgggcaccttccgcgccttcctgtcctcgcgcctgcaggacctgtacagcatcgtgcgccgtgccgaccgcgcacgcgtgcccatcgtcaacctcaaggacgagctgctgtttcccagctgggaggctctgttctcaggctctgagggtccgctgaagcccggggcacgcatcttctcctttaacggcaaggacgtcctgaggcaccccacctggccccagaagagcgtgtggcatggctcggaccccaacggcgcaggctgaccgagagctactgtgagacgtggcggacggaggctccctcggccacgggcaggcctcctcgctgctgggggcaggctcctggggcagagtgccgcgagctgccatcacgcctacatcgtgctatgcattgagaacagcttcatgactgcctccaagtaatagtctagactcgagggatccatcgagcaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatcgtctagcatcgaagatctgcagggtgcgagacccaggcagaaacattttgctggatgaggaggaaagatgtaaggttgctccccttcagagacagcaaagggcaggtctgtagcttcacttacttcaggattgtgatttttgacagagccgagagatcagggttgttgaaccaggcctgaaggtcctagtgaatctcgtgaagagaggaggggtctggctgtaacatggacctagaggacatttttactgcaggagaaggaacagtggggatggggtggacttgccaaaggaatatagctcaagttcctgcagcccaaaaaagctcagtttcttttggccaaagcttcgcgcgggcggggaagcgcggcccagaccccgcggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggatctcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccactcgagaattcaccatgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccctggacacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataacgcgtcgagcatgcatctagggcggccaattccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgtgattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataagcttgccacaacccgggatcctctagaaccatgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataagtcgacttcgagcaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatcgtctagcatcgaagatccaataacttcgtatagcatacattatacgaagttat-5

Wherein: (1) adenovirus 5 type genome sequences: see the pBHGloxdeltaE1 of Microbix Biosystems company, the 3Cre sequence; (2) 2-102: adenovirus ITR sequence; (3) 103-454: adenovirus 5 type genome sequences; (4) 467-1677: Endostatin expression cassette (CMV promotor+M-becomes knurl protein signal peptide and Endostatin cDNA+SV40PolyA); (5) 1682-2368: the tumour-specific chimeric promoters of forming by EGFR enhanser and reverse transcriptase of telomere promotor core sequence; (6) 2382-3238:mE1a289R encoding sequence; (7) 3251-3855: polysome entry site (IRES); (8) 3878-4597:mE1a243R encoding sequence; (9) 4604-4764:SV40 Poly A; (10) 4765-4798:LoxP sequence.

Specific expressed in tumour cell of the mE1a289R of oncolytic adenovirus mutant of the present invention and mE1a243R mutant nucleotide sequence, its tumour-specific chimeric promoters can be made up of following any two groups of tumor-specific promoters and enhanser: (a) carcinomebryonic antigen promotor, enhanser and mutant sequence thereof; (b) afp promoter, enhanser and mutant sequence thereof; (c) receptor tyrosine kinase of Human epidermal growth factor receptor family (EGFRs) (comprising EGFR, Her-2, Her-3 and Her-4) promotor, enhanser and mutant sequence thereof; (d) breast cancer correlation antigen DF3/MUC1 promotor, enhanser and mutant sequence thereof; (e) promotor, enhanser and the mutant sequence thereof of vascular endothelial growth factor (VEGF) receptor KDR; (f) L-plastin promotor, enhanser and mutant sequence thereof; (g) member's of IAP family (IAP) promotor, enhanser and mutant sequence thereof; (h) promotor of prostaglandin(PG) specific antigens, enhanser and mutant sequence thereof; (i) the hypoxia response elements conserved sequence of HIF-1 (HIF-1) regulation and control; (j) transcription factor E2F promotor, enhanser and mutant sequence thereof.

Oncolytic adenovirus mutant of the present invention, its Elb-55kDa protein gene disappearance is by realizing the proteic gene order point mutation of coding Elb-55kDa, the mode that lacks, insert sudden change wholly or in part or insert terminator codon.

This virus mutant disappearance Elb-55kDa coding gene sequence makes it duplicate propagation at specifically inside tumor cell, the performance oncolysis, and to not influence of normal cell.Normal cell and tumour exist the difference in some genetic expression, can express wild-type P53 albumen as normal cell, and most tumour cells are not expressed wild-type P53 albumen or express mutant P53 albumen, therefore some viruses are duplicated necessary gene in normal cell, and do not need in tumour cell.Elb-55kDa be adenovirus normal cell propagation duplicate essential and in tumour cell unessential albumen, the ability that the selectivity disappearance of Elb-55kDa encoding gene can make adenovirus keep propagation to duplicate in tumour cell, and in normal cell, lose replication.Elb-55kDa albumen can the deactivation and the P53 albumen of degrading, and the selectivity disappearance of Elb-55kDa encoding gene helps the anti-tumor activity that cell keeps P53, improves the target of virus vector simultaneously.

The invention provides the oncolytic adenovirus mutant, its Elb-19kDa protein gene disappearance is by realizing the proteic gene order point mutation of coding Elb-19kDa, the mode that lacks, insert sudden change wholly or in part or insert terminator codon.

This virus mutant duplicates propagation performance oncolysis by disappearance Elb-19kDa coding gene sequence at specifically inside tumor cell, and to not influence of normal cell.Adenovirus infection can be blocked the apoptosis program of cell; adenovirus Elb-19kDa gene and apoptosis suppressor Bcl-2 homology; the Elb-19kDa albumen of coding can suppress program or/and Bak starts the apoptosis in downstream in conjunction with Bax; Elb-19kDa can also destroy Fas mediated Apoptosis process, and the cell that protection is infected is avoided the alpha mediated lethal effect of TNF-.Tumour-specific oncolytic adenovirus of the present invention, its Elb-19kDa genetically deficient, thereby this virus mutant is improved in the specificity of tumour cell internal breeding, and the proliferation activity in normal cell is weakened.The forfeiture of Elb-19kDa protein function, not only can promote the recovery of apoptosis of tumor cells path, and help the quick removing of virus in normal cell and the snap-out release in tumour cell and send out, make the specificity of this oncolytic adenovirus treatment tumour better, usefulness is stronger.

Tumour-specific oncolytic adenovirus mutant of the present invention can also make the forfeiture of Elb-19kDa protein function by the proteic gene order of coding Elb-19kDa being carried out modes such as point mutation, excalation, insertion sudden change or insertion terminator codon.

Oncolytic adenovirus mutant of the present invention, the selection of its Antioncogene can also be following any one: (a) Interferon, rabbit series immune-regulating factor gene; (b) interleukin-series immune-regulating factor gene; (c) colony-stimulating factor gene; (d) cancer suppressor gene; (e) proto-oncogene antisense sequences; (f) antibody gene of people's tumour Epidermal Growth Factor Receptor Family (EGFRs); (g) has the nucleotide sequence such as Endostatin, angiostatin and fragment thereof, plasminogen activating factors inhibitor, Canstatin, thrombospondin of angiogenesis inhibitor; (h) apoptosis inducing factor family gene; (i) vascular endothelial growth factor antibody gene; (j) medicine prerequisite transforming gene (claiming suicide gene again); (k) tumour necrosis factor gene.

The invention provides a kind of oncolytic adenovirus mutant with the anticancer mechanism of multiple specific, the promotor of the nucleotide sequence of its coding blood vessel endothelium chalone can also be following any one: (a) carcinomebryonic antigen promotor; (b) afp promoter; (c) receptor tyrosine kinase of Human epidermal growth factor receptor family (EGFRs) (comprising EGFR, Her-2, Her-3 and Her-4) promotor; (d) breast cancer correlation antigen DF3/MUC1 promotor; (e) promotor of vascular endothelial growth factor (VEGF) receptor KDR; (f) hsv promotor; (g) E2F promotor; (h) promotor of prostaglandin(PG) specific antigens.

The invention provides a kind of oncolytic adenovirus mutant with the anticancer mechanism of multiple specific, its mE1a289R and the specific expressed control that can also respectively be subjected to two kind different tumor-specific promoters of mE1a243R mutant nucleotide sequence in tumour cell, the selection of tumor-specific promoters can be following any two groups combination: (a) carcinomebryonic antigen promotor, enhanser and mutant sequence thereof; (b) afp promoter, enhanser and mutant sequence thereof; (c) receptor tyrosine kinase of Human epidermal growth factor receptor family (EGFRs) (comprising EGFR, Her-2, Her-3 and Her-4) promotor, enhanser and mutant sequence thereof; (d) breast cancer correlation antigen DF3/MUC1 promotor, enhanser and mutant sequence thereof; (e) promotor, enhanser and the mutant sequence thereof of vascular endothelial growth factor (VEGF) receptor KDR; (f) L-plastin promotor, enhanser and mutant sequence thereof; (g) member's of IAP family (IAP) promotor, enhanser and mutant sequence thereof; (h) promotor of prostaglandin(PG) specific antigens, enhanser and mutant sequence thereof; (i) the hypoxia response elements conserved sequence of HIF-1 (HIF-1) regulation and control; (j) transcription factor E2F promotor, enhanser and mutant sequence thereof.

The invention provides a kind of oncolytic adenovirus mutant with the anticancer mechanism of multiple specific, the sudden change mode of its mE1a289R and mE1a243R can also be point mutation and the excalation sudden change that the encoding sequence to CR2 district 120-140 amino acids residue carries out.

In sum, the novel oncolytic adenovirus mutant with the anticancer mechanism of multiple specific provided by the invention has following significance:

1. can be used for making up the adenovirus product of multiple Antioncogene treatment, for genetic treatment of tumor is set up a kind of curative effect reliable technique platform.

2. has multiple antitumor mechanism: 1) in the human tumor cell of most of types, breed and destroy tumour cell with reverse transcriptase of telomere promoter regulation adenoviral mutants, under the effect of EGFRs enhanser, its regulation and control have better reliability and security; 2) disappearance fully of Elb-55kDa encoding gene makes adenovirus keep breeding the ability of duplicating and lose replication in normal cell in tumour cell, and helps the anti-tumor activity of cell maintenance P53, has improved the target of virus vector; 3) the Elb-19kDa gene lacks fully, not only can promote the recovery of apoptosis of tumor cells path, and help the quick removing of virus in normal cell and the snap-out release in tumour cell and send out, make the specificity of this oncolytic adenovirus treatment tumour better, usefulness is stronger; 4) encoding sequence (CACGAGGCTGGC) of the CR2 district 125-128 amino acids residue of mE1a289R and mE1a243R mutant nucleotide sequence disappearance, the proteic function of its inactivation of viruses protein binding Rb, guarantee that dephosphorylized Rb albumen and transcription factor E2F form mixture, the transcriptional activity of blocking-up E2F plays therapeutic action to tumour; 5) efficient and specific expressed mE1a289R and mE1a243R in tumour cell, by suppressing the number of ways such as expression that proteinase genes such as Her-2/neu gene transcription, the activity of blocking-up NF-κ B, the expression that improves p53, inhibition IV Collagen Type VI enzyme, plasminogen activator, interstitial collagenase, urokinase and stromelysin were expressed, improved the lethal effect of CTL cell, NK cell, scavenger cell, strengthen nm-23 nm23, inducing apoptosis of tumour cell, suppress tumor invasion and shift, improve the susceptibility of tumour cell chemotherapy, radiotherapy; 6) will the encode nucleotide sequence of blood vessel endothelium chalone inserts in the genome of this virus mutant, along with the proliferated specifically of virus in tumour duplicates, the copy number of the endostatin gene that it carries and expression amount also are how much multiples and increase, thereby suppress tumor neovasculature formation, the nutrition supply of blocking-up tumour cell causes tumor growth to suppress and even disappear fully to take off.

3. oncolytic adenovirus mutant provided by the invention, has better therapeutic than the domestic gene therapy product recombinant P 53 adenovirus injection liquid " Ad-p53 " that has gone on the market at present, have the security of better therapeutic and Geng Gao than the domestic replicative adenovirus product H101 that has gone on the market at present, be adapted to the treatment of human most type malignant tumours.

Embodiment

Embodiment 1

The construction of recombinant adenovirus containing of tumour-specific chimeric promoters control mE1a289R and mE1a243R

The first step: the clone obtains the tumour-specific chimeric promoters, inserts the NheI+XhoI site of plasmid pIRES, is built into the carrier pSu-1 that contains the tumour-specific chimeric promoters.PIRES purchases the ClontechLaboratories company in the U.S..The tumour-specific chimeric promoters total length 696bp of design, sequence is as follows:

ctagcagatctgcagggtgcgagacccaggcagaaacattttgctggatgaggaggaaagatgtaaggttgctccccttcagagacagcaaagggcaggtctgtagcttcacttacttcaggattgtgatttttgacagagccgagagatcagggttgttgaaccaggcctgaaggtcctagtgaatctcgtgaagagaggaggggtctggctgtaacatggacctagaggacatttttactgcaggagaaggaacagtggggatggggtggacttgccaaaggaatatagctcaagttcctgcagcccaaaaaagctcagtttcttttggccaaagcttcgcgcgggcggggaagcgcggcccagaccccgcggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggatctcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccac

Second step: the clone obtains adenovirus mE1a289R mutant sequence, and the EcoRI+MluI site of inserting pSu-1 is built into the carrier pSu-2 that tumour-specific chimeric promoters control mE1a289R expresses.ME1a289R mutant sequence total length 866bp, sequence is as follows:

aattcaccatgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggatt?ga?cttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccctggacacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataa

The 3rd step: the design primer, the mE1a289R that obtains with above-mentioned clone is a template, amplification mE1a243R makes up the carrier pSu-3 that tumour-specific chimeric promoters control mE1a289R and mE1a243R express.Primer sequence is as follows:

Ad001:5 '-gc TctagaAccatgagacatattatc-3 ' contains the XbaI site

Ad002：5’-aggttcagacacaggaccctcttcatcctc-3’

Ad003：5’-gaggatgaagagggtcctgtgtctgaacct-3’

Ad004:5 '-gc GtcgacTtatggcctggggcg-3 ' contains the SalI site

With Ad001 and Ad002 amplified fragments 431bp, again with Ad003 and Ad004 amplified fragments 338bp, two products of amplification mix does template earlier, with Ad001 and Ad004 amplification, and amplified fragments 739bp, sequence is as follows:

gc tctagaaccatgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataa gtcg acgc

The product of Ad001 and Ad004 amplification reclaims the fragment of 729bp after the XbaI+SalI enzyme is cut, insert the pUC19/XbaI+SalI site, is built into pUC19-mE1a243R.After the pUC19-mE1a243R order-checking is correct, the XbaI+SalI enzyme cuts back to close the fragment of 729bp, insert the pSu-2/XbaI+SalI site, be built into the carrier pSu-3 that tumour-specific chimeric promoters control mE1a289R and mE1a243R express, wherein mE1a289R is connected by IRES with the mE1a243R sequence.

The 4th step: the NheI+SalI enzyme is cut pSu-3, obtain the pSu-3/NheI+SalI fragment of 2927bp, insert adenovirus carrier plasmid pDC315/XbaI+SalI site, be built into the adenovirus carrier pSu-4 of tumour-specific chimeric promoters control mE1a289R and mE1a243R.PDC315 purchases the company in Canadian MicrobixBiosystems.The pSu-3/NheI+SalI fragment contains tumour-specific chimeric promoters, mE1a289R, IRES and mE1a243R, total length 2926bp, and sequence is as follows:

ctagcagatctgcagggtgcgagacccaggcagaaacattttgctggatgaggaggaaagatgtaaggttgctccccttcagagacagcaaagggcaggtctgtagcttcacttacttcaggattgtgatttttgacagagccgagagatcagggttgttgaaccaggcctgaaggtcctagtgaatctcgtgaagagaggaggggtctggctgtaacatggacctagaggacatttttactgcaggagaaggaacagtggggatggggtggacttgccaaaggaatatagctcaagttcctgcagcccaaaaaagctcagtttcttttggccaaagcttcgcgcgggcggggaagcgcggcccagaccccgcggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggatctcacagacgcccaggacc1gcgcttcccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccactcgagaattcaccatgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccctggacacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataacgcgtcgagcatgcatctagggcggccaattccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgtgattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataagcttgccacaacccgggatcctctagaaccatgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataag

Embodiment 2

The construction of recombinant adenovirus containing of the E1 district disappearance of carrier's Endostatin (endostatin) gene

The first step: the clone obtains human endostatin (endostatin) gene order, and the front adds M-and becomes knurl protein signal peptide-coding sequence, and its effect is to make the endostatin protein of expression have the external secretion effect.Gene fragment total length 636bp, sequence is as follows:

aattcaccatgggggtactgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagccacagccaccgcgacttccagccggtgctccacctggttgcgctcaacagccccctgtcaggcggcatgcggggcatccgcggggccgacttccagtgcttccagcaggcgcgggccgtggggctggcgggcaccttccgcgccttcctgtcctcgcgcctgcaggacctgtacagcatcgtgcgccgtgccgaccgcgcagccgtgcccatcgtcaacctcaaggacgagctgctgtttcccagctgggaggctctgttctcaggctctgagggtccgctgaagcccggggcacgcatcttctcctttaacggcaaggacgtcctgaggcaccccacctggccccagaagagcgtgtggcatggctcggaccccaacgggcgcaggctgaccgagagctactgtgagacgtggcggacggaggctccctcggccacgggccaggcctcctcgctgctggggggcaggctcctggggcagagtgccgcgagctgccatcacgcctacatcgtgctatgcattgagaacagcttcatgactgcctccaagtaatagt

Second step: 636bp human endostatin gene is inserted adenovirus carrier pCA13/EcoRI+XbaI site, be built into the adenovirus carrier pCA13-hE of the E1 district disappearance of carrier's endostatin gene.The pCAl3 carrier is purchased the company in Canadian Microbix Biosystems, contain 5 type adenovirus 22-5790bp sequences and lack E1 district 342-3523bp fragment, be that Human cytomegalic inclusion disease virus (HCMV) IE promotor (is SV40poly (A) tailing signal after the multiple clone site 299-+72), before its multiple clone site.

Embodiment 3

The structure of the oncolytic adenovirus carrier of carrier's Endostatin (endostatin) gene

PCA13-hE cuts through the BglII enzyme, reclaims the fragment of the human endostatin gene complete expression cassette that contains, and inserts the pSu-4/BglII site, is built into the oncolytic adenovirus carrier pSu-hE of carrier's endostatin gene.

The human endostatin gene complete expression cassette total length 1217bp that pCA13-hE contains, sequence is as follows:

gatctaattccctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctggggatcagtcttcgagtcgacaagcttgaattcaccatgggggtactgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagccacagccaccgcgacttccagccggtgctccacctggttgcgctcaacagccccctgtcaggcggcatgcggggcatccgcggggccgacttccagtgcttccagcaggcgcgggccgtggggctggcgggcaccttccgcgccttcctgtcctcgcgcctgcaggacctgtacagcatcgtgcgccgtgccgaccgcgcagccgtgcccatcgtcaacctcaaggacgagctgctgtttcccagctgggaggctctgttctcaggctctgagggtccgctgaagcccggggcacgcatcttctcctttaacggcaaggacgtcctgaggcaccccacctggccccagaagagcgtgtggcatggctcggaccccaacgggcgcaggctgaccgagagctactgtgagacgtggcggacggaggctccctcggccacgggccaggcctcctcgctgctggggggcaggctcctggggcagagtgccgcgagctgccatcacgcctacatcgtgctatgcattgagaacagcttcatgactgcctccaagtaatagtctagactcgagggatccatcgagcaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatcgtctagcatcgaa

Embodiment 4

Reorganization and amplification purification in the cell of adenovirus

Proliferous type oncolytic adenovirus provided by the invention and propagation defective adenoviral are in contrast recombinated in the HEK293 human embryonic kidney cell and are finished.The HEK293 cell strain is purchased the company in Canadian MicrobixBiosystems, and this cell is transformed by the 5 type adenovirus DNAs of shearing, and contains 5 type adenovirus E 1 districts, and adenovirus DNA has high transfection efficiency to it.To contain the plasmid and the plasmid co-transfection HEK293 cell that contains 5 type adenovirus right arms of 5 type adenovirus left arms, produce adenovirus with infectivity by reorganization in the cell.

With plasmid pSu-4, the pSu-hE of the above-mentioned 5 type adenovirus left arms that build, pass through the common rotaring redyeing 293 cell of LipoFectamine2000 with the plasmid pBHGloxdelE13cre that contains 5 type adenovirus right arms respectively.Equally, with the plasmid pCA13-hE of the above-mentioned 5 type adenovirus left arms that build, pass through the common rotaring redyeing 293 cell of LipoFectamine2000 with the plasmid pBHGE3 that contains 5 type adenovirus right arms.Transfection concrete grammar step is referring to the LipoFectamine2000 test kit process specifications of Invitrogen company.PBHGloxdelE13cre and pBHGE3 purchase the company in Canadian Microbix Biosystems, and pBHGloxdelE13cre contains 5 type adenovirus right arms, disappearance E1, E3 district, and its recombinase system Cre/LoxP can guarantee viral efficient reorganization; PBHGE3 contains 5 type adenovirus right arms, keeps the E3 district.9-14 behind the carrier cotransfection days, virus plaque appears successively, (concrete grammar is referring to GeneTransfer and ExpressionProtocols through three virus plaque purifying, Murray EJ chief editor, Humana Press, Clifton, New Jersey), the adenovirus of recombinating out TIDE 100 (recombination oncolytic adenovirus), TIDE 101 (the anti-angiogenic oncolytic adenovirus of recombinating) and Ad-hE (the anti-angiogenic non-replicative adenovirus of recombinating).

Recombinant adenovirus TIDE 100, TIDE 101, Ad-hE identify:

With Ad001 and Ad004 is primer PCR amplicon virus genomic dna, amplified fragments 739bp, and with the positive control plasmid of pSu-3, TIDE 100, TIDE 101 are positive, and Ad-hE is negative.

Synthetic primer Ad005:5 '-ttgaattcaccatgggggtacttgctca-3 ' (Human EndostatinUpstream Primer); Ad006:5 '-atggatccctcgagtctagactattact-3 ' (Human EndostatinDownstream Primer) is a primer PCR amplicon virus genomic dna with Ad005 and Ad006, and amplified fragments 658bp is with the positive control plasmid of pAd-hE.TIDE 101, Ad-hE are positive, and TIDE 100 is negative.

Recombinant adenovirus name and evaluation:

Adenovirus is breeding in a large number in the HEK293 cell, (concrete grammar is referring to GeneTransfer and Expression Protocols, and Murray EJ edits, Humana Press for the method large-scale purification adenovirus of application caesium chloride density gradient centrifugation, Clifton, New Jersey).The mutant nucleotide sequence of recombinant adenovirus and insertion sequence confirm by order-checking.TIDE 100, TIDE 101 is 5 type adenoviral mutants, its Elb-55kDa and Elb-19kDa gene lack fully, adenovirus E 1 a gene is subjected to human telomerase reverse reversed transcriptive enzyme promotor core sequence and human tumor EGF-R ELISA to strengthen effective control of molecular chimeric promoters based on the mutant nucleotide sequence mE1a289R and the mE1a243R of CR2 region mutation, mE1a289R is connected by IRES with the mE1a243R gene, and lack with E3 district partial sequence (28132-30813bp), TIDE 101 has also inserted in the multiple clone site district before its chimeric promoters sequence the expression cassette of human endostatin, and other dna sequence dnas are identical with 5 type adenovirus.Ad-hE is 5 type adenovirus, and disappearance E1 district keeps the E3 district, and has inserted the expression cassette of human endostatin in the E1 zone of disappearance, and other dna sequence dnas are identical with 5 type adenovirus.

Embodiment 5

Recombinate in-vitro multiplication, expression and the fragmentation test of anti-angiogenic oncolytic adenovirus

The Western blot that mE1a and Endostatin express analyzes: human hepatoma cell strain (Hep3B, HepGII), human pancreas cancer cell strain (PANC-1), human lung carcinoma cell line (A549), people's colon-cancer cell strain (HT29), human breast cancer cell strain (MBD-231), people's normal fibroblast strain (MRC-5, IMR-90, BJ) are available from ATCC (American Type Culture Collection), human stomach cancer cell line SGC-7901 derives from cell institute of the Chinese Academy of Sciences, and people's normal liver cell of former generation is taken from the fetal livers tissue of clinical miscarriage.Cell counting is spread 24 orifice plates, 5 * 10 ⁴24h is cultivated in/hole; Use serum-free medium instead, MOI=1 adds the anti-angiogenic oncolytic adenovirus TIDE101 of reorganization respectively and contrasts adenovirus TIDE100, Ad-hE, wild-type 5 type adenovirus (WAd5), jog 2h; Absorb supernatant, use 2% serum nutrient solution instead, cultivate 48h; Collecting cell with M-PER Mammalian Protein Extraction Reagent (PIERCE) lysing cell, reclaims albumen, behind protein quantification, and with 10% polyacrylamide gel solution, 70V constant voltage electrophoresis, isolated protein; With the electrotransfer instrument (Continental Lab Products, Inc.) 3V 90mA moves on to PROTRANNitrocellulose Transfer Membrane (Schleicher﹠amp with protein transduction; Schuell Inc.); Confining liquid (0.5%FBS, 50mmol/L Tris-HCl pH7.5,150mmol/L NaCl, 0.1%Tween-20,0.02%NaN3) sealing 1h, 1 * TBST (50mmol/L Tris-HCl pH7.5,150mmol/L NaCl 0.1%Tween-20) washes film 3 times, each 5min; Under 4 ℃ of conditions with first antibody mouse anti adenovirus E 1 a monoclonal antibody (Santa CruzBiotechnology, Inc.) or rat anti people Endostatin monoclonal antibody (R﹠amp; D Systems) overnight incubation, 1 * TBST washes film three times, each 5min; Down (1 * TBST washes film three times to room temperature condition, at every turn 5min for Cell Signaling Technology, Inc.) reaction 1h with second antibody HRP-goat anti-mouse igg antibody or HRP-goat-anti rat IgG antibody; (Cell Signaling Technology, Inc.), the X-ray film exposes to add colour developing liquid LumiGLO chemiluminescent reagent andperoxide.The result shows: TIDE100, TIDE 101 be high expression level mE1a289 and mE1a243 albumen in tumor cell line specifically, and in normal cell, do not express, but WAd5 all expresses E1a albumen in tumour cell and normal cell system, and Ad-hE does not all express in tumour cell and normal cell system.TIDE 101 is high expression level people Endostatin in tumor cell line specifically, and does not express or express very weak in normal cell, but Ad-hE all shows weak expression Endostatin in tumour cell and normal cell system.

The recombinate proliferated specifically of anti-angiogenic oncolytic adenovirus: collect the tumour cell and the normal cell of logarithmic phase, counting is spread 6 orifice plates, 1 * 10 ⁶/ hole, cancer cells cover with at the bottom of being cultured to the hole, and normal cell is cultured to and covers with and contact inhibition occurs, uses serum-free medium instead; Add the anti-angiogenic oncolytic adenovirus TIDE101 of reorganization respectively and contrast adenovirus TIDE100, Ad-hE, WAd5 with MOI=1, be adjusted to 5% serum nutrient solution behind the 2h; Collect cell and the supernatant liquor of virus infection 0h and 48h ,-80 ℃ frozen; The TCID50 method detects virus titer.The result shows: TIDE101, TIDE100 breed in tumor cell line specifically and duplicate, and do not breed in normal cell.But Ad-hE does not all breed in tumour cell and normal cell system, and WAd5 all has propagation in tumour cell and normal cell system.

Detection by quantitative and activity experiment that Endostatin expresses: with the tumour cell of logarithmic phase and normal cell with 5 * 10 ⁴24 orifice plates are spread in/hole, infect anti-angiogenic oncolytic adenovirus TIDE101 of reorganization and contrast adenovirus Ad-hE thereof with MOI=1 behind the 24h, and method is the same.The the 1st, 3,7 day collecting cell culture supernatant after infection respectively ,-80 ℃ of frozen being equipped with, survey.The ELISA test box of Human Endostatin is available from U.S. ChemiconInternational Inc., and concrete operations are with reference to this test kit specification sheets.The active detection with Human umbilical vein endothelial cells strain ECV304 of Endostatin is target cell, and ECV-304 purchases the cell bank in U.S. ATCC.Cultivate 10 in inoculating cell to 6 orifice plate ⁵Cells/well is cultivated 24h, and the above-mentioned TIDE101 and the Ad-hE that add different concns infect the cells and supernatant that collect the back, continues to cultivate 3 days, and with the fixing 10min of 10% Viola crystallina formalin solution, Viola crystallina is dyeed.The result shows: TIDE101 can mediate the Endostatin specific efficient and express in tumor cell line, and its expression amount is than Ad-hE showed increased, but the amount of TIDE101 expression Endostatin is extremely low in normal cell system, is lower than Ad-hE or is equal to Ad-hE.TIDE101 infects the growth that the cells and supernatant of collecting the back can obviously suppress Human umbilical vein endothelial cells strain ECV304, and its retarding effect is relevant with the content of Endostatin.

The specific killing of anti-angiogenic oncolytic adenovirus of recombinating: detect viral TIDE101 and TIDE100 to tumour cell and Normocellular effect by tetrazolium salts colorimetric experiment (MTT), and compare with WAd5, Ad-hE to tumour cell.Cell Proliferation Kit I (MTT) purchases the DiagnosticsGmbH in Roche.At first determine the experiment of optimum cell concentration, collect the cell of logarithmic phase, counting is mixed with by 2 * 10 with 10% serum nutrient solution ⁴To 2 * 10 ⁵/ ml is the individual cells suspension of totally 11 concentration gradients, and 100 μ l/ holes reach 96 orifice plates, and each cell concn value is established 8 multiple holes, 24h in the incubator; Add serum-free medium 100 μ l/ holes, cultivated 7 days; Discard nutrient solution, add 0.1mol/LPBS solution 100 μ l/ holes, add MTTlabeling reagent 10 μ l/ holes again, put 4h in the incubator to final concentration 0.5mg/ml; Add Solubilization solution (10%SDS in 0.01mol/L HCl) 100 μ l/ holes, put in the incubator and spend the night; Adopt Model 550MicroplateReader (BIO-RAD) to measure 570nm wavelength light absorption value, tuning wavelength is 655nm; Curve plotting is determined three kinds of cell common optimal cell concentration.Secondly carry out the MTT test by different MOI values, collect the cell of logarithmic phase, counting with 10% serum nutrient solution, by the determined optimal cell concentration of above-mentioned experiment, is mixed with the individual cells suspension, and 100 μ l/ holes reach 96 orifice plates, put 24h in the incubator; The serum-free medium virus dilution adds viral 100 μ l by MOI=0.0001～500 different concns, establishes 8 multiple holes corresponding to each MOI value, cultivates and carries out the MTT experiment after 7 days as stated above.The result shows: TIDE101 and TIDE100 can the specific killing tumour cells, can show tangible lethal effect under very low MOI value, then need just appearance under very high MOI value to Normocellular killing and wounding.

Embodiment 6

The treatment effect of anti-angiogenic oncolytic adenovirus of recombinating to transplanted tumor in nude mice

The curative effect science experiment: healthy purebred BALB/c nude mice or SCID mouse, in 4～6 ages in week, Chinese Academy of Sciences's Shanghai Experimental Animal Center provides, male and female half and half, cleaning level Animal Lab. is raised, random packet (TIDE101 group, TIDE100 group, Ad-hE group, blank group), weigh numbering.The tumour cell of taking the logarithm vegetative period is adjusted cell count to 1 * 10 with PBS liquid ⁸/ ml, sterilization nude mice flank portion nearly armpit skin is got 100 μ l cell suspensions and is injected in subcutaneously, and constant temperature, ventilation, aseptic condition are raised down; Regularly observe knurl bulk-growth situation every day, the subcutaneous ruddy scleroma of grain of rice size that occurs is distinguished in inoculation, is and plants successfully.Begin treatment during to knurl body average diameter growth to 5～7mm; With 2 * 10 ⁸Multi-point injection in the direct knurl of recombinant virus of pfu/100 μ l, the next day once, totally 5 times, the blank group is preserved liquid Ad Buffer (10mmol/L Tris-HCl pH8.0,2mmol/LMgCl with virus ₂, 4%Sucrose) replace the recombinant virus injection, 100 μ l * 5 time; Regularly measure knurl bulk-growth situation, vernier caliper measurement knurl body size is with " a * b ²* 0.5 " formula calculates knurl body volume (a: maximum diameter, b: path); Disconnected neck is put to death mouse when selecting, and gets serum and knurl body sample.Serum is surveyed Endostatin content fully, and sample is done the pathology inspection fully.The ELISA test box of Human Endostatin is available from U.S. Chemicon International Inc., and concrete operations are with reference to this test kit specification sheets.The pathology immunohistochemical methods checks that used mouse-anti adenovirus Hexon monoclonal antibody is available from Biodesign International company, rat anti-mouse CD31 monoclonal antibody is available from U.S. BD Biosciences Pharmingen company, and the HRP-sheep anti-mouse igg is available from ZYMED Laboratories company.The result shows: compare with control group, TIDE101 and TIDE100 treatment group curative effect are obvious, and obviously are better than Ad-hE.Endostatin content detection in the mice serum, TIDE101 treatment are organized each time point all apparently higher than Ad-hE.Get tumor tissue and carry out pathological section, the conventional H E visible control group tumor cell growth that dyes is vigorous, obviously special-shaped, the pathology nuclear fission mutually more to be seen, and visible large stretch of downright bad or more focal necrosis district in TIDE101 and the TIDE100 treatment group tumor tissue, necrotic area periphery cancer cells regression, cell diminishes round, nuclear chromatin concentrates engrain, and eosinophilic cytoplasmic becomes, and apoptotic change occurs.Pathological section is carried out the immunohistochemical methods inspection, and a lot of cancer cells present virus coat protein Hexon positive expression in visible TIDE101 and the TIDE100 treatment group cancerous tissue.The capillary blood vessel counting is found in the tumor tissues, compares with control group, and microvessel quantity obviously reduces in the TIDE101 treatment group tumor tissue, and Ad-hE group microvessel quantity minimizing degree is not as TIDE101 treatment group.

Acute toxicity test: healthy BALB/c mouse, 4～6 ages in week, Chinese Academy of Sciences's Shanghai Experimental Animal Center provides, male and female half and half, cleaning level Animal Lab. is raised, random packet (TIDE101 high dose group, TIDE101 low dose group, TIDE100 high dose group, TIDE100 low dose group, WAd5 high dose group, WAd5 low dose group, blank group) is weighed, numbering.The tail vein injection recombinant virus, every day 1 time, continuous 5 days, each every 1 * 10 of low dose group ¹⁰Pfu/kg (being equal to the nude mice therapeutic dose), each every 2.5 * 10 of high dose group ¹¹Pfu/kg (nude mice therapeutic dose 25 times), control group per injection 100 μ l virus is preserved liquid.The morbid change of observing the dead of mouse continuously and may occurring, treatment finishes back 2 days, and venous blood samples detects liver transaminase ALT and AST.Disconnected neck is put to death mouse, gets each internal organs and carries out pathologic finding.The result shows: WAd5 causes the high mortality of mouse in high dose group, cause the low actual of mouse in low dose group, and cause dosage relevant liver transaminase ALT and AST obviously to raise, liver cell oedema and focal necrosis in various degree, even the liver plate destroys.By contrast, TIDE101 and TIDE100 treatment group mouse survival condition are good, do not have death, and liver transaminase ALT and AST do not raise, and each internal organs does not see that its matter venereal disease becomes, and the liver cell of high dose group minority mouse has Mild edema.Immunohistochemical methods detects the proteic expression of finding to have in the WAd5 group liver cell in various degree of E1a, and TIDE101 and TIDE100 treatment group are not seen the expression of E1a.

Sequence table

＜110〉Jiangsu Shuntang Bioengineering Co., Ltd.

＜120〉a kind of oncolytic adenovirus mutant with multiple anticancer mechanism

<160>7

<210>1

<211>4798

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_recomb

<222>(2)...(102)

<220>

<221>misc_feature

<222>(103)...(454)

<220>

<221>Promoter

<222>(467)...(869)

<220>

<221>sig_peptide

<222>(879)...(950)

<220>

<221>CDS

<222>(951)...(1502)

<220>

<221>PolyA_signal

<222>(1524)...(1677)

<220>

<221>Enhancer

<222>(1682)...(2012)

<220>

<221>Promoter

<222>(2013)...(2368)

<220>

<221>CDS

<222>(2382)...(3239)

<220>

<221>misc_signal

<222>(3251)...(3855)

<220>

<221>CDS

<222>(3878)...(4597)

<220>

<221>PolyA_signal

<222>(4604)...(4764)

<220>

<221>misc_recomb

<222>(4765)...(4798)

<400>1

ttcatcaata?atatacctta?ttttggattg?aagccaatat?gataatgagg?gggtggagtt 60

tgtgacgtgg?cgcggggcgt?gggaacgggg?cgggtgacgt?agtagtgtgg?cggaagtgtg 120

atgttgcaag?tgtggcggaa?cacatgtaag?cgacggatgt?ggcaaaagtg?acgtttttgg 180

tgtgcgccgg?tgtacacagg?aagtgacaat?tttcgcgcgg?ttttaggcgg?atgttgtagt 240

aaatttgggc?gtaaccgagt?aagatttggc?cattttcgcg?ggaaaactga?ataagaggaa 300

gtgaaatctg?aataattttg?tgttactcat?agcgcgtaat?atttgtctag?ggccgcgggg 360

actttgaccg?tttacgtgga?gactcgccca?ggtgtttttc?tcaggtgttt?tccgcgttcc 420

gggtcaaagt?tggcgtttta?ttattatagt?cagttctagc?agatctaatt?ccctggcatt 480

atgcccagta?catgacctta?tgggactttc?ctacttggca?gtacatctac?gtattagtca 540

tcgctattac?catggtgatg?cggttttggc?agtacatcaa?tgggcgtgga?tagcggtttg 600

actcacgggg?atttccaagt?ctccacccca?ttgacgtcaa?tgggagtttg?ttttggcacc 660

aaaatcaacg?ggactttcca?aaatgtcgta?acaactccgc?cccattgacg?caaatgggcg 720

gtaggcgtgt?acggtgggag?gtctatataa?gcagagctcg?tttagtgaac?cgtcagatcg 780

cctggagacg?ccatccacgc?tgttttgacc?tccatagaag?acaccgggac?cgatccagcc 840

tggggatcag?tcttcgagtc?gacaagcttg?aattcaccat?gggggtactt?gctcacacag 900

aggacgctgc?tcagtctggt?ccttgcactc?ctgtttccaa?gcatggcgag?ccagcagcca 960

ccgcgacttc?cagccggtgc?tccacctggt?tgctgctcaa?cagccccctg?tcaggcggca?1020

tgcggggcat?ccgcggggcc?gacttccagt?gcttccagca?ggcgcgggcc?gtggggctgg?1080

cgggcacctt?ccgcgccttc?ctgtcctcgc?gcctgcagga?cctgtacagc?atcgtgcgcc?1140

gtgccgaccg?cgcacgcgtg?cccatcgtca?acctcaagga?cgagctgctg?tttcccagct?1200

gggaggctct?gttctcaggc?tctgagggtc?cgctgaagcc?cggggcacgc?atcttctcct?1260

ttaacggcaa?ggacgtcctg?aggcacccca?cctggcccca?gaagagcgtg?tggcatggct?1320

cggaccccaa?cggcgcaggc?tgaccgagag?ctactgtgag?acgtggcgga?cggaggctcc?1380

ctcggccacg?ggcaggcctc?ctcgctgctg?ggggcaggct?cctggggcag?agtgccgcga?1440

gctgccatca?cgcctacatc?gtgctatgca?ttgagaacag?cttcatgact?gcctccaagt?1500

aatagtctag?actcgaggga?tccatcgagc?aacttgttta?ttgcagctta?taatggttac?1560

aaataaagca?atagcatcac?aaatttcaca?aataaagcat?ttttttcact?gcattctagt?1620

tgtggtttgt?ccaaactcat?caatgtatct?tatcatgtct?ggatcgtcta?gcatcgaaga?1680

tctgcagggt?gcgagaccca?ggcagaaaca?ttttgctgga?tgaggaggaa?agatgtaagg?1740

ttgctcccct?tcagagacag?caaagggcag?gtctgtagct?tcacttactt?caggattgtg?1800

atttttgaca?gagccgagag?atcagggttg?ttgaaccagg?cctgaaggtc?ctagtgaatc?1860

tcgtgaagag?aggaggggtc?tggctgtaac?atggacctag?aggacatttt?tactgcagga?1920

gaaggaacag?tggggatggg?gtggacttgc?caaaggaata?tagctcaagt?tcctgcagcc?1980

caaaaaagct?cagtttcttt?tggccaaagc?ttcgcgcggg?cggggaagcg?cggcccagac?2040

cccgcggtcc?gcccggagca?gctgcgctgt?cggggccagg?ccgggctccc?agtggattcg?2100

cgggatctca?cagacgccca?ggaccgcgct?tcccacgtgg?cggagggact?ggggacccgg?2160

gcacccgtcc?tgccccttca?ccttccagct?ccgcctcctc?cgcgcggacc?ccgccccgtc?2220

ccgacccctc?ccgggtcccc?ggcccagccc?cctccgggcc?ctcccagccc?ctccccttcc?2280

tttccgcggc?cccgccctct?cctcgcggcg?cgagtttcag?gcagcgctgc?gtcctgctgc?2340

gcacgtggga?agccctggcc?ccggccactc?gagaattcac?catgagacat?attatctgcc?2400

acggaggtgt?tattaccgaa?gaaatggccg?ccagtctttt?ggaccagctg?atcgaagagg?2460

tactggctga?taatcttcca?cctcctagcc?attttgaacc?acctaccctt?cacgaactgt?2520

atgatttaga?cgtgacggcc?cccgaagatc?ccaacgagga?ggcggtttcg?cagatttttc?2580

ccgactctgt?aatgttggcg?gtgcaggaag?ggattgactt?actcactttt?ccgccggcgc?2640

ccggttctcc?ggagccgcct?cacctttccc?ggcagcccga?gcagccggag?cagagagcct?2700

tgggtccggt?ttctatgcca?aaccttgtac?cggaggtgat?tgatcttacc?tgctttccac?2760

ccagtgacga?cgaggatgaa?gagggtgagg?agtttgtgtt?agattatgtg?gagcaccctg?2820

gacacggttg?caggtcttgt?cattatcacc?ggaggaatac?gggggaccca?gatattatgt?2880

gttcgctttg?ctatatgagg?acctgtggca?tgtttgtcta?cagtcctgtg?tctgaacctg?2940

agcctgagcc?cgagccagaa?ccggagcctg?caagacctac?ccgccgtcct?aaaatggcgc?3000

ctgctatcct?gagacgcccg?acatcacctg?tgtctaggga?atgcaatagt?agtacggata?3060

gctgtgactc?cggtccttct?aacacacctc?ctgagataca?cccggtggtc?ccgctgtgcc?3120

ccattaaacc?agttgccgtg?agagttggtg?ggcgtcgcca?ggctgtggaa?tgtatcgagg?3180

acttgcttaa?cgagcctggg?caacctttgg?acttgagctg?taaacgcccc?aggccataac?3240

gcgtcgagca?tgcatctagg?gcggccaatt?ccgcccctct?ccctcccccc?cccctaacgt?3300

tactggccga?agccgcttgg?aataaggccg?gtgtgcgttt?gtctatatgt?gattttccac?3360

catattgccg?tcttttggca?atgtgagggc?ccggaaacct?ggccctgtct?tcttgacgag?3420

cattcctagg?ggtctttccc?ctctcgccaa?aggaatgcaa?ggtctgttga?atgtcgtgaa?3480

ggaagcagtt?cctctggaag?cttcttgaag?acaaacaacg?tctgtagcga?ccctttgcag?3540

gcagcggaac?cccccacctg?gcgacaggtg?cctctgcggc?caaaagccac?gtgtataaga?3600

tacacctgca?aaggcggcac?aaccccagtg?ccacgttgtg?agttggatag?ttgtggaaag?3660

agtcaaatgg?ctctcctcaa?gcgtattcaa?caaggggctg?aaggatgccc?agaaggtacc?3720

ccattgtatg?ggatctgatc?tggggcctcg?gtgcacatgc?tttacatgtg?tttagtcgag?3780

gttaaaaaaa?cgtctaggcc?ccccgaacca?cggggacgtg?gttttccttt?gaaaaacacg?3840

atgataagct?tgccacaacc?cgggatcctc?tagaaccatg?agacatatta?tctgccacgg?3900

aggtgttatt?accgaagaaa?tggccgccag?tcttttggac?cagctgatcg?aagaggtact?3960

ggctgataat?cttccacctc?ctagccattt?tgaaccacct?acccttcacg?aactgtatga?4020

tttagacgtg?acggcccccg?aagatcccaa?cgaggaggcg?gtttcgcaga?tttttcccga?4080

ctctgtaatg?ttggcggtgc?aggaagggat?tgacttactc?acttttccgc?cggcgcccgg?4140

ttctccggag?ccgcctcacc?tttcccggca?gcccgagcag?ccggagcaga?gagccttggg?4200

tccggtttct?atgccaaacc?ttgtaccgga?ggtgattgat?cttacctgct?ttccacccag?4260

tgacgacgag?gatgaagagg?gtcctgtgtc?tgaacctgag?cctgagcccg?agccagaacc?4320

ggagcctgca?agacctaccc?gccgtcctaa?aatggcgcct?gctatcctga?gacgcccgac?4380

atcacctgtg?tctagggaat?gcaatagtag?tacggatagc?tgtgactccg?gtccttctaa?4440

cacacctcct?gagatacacc?cggtggtccc?gctgtgcccc?attaaaccag?ttgccgtgag?4500

agttggtggg?cgtcgccagg?ctgtggaatg?tatcgaggac?ttgcttaacg?agcctgggca?4560

acctttggac?ttgagctgta?aacgccccag?gccataagtc?gacttcgagc?aacttgttta?4620

ttgcagctta?taatggttac?aaataaagca?atagcatcac?aaatttcaca?aataaagcat?4680

ttttttcact?gcattctagt?tgtggtttgt?ccaaactcat?caatgtatct?tatcatgtct?4740

ggatcgtcta?gcatcgaaga?tccaataact?tcgtatagca?tacattatac?gaagttat 4798

<210>2

<211>696

<212>DNA

＜213〉artificial sequence

<220>

<221>Enhancer

<222>(10)...(340)

<220>

<221>Promoter

<222>(341)...(696)

<400>2

ctagcagatc?tgcagggtgc?gagacccagg?cagaaacatt?ttgctggatg?aggaggaaag 60

atgtaaggtt?gctccccttc?agagacagca?aagggcaggt?ctgtagcttc?acttacttca?120

ggattgtgat?ttttgacaga?gccgagagat?cagggttgtt?gaaccaggcc?tgaaggtcct?180

agtgaatctc?gtgaagagag?gaggggtctg?gctgtaacat?ggacctagag?gacattttta?240

ctgcaggaga?aggaacagtg?gggatggggt?ggacttgcca?aaggaatata?gctcaagttc?300

ctgcagccca?aaaaagctca?gtttcttttg?gccaaagctt?cgcgcgggcg?gggaagcgcg?360

gcccagaccc?cgcggtccgc?ccggagcagc?tgcgctgtcg?gggccaggcc?gggctcccag?420

tggattcgcg?ggatctcaca?gacgcccagg?accgcgcttc?ccacgtggcg?gagggactgg?480

ggacccgggc?acccgtcctg?ccccttcacc?ttccagctcc?gcctcctccg?cgcggacccc?540

gccccgtccc?gacccctccc?gggtccccgg?cccagccccc?tccgggccct?cccagcccct?600

ccccttcctt?tccgcggccc?cgccctctcc?tcgcggcgcg?agtttcaggc?agcgctgcgt?660

cctgctgcgc?acgtgggaag?ccctggcccc?ggccac 696

<210>3

<211>866

<212>DNA

＜213〉artificial sequence

<220>

<221>CDS

<222>(9)...(866)

<400>3

aattcaccat?gagacatatt?atctgccacg?gaggtgttat?taccgaagaa?atggccgcca 60

gtcttttgga?ccagctgatc?gaagaggtac?tggctgataa?tcttccacct?cctagccatt?120

ttgaaccacc?tacccttcac?gaactgtatg?atttagacgt?gacggccccc?gaagatccca?180

acgaggaggc?ggtttcgcag?atttttcccg?actctgtaat?gttggcggtg?caggaaggga?240

ttgacttact?cacttttccg?ccggcgcccg?gttctccgga?gccgcctcac?ctttcccggc?300

agcccgagca?gccggagcag?agagccttgg?gtccggtttc?tatgccaaac?cttgtaccgg?360

aggtgattga?tcttacctgc?tttccaccca?gtgacgacga?ggatgaagag?ggtgaggagt?420

ttgtgttaga?ttatgtggag?caccctggac?acggttgcag?gtcttgtcat?tatcaccgga?480

ggaatacggg?ggacccagat?attatgtgtt?cgctttgcta?tatgaggacc?tgtggcatgt?540

ttgtctacag?tcctgtgtct?gaacctgagc?ctgagcccga?gccagaaccg?gagcctgcaa?600

gacctacccg?ccgtcctaaa?atggcgcctg?ctatcctgag?acgcccgaca?tcacctgtgt?660

ctagggaatg?caatagtagt?acggatagct?gtgactccgg?tccttctaac?acacctcctg?720

agatacaccc?ggtggtcccg?ctgtgcccca?ttaaaccagt?tgccgtgaga?gttggtgggc?780

gtcgccaggc?tgtggaatgt?atcgaggact?tgcttaacga?gcctgggcaa?cctttggact?840

tgagctgtaa?acgccccagg?ccataa 866

<210>4

<211>739

<212>DNA

＜213〉artificial sequence

<220>

<221>CDS

<222>(12)...(731)

<400>4

gctctagaac?catgagacat?attatctgcc?acggaggtgt?tattaccgaa?gaaatggccg 60

ccagtctttt?ggaccagctg?atcgaagagg?tactggctga?taatcttcca?cctcctagcc?120

attttgaacc?acctaccctt?cacgaactgt?atgatttaga?cgtgacggcc?cccgaagatc?180

ccaacgagga?ggcggtttcg?cagatttttc?ccgactctgt?aatgttggcg?gtgcaggaag?240

ggattgactt?actcactttt?ccgccggcgc?ccggttctcc?ggagccgcct?cacctttccc?300

ggcagcccga?gcagccggag?cagagagcct?tgggtccggt?ttctatgcca?aaccttgtac?360

cggaggtgat?tgatcttacc?tgctttccac?ccagtgacga?cgaggatgaa?gagggtcctg?420

tgtctgaacc?tgagcctgag?cccgagccag?aaccggagcc?tgcaagacct?acccgccgtc?480

ctaaaatggc?gcctgctatc?ctgagacgcc?cgacatcacc?tgtgtctagg?gaatgcaata?540

gtagtacgga?tagctgtgac?tccggtcctt?ctaacacacc?tcctgagata?cacccggtgg?600

tcccgctgtg?ccccattaaa?ccagttgccg?tgagagttgg?tgggcgtcgc?caggctgtgg?660

aatgtatcga?ggacttgctt?aacgagcctg?ggcaaccttt?ggacttgagc?tgtaaacgcc?720

ccaggccata?agtcgacgc 739

<210>5

<211>2926

<212>DNA

＜213〉artificial sequence

<220>

<221>Enhancer

<222>(10)...(340)

<220>

<221>Promoter

<222>(341)...(696)

<220>

<221>CDS

<222>(710)...(1567)

<220>

<221>misc_signal

<222>(1579)...(2183)

<220>

<221>CDS

<222>(2206)...(2925)

<400>5

ctagcagatc?tgcagggtgc?gagacccagg?cagaaacatt?ttgctggatg?aggaggaaag 60

atgtaaggtt?gctccccttc?agagacagca?aagggcaggt?ctgtagcttc?acttacttca 120

ggattgtgat?ttttgacaga?gccgagagat?cagggttgtt?gaaccaggcc?tgaaggtcct 180

agtgaatctc?gtgaagagag?gaggggtctg?gctgtaacat?ggacctagag?gacattttta 240

ctgcaggaga?aggaacagtg?gggatggggt?ggacttgcca?aaggaatata?gctcaagttc 300

ctgcagccca?aaaaagctca?gtttcttttg?gccaaagctt?cgcgcgggcg?gggaagcgcg 360

gcccagaccc?cgcggtccgc?ccggagcagc?tgcgctgtcg?gggccaggcc?gggctcccag 420

tggattcgcg?ggatctcaca?gacgcccagg?accgcgcttc?ccacgtggcg?gagggactgg 480

ggacccgggc?acccgtcctg?ccccttcacc?ttccagctcc?gcctcctccg?cgcggacccc 540

gccccgtccc?gacccctccc?gggtccccgg?cccagccccc?tccgggccct?cccagcccct 600

ccccttcctt?tccgcggccc?cgccctctcc?tcgcggcgcg?agtttcaggc?agcgctgcgt 660

cctgctgcgc?acgtgggaag?ccctggcccc?ggccactcga?gaattcacca?tgagacatat 720

tatctgccac?ggaggtgtta?ttaccgaaga?aatggccgcc?agtcttttgg?accagctgat 780

cgaagaggta?ctggctgata?atcttccacc?tcctagccat?tttgaaccac?ctacccttca 840

cgaactgtat?gatttagacg?tgacggcccc?cgaagatccc?aacgaggagg?cggtttcgca 900

gatttttccc?gactctgtaa?tgttggcggt?gcaggaaggg?attgacttac?tcacttttcc 960

gccggcgccc?ggttctccgg?agccgcctca?cctttcccgg?cagcccgagc?agccggagca?1020

gagagccttg?ggtccggttt?ctatgccaaa?ccttgtaccg?gaggtgattg?atcttacctg?1080

ctttccaccc?agtgacgacg?aggatgaaga?gggtgaggag?tttgtgttag?attatgtgga?1140

gcaccctgga?cacggttgca?ggtcttgtca?ttatcaccgg?aggaatacgg?gggacccaga?1200

tattatgtgt?tcgctttgct?atatgaggac?ctgtggcatg?tttgtctaca?gtcctgtgtc?1260

tgaacctgag?cctgagcccg?agccagaacc?ggagcctgca?agacctaccc?gccgtcctaa?1320

aatggcgcct?gctatcctga?gacgcccgac?atcacctgtg?tctagggaat?gcaatagtag?1380

tacggatagc?tgtgactccg?gtccttctaa?cacacctcct?gagatacacc?cggtggtccc?1440

gctgtgcccc?attaaaccag?ttgccgtgag?agttggtggg?cgtcgccagg?ctgtggaatg?1500

tatcgaggac?ttgcttaacg?agcctgggca?acctttggac?ttgagctgta?aacgccccag?1560

gccataacgc?gtcgagcatg?catctagggc?ggccaattcc?gcccctctcc?ctcccccccc?1620

cctaacgtta?ctggccgaag?ccgcttggaa?taaggccggt?gtgcgtttgt?ctatatgtga?1680

ttttccacca?tattgccgtc?ttttggcaat?gtgagggccc?ggaaacctgg?ccctgtcttc?1740

ttgacgagca?ttcctagggg?tctttcccct?ctcgccaaag?gaatgcaagg?tctgttgaat?1800

gtcgtgaagg?aagcagttcc?tctggaagct?tcttgaagac?aaacaacgtc?tgtagcgacc?1860

ctttgcaggc?agcggaaccc?cccacctggc?gacaggtgcc?tctgcggcca?aaagccacgt?1920

gtataagata?cacctgcaaa?ggcggcacaa?ccccagtgcc?acgttgtgag?ttggatagtt?1980

gtggaaagag?tcaaatggct?ctcctcaagc?gtattcaaca?aggggctgaa?ggatgcccag?2040

aaggtacccc?attgtatggg?atctgatctg?gggcctcggt?gcacatgctt?tacatgtgtt?2100

tagtcgaggt?taaaaaaacg?tctaggcccc?ccgaaccacg?gggacgtggt?tttcctttga?2160

aaaacacgat?gataagcttg?ccacaacccg?ggatcctcta?gaaccatgag?acatattatc?2220

tgccacggag?gtgttattac?cgaagaaatg?gccgccagtc?ttttggacca?gctgatcgaa?2280

gaggtactgg?ctgataatct?tccacctcct?agccattttg?aaccacctac?ccttcacgaa?2340

ctgtatgatt?tagacgtgac?ggcccccgaa?gatcccaacg?aggaggcggt?ttcgcagatt?2400

tttcccgact?ctgtaatgtt?ggcggtgcag?gaagggattg?acttactcac?ttttccgccg?2460

gcgcccggtt?ctccggagcc?gcctcacctt?tcccggcagc?ccgagcagcc?ggagcagaga?2520

gccttgggtc?cggtttctat?gccaaacctt?gtaccggagg?tgattgatct?tacctgcttt?2580

ccacccagtg?acgacgagga?tgaagagggt?cctgtgtctg?aacctgagcc?tgagcccgag?2640

ccagaaccgg?agcctgcaag?acctacccgc?cgtcctaaaa?tggcgcctgc?tatcctgaga?2700

cgcccgacat?cacctgtgtc?tagggaatgc?aatagtagta?cggatagctg?tgactccggt?2760

ccttctaaca?cacctcctga?gatacacccg?gtggtcccgc?tgtgccccat?taaaccagtt?2820

gccgtgagag?ttggtgggcg?tcgccaggct?gtggaatgta?tcgaggactt?gcttaacgag?2880

cctgggcaac?ctttggactt?gagctgtaaa?cgccccaggc?cataag 2926

<210>6

<211>636

<212>DNA

＜213〉artificial sequence

<220>

<221>sig_peptide

<222>(9)...(80)

<220>

<221>CDS

<222>(81)...(632)

<400>6

aattcaccat?gggggtactg?ctcacacaga?ggacgctgct?cagtctggtc?cttgcactcc 60

tgtttccaag?catggcgagc?cacagccacc?gcgacttcca?gccggtgctc?cacctggttg?120

cgctcaacag?ccccctgtca?ggcggcatgc?ggggcatccg?cggggccgac?ttccagtgct?180

tccagcaggc?gcgggccgtg?gggctggcgg?gcaccttccg?cgccttcctg?tcctcgcgcc?240

tgcaggacct?gtacagcatc?gtgcgccgtg?ccgaccgcgc?agccgtgccc?atcgtcaacc?300

tcaaggacga?gctgctgttt?cccagctggg?aggctctgtt?ctcaggctct?gagggtccgc?360

tgaagcccgg?ggcacgcatc?ttctccttta?acggcaagga?cgtcctgagg?caccccacct?420

ggccccagaa?gagcgtgtgg?catggctcgg?accccaacgg?gcgcaggctg?accgagagct?480

actgtgagac?gtggcggacg?gaggctccct?cggccacggg?ccaggcctcc?tcgctgctgg?540

ggggcaggct?cctggggcag?agtgccgcga?gctgccatca?cgcctacatc?gtgctatgca?600

ttgagaacag?cttcatgact?gcctccaagt?aatagt 636

<210>7

<211>1217

<212>DNA

＜213〉artificial sequence

<220>

<221>Promoter

<222>(6)...(408)

<220>

<221>sig_peptide

<222>(418)...(489)

<220>

<221>CDS

<222>(490)...(1041)

<220>

<221>PolyA_signal

<222>(1063)...(1216)

<400>7

gatctaattc?cctggcatta?tgcccagtac?atgaccttat?gggactttcc?tacttggcag 60

tacatctacg?tattagtcat?cgctattacc?atggtgatgc?ggttttggca?gtacatcaat?120

gggcgtggat?agcggtttga?ctcacgggga?tttccaagtc?tccaccccat?tgacgtcaat?180

gggagtttgt?tttggcacca?aaatcaacgg?gactttccaa?aatgtcgtaa?caactccgcc?240

ccattgacgc?aaatgggcgg?taggcgtgta?cggtgggagg?tctatataag?cagagctcgt?300

ttagtgaacc?gtcagatcgc?ctggagacgc?catccacgct?gttttgacct?ccatagaaga?360

caccgggacc?gatccagcct?ggggatcagt?cttcgagtcg?acaagcttga?attcaccatg?420

ggggtactgc?tcacacagag?gacgctgctc?agtctggtcc?ttgcactcct?gtttccaagc 480

atggcgagcc?acagccaccg?cgacttccag?ccggtgctcc?acctggttgc?gctcaacagc 540

cccctgtcag?gcggcatgcg?gggcatccgc?ggggccgact?tccagtgctt?ccagcaggcg 600

cgggccgtgg?ggctggcggg?caccttccgc?gccttcctgt?cctcgcgcct?gcaggacctg 660

tacagcatcg?tgcgccgtgc?cgaccgcgca?gccgtgccca?tcgtcaacct?caaggacgag 720

ctgctgtttc?ccagctggga?ggctctgttc?tcaggctctg?agggtccgct?gaagcccggg 780

gcacgcatct?tctcctttaa?cggcaaggac?gtcctgaggc?accccacctg?gccccagaag 840

agcgtgtggc?atggctcgga?ccccaacggg?cgcaggctga?ccgagagcta?ctgtgagacg 900

tggcggacgg?aggctccctc?ggccacgggc?caggcctcct?cgctgctggg?gggcaggctc 960

ctggggcaga?gtgccgcgag?ctgccatcac?gcctacatcg?tgctatgcat?tgagaacagc?1020

ttcatgactg?cctccaagta?atagtctaga?ctcgagggat?ccatcgagca?acttgtttat?1080

tgcagcttat?aatggttaca?aataaagcaa?tagcatcaca?aatttcacaa?ataaagcatt?1140

tttttcactg?cattctagtt?gtggtttgtc?caaactcatc?aatgtatctt?atcatgtctg?1200

gatcgtctag?catcgaa 1217

Claims (5)

1. oncolytic adenovirus mutant with the anticancer mechanism of multiple specific, it is characterized in that on the basis of human 5 type adenoviral gene groups, lack simultaneously E-lb-55kDa and the proteic encoding gene of Elb-19kDa fully, E1a sports mE1a289R and mE1a243R sequence with its propagation indispensable gene, mE1a289R is connected by polysome entry site IRES sequence with the mE1a243R mutant nucleotide sequence, before mE1a289R and mE1a243R sequence, insert a kind of tumour-specific chimeric promoters, with being cis-acting elements control virus multiplication indispensable gene, this cis-acting elements inserts between the transcription initiation site and translation initiation site ATG of propagation indispensable gene sequence with the tumour-specific chimeric promoters; Said chimeric promoters by the human telomerase reverse transcriptase's promotor-304 that has knocked out silencer～+ enhanser of 48bp core sequence and people's tumour epidermal growth factor receptor gene forms, this viral genome has also been inserted the Antioncogene expression cassette of blood vessel endothelium chalone gene; The gene clone site that restriction endonuclease BglII has been preset in said propagation indispensable gene expressed intact sequence upstream, the gene clone site of restriction endonuclease SalI and AccI has been preset in the downstream; The coding nucleotide sequence of blood vessel endothelium chalone directly inserts the exogenous gene cloning site BalII in this oncolytic adenovirus mutant gene group; Insert M-before the coding nucleotide sequence of blood vessel endothelium chalone and become knurl protein signal peptide-coding sequence; The coding nucleotide sequence of coding blood vessel endothelium chalone is subjected to the control of human cytomegalovirus CMV promotor in the Antioncogene expression cassette, between the transcription initiation site and translation initiation site of the coding nucleotide sequence of this promotor insertion blood vessel endothelium chalone; The tailer sequence that adds of the Nucleotide of said coding blood vessel endothelium chalone is SV40Poly A, after translation stop codon of the coding nucleotide sequence of insertion blood vessel endothelium chalone;

The sequence of said mE1a289R and mE1a243R is respectively:

mE1a289R：

atgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtact

ggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaag

atcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttc

cgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccgg

tttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtgagga

gtttgtgttagattatgtggagcaccctggacacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagat

attatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtcctgtgtctgaacctgagcctgagcccgagccag

aaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagg

gaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgcc

ccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggc

aacctttggacttgagctgtaaacgccccaggccataa；

mE1a243R：

atgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtact

ggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaag

atcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttc

cgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccgg

tttctatgccaaaccttgtaccggaggtgattgatcttacctgctttccacccagtgacgacgaggatgaagagggtcctgtgt

ctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcct

gagacgcccgacatcacctgtgtctagggaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcct

gagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgt

atcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataa；

The sequence of said tumour-specific chimeric promoters is:

gcagggtgcgagacccaggcagaaacattttgctggatgaggaggaaagatgtaaggttgctccccttcagagac

agcaaagggcaggtctgtagcttcacttacttcaggattgtgatttttgacagagccgagagatcagggttgttgaaccaggc

ctgaaggtcctagtgaatctcgtgaagagaggaggggtctggctgtaacatggacctagaggacatttttactgcaggaga

aggaacagtggggatggggtggacttgccaaaggaatatagctcaagttcctgcagcccaaaaaagctcagtttcttttggc

caaagcttcgcgcgggcggggaagcgcggcccagaccccgcggtccgcccggagcagctgcgctgtcggggccagg

ccgggctcccagtggattcgcgggatctcacagacgcccaggaccgcgcttcccacgtggcggagggactggggaccc

gggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtcc

ccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttca

ggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccac；

The coding nucleotide sequence of said blood vessel endothelium chalone is:

Atgggggtacttgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagccagcagcc

accgcgacttccagccggtgctccacctggttgctgctcaacagccccctgtcaggcggcatgcggggcatccgcgggg

ccgacttccagtgcttccagcaggcgcgggccgtggggctggcgggcaccttccgcgccttcctgtcctcgcgcctgcag

gacctgtacagcatcgtgcgccgtgccgaccgcgcacgcgtgcccatcgtcaacctcaaggacgagctgctgtttcccag

ctgggaggctctgttctcaggctctgagggtccgctgaagcccggggcacgcatcttctcctttaacggcaaggacgtcct

gaggcaccccacctggccccagaagagcgtgtggcatggctcggaccccaacggcgcaggctgaccgagagctactgt

gagacgtggcggacggaggctccctcggccacgggcaggcctcctcgctgctgggggcaggctcctggggcagagtgccgcgagctgccatcacgcctacatcgtgctatgcattgagaacagcttcatgactgcctccaagtaatag。

2. the oncolytic adenovirus mutant with the anticancer mechanism of multiple specific according to claim 1, it is characterized in that the CR2 conserved regions is introduced deletion mutantion in mE1a289R and the mE1a243R mutant nucleotide sequence, the encoding sequence CACGAGGCTGGC disappearance of 125-128 amino acids residue.

3. the oncolytic adenovirus mutant with the anticancer mechanism of multiple specific according to claim 1, the codon that it is characterized in that mE1a289R and mE1a243R mutant nucleotide sequence the 120th amino acids residue sports ATT by ATC, 146, the codon of 147 amino acids residues sports CCTGGA by CCCGGG, and the codon of 219 amino acids residues sports AGG by AGA.

4. the oncolytic adenovirus mutant with the anticancer mechanism of multiple specific according to claim 1 is characterized in that the proteic encoding gene disappearance of Elb-55kDa, realizes by the mode that the proteic coding gene sequence of Elb-55kDa is lacked fully.

5. the oncolytic adenovirus mutant with the anticancer mechanism of multiple specific according to claim 1 is characterized in that the proteic encoding gene disappearance of Elb-19kDa, realizes by the mode that the proteic coding gene sequence of Elb-19kDa is lacked fully.